DOCSLIB.ORG

Biochemical Mechanisms of Thyroid Hormone Deiodination

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Biochemical Mechanisms of Thyroid Hormone Deiodination THYROID Volume 15, Number 8, 2005 © Mary Ann Liebert, Inc. Biochemical Mechanisms of Thyroid Hormone Deiodination George G.J.M. Kuiper, Monique H.A. Kester, Robin P. Peeters, and Theo J. Visser Deiodination is the foremost pathway of thyroid hormone metabolism not only in quantitative terms but also because thyroxine (T4) is activated by outer ring deiodination (ORD) to 3,3’,5-triiodothyronine (T3), whereas both T4 and T3 are inactivated by inner ring deiodination (IRD) to 3,3’,5-triiodothyronine and 3,3’- diiodothyronine, respectively. These reactions are catalyzed by three iodothyronine deiodinases, D1-3. Although they are homologous selenoproteins, they differ in important respects such as catalysis of ORD and/or IRD, deiodination of sulfated iodothyronines, inhibition by the thyrostatic drug propylthiouracil, and regulation during fetal and neonatal development, by thyroid state, and during illness. In this review we will briefly discuss recent developments in these different areas. These have resulted in the emerging view that the biological activity of thyroid hormone is regulated locally by tissue-specific regulation of the different deiodinases. HYROID HORMONE is essential for growth, development, thyrostatic drug 6-propyl-2-thiouracil (PTU). D1 activity is Tand regulation of energy metabolism (1–3). Amphibian positively regulated by T3, reflecting regulation of D1 ex- metamorphosis is an important example of thyroid hormone pression by T3 at the pretranslational level. actions on development (4). Equally well known is the crit- In humans, D2 activity is found in brain, anterior pitu- ical role of thyroid hormone in development and function itary, placenta, thyroid and skeletal muscle, and D2 mRNA of the human central nervous system (5,6). Thyroid hor- has also been detected in the human heart. In rodents D2 is mone is produced by the thyroid in the form of the biolog- also expressed in brown adipose tissue. D2 has only ORD ically inactive precursor thyroxine (T4). The prinicipal bioac- activity, preferring T4 over rT3 as the substrate, with appar- tive form of the hormone is triiodothyronine (T3). In ent Km values in the nanomolar range. In general, D2 activ- humans, only approximately 20% of T3 is secreted by the ity is increased in hypothyroidism and decreased in hyper- thyroid; most circulating T3 is derived from outer ring deio- thyroidism. Both pre- and posttranslational mechanisms are dination (ORD) of T4 in peripheral tissues. Both T4 and T3 involved in the regulation of D2 expression by thyroid state, undergo inner ring deiodination (IRD) to metabolites which with distinct roles for T3, and for T4 and rT3, respectively. do not interact with T3 receptors, reverse triiodothyronine Although perhaps D2 in skeletal muscle may contribute to Ј Ј (rT3) and 3,3 -diiodothyronine (3,3 -T2), respectively. Thus, circulating T3, the enzyme is particularly important for local ORD is regarded as an activating pathway and IRD as an T3 production in brain and anterior pituitary. inactivating pathway. ORD is also the main pathway for the In human and rodents, D3 is located in brain, placenta, metabolism of rT3, representing another route for the gen- pregnant uterus, and fetal tissues. D3 has only IRD activity, Ј eration of 3,3 -T2. Three iodothyronine deiodinases are in- and is thus important for the inactivation of thyroid hor- volved in the deiodination of iodothyronines, namely, mone. It shows preference for T3 over T4 as the substrate, D1–D3 (7–9). with apparent Km values in the nanomolar range. The high In humans and rodents, D1 is located primarily in liver, D3 activity in placenta, pregnant uterus and different fetal kidney, and thyroid. Lower D1 activities are expressed in tissues seems to serve the purpose of protecting the fetus other tissues, including rat anterior pituitary. Although D1 against undue exposure to active thyroid hormone that may has both ORD and IRD activities, it appears particularly im- be detrimental for the development of different tissues, in portant for the generation of plasma T3 and clearance of particular the brain. In brain, D3 activity is increased in hy- plasma rT3. ORD of rT3 is the most efficient reaction cat- perthyroidism and decreased in hypothyroidism but the alyzed by D1, while IRD of both T4 and T3 are strongly ac- mechanism of this regulation remains to be established. celerated by sulfation of these iodothyronines. Michaelis In this short review we will focus on recent insights in Menten constant (Km) values for substrates of D1 are in the deiodinase structure-function relationships and physiologi- micromolar range. The enzyme is potently inhibited by the cal roles of deiodinases. For a more in-depth discussion on Department of Internal Medicine, Erasmus Medical Center, Rotterdam, The Netherlands. 