Identification of Pold2 As a Novel Interaction Partner of Protein Inhibitor of Activated STAT2

Total Page:16

File Type:pdf, Size:1020Kb

Identification of Pold2 As a Novel Interaction Partner of Protein Inhibitor of Activated STAT2 884 INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 30: 884-888, 2012 Identification of Pold2 as a novel interaction partner of protein inhibitor of activated STAT2 YING ZHENG1, SHUDONG SHENG2, HAIYAN WANG1, XIAOQING JIA1, YANQIU HU3, YAYUN QIAN1, YONGZE ZHU1 and JIANJUN WANG1 1Department of Histology and Embryology, Medical College, Yangzhou University; 2Department of Medicine, Yangzhou Vocational College of Environment and Resources; 3Center of Reproductive Medicine, Clinical Medical College, Yangzhou University, Yangzhou 225001, P.R. China Received February 18, 2012; Accepted June 20, 2012 DOI: 10.3892/ijmm.2012.1065 Abstract. Pold2 is a subunit of the DNA polymerase δ complex, involved in the recruitment of several proteins regulating DNA encoding a protein involved in DNA replication and repair. In metabolism, including p21, PDIP1 (polymerase δ-interacting this study, using a yeast two-hybrid screening technique and the protein 1, PDIP1), PDIP38, PDIP46 and WRN (Werner protein, common cDNA fragment of the mouse PIAS2 as a bait, Pold2 WRN) (11-14). was found to interact with PIAS2. A direct interaction between PIAS2 [protein inhibitor of activated STAT (signal transducer Pold2 and PIAS2 was confirmed by direct yeast two-hybrid. and activator of transcription) 2, PIAS2] belongs to the family In vivo evidence of Pold2 association with PIAS2 was obtained of PIAS proteins, which includes PIAS1, PIAS2, PIAS3 and by co-immunoprecipitation using HEK-293 cells. Subcellular PIASy (15-18). PIAS proteins were initially identified as specific localization studies demonstrated that Pold2 and PIAS2 were cofactors inhibiting DNA binding and transcriptional activation partially co-localized in mammalian cells. Collectively, our by the STAT family of transcription factors (15). These proteins results suggest that Pold2 interacts under physiological condi- typically contain an N-terminal SAP domain, an N-terminal tions with PIAS2. PINIT domain, a central RING-like zincfinger (RLD) domain and a C-terminal acidic domain (19,20). The human PIAS2 Introduction gene encodes two splice variants, PIASxα (also called ARIP3, androgen receptor-interacting protein 3) and PIASxβ (also DNA replication is essential not only for duplication of the known as Miz1, Msx-interacting-zinc finger) (16,21). The mouse genome but also for maintenance of genomic integrity during PIAS2 gene has at least five isoforms (isoforms 1-5), which differ DNA repair (1,2). Chromosomal DNA replication in eukaryotic in the N- and C-termini as a result of alternative splicing. The cells requires three distinct DNA polymerases-α, -δ (Polδ), mouse PIAS2 protein shows 99.4% sequence identity to the and -ε (1-5). Mammalian Polδ plays a crucial and versatile role human homologue. Although PIAS2 was originally identified in DNA replication and various DNA repair processes (6). Its as a protein that binds to and inhibits STAT4, the functions of function as a chromosomal DNA polymerase is dependent on PIAS2 protein are clearly not limited to the regulation of STAT4. the association with proliferating cell nuclear antigen (PCNA) PIAS2 is capable of interacting with and modulating (activating which functions as a molecular sliding clamp (7,8). Similar and repressing) transcriptional activities of several transcription to S. pombe enzyme, the mammalian Polδ consists of four factors (22-24). subunits: p125, p50 (also named DNA polymerases δ 2 small To determine the molecular mechanism of PIAS2 func- subunit, Pold2), p66 and p12, forming a heterotetrameric tion, we used the yeast two-hybrid screening technique complex (4,9). It has been reported that Pold2 serves as a scaf- to identify interacting proteins