Novel Imprinted DLK1/GTL2 Domain on Human Chromosome 14 Contains Motifs That Mimic Those Implicated in IGF2/H19 Regulation

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Letter Novel Imprinted DLK1/GTL2 Domain on Human Chromosome 14 Contains Motifs that Mimic Those Implicated in IGF2/H19 Regulation Andrew A. Wylie,1,2 Susan K. Murphy,1 Terry C. Orton,2 and Randy L. Jirtle1,3 1Departments of Radiation Oncology and Pathology, Duke University Medical Center, Durham, NC 27710, USA; 2Safety Assessment, AstraZeneca Pharmaceuticals, Alderley Edge, SK1 04TG, UK The evolution of genomic imprinting in mammals occurred more than 100 million years ago, and resulted in the formation of genes that are functionally haploid because of parent-of-origin–dependent expression. Despite ample evidence from studies in a number of species suggesting the presence of imprinted genes on human chromosome 14, their identity has remained elusive. Here we report the identification of two reciprocally imprinted genes, GTL2 and DLK1, which together define a novel imprinting cluster on human chromosome 14q32. The maternally expressed GTL2 (gene trap locus 2) gene encodes for a nontranslated RNA. DLK1 (delta, Drosophila, homolog-like 1) is a paternally expressed gene that encodes for a transmembrane protein containing six epidermal growth factor (EGF) repeat motifs closely related to those present in the delta/notch/serrate family of signaling molecules. The paternal expression, chromosomal localization, and biological function of DLK1 also make it a likely candidate gene for the callipyge phenotype in sheep. Many of the predicted structural and regulatory features of the DLK1/GTL2 domain are highly analogous to those implicated in IGF2/H19 imprint regulation, including two hemimethylated consensus binding sites for the vertebrate enhancer blocking protein, CTCF. These results provide evidence that a common mechanism and domain organization may be used for juxtapositioned, reciprocally imprinted genes. Genomic imprinting refers to an epigenetic chromo- genes on a number of chromosomes (Ledbetter and somal modification that results in the preferential ex- Engel 1995). These include distinct clinical abnormali- pression of a gene in a parent-of-origin–dependent ties associated with both maternal and paternal UPD of manner. Genomic imprinting evolved in mammals the long arm of human chromosome 14 (14q24.3–32). >100 million years ago (Killian et al. 2000) possibly Maternal UPD (mUPD) of chromosome 14 is associated because of an interparental genetic conflict to control with low birth weight, short stature, small hands and maternal-dependent growth of the offspring (Haig and feet, motor delay, and precocious puberty, whereas pa- Graham 1991). Imprinted genes have been linked to a ternal UPD (pUPD) is not only observed less fre- number of human behavioral and developmental dis- quently, but it also leads to more severe musculoskel- orders, including Angelman, Prader-Willi, and Beck- etal problems and mental retardation. Consistent with with-Wiedemann syndromes, as well as a variety of these observations in humans, genetic studies using pediatric and adult malignancies (for reviews, see Ni- Robertsonian or reciprocal translocations to generate cholls et al. 1998; Falls et al. 1999; Mann and Barto- UPD for mouse distal chromosome 12 result in early lomei 1999; Reik et al. 2000). Evidence also suggests embryonic lethality, indicating the presence of an im- that a number of unidentified imprinted genes under- printed gene or genes in a region homologous with lie the etiology of other human disorders, including human chromosome 14 (Cattanach and Beechey autism, schizophrenia, bipolar disease, and Crohn’s 1997). The parent-of-origin inheritance of the callipyge disease (Morison and Reeve 1998; Isles and Wilkinson gene, mapped to the distal portion of chromosome 18 2000). Therefore, the isolation and characterization of in sheep, is also consistent with the presence of im- novel imprinted genes will provide further insight into printed genes in this homologous region of the long their roles in these disorders as well as into the regula- arm of human chromosome 14 (Cockett et al. 1996; tory mechanisms fundamental to this intriguing phe- Freking et al. 1998; Lien et al. 1999). nomenon. Despite compelling evidence for the presence of Abnormal phenotypes associated with uniparental maternally and paternally imprinted genes on human disomy (UPD) have implied the presence of imprinted chromosome 14, their identity has remained elusive. We used a bioinformatics-based approach to select can- 3Corresponding author. didate regions of chromosome 14 for further expres- E-MAIL [email protected]; FAX (919) 684-5584. Article and publication are at www.genome.org/cgi/doi/10.1101/ sion and DNA methylation analysis. This led to the gr.161600. identification of two reciprocally imprinted genes on 10:1711–1718 ©2000 by Cold Spring Harbor Laboratory Press ISSN 1088-9051/00 $5.00; www.genome.org Genome Research 1711 www.genome.org Wylie et al. human chromosome 14q32. GTL2 is maternally ex- Gtl2, being maternally expressed, was unlikely to pressed and appears to lack an open reading frame. In be directly involved in generating the abnormal