787 788 KUIPER ET AL. the concepts underlying much of the work to be presented Iodothyronine substrate interaction the reader is referred to earlier reviews (8–11). Cloning of D1 from various species (rat, mouse, cat, dog, human) and careful analysis of kinetic properties with a Structure-Function Relationship of range of substrates (T , T , rT , rT S, T , T S) has enabled the Iodothyronine Deiodinases 4 3 3 3 2 2 identification of a region that is involved in substrate inter- Catalytic center action. Comparative structural–functional analysis of human and dog D1 enzymes showed that the region between amino Iodothyronine deiodinases are selenoproteins, containing acid residue 30 and 70 accounts for the difference in K value a single selenocysteine residue (SeC) in the core catalytic cen- m for rT ORD between dog and human D1 (19). Dog D1 has ter. This core catalytic center consists of approximately 15 3 an approximately 30-fold higher K for rT ORD than hu- amino acid residues surrounding the SeC and is highly con- m 3 man D1. More detailed studies demonstrated that it is mainly served within and between the deiodinase subtypes. The SeC the Phe65Leu substitution that explains the slow ORD of rT is encoded by a UGA stop codon which in the presence of a 3 by dog D1 versus human and rat D1 (19). The same type of so-called SECIS (selenocysteine insertion sequence) element studies comparing cat and rat D1 enzyme also indicated that in the 3Ј untranslated region (UTR) is recoded from a stop the region between residue 40 and 70 is involved in substrate to a SeC codon (12). The SeC residue is essential for enzyme interaction. By site-directed mutagenesis it was found that a activity because replacement with Ala or Ser residues (es- combination of mutations was necessary to improve the sentially replacing the SeH group by H or OH) eliminates deiodination of rT by cat D1. For efficient rT deiodination, activity. As far as we know only replacement of SeC with 3 3 a Phe at position 65 and the insertion of the Thr-Gly-Met- Cys (substituting S for Se) in D1, D2, or D3 maintains enzy- Thr-Arg sequence (residue 48–52) as well as the amino acids matic activity, although with strongly reduced substrate Gly and Glu at position 45–46 are essential (20). An intrigu- turnover numbers and significantly increased K values for m ing property of cat D1 is the facilitated deiodination of rT S, the iodothyronine substrates (13–15). For some reason dur- 3 and the combination of the described changes did not affect ing evolution nature has decided that deiodinases should be this property (V /K rT ϭ 3 and V /K rT S ϭ 81). selenoenzymes, despite the fact that the synthesis of a se- max m 3 max m 3 The negatively charged sulfate group of rT S might interact lenoprotein is expensive for the cell. From an energetic point 3 with the positively charged side group of a basic amino acid of view the extraction of iodonium (Iϩ) from an aromatic ring (Lys, Arg), thereby stabilizing interaction with D1. Our stud- is a difficult step and most likely the more negatively charged ies indicated that this basic amino acid is probably situated selenol group (SeH ↔ SeϪ) is better capable of accomplish- outside the region between residue 40 and 70, and remains ing this than the sulfydryl group (SH). The selenol group to be identified. The fact that D1 catalyzes ORD (rT3, rT3S, might interact with side groups of other amino acid residues T ) and IRD (T , T S, T , T S) suggests different orientations facilitating its deprotonation. For D1 the formation of an es- 4 4 4 3 3 of substrate binding within a single site, so that either the sential imidazolium–selenolate ion pair was postulated on iodines of the inner ring or of the outer ring are in close prox- the basis of experiments with histidine-directed reagents and imity of the catalytic center. In other words, the D1 substrate side-directed mutagenesis studies (8,16,17). binding site is very flexible and therefore it will be difficult More detailed insights in deiodinase structure and cat- to gain more insight in the structure–activity relationship by alytic mechanism must come from the three-dimensional site-directed mutagenesis studies with the thus far cloned D1 structure when this is resolved by crystallographic studies. enzymes, unless D1 variants from other species turn up Unfortunately, these studies are greatly hampered by the dif- which for instance lack IRD activity or do not show facili- ficulties encountered with overexpressing these membrane- tated deiodination of sulfated iodothyronines. For similar integrated enzymes in a soluble and active form. An alter- reasons, that is no large variations in kinetic properties for native strategy consists of attempting to model deiodinase different substrates among D2 and D3 enzymes in various structure on the basis of structural resemblance to other pro- species, no progress has been made in the identification of teins for which experimental structure information exists.