associated with PIAS2. fold for the assembly of Polδ by interacting simultaneously with Interestingly, Pold2 was found to interact with PIAS2. Here all of the other three subunits (10). In addition, Pold2 is also we report evidence for a direct interaction between Pold2 and PIAS2. Materials and methods Correspondence to: Dr Ying Zheng, Department of Histology and Embryology, Medical College, Yangzhou University, Yangzhou Yeast two-hybrid analysis. The common cDNA fragment of 225001, P.R. China the mouse PIAS2 gene [9-401 aa corresponding to nucleotides E-mail: [email protected] (nt) 213-1391 of NM_008602] was cloned into the pGBKT7 vector containing the GAL4 DNA-binding domain to generate Key words: yeast two-hybrid system, protein inhibitor of activated the bait plasmid, pGBKT7-PIAS2. This construct did not show STAT2, Pold2, protein interaction toxic effects or autonomous transcriptional activation following transformation into the yeast strain, Y187. The mouse stem cell cDNA library was constructed in a pGADT7-Rec vector ZHENG et al: IDENTIFICATION OF Pold2 AS A NOVEL INTERACTION PARTNER FOR PIAS2 885 containing a GAL4 activation domain using Matchmaker Western blot analysis. Initial lysates and immunoprecipitated Library Construction and Screening kits (Clontech, Santa proteins were analyzed by SDS-PAGE and immunoblotting was Clara, USA) and then transformed into the yeast AH109 carried out using specific antibodies. Proteins were electropho- strain. Yeast two-hybrid screening was performed using the retically transferred to nitrocellulose membranes (Amersham Matchmaker Two-Hybrid system (Clontech). Positive clones Biosciences, Amersham, UK) and probed with the appropriate were selected based on their ability to grow on synthetic antibodies. Bound antibodies were visualized with horseradish dropout (SD) medium/-LTHA/X-α-Gal and for X-α-Gal peroxidase (HRP)-conjugated anti-rabbit or anti-mouse (Sigma) activity. IgG antibodies using the enhanced chemiluminescence system (ECL, Thermo Scientific, MA, USA). Clone isolation and interaction analysis. Plasmid DNA of prey clones was isolated (Qiagen, Hilden, Germany) and transformed Fluoresence microscope analysis. To detect PIAS2 and into E. coli DH5α. Prey clones were recovered by ampicillin Pold2, HEK 293T/HeLa cells plated on round coverslips were resistance and cDNA inserts were identified by PCR amplifica- transiently transfected with the pDsRed-Express-1-PIAS2 and tion, sequencing, and BLAST alignment. Interaction between pEGFP-N1-Pold2 constructs using Lipofectamine 2000 reagent. the bait and identified prey clones was verified by co-trans- After 48 h, cells were washed twice with PBS and visualized by forming the purified prey plasmid with the bait pGBKT7-PIAS2 Nikon scanning laser confocal microscope. construct into the yeast AH109 strain followed by selection on SD/-LTHA medium. Co-transforming of pGBKT7-p53 with Results pGADT7-SV40 was used as a positive control. A negative control was also included by co-transforming of pGBKT7-p53 Identification of Pold2 as a PIAS2-interacting protein using a with pGADT7 vector into the same yeast cells. yeast two-hybrid screening system. To identify mouse proteins that interact with PIAS2, cDNA libraries derived from mouse Expression constructs and antibody preparation. The common stem cells were screened using a yeast two-hybrid system with cDNA fragment of the mouse PIAS2 gene was amplified by PCR the bait plasmid pGBKT7-PIAS2. Growth of yeast strain Y187 and cloned into the pCMV-Myc and pDsRed-Express-1 vector co-transformed with this construct and the empty prey plasmid (Clontech) to generate pCMV-c-Myc-PIAS2 and pDsRed- pGADT7 was not supported on SD/-LTHA medium confirming Express-1-PIAS2 respectively. Full-length Pold2 was cloned that the bait was not auto-activated. A total of 2x106 primary into pEGFP-N1 (Clontech) to generate pEGFP-N1-Pold2. transformants were screened, yielding over 54 