phe- contrast, DLK1 is paternally expressed, and encodes for notype of the Gtl2lacZ mouse. It was therefore likely a cell-surface transmembrane protein containing epi- that the dwarfism phenotype of the Gtl2lacZ mouse re- dermal growth factor-like (EGF-like) repeats that are sulted from disruption of a paternally expressed gene closely related to the EGF-like repeats of the inverte- located in close proximity to Gtl2. BLAST analysis of a brate proteins delta and notch (Laborda et al. 1993; 500 kb region surrounding GTL2 (BACs AL117190, Artavanis-Tsakonas et al. 1995; Fleming 1998). Further AL132711, and AL163974), using both the nonredun- analysis of the structural, spatial, and epigenetic char- dant and human EST GenBank databases, identified acteristics of the DLK1/GTL2 domain revealed a strik- DLK1 (delta, Drosophila homolog-like 1) located 102 kb ing similarity to the IGF2/H19 domain on human centromeric to GTL2. chromosome 11. A SNP was identified in exon five of DLK1 (Fig. 2A), and it was used to analyze gene expression in RESULTS seven heterozygous individuals. As shown in Figure 2B, DLK1 is monoallelically expressed in fetal brain (n = 7), Identification of Novel Imprinted Genes kidney (n = 3), liver (n = 3) and lung (n = 2). Monoal- Using gene trap technology, Schuster-Gossler et al. lelic expression was also detected in other fetal tissues, (1996) identified a transgene-induced insertional mu- including adrenal gland (n = 2), skeletal muscle (n = 1), tation (Gtl2lacZ) on mouse distal chromosome 12 that gut (n = 2), heart (n = 4), spleen (n = 1) and placenta conferred proportionate dwarfism in a parent-of- (n = 2, data not shown). Thus, DLK1 was monoalleli- origin–dependent manner. The gene subsequently cally expressed in 27 tissues from seven different hu- identified from the site of transgene integration was man conceptuses. The parent-of-origin of the ex- Gtl2 (gene trap locus 2) (Schuster-Gossler et al. 1998). pressed allele was determined to be exclusively pater- Using BLAST analysis of the NCBI GenBank database, nal following the genotyping of matched maternal we found that human cDNA clone 23887 (AF052114) decidua tissue (Fig. 2B). This is consistent with the re- had significant homology with mouse Gtl2, and that it cent finding that mouse Dlk1 is also paternally ex- lacked a significant open reading frame. This clone and pressed (Schmidt et al. 2000). its associated UniGene cluster (Hs.112844) map to hu- man chromosome 14q32, a region homologous with Methylation Analysis distal mouse chromosome 12. Alignment of clone Methylation appears to be a key component of the im- 23887 sequence (henceforth referred to as human print regulation in eutherian mammals, and most GTL2) with published human BAC sequence AL117190 known imprinted genes are associated with differen- revealed the presence of five exons in the mRNA se- tially methylated CpG-rich regions. GRAIL analysis of quence, with the transcription start site located at the upstream regions of DLK1 and GTL2 showed that nucleotide 69187 (Fig. 1A). the putative promoter regions of both genes contain To determine if GTL2 is monoallelically expressed, sequences rich in CpG dinucleotides. To determine we identified a single nucleotide polymorphism (SNP) their methylation status, three independent areas of in exon 5 (Fig. 1A), and analyzed allelic expression of each region were analyzed using bisulphite sequencing GTL2 in tissues from five human conceptuses hetero- of DNA isolated from fetal brain, kidney, liver, and zygous for the polymorphism. As shown in Figure 1B, pancreas (Fig. 3). The methylation profile of both pu- GTL2 was monoallelically expressed in fetal heart tative promoter regions was indistinguishable in the (n = 1), kidney (n = 2), liver (n = 2) and lung (n = 2). four tissues analyzed, and a representative analysis is GTL2 was also monoallelically expressed in fetal brain shown in Figure 3. All three areas of the CpG-rich re- (n = 4, data not shown). Thus, GTL2 was shown to be gion examined upstream of GTL2 (G1, position monoallelically expressed in 11 tissues from five differ- 65,973–66,085; G2, position 66,667–66,793, and G3, ent human conceptuses. The expressed allele was de- position 67,780–67,926; GenBank accession no. termined to be of maternal origin by genotyping AL117190) were found to be hemimethylated, consis- matching maternal decidua tissue (Fig. 1B). Using an tent with the notion that allelic methylation differ- alternative experimental approach, Miyoshi et al. ences contribute to the imprinted regulation of GTL2 (2000) recently identified a maternally expressed hu- expression. In contrast, whereas ∼150 bp of the up- man homolog of mouse Gtl2, which they called MEG3, stream DLK1 promoter region were hemimethylated and using Northern blot analysis showed that MEG3 (D1, position 140,543–140,687; accession no. (GTL2) was an abundant transcript. The function of AL132711), the two downstream regions were pre- GTL2 is presently unknown because neither the mouse dominantly unmethylated (D2, position 141,101– nor human homologs contain a significant open read- 141,205; and D3, position 141,459–141,594; accession ing frame.
Recommended publications
  • Biochemical Mechanisms of Thyroid Hormone Deiodination