Load more

Recommended publications
  • The Deiodination of Thyroid Hormone in Rat Liver
    The deiodination of thyroid hormone in rat liver De dejodering van schildklierhormoon in de lever van de rat PROEFSCHRIFT T er verkrijging van de graad van doctor in de geneeskunde aan de Erasmus Universiteit Rotterdam op gezag van de rector magnificus prof. dr. M. W. van Hof en vo1gens bes1uit van het college van dekanen. De openbare verdediging zal p1aatsvinden op woensdag 12 juni 1985 te 15.45 uur door Jan Adrianus Mol geboren te Dordrecht BEGELEIDINGSCOMMISSIE PROMOTOR PROF. DR. G. HENNEMANN OVERIGE LEDEN PROF. DR. W.C. HuLSMANN PROF. DR. H.J. VANDER MOLEN PROF. DR. H.J. VAN EIJK The studies in this thesis were carried out under the direction of Dr. T.J. Visser in the laboratory of the Thyroid Hormone Research Unit (head Prof. Dr. G. Hennemann) at the Department of Internal Medicine III and Clinical ·Endocrinology (head Prof. Dr. J.c. Birkenhager), Erasmus University Medical School, Rotterdam, The Netherlands. The investigations were supported by grant 13-34-108 from the Foundation for Medical Research FUNGO. Kennis, zij zal afgedaan hebben •... zo blijven dan: Geloof, hoop en liefde •.•. (I Korintiers 13) aan mijn Ouders aan Ellen, Gerben en Jurjan CONTENTS List of abbreviations. 7 Chapter I General introduction. 9 Chapter II The liver, a central organ for iodothyronine 17 metabolism? Chapter III Synthesis and some properties of sulfate 45 esters and sulfamates o_f iodothyronines. Chapter IV Rapid and selective inner ring deiodination 61 of T4 sulfate by rat liver deiodinase. Chapter V Modification of rat liver iodothyronine 75 5'-deiodinase activity with diethylpyrocarbo­ nate and Rose Bengal: evidence for an active site histidine residue.
    [Show full text]
  • The Imprinted DLK1-MEG3 Gene Region on Chromosome 14Q32.2 Alters Susceptibility to Type 1 Diabetes
    LETTERS The imprinted DLK1-MEG3 gene region on chromosome 14q32.2 alters susceptibility to type 1 diabetes Chris Wallace, Deborah J Smyth, Meeta Maisuria-Armer, Neil M Walker, John A Todd & David G Clayton Genome-wide association (GWA) studies to map common score tests were based on the Cochran-Armitage test, with a Mantel disease susceptibility loci have been hugely successful, with extension to allow combination over different strata (UK region in over 300 reproducibly associated loci reported to date1. the case of the WTCCC and T1DGC samples, and estimated ancestry However, these studies have not yet provided convincing score derived from principal components in the case of the GoKinD- evidence for any susceptibility locus subject to parent-of-origin NIMH samples3). For imputed SNPs, we calculated the score statistics effects. Using imputation to extend existing GWA datasets2–4, using the expected value of the imputed SNP, given observed SNPs, we have obtained robust evidence at rs941576 for paternally with the expectation calculated under the null hypothesis. inherited risk of type 1 diabetes (T1D; ratio of allelic effects for Overall, there was some overdispersion of test statistics (λ = 1.14 and paternal versus maternal transmissions = 0.75; 95% confidence 1.09 for 1 and 2 degrees of freedom, respectively). This was consistent interval (CI) = 0.71–0.79). This marker is in the imprinted with the large sample size (almost 17,000 samples) and the overdisper- region of chromosome 14q32.2, which contains the functional sion observed in earlier analysis of these data without HapMap imputa- candidate gene DLK1. Our meta-analysis also provided support tion4.