positive clones, The following commercially available antibodies were used 10 of which demonstrated strong growth on SD/-LTHA medium. for immunoprecipitation and western blot analysis: monoclonal These clones were isolated, sequenced and aligned using the anti-c-Myc antibody (Millipore Biotechnology, Bedford, MA, NCBI BLAST alignment search tool. One clone encoded Pold2 USA) and rabbit anti-GFP polyclonal antibody (Epitomics, (DNA polymerase, δ 2 small subunit), spanning regions of 177 Burlingame, USA). amino acids (Pold2 292-469 aa) was found to interact with PIAS2 protein. To confirm these results, the PIAS2-Pold2 interaction Cell culture and transfection. HEK 293T and HeLa cells was further investigated using a direct yeast hybrid screening (human epithelial carcinoma line) were cultured and main- system. The yeast strain co-transformed with pGADT7-Pold2 tained in DMEM (Invitrogen) supplemented with 10% fetal and pGBKT7 could not grow on SD/-LTHA medium and bovine serum at 37˚C in a humidified atmosphere containing showed negative β-galactosidase activity (Fig. 1B, clone 3). 5% CO2. Transient transfection of HEK 293T and HeLa cells While strong growth on SD/-LTHA medium was observed (75-90% confluence) was performed using Lipofectamine 2000 only in yeast cells co-transformed with pGBKT7-PIAS2 and (Invitrogen, Carlsbad, CA, USA) according to the instructions pGADT7-Pold2 (Fig. 1B, clone 1), indicating interaction of provided by the manufacturer. Pold2 with PIAS2 in yeast. Immunoprecipitations. HEK 293T cells were transiently Pold2 interacts with PIAS2 in vivo. The data obtained from the transfected with pCMV-c-Myc-PIAS2 and pEGFP-N1-Pold2 yeast two-hybrid screen was confirmed by evidence of a direct constructs and maintained as described above for 24 h. The interaction between PIAS2 and Pold2 in mammalian cells. The cells were then washed with ice-cold PBS and harvested in expression vectors for c-myc-tagged
Recommended publications
  • Polymerase Δ Deficiency Causes Syndromic Immunodeficiency with Replicative Stress
    Polymerase δ deficiency causes syndromic immunodeficiency with replicative stress Cecilia Domínguez Conde, … , Mirjam van der Burg, Kaan Boztug J Clin Invest. 2019. https://doi.org/10.1172/JCI128903. Research Article Genetics Immunology Graphical abstract Find the latest version: https://jci.me/128903/pdf The Journal of Clinical Investigation RESEARCH ARTICLE Polymerase δ deficiency causes syndromic immunodeficiency with replicative stress Cecilia Domínguez Conde,1,2 Özlem Yüce Petronczki,1,2,3 Safa Baris,4,5 Katharina L. Willmann,1,2 Enrico Girardi,2 Elisabeth Salzer,1,2,3,6 Stefan Weitzer,7 Rico Chandra Ardy,1,2,3 Ana Krolo,1,2,3 Hanna Ijspeert,8 Ayca Kiykim,4,5 Elif Karakoc-Aydiner,4,5 Elisabeth Förster-Waldl,9 Leo Kager,6 Winfried F. Pickl,10 Giulio Superti-Furga,2,11 Javier Martínez,7 Joanna I. Loizou,2 Ahmet Ozen,4,5 Mirjam van der Burg,8 and Kaan Boztug1,2,3,6 1Ludwig Boltzmann Institute for Rare and Undiagnosed Diseases, 2CeMM Research Center for Molecular Medicine of the Austrian Academy of Sciences, and 3St. Anna Children’s Cancer Research Institute (CCRI), Vienna, Austria. 4Pediatric Allergy and Immunology, Marmara University, Faculty of Medicine, Istanbul, Turkey. 5Jeffrey Modell Diagnostic Center for Primary Immunodeficiency Diseases, Marmara University, Istanbul, Turkey. 6St. Anna Children’s Hospital, Department of Pediatrics and Adolescent Medicine, Vienna, Austria. 7Center for Medical Biochemistry, Medical University of Vienna, Vienna, Austria. 8Department of Pediatrics, Laboratory for Immunology, Leiden University Medical Centre, Leiden, Netherlands. 9Department of Neonatology, Pediatric Intensive Care and Neuropediatrics, Department of Pediatrics and Adolescent Medicine, 10Institute of Immunology, Center for Pathophysiology, Infectiology and Immunology, and 11Center for Physiology and Pharmacology, Medical University of Vienna, Vienna, Austria.