    Biochemical Mechanisms of Thyroid Hormone Deiodination

    THYROID Volume 15, Number 8, 2005 © Mary Ann Liebert, Inc. Biochemical Mechanisms of Thyroid Hormone Deiodination George G.J.M. Kuiper, Monique H.A. Kester, Robin P. Peeters, and Theo J. Visser Deiodination is the foremost pathway of thyroid hormone metabolism not only in quantitative terms but also because thyroxine (T4) is activated by outer ring deiodination (ORD) to 3,3’,5-triiodothyronine (T3), whereas both T4 and T3 are inactivated by inner ring deiodination (IRD) to 3,3’,5-triiodothyronine and 3,3’- diiodothyronine, respectively. These reactions are catalyzed by three iodothyronine deiodinases, D1-3. Although they are homologous selenoproteins, they differ in important respects such as catalysis of ORD and/or IRD, deiodination of sulfated iodothyronines, inhibition by the thyrostatic drug propylthiouracil, and regulation during fetal and neonatal development, by thyroid state, and during illness. In this review we will briefly discuss recent developments in these different areas. These have resulted in the emerging view that the biological activity of thyroid hormone is regulated locally by tissue-specific regulation of the different deiodinases. HYROID HORMONE is essential for growth, development, thyrostatic drug 6-propyl-2-thiouracil (PTU). D1 activity is Tand regulation of energy metabolism (1–3). Amphibian positively regulated by T3, reflecting regulation of D1 ex- metamorphosis is an important example of thyroid hormone pression by T3 at the pretranslational level. actions on development (4). Equally well known is the crit- In humans, D2 activity is found in brain, anterior pitu- ical role of thyroid hormone in development and function itary, placenta, thyroid and skeletal muscle, and D2 mRNA of the human central nervous system (5,6).
  • The Imprinted DLK1-MEG3 Gene Region on Chromosome 14Q32.2 Alters Susceptibility to Type 1 Diabetes

    The Imprinted DLK1-MEG3 Gene Region on Chromosome 14Q32.2 Alters Susceptibility to Type 1 Diabetes