    [Show full text]
  • Thyroid-Modulating Activities of Olive and Its Polyphenols: a Systematic Review
    nutrients Review Thyroid-Modulating Activities of Olive and Its Polyphenols: A Systematic Review Kok-Lun Pang 1,† , Johanna Nathania Lumintang 2,† and Kok-Yong Chin 1,* 1 Department of Pharmacology, Faculty of Medicine, Universiti Kebangsaan Malaysia, Jalan Yaacob Latif, Bandar Tun Razak, Cheras 56000, Kuala Lumpur, Malaysia; [email protected] 2 Faculty of Applied Sciences, UCSI University Kuala Lumpur Campus, Jalan Menara Gading, Taman Connaught, Cheras 56000, Kuala Lumpur, Malaysia; [email protected] * Correspondence: [email protected]; Tel.: +60-3-91459573 † These authors contributed equally to this work. Abstract: Olive oil, which is commonly used in the Mediterranean diet, is known for its health benefits related to the reduction of the risks of cancer, coronary heart disease, hypertension, and neurodegenerative disease. These unique properties are attributed to the phytochemicals with potent antioxidant activities in olive oil. Olive leaf also harbours similar bioactive compounds. Several studies have reported the effects of olive phenolics, olive oil, and leaf extract in the modulation of thyroid activities. A systematic review of the literature was conducted to identify relevant studies on the effects of olive derivatives on thyroid function. A comprehensive search was conducted in October 2020 using the PubMed, Scopus, and Web of Science databases. Cellular, animal, and human studies reporting the effects of olive derivatives, including olive phenolics, olive oil, and leaf extracts on thyroid function were considered. The literature search found 445 articles on this topic, but only nine articles were included based on the inclusion and exclusion criteria. All included articles were animal studies involving the administration of olive oil, olive leaf extract, or olive pomace residues orally.
    [Show full text]
  • REVIEW Iodothyronine Deiodinase Structure and Function
    189 REVIEW Iodothyronine deiodinase structure and function: from ascidians to humans Veerle M Darras and Stijn L J Van Herck Animal Physiology and Neurobiology Section, Department of Biology, Laboratory of Comparative Endocrinology, KU Leuven, Naamsestraat 61, PO Box 2464, B-3000 Leuven, Belgium (Correspondence should be addressed to V M Darras; Email: [email protected]) Abstract Iodothyronine deiodinases are important mediators of thyroid of each of them, however, varies amongst species, develop- hormone (TH) action. They are present in tissues throughout mental stages and tissues. This is especially true for 0 the body where they catalyse 3,5,3 -triiodothyronine (T3) amphibians, where the impact of D1 may be minimal. D2 production and degradation via, respectively, outer and inner and D3 expression and activity respond to thyroid status in ring deiodination. Three different types of iodothyronine an opposite and conserved way, while the response of D1 is deiodinases (D1, D2 and D3) have been identified in variable, especially in fish. Recently, a number of deiodinases vertebrates from fish to mammals. They share several have been cloned from lower chordates. Both urochordates common characteristics, including a selenocysteine residue and cephalochordates possess selenodeiodinases, although in their catalytic centre, but show also some type-specific they cannot be classified in one of the three vertebrate types. differences. These specific characteristics seem very well In addition, the cephalochordate amphioxus also expresses conserved for D2 and D3, while D1 shows more evolutionary a non-selenodeiodinase. Finally, deiodinase-like sequences diversity related to its Km, 6-n-propyl-2-thiouracil sensitivity have been identified in the genome of non-deuterostome and dependence on dithiothreitol as a cofactor in vitro.