    [Show full text]
  • DNA Ligase C and Primpolc Participate in Base Excision Repair in Mycobacteria
    DNA Ligase C and Prim-PolC participate in base excision repair in mycobacteria Article (Accepted Version) Plocinski, Przemyslaw, Brissett, Nigel C, Bianchi, Julie, Brzostek, Anna, Korycka-Machała, Małgorzata, Dziembowski, Andrzej, Dziadek, Jaroslaw and Doherty, Aidan J (2017) DNA Ligase C and Prim-PolC participate in base excision repair in mycobacteria. Nature Communications, 8 (1). a1251 1-12. ISSN 2041-1723 This version is available from Sussex Research Online: http://sro.sussex.ac.uk/id/eprint/70317/ This document is made available in accordance with publisher policies and may differ from the published version or from the version of record. If you wish to cite this item you are advised to consult the publisher’s version. Please see the URL above for details on accessing the published version. Copyright and reuse: Sussex Research Online is a digital repository of the research output of the University. Copyright and all moral rights to the version of the paper presented here belong to the individual author(s) and/or other copyright owners. To the extent reasonable and practicable, the material made available in SRO has been checked for eligibility before being made available. Copies of full text items generally can be reproduced, displayed or performed and given to third parties in any format or medium for personal research or study, educational, or not-for-profit purposes without prior permission or charge, provided that the authors, title and full bibliographic details are credited, a hyperlink and/or URL is given for the original metadata page and the content is not changed in any way. http://sro.sussex.ac.uk 1 2 DNA Ligase C and Prim-PolC participate 3 in base excision repair in mycobacteria 4 5 Przemysáaw PáociĔski1,2§, Nigel C.
    [Show full text]
  • Arsenic Hexoxide Has Differential Effects on Cell Proliferation And
    www.nature.com/scientificreports OPEN Arsenic hexoxide has diferential efects on cell proliferation and genome‑wide gene expression in human primary mammary epithelial and MCF7 cells Donguk Kim1,7, Na Yeon Park2,7, Keunsoo Kang3, Stuart K. Calderwood4, Dong‑Hyung Cho2, Ill Ju Bae5* & Heeyoun Bunch1,6* Arsenic is reportedly a biphasic inorganic compound for its toxicity and anticancer efects in humans. Recent studies have shown that certain arsenic compounds including arsenic hexoxide (AS4O6; hereafter, AS6) induce programmed cell death and cell cycle arrest in human cancer cells and murine cancer models. However, the mechanisms by which AS6 suppresses cancer cells are incompletely understood. In this study, we report the mechanisms of AS6 through transcriptome analyses. In particular, the cytotoxicity and global gene expression regulation by AS6 were compared in human normal and cancer breast epithelial cells. Using RNA‑sequencing and bioinformatics analyses, diferentially expressed genes in signifcantly afected biological pathways in these cell types were validated by real‑time quantitative polymerase chain reaction and immunoblotting assays. Our data show markedly diferential efects of AS6 on cytotoxicity and gene expression in human mammary epithelial normal cells (HUMEC) and Michigan Cancer Foundation 7 (MCF7), a human mammary epithelial cancer cell line. AS6 selectively arrests cell growth and induces cell death in MCF7 cells without afecting the growth of HUMEC in a dose‑dependent manner. AS6 alters the transcription of a large number of genes in MCF7 cells, but much fewer genes in HUMEC. Importantly, we found that the cell proliferation, cell cycle, and DNA repair pathways are signifcantly suppressed whereas cellular stress response and apoptotic pathways increase in AS6‑treated MCF7 cells.
    [Show full text]
  • DNA Polymerases at the Eukaryotic Replication Fork Thirty Years After: Connection to Cancer
    cancers Review DNA Polymerases at the Eukaryotic Replication Fork Thirty Years after: Connection to Cancer Youri I. Pavlov 1,2,* , Anna S. Zhuk 3 and Elena I. Stepchenkova 2,4 1 Eppley Institute for Research in Cancer and Allied Diseases and Buffett Cancer Center, University of Nebraska Medical Center, Omaha, NE 68198, USA 2 Department of Genetics and Biotechnology, Saint-Petersburg State University, 199034 Saint Petersburg, Russia; [email protected] 3 International Laboratory of Computer Technologies, ITMO University, 197101 Saint Petersburg, Russia; [email protected] 4 Laboratory of Mutagenesis and Genetic Toxicology, Vavilov Institute of General Genetics, Saint-Petersburg Branch, Russian Academy of Sciences, 199034 Saint Petersburg, Russia * Correspondence: [email protected] Received: 30 September 2020; Accepted: 13 November 2020; Published: 24 November 2020 Simple Summary: The etiology of cancer is linked to the occurrence of mutations during the reduplication of genetic material. Mutations leading to low replication fidelity are the culprits of many hereditary and sporadic cancers. The archetype of the current model of replication fork was proposed 30 years ago. In the sequel to our 2010 review with the words “years after” in the title inspired by A. Dumas’s novels, we go over new developments in the DNA replication field and analyze how they help elucidate the effects of the genetic variants of DNA polymerases on cancer. Abstract: Recent studies on tumor genomes revealed that mutations in genes of replicative DNA polymerases cause a predisposition for cancer by increasing genome instability. The past 10 years have uncovered exciting details about the structure and function of replicative DNA polymerases and the replication fork organization.