    LETTERS The imprinted DLK1-MEG3 gene region on chromosome 14q32.2 alters susceptibility to type 1 diabetes Chris Wallace, Deborah J Smyth, Meeta Maisuria-Armer, Neil M Walker, John A Todd & David G Clayton Genome-wide association (GWA) studies to map common score tests were based on the Cochran-Armitage test, with a Mantel disease susceptibility loci have been hugely successful, with extension to allow combination over different strata (UK region in over 300 reproducibly associated loci reported to date1. the case of the WTCCC and T1DGC samples, and estimated ancestry However, these studies have not yet provided convincing score derived from principal components in the case of the GoKinD- evidence for any susceptibility locus subject to parent-of-origin NIMH samples3). For imputed SNPs, we calculated the score statistics effects. Using imputation to extend existing GWA datasets2–4, using the expected value of the imputed SNP, given observed SNPs, we have obtained robust evidence at rs941576 for paternally with the expectation calculated under the null hypothesis. inherited risk of type 1 diabetes (T1D; ratio of allelic effects for Overall, there was some overdispersion of test statistics (λ = 1.14 and paternal versus maternal transmissions = 0.75; 95% confidence 1.09 for 1 and 2 degrees of freedom, respectively). This was consistent interval (CI) = 0.71–0.79). This marker is in the imprinted with the large sample size (almost 17,000 samples) and the overdisper- region of chromosome 14q32.2, which contains the functional sion observed in earlier analysis of these data without HapMap imputa- candidate gene DLK1. Our meta-analysis also provided support tion4.
  • REVIEW Iodothyronine Deiodinase Structure and Function

    REVIEW Iodothyronine Deiodinase Structure and Function

    189 REVIEW Iodothyronine deiodinase structure and function: from ascidians to humans Veerle M Darras and Stijn L J Van Herck Animal Physiology and Neurobiology Section, Department of Biology, Laboratory of Comparative Endocrinology, KU Leuven, Naamsestraat 61, PO Box 2464, B-3000 Leuven, Belgium (Correspondence should be addressed to V M Darras; Email: [email protected]) Abstract Iodothyronine deiodinases are important mediators of thyroid of each of them, however, varies amongst species, develop- hormone (TH) action. They are present in tissues throughout mental stages and tissues. This is especially true for 0 the body where they catalyse 3,5,3 -triiodothyronine (T3) amphibians, where the impact of D1 may be minimal. D2 production and degradation via, respectively, outer and inner and D3 expression and activity respond to thyroid status in ring deiodination. Three different types of iodothyronine an opposite and conserved way, while the response of D1 is deiodinases (D1, D2 and D3) have been identified in variable, especially in fish. Recently, a number of deiodinases vertebrates from fish to mammals. They share several have been cloned from lower chordates. Both urochordates common characteristics, including a selenocysteine residue and cephalochordates possess selenodeiodinases, although in their catalytic centre, but show also some type-specific they cannot be classified in one of the three vertebrate types. differences. These specific characteristics seem very well In addition, the cephalochordate amphioxus also expresses conserved for D2 and D3, while D1 shows more evolutionary a non-selenodeiodinase. Finally, deiodinase-like sequences diversity related to its Km, 6-n-propyl-2-thiouracil sensitivity have been identified in the genome of non-deuterostome and dependence on dithiothreitol as a cofactor in vitro.
  • Imprinted Gene Expression at the Dlk1-Dio3 Cluster Is Controlled by Both Maternal and Paternal

    Imprinted Gene Expression at the Dlk1-Dio3 Cluster Is Controlled by Both Maternal and Paternal

    bioRxiv preprint doi: https://doi.org/10.1101/536102; this version posted January 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Imprinted gene expression at the Dlk1-Dio3 cluster is controlled by both maternal and paternal IG-DMRs in a tissue-specific fashion. Katherine A. Alexander 2 and María J. García-García 1* 1 Department of Molecular Biology and Genetics, Cornell University. Ithaca. NY. 14853. USA 2 Current address: Department of Cellular and Developmental Biology, University of Pennsylvania. Philadelphia PA, 19103, USA * corresponding author: [email protected] Short title: Tissue-specific imprinting control Keywords: imprinting, TRIM28, IG-DMR, Dlk1, Gtl2, PRO-seq 1 bioRxiv preprint doi: https://doi.org/10.1101/536102; this version posted January 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. ABSTRACT Imprinting at the Dlk1-Dio3 cluster is controlled by the IG-DMR, an imprinting control region differentially methylated between maternal and paternal chromosomes. The maternal IG-DMR is essential for imprinting control, functioning as a cis enhancer element. Meanwhile, DNA methylation at the paternal IG-DMR is thought to prevent enhancer activity. To explore whether suppression of enhancer activity at the methylated IG-DMR requires the transcriptional repressor TRIM28, we analyzed Trim28chatwo embryos and performed epistatic experiments with IG-DMR deletion mutants. We found that while TRIM28 regulates the enhancer properties of the paternal IG-DMR, it also controls imprinting through other mechanisms.
  • Decreased Expression of the Thyroid Hormone-Inactivating Enzyme Type