    [Show full text]
  • Imprinted Gene Expression at the Dlk1-Dio3 Cluster Is Controlled by Both Maternal and Paternal
    bioRxiv preprint doi: https://doi.org/10.1101/536102; this version posted January 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Imprinted gene expression at the Dlk1-Dio3 cluster is controlled by both maternal and paternal IG-DMRs in a tissue-specific fashion. Katherine A. Alexander 2 and María J. García-García 1* 1 Department of Molecular Biology and Genetics, Cornell University. Ithaca. NY. 14853. USA 2 Current address: Department of Cellular and Developmental Biology, University of Pennsylvania. Philadelphia PA, 19103, USA * corresponding author: [email protected] Short title: Tissue-specific imprinting control Keywords: imprinting, TRIM28, IG-DMR, Dlk1, Gtl2, PRO-seq 1 bioRxiv preprint doi: https://doi.org/10.1101/536102; this version posted January 31, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. ABSTRACT Imprinting at the Dlk1-Dio3 cluster is controlled by the IG-DMR, an imprinting control region differentially methylated between maternal and paternal chromosomes. The maternal IG-DMR is essential for imprinting control, functioning as a cis enhancer element. Meanwhile, DNA methylation at the paternal IG-DMR is thought to prevent enhancer activity. To explore whether suppression of enhancer activity at the methylated IG-DMR requires the transcriptional repressor TRIM28, we analyzed Trim28chatwo embryos and performed epistatic experiments with IG-DMR deletion mutants. We found that while TRIM28 regulates the enhancer properties of the paternal IG-DMR, it also controls imprinting through other mechanisms.
    [Show full text]
  • Decreased Expression of the Thyroid Hormone-Inactivating Enzyme Type
    www.nature.com/scientificreports OPEN Decreased expression of the thyroid hormone‑inactivating enzyme type 3 deiodinase is associated with lower survival rates in breast cancer Iuri Martin Goemann1, Vicente Rodrigues Marczyk1,5, Mariana Recamonde‑Mendoza2,3, Simone Magagnin Wajner1,5, Marcia Silveira Graudenz4,5 & Ana Luiza Maia 1,5* Thyroid hormones (THs) are critical regulators of cellular processes, while changes in their levels impact all the hallmarks of cancer. Disturbed expression of type 3 deiodinase (DIO3), the main TH‑inactivating enzyme, occurs in several human neoplasms and has been associated with adverse outcomes. Here, we investigated the patterns of DIO3 expression and its prognostic signifcance in breast cancer. DIO3 expression was evaluated by immunohistochemistry in a primary cohort of patients with breast cancer and validated in a second cohort using RNA sequencing data from the TCGA database. DNA methylation data were obtained from the same database. DIO3 expression was present in normal and tumoral breast tissue. Low levels of DIO3 expression were associated with increased mortality in the primary cohort. Accordingly, low DIO3 mRNA levels were associated with an increased risk of death in a multivariate model in the validation cohort. DNA methylation analysis revealed that the DIO3 gene promoter is hypermethylated in tumors when compared to normal tissue. In conclusion, DIO3 is expressed in normal and tumoral breast tissue, while decreased expression relates to poor overall survival in breast cancer patients. Finally, loss of DIO3 expression is associated with hypermethylation of the gene promoter and might have therapeutic implications. Breast cancer is the most common cancer in women worldwide, accounting for more than two million new cancer cases and 14.9% of all cancer-related deaths in women in 2018 1.
    [Show full text]