    [Show full text]
  • The Second Subunit of DNA Polymerase Delta Is Required for Genomic Stability and Epigenetic Regulation1[OPEN]
    The Second Subunit of DNA Polymerase Delta Is Required for Genomic Stability and Epigenetic Regulation1[OPEN] Jixiang Zhang, Shaojun Xie, Jinkui Cheng, Jinsheng Lai, Jian-Kang Zhu, and Zhizhong Gong* State Key Laboratory of Plant Physiology and Biochemistry, College of Biological Sciences, China Agricultural University, Beijing 100193, China (J.Z., J.C., Z.G.); Shanghai Center for Plant Stress Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200032, China (S.X., J.-K.Z.); Department of Horticulture and Landscape Architecture, Purdue University, West Lafayette, Indiana 47906 (S.X., J.-K.Z.); and State Key Laboratory of Agrobiotechnology, China National Maize Improvement Center, Department of Plant Genetics and Breeding, China Agricultural University, Beijing 100193, China (J.L.) ORCID IDs: 0000-0002-1641-8650 (J.Z.); 0000-0002-6719-9814 (S.X.); 0000-0001-5134-731X (J.-K.Z.). DNA polymerase d plays crucial roles in DNA repair and replication as well as maintaining genomic stability. However, the function of POLD2, the second small subunit of DNA polymerase d, has not been characterized yet in Arabidopsis (Arabidopsis thaliana). During a genetic screen for release of transcriptional gene silencing, we identified a mutation in POLD2. Whole-genome bisulfite sequencing indicated that POLD2 is not involved in the regulation of DNA methylation. POLD2 genetically interacts with Ataxia Telangiectasia-mutated and Rad3-related and DNA polymerase a. The pold2-1 mutant exhibits genomic instability with a high frequency of homologous recombination. It also exhibits hypersensitivity to DNA-damaging reagents and short telomere length. Whole-genome chromatin immunoprecipitation sequencing and RNA sequencing analyses suggest that pold2-1 changes H3K27me3 and H3K4me3 modifications, and these changes are correlated with the gene expression levels.
    [Show full text]
  • Plant DNA Polymerases Alpha and Delta Mediate Replication of Geminiviruses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.20.212167; this version posted July 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Plant DNA polymerases alpha and delta mediate replication of geminiviruses Mengshi Wu1,2,3, Hua Wei1,3, Huang Tan1,3, Shaojun Pan1,3, Qi Liu2, Eduardo R Bejarano4, Rosa Lozano-Durán1* 1Shanghai Center for Plant Stress Biology, CAS Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences, Shanghai 201602, China. 2Bioinformatics Department, School of Life Sciences and Technology, Tongji University, Shanghai, China. 3University of the Chinese Academy of Sciences, Beijing 100049, China. 4Instituto de Hortofruticultura Subtropical y Mediterránea “La Mayora” (IHSM-UMA-CSIC), Area de Genética, Facultad de Ciencias, Universidad de Málaga, Campus de Teatinos s/n, E-29071 Málaga, Spain. *Correspondence to: [email protected]. ABSTRACT Geminiviruses are causal agents of devastating diseases in crops. Geminiviruses have circular single-stranded (ss)DNA genomes that are replicated in the nucleus of the infected plant cell through double-stranded (ds)DNA intermediates by the plant’s DNA replication machinery; which host DNA polymerase mediates geminiviral multiplication, however, has so far remained elusive. Here, we show that subunits of the nuclear replicative DNA polymerases α and δ physically interact with the geminivirus-encoded replication enhancer protein, C3, and are required for viral replication. Our results suggest that while DNA polymerase α is essential to generate the viral dsDNA intermediate, DNA polymerase δ mediates the synthesis of new copies of the geminiviral ssDNA genome, and that the virus-encoded C3 acts selectively recruiting DNA polymerase δ over ε to favour a productive replication.