    Decreased Expression of the Thyroid Hormone-Inactivating Enzyme Type

    www.nature.com/scientificreports OPEN Decreased expression of the thyroid hormone‑inactivating enzyme type 3 deiodinase is associated with lower survival rates in breast cancer Iuri Martin Goemann1, Vicente Rodrigues Marczyk1,5, Mariana Recamonde‑Mendoza2,3, Simone Magagnin Wajner1,5, Marcia Silveira Graudenz4,5 & Ana Luiza Maia 1,5* Thyroid hormones (THs) are critical regulators of cellular processes, while changes in their levels impact all the hallmarks of cancer. Disturbed expression of type 3 deiodinase (DIO3), the main TH‑inactivating enzyme, occurs in several human neoplasms and has been associated with adverse outcomes. Here, we investigated the patterns of DIO3 expression and its prognostic signifcance in breast cancer. DIO3 expression was evaluated by immunohistochemistry in a primary cohort of patients with breast cancer and validated in a second cohort using RNA sequencing data from the TCGA database. DNA methylation data were obtained from the same database. DIO3 expression was present in normal and tumoral breast tissue. Low levels of DIO3 expression were associated with increased mortality in the primary cohort. Accordingly, low DIO3 mRNA levels were associated with an increased risk of death in a multivariate model in the validation cohort. DNA methylation analysis revealed that the DIO3 gene promoter is hypermethylated in tumors when compared to normal tissue. In conclusion, DIO3 is expressed in normal and tumoral breast tissue, while decreased expression relates to poor overall survival in breast cancer patients. Finally, loss of DIO3 expression is associated with hypermethylation of the gene promoter and might have therapeutic implications. Breast cancer is the most common cancer in women worldwide, accounting for more than two million new cancer cases and 14.9% of all cancer-related deaths in women in 2018 1.
  • DLK (DLK1) (NM 003836) Human Tagged ORF Clone Product Data

    DLK (DLK1) (NM 003836) Human Tagged ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC202923 DLK (DLK1) (NM_003836) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: DLK (DLK1) (NM_003836) Human Tagged ORF Clone Tag: Myc-DDK Symbol: DLK1 Synonyms: Delta1; DLK; DLK-1; FA1; pG2; Pref-1; PREF1; ZOG Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC202923 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGACCGCGACCGAAGCCCTCCTGCGCGTCCTCTTGCTCCTGCTGGCTTTCGGCCACAGCACCTATGGGG CTGAATGCTTCCCGGCCTGCAACCCCCAAAATGGATTCTGCGAGGATGACAATGTTTGCAGGTGCCAGCC TGGCTGGCAGGGTCCCCTTTGTGACCAGTGCGTGACCTCTCCCGGCTGCCTTCACGGACTCTGTGGAGAA CCCGGGCAGTGCATTTGCACCGACGGCTGGGACGGGGAGCTCTGTGATAGAGATGTTCGGGCCTGCTCCT CGGCCCCCTGTGCCAACAACGGGACCTGCGTGAGCCTGGACGATGGCCTCTATGAATGCTCCTGTGCCCC CGGGTACTCGGGAAAGGACTGCCAGAAAAAGGACGGGCCCTGTGTGATCAACGGCTCCCCCTGCCAGCAC GGAGGCACCTGCGTGGATGATGAGGGCCGGGCCTCCCATGCCTCCTGCCTGTGCCCCCCTGGCTTCTCAG GCAATTTCTGCGAGATCGTGGCCAACAGCTGCACCCCCAACCCATGCGAGAACGACGGCGTCTGCACTGA CATCGGGGGCGACTTCCGCTGCCGGTGCCCAGCCGGCTTCATCGACAAGACCTGCAGCCGCCCGGTGACC AACTGCGCCAGCAGCCCGTGCCAGAACGGGGGCACCTGCCTGCAGCACACCCAGGTGAGCTACGAGTGTC TGTGCAAGCCCGAGTTCACAGGTCTCACCTGTGTCAAGAAGCGCGCGCTGAGCCCCCAGCAGGTCACCCG TCTGCCCAACGGCTATGGGCTGGCCTACCGCCTGACCCCTGGGGTGCACGAGCTGCCGGTGCAGCAGCCG
  • The Long Non-Coding RNA Meg3 Is Dispensable for Hematopoietic Stem Cells