  • DLK (DLK1) (NM 003836) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC202923 DLK (DLK1) (NM_003836) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: DLK (DLK1) (NM_003836) Human Tagged ORF Clone Tag: Myc-DDK Symbol: DLK1 Synonyms: Delta1; DLK; DLK-1; FA1; pG2; Pref-1; PREF1; ZOG Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC202923 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGACCGCGACCGAAGCCCTCCTGCGCGTCCTCTTGCTCCTGCTGGCTTTCGGCCACAGCACCTATGGGG CTGAATGCTTCCCGGCCTGCAACCCCCAAAATGGATTCTGCGAGGATGACAATGTTTGCAGGTGCCAGCC TGGCTGGCAGGGTCCCCTTTGTGACCAGTGCGTGACCTCTCCCGGCTGCCTTCACGGACTCTGTGGAGAA CCCGGGCAGTGCATTTGCACCGACGGCTGGGACGGGGAGCTCTGTGATAGAGATGTTCGGGCCTGCTCCT CGGCCCCCTGTGCCAACAACGGGACCTGCGTGAGCCTGGACGATGGCCTCTATGAATGCTCCTGTGCCCC CGGGTACTCGGGAAAGGACTGCCAGAAAAAGGACGGGCCCTGTGTGATCAACGGCTCCCCCTGCCAGCAC GGAGGCACCTGCGTGGATGATGAGGGCCGGGCCTCCCATGCCTCCTGCCTGTGCCCCCCTGGCTTCTCAG GCAATTTCTGCGAGATCGTGGCCAACAGCTGCACCCCCAACCCATGCGAGAACGACGGCGTCTGCACTGA CATCGGGGGCGACTTCCGCTGCCGGTGCCCAGCCGGCTTCATCGACAAGACCTGCAGCCGCCCGGTGACC AACTGCGCCAGCAGCCCGTGCCAGAACGGGGGCACCTGCCTGCAGCACACCCAGGTGAGCTACGAGTGTC TGTGCAAGCCCGAGTTCACAGGTCTCACCTGTGTCAAGAAGCGCGCGCTGAGCCCCCAGCAGGTCACCCG TCTGCCCAACGGCTATGGGCTGGCCTACCGCCTGACCCCTGGGGTGCACGAGCTGCCGGTGCAGCAGCCG
    [Show full text]
  • Selenium Vs. Sulfur: Investigating the Substrate Specificity of a Selenocysteine Lyase
    University of Central Florida STARS Electronic Theses and Dissertations, 2004-2019 2019 Selenium vs. Sulfur: Investigating the Substrate Specificity of a Selenocysteine Lyase Michael Johnstone University of Central Florida Part of the Biotechnology Commons Find similar works at: https://stars.library.ucf.edu/etd University of Central Florida Libraries http://library.ucf.edu This Masters Thesis (Open Access) is brought to you for free and open access by STARS. It has been accepted for inclusion in Electronic Theses and Dissertations, 2004-2019 by an authorized administrator of STARS. For more information, please contact [email protected]. STARS Citation Johnstone, Michael, "Selenium vs. Sulfur: Investigating the Substrate Specificity of a Selenocysteine Lyase" (2019). Electronic Theses and Dissertations, 2004-2019. 6511. https://stars.library.ucf.edu/etd/6511 SELENIUM VS. SULFUR: INVESTIGATING THE SUBSTRATE SPECIFICITY OF A SELENOCYSTEINE LYASE by MICHAEL ALAN JOHNSTONE B.S. University of Central Florida, 2017 A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science in the Burnett School of Biomedical Sciences in the College of Medicine at the University of Central Florida Orlando, Florida Summer Term 2019 Major Professor: William T. Self © 2019 Michael Alan Johnstone ii ABSTRACT Selenium is a vital micronutrient in many organisms. While traces are required for survival, excess amounts are toxic; thus, selenium can be regarded as a biological “double-edged sword”. Selenium is chemically similar to the essential element sulfur, but curiously, evolution has selected the former over the latter for a subset of oxidoreductases. Enzymes involved in sulfur metabolism are less discriminate in terms of preventing selenium incorporation; however, its specific incorporation into selenoproteins reveals a highly discriminate process that is not completely understood.
    [Show full text]
  • Association of Antiepileptic Drug Usage, Trace Elements and Thyroid Hormone Status
    C Zevenbergen, Trace elements and thyroid 174:4 425–432 Clinical Study T I M Korevaar, hormones A Schuette and others Association of antiepileptic drug usage, trace elements and thyroid hormone status Chantal Zevenbergen1,2,*, Tim I M Korevaar1,2,*, Andrea Schuette3,*, Robin P Peeters1,2, Marco Medici1,2, Theo J Visser1,2, Lutz Schomburg3 and W Edward Visser1,2 1Department of Internal Medicine and 2Rotterdam Thyroid Center, Erasmus Medical Center, Wytemaweg 80, 3015 Correspondence CN Rotterdam, The Netherlands and 3Institut fu¨ r Experimentelle Endokrinologie, Charite´ -Universita¨ tsmedizin should be addressed Berlin, Augustenburger Platz 1, D-13353 Berlin, Germany to W E Visser *(C Zevenbergen, T I M Korevaar, A Schuette contributed equally to this work) Email [email protected] Abstract Background: Levels of thyroid hormone (TH) and trace elements (copper (Cu) and selenium (Se)) are important for development and function of the brain. Anti-epileptic drugs (AEDs) can influence serum TH and trace element levels. As the relationship between AEDs, THs, and trace elements has not yet been studied directly, we explored these interactions. Method: In total 898 participants, from the Thyroid Origin of Psychomotor Retardation study designed to investigate thyroid parameters in subjects with intellectual disability (ID), had data available on serum Se, Cu, thyroid stimulating hormone (TSH), free thyroxine (FT4), tri-iodothyronine (T3), reverse T3,T4, and thyroxine-binding globulin (TBG); 