    [Show full text]
  • The Genetic Program of Pancreatic Beta-Cell Replication in Vivo
    Page 1 of 65 Diabetes The genetic program of pancreatic beta-cell replication in vivo Agnes Klochendler1, Inbal Caspi2, Noa Corem1, Maya Moran3, Oriel Friedlich1, Sharona Elgavish4, Yuval Nevo4, Aharon Helman1, Benjamin Glaser5, Amir Eden3, Shalev Itzkovitz2, Yuval Dor1,* 1Department of Developmental Biology and Cancer Research, The Institute for Medical Research Israel-Canada, The Hebrew University-Hadassah Medical School, Jerusalem 91120, Israel 2Department of Molecular Cell Biology, Weizmann Institute of Science, Rehovot, Israel. 3Department of Cell and Developmental Biology, The Silberman Institute of Life Sciences, The Hebrew University of Jerusalem, Jerusalem 91904, Israel 4Info-CORE, Bioinformatics Unit of the I-CORE Computation Center, The Hebrew University and Hadassah, The Institute for Medical Research Israel- Canada, The Hebrew University-Hadassah Medical School, Jerusalem 91120, Israel 5Endocrinology and Metabolism Service, Department of Internal Medicine, Hadassah-Hebrew University Medical Center, Jerusalem 91120, Israel *Correspondence: [email protected] Running title: The genetic program of pancreatic β-cell replication 1 Diabetes Publish Ahead of Print, published online March 18, 2016 Diabetes Page 2 of 65 Abstract The molecular program underlying infrequent replication of pancreatic beta- cells remains largely inaccessible. Using transgenic mice expressing GFP in cycling cells we sorted live, replicating beta-cells and determined their transcriptome. Replicating beta-cells upregulate hundreds of proliferation- related genes, along with many novel putative cell cycle components. Strikingly, genes involved in beta-cell functions, namely glucose sensing and insulin secretion were repressed. Further studies using single molecule RNA in situ hybridization revealed that in fact, replicating beta-cells double the amount of RNA for most genes, but this upregulation excludes genes involved in beta-cell function.
    [Show full text]
  • Identification of Proteins Involved in the Maintenance of Genome Stability
    Identification of Proteins Involved in the Maintenance of Genome Stability by Edith Hang Yu Cheng A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Biochemistry University of Toronto ©Copyright by Edith Cheng2015 Identification of Proteins Involved in the Maintenance of Genome Stability Edith Cheng Doctor of Philosophy Department of Biochemistry University of Toronto 2015 Abstract Aberrant changes to the genome structure underlie numerous human diseases such as cancers. The functional characterization ofgenesand proteins that maintain chromosome stability will be important in understanding disease etiology and developing therapeutics. I took a multi-faceted approach to identify and characterize genes involved in the maintenance of genome stability. As biological pathways involved in genome maintenance are highly conserved in evolution, results from model organisms can greatly facilitate functional discovery in humans. In S. cerevisiae, I identified 47 essential gene depletions with elevated levels of spontaneous DNA damage foci and 92 depletions that caused elevated levels of chromosome rearrangements. Of these, a core subset of 15 DNA replication genes demonstrated both phenotypes when depleted. Analysis of rearrangement breakpoints revealed enrichment at yeast fragile sites, Ty retrotransposons, early origins of replication and replication termination sites. Together, thishighlighted the integral role of DNA replicationin genome maintenance. In light of my findings in S. cerevisiae, I identified a list of 153 human proteins that interact with the nascentDNA at replication forks, using a DNA pull down strategy (iPOND) in human cell lines. As a complementary approach for identifying human proteins involved in genome ii maintenance, I usedthe BioID techniqueto discernin vivo proteins proximal to the human BLM- TOP3A-RMI1-RMI2 genome stability complex, which has an emerging role in DNA replication progression.