    The Long Non-Coding RNA Meg3 Is Dispensable for Hematopoietic Stem Cells

    www.nature.com/scientificreports OPEN The long non-coding RNA Meg3 is dispensable for hematopoietic stem cells Received: 10 October 2018 Pia Sommerkamp1,2,3, Simon Renders1,2, Luisa Ladel1,2, Agnes Hotz-Wagenblatt 4, Accepted: 2 January 2019 Katharina Schönberger1,2,5, Petra Zeisberger1,2, Adriana Przybylla1,2, Markus Sohn1,2, Published: xx xx xxxx Yunli Zhou6, Anne Klibanski6, Nina Cabezas-Wallscheid1,2,5 & Andreas Trumpp1,2 The long non-coding RNA (lncRNA) Maternally Expressed Gene 3 (Meg3) is encoded within the imprinted Dlk1-Meg3 gene locus and is only maternally expressed. Meg3 has been shown to play an important role in the regulation of cellular proliferation and functions as a tumor suppressor in numerous tissues. Meg3 is highly expressed in mouse adult hematopoietic stem cells (HSCs) and strongly down-regulated in early progenitors. To address its functional role in HSCs, we used MxCre to conditionally delete Meg3 in the adult bone marrow of Meg3mat-fox/pat-wt mice. We performed extensive in vitro and in vivo analyses of mice carrying a Meg3 defcient blood system, but neither observed impaired hematopoiesis during homeostatic conditions nor upon serial transplantation. Furthermore, we analyzed VavCre Meg3mat-fox/pat-wt mice, in which Meg3 was deleted in the embryonic hematopoietic system and unexpectedly this did neither generate any hematopoietic defects. In response to interferon-mediated stimulation, Meg3 defcient adult HSCs responded highly similar compared to controls. Taken together, we report the fnding, that the highly expressed imprinted lncRNA Meg3 is dispensable for the function of HSCs during homeostasis and in response to stress mediators as well as for serial reconstitution of the blood system in vivo.
  • The Dlk1 and Gtl2 Genes Are Linked and Reciprocally Imprinted

    The Dlk1 and Gtl2 Genes Are Linked and Reciprocally Imprinted

    Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press RESEARCH COMMUNICATION entially methylated cis-acting imprinting control ele- The Dlk1 and Gtl2 genes are ment (Thorvaldson et al. 1998). Third, a majority of im- linked and reciprocally printed genes for which a function has been identified imprinted code for proteins involved in the control of embryonic growth (Tilghman 1999). Jennifer V. Schmidt,1,2 Paul G. Matteson,2 Given the role of imprinted genes in fetal growth it is Beverly K. Jones, Xiao-Juan Guan, not surprising that they are often expressed in the pla- and Shirley M. Tilghman3 centa, the primary tissue regulating nutrient transfer be- tween mother and fetus. To identify new imprinted Howard Hughes Medical Institute and Department genes, we designed an allelic differential display strategy of Molecular Biology, Princeton University, Princeton, (Hagiwara et al. 1997) using placental mRNA derived New Jersey 08544 USA from two closely related species of North American deer mice, Peromyscus maniculatus (BW) and Peromyscus Genes subject to genomic imprinting exist in large chro- polionotus (PO). These mice display a high degree of mosomal domains, probably reflecting coordinate regu- polymorphism (Vrana et al. 1998), making them useful lation of the genes within a cluster. Such regulation has for screens that depend on allelic differences. been demonstrated for the H19, Igf2, and Ins2 genes that We report here the paternal-specific expression of the share a bifunctional imprinting control region. We have Delta-like (Dlk1) gene in both Peromyscus and the labo- identified the Dlk1 gene as a new imprinted gene that is ratory mouse genus Mus.
  • New Mesh Headings for 2018 Single Column After Cutover

    New Mesh Headings for 2018 Single Column After Cutover

    New MeSH Headings for 2018 Listed in alphabetical order with Heading, Scope Note, Annotation (AN), and Tree Locations 2-Hydroxypropyl-beta-cyclodextrin Derivative of beta-cyclodextrin that is used as an excipient for steroid drugs and as a lipid chelator. Tree locations: beta-Cyclodextrins D04.345.103.333.500 D09.301.915.400.375.333.500 D09.698.365.855.400.375.333.500 AAA Domain An approximately 250 amino acid domain common to AAA ATPases and AAA Proteins. It consists of a highly conserved N-terminal P-Loop ATPase subdomain with an alpha-beta-alpha conformation, and a less-conserved C- terminal subdomain with an all alpha conformation. The N-terminal subdomain includes Walker A and Walker B motifs which function in ATP binding and hydrolysis. Tree locations: Amino Acid Motifs G02.111.570.820.709.275.500.913 AAA Proteins A large, highly conserved and functionally diverse superfamily of NTPases and nucleotide-binding proteins that are characterized by a conserved 200 to 250 amino acid nucleotide-binding and catalytic domain, the AAA+ module. They assemble into hexameric ring complexes that function in the energy-dependent remodeling of macromolecules. Members include ATPASES ASSOCIATED WITH DIVERSE CELLULAR ACTIVITIES. Tree locations: Acid Anhydride Hydrolases D08.811.277.040.013 Carrier Proteins D12.776.157.025 Abuse-Deterrent Formulations Drug formulations or delivery systems intended to discourage the abuse of CONTROLLED SUBSTANCES. These may include physical barriers to prevent chewing or crushing the drug; chemical barriers that prevent extraction of psychoactive ingredients; agonist-antagonist combinations to reduce euphoria associated with abuse; aversion, where controlled substances are combined with others that will produce an unpleasant effect if the patient manipulates the dosage form or exceeds the recommended dose; delivery systems that are resistant to abuse such as implants; or combinations of these methods.
  • Epigenetic Regulation of the Dlk1-Meg3 Imprinted Locus in Human Islets

    Epigenetic Regulation of the Dlk1-Meg3 Imprinted Locus in Human Islets

    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2016 Epigenetic Regulation of the Dlk1-Meg3 Imprinted Locus in Human Islets Vasumathi Kameswaran University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Cell Biology Commons, Genetics Commons, and the Molecular Biology Commons Recommended Citation Kameswaran, Vasumathi, "Epigenetic Regulation of the Dlk1-Meg3 Imprinted Locus in Human Islets" (2016). Publicly Accessible Penn Dissertations. 1798. https://repository.upenn.edu/edissertations/1798 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1798 For more information, please contact [email protected]. Epigenetic Regulation of the Dlk1-Meg3 Imprinted Locus in Human Islets Abstract Type 2 diabetes mellitus (T2DM) is a complex metabolic disease characterized by inadequate insulin secretion by the pancreatic β-cell in response to increased blood glucose levels. Despite compelling evidence that T2DM has a high rate of familial aggregation, known genetic risk variants account for less than 10% of the observed heritability. Consequently, post-transcriptional regulators of gene expression, including microRNAs and other noncoding RNAs, have been implicated in the etiology of T2DM, in part due to their ability to simultaneously regulate the expression of hundreds of targets. To determine if microRNAs are involved in the pathogenesis of human T2DM, I sequenced the small RNAs of human islets from diabetic and non-diabetic organ donors. From this screen, I identified the maternally-expressed genes in the imprinted DLK1-MEG3 locus as highly- and specifically-expressed in human β-cells, but repressed in T2DM islets. Repression of this noncoding transcript was strongly correlated with hyper-methylation of the promoter that drives transcription of all the maternal noncoding RNAs including the long noncoding RNA MEG3, several microRNAs and snoRNAs.
  • Expression of Mirnas from the Imprinted DLK1/DIO3 Locus Signals the Osteogenic Potential of Human Pluripotent Stem Cells