    [Show full text]
  • DNA Polymerase Delta P50 (POLD2) (NM 001127218) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG225794 DNA polymerase delta p50 (POLD2) (NM_001127218) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: DNA polymerase delta p50 (POLD2) (NM_001127218) Human Tagged ORF Clone Tag: TurboGFP Symbol: POLD2 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG225794 representing NM_001127218 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTTTCTGAGCAGGCTGCCCAGAGGGCCCACACTCTACTGTCCCCACCATCAGCCAACAATGCCACCT TTGCCCGGGTGCCAGTGGCAACCTACACCAACTCCTCACAACCCTTCCGGCTAGGAGAGCGCAGCTTTAG CCGGCAGTATGCCCACATTTATGCCACCCGCCTCATCCAAATGAGACCCTTCCTGGAGAACCGGGCCCAG CAGCACTGGGGCAGTGGAGTGGGAGTGAAGAAGCTGTGTGAACTGCAGCCTGAGGAGAAGTGCTGTGTGG TGGGCACTCTGTTCAAGGCCATGCCGCTGCAGCCCTCCATCCTGCGGGAGGTCAGCGAGGAGCACAACCT GCTCCCCCAGCCTCCTCGGAGTAAATACATACACCCAGATGACGAGCTGGTCTTGGAAGATGAACTGCAG CGTATCAAACTAAAAGGCACCATTGACGTGTCAAAGCTGGTTACGGGGACTGTCCTGGCTGTGTTTGGCT CCGTGAGAGACGACGGGAAGTTTCTGGTGGAGGACTATTGCTTTGCTGACCTTGCTCCCCAGAAGCCCGC ACCCCCACTTGACACAGATAGGTTTGTGCTACTGGTGTCCGGCCTGGGCCTGGGTGGCGGTGGAGGCGAG AGCCTGCTGGGCACCCAGCTGCTGGTGGATGTGGTGACGGGGCAGCTTGGGGACGAAGGGGAGCAGTGCA GCGCCGCCCACGTCTCCCGGGTTATCCTCGCTGGCAACCTCCTCAGCCACAGCACCCAGAGCAGGGATTC TATCAATAAGGCCAAATACCTCACCAAGAAAACCCAGGCAGCCAGCGTGGAGGCTGTTAAGATGCTGGAT
    [Show full text]
  • Cshperspect-REP-A015727 Table3 1..10
    Table 3. Nomenclature for proteins and protein complexes in different organisms Mammals Budding yeast Fission yeast Flies Plants Archaea Bacteria Prereplication complex assembly H. sapiens S. cerevisiae S. pombe D. melanogaster A. thaliana S. solfataricus E. coli Hs Sc Sp Dm At Sso Eco ORC ORC ORC ORC ORC [Orc1/Cdc6]-1, 2, 3 DnaA Orc1/p97 Orc1/p104 Orc1/Orp1/p81 Orc1/p103 Orc1a, Orc1b Orc2/p82 Orc2/p71 Orc2/Orp2/p61 Orc2/p69 Orc2 Orc3/p66 Orc3/p72 Orc3/Orp3/p80 Orc3/Lat/p82 Orc3 Orc4/p50 Orc4/p61 Orc4/Orp4/p109 Orc4/p52 Orc4 Orc5L/p50 Orc5/p55 Orc5/Orp5/p52 Orc5/p52 Orc5 Orc6/p28 Orc6/p50 Orc6/Orp6/p31 Orc6/p29 Orc6 Cdc6 Cdc6 Cdc18 Cdc6 Cdc6a, Cdc6b [Orc1/Cdc6]-1, 2, 3 DnaC Cdt1/Rlf-B Tah11/Sid2/Cdt1 Cdt1 Dup/Cdt1 Cdt1a, Cdt1b Whip g MCM helicase MCM helicase MCM helicase MCM helicase MCM helicase Mcm DnaB Mcm2 Mcm2 Mcm2/Nda1/Cdc19 Mcm2 Mcm2 Mcm3 Mcm3 Mcm3 Mcm3 Mcm3 Mcm4 Mcm4/Cdc54 Mcm4/Cdc21 Mcm4/Dpa Mcm4 Mcm5 Mcm5/Cdc46/Bob1 Mcm5/Nda4 Mcm5 Mcm5 Mcm6 Mcm6 Mcm6/Mis5 Mcm6 Mcm6 Mcm7 Mcm7/Cdc47 Mcm7 Mcm7 Mcm7/Prolifera Gmnn/Geminin Geminin Mcm9 Mcm9 Hbo1 Chm/Hat1 Ham1 Ham2 DiaA Ihfa Ihfb Fis SeqA Replication fork assembly Hs Sc Sp Dm At Sso Eco Mcm8 Rec/Mcm8 Mcm8 Mcm10 Mcm10/Dna43 Mcm10/Cdc23 Mcm10 Mcm10 DDK complex DDK complex DDK complex DDK complex Cdc7 Cdc7 Hsk1 l(1)G0148 Hsk1-like 1 Dbf4/Ask Dbf4 Dfp1/Him1/Rad35 Chif/chiffon Drf1 Continued 2 Replication fork assembly (Continued ) Hs Sc Sp Dm At Sso Eco CDK complex CDK complex CDK complex CDK complex CDK complex Cdk1 Cdc28/Cdk1 Cdc2/Cdk1 Cdc2 CdkA Cdk2 Cdc2c CcnA1, A2 CycA CycA1, A2,
    [Show full text]
  • Polymerase Δ Promotes Chromosomal Rearrangements and Imprecise Double-Strand Break Repair
    Polymerase δ promotes chromosomal rearrangements and imprecise double-strand break repair Jacob V. Layera, Lydie Debaizea, Alexandria Van Scoyka, Nealia C. Houseb, Alexander J. Brownc, Yunpeng Liud, Kristen E. Stevensone, Michael Hemannd, Steven A. Robertsc, Brendan D. Priceb, David M. Weinstocka,f,g,1, and Tovah A. Dayh,1 aDepartment of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA 02215; bDepartment of Radiation Oncology, Dana-Farber Cancer Institute, Boston, MA 02215; cSchool of Molecular Biosciences, Washington State University, Pullman, WA 99164; dThe Koch Institute for Integrative Cancer Research at MIT, Massachusetts Institute of Technology, Cambridge, MA 02139; eDepartment of Biostatistics and Computational Biology, Dana-Farber Cancer Institute, Boston, MA 02215; fCancer Biology Program, Broad Institute of MIT and Harvard University, Cambridge, MA 02142; gBiological and Biomedical Sciences Program, Harvard Medical School, Boston, MA 02215; and hDepartment of Biology, Northeastern University, Boston, MA 02115 Edited by James E. Haber, Brandeis University, Waltham, MA, and approved September 9, 2020 (received for review July 10, 2020) Recent studies have implicated DNA polymerases θ (Pol θ) and β and λ, can also be recruited for end-resection and gap-filling (9, (Pol β) as mediators of alternative nonhomologous end-joining 10). The XRCC4/LIGIV complex is recruited and ligates both (Alt-NHEJ) events, including chromosomal translocations. Here strands (11). we identify subunits of the replicative DNA polymerase δ (Pol δ) The third type of repair, alternative NHEJ (Alt-NHEJ), is as promoters of Alt-NHEJ that results in more extensive intrachro- often described as a back-up end-joining process, as it resolves a mosomal mutations at a single double-strand break (DSB) and greater fraction of DSBs when C-NHEJ is compromised (12).
    [Show full text]
  • Roles of Human POLD1 and POLD3 in Genome Stability Emanuela Tumini, Sonia Barroso, Carmen Pérez-Calero & Andrés Aguilera
    www.nature.com/scientificreports OPEN Roles of human POLD1 and POLD3 in genome stability Emanuela Tumini, Sonia Barroso, Carmen Pérez-Calero & Andrés Aguilera DNA replication is essential for cellular proliferation. If improperly controlled it can constitute a major Received: 11 July 2016 source of genome instability, frequently associated with cancer and aging. POLD1 is the catalytic Accepted: 16 November 2016 subunit and POLD3 is an accessory subunit of the replicative Pol δ polymerase, which also functions in Published: 15 December 2016 DNA repair, as well as the translesion synthesis polymerase Pol ζ, whose catalytic subunit is REV3L. In cells depleted of POLD1 or POLD3 we found a differential but general increase in genome instability as manifested by DNA breaks, S-phase progression impairment and chromosome abnormalities. Importantly, we showed that both proteins are needed to maintain the proper amount of active replication origins and that POLD3-depletion causes anaphase bridges accumulation. In addition, POLD3-associated DNA damage showed to be dependent on RNA-DNA hybrids pointing toward an additional and specific role of this subunit in genome stability. Interestingly, a similar increase in RNA-DNA hybrids-dependent genome instability was observed in REV3L-depleted cells. Our findings demonstrate a key role of POLD1 and POLD3 in genome stability and S-phase progression revealing RNA-DNA hybrids-dependent effects for POLD3 that might be partly due to its Polζ interaction. DNA replication is an essential process in which DNA is duplicated and passed on to daughter cells, allowing the transmission of genetic information. To safeguard its integrity, cells have developed sophisticated mechanisms that constitute the DNA damage response (DDR) pathway.
    [Show full text]