    Expression of Mirnas from the Imprinted DLK1/DIO3 Locus Signals the Osteogenic Potential of Human Pluripotent Stem Cells

    cells Article Expression of miRNAs from the Imprinted DLK1/DIO3 Locus Signals the Osteogenic Potential of Human Pluripotent Stem Cells Laetitia Barrault 1, Jacqueline Gide 1, Tingting Qing 1, Lea Lesueur 2, Jorg Tost 3 , Jerome Alexandre Denis 2 , Michel Cailleret 2 , Laetitia Aubry 2, Marc Peschanski 1,2, Cécile Martinat 2,* and Sandrine Baghdoyan 2 1 CECS/AFM, I-STEM, 91100 Corbeil-Essonnes, France; [email protected] (L.B.); [email protected] (J.G.); [email protected] (T.Q.); [email protected] (M.P.) 2 INSERM/ UEVE UMR 861, Paris Saclay Univ I-STEM, 91100 Corbeil-Essonnes, France; [email protected] (L.L.); [email protected] (J.A.D.); [email protected] (M.C.); [email protected] (L.A.); [email protected] (S.B.) 3 LEE/ CNRGH/ CEA—IBFJ 2, 91000 Evry, France; [email protected] * Correspondence: [email protected] Received: 27 August 2019; Accepted: 19 November 2019; Published: 26 November 2019 Abstract: Substantial variations in differentiation properties have been reported among human pluripotent cell lines (hPSC), which could affect their utility and clinical safety. We characterized the variable osteogenic capacity observed between different human pluripotent stem cell lines. By focusing on the miRNA expression profile, we demonstrated that the osteogenic differentiation propensity of human pluripotent stem cell lines could be associated with the methylation status and the expression of miRNAs from the imprinted DLK1/DIO3 locus. More specifically, quantitative analysis of the expression of six different miRNAs of that locus prospectively identified human embryonic stem cells and human-induced pluripotent stem cells with differential osteogenic differentiation capacities.
  • 1 Epigenetic Change Induced by in Utero Dietary Challenge Provokes Phenotypic Variability Across Multiple Generations of Mice M

    1 Epigenetic Change Induced by in Utero Dietary Challenge Provokes Phenotypic Variability Across Multiple Generations of Mice M

    bioRxiv preprint doi: https://doi.org/10.1101/2020.08.07.241034; this version posted August 7, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Epigenetic change induced by in utero dietary challenge provokes phenotypic variability across multiple generations of mice Mathew Van de Pette1, Antonio Galvao2,3,4, Steven J. Millership5, Wilson To1, Andrew Dimond1, Chiara Prodani1, Grainne McNamara1, Ludovica Bruno1, Alessandro Sardini6, Zoe Webster7, James McGinty8, Paul French8, Anthony G. Uren9, Juan Castillo-Fernandez2, Rosalind M. John10, Anne C. Ferguson-Smith11, Matthias Merkenschlager1, Gavin Kelsey2,4 and Amanda G. Fisher1* 1 Lymphocyte Development Group, MRC London Institute of Medical Sciences, Imperial College London Hammersmith Hospital Campus, Du Cane Road, London, W12 0NN, UK. 2 Epigenetics Programme, The Babraham Institute, Cambridge, CB22 3AT, UK. 3 Institute of Animal Reproduction and Food Research of PAS, Department of Reproductive Immunology and Pathology, Olsztyn, Poland. 4 Centre for Trophoblast Research, University of Cambridge, Cambridge, CB2 3EG, UK. 5 Department of Medicine, Imperial College London, Hammersmith Hospital, Du Cane Road, London, W12 0NN, UK. 6 Whole Animal Physiology and Imaging, London Institute of Medical Sciences, Imperial College London, Hammersmith Hospital Campus, Du Cane Road, London, W12 0NN, UK. 7 Transgenics and Embryonic Stem Cell Laboratory, London Institute of Medical Sciences, Imperial College London, Hammersmith Hospital Campus, Du Cane Road, London, W12 0NN, UK. 8 Photonics Group, Department of Physics, Imperial College London, London, UK. 9 Cancer Genomics Group, MRC Institute of Clinical Sciences, Imperial College London, Hammersmith Hospital Campus, Du Cane Road, London, W12 0NN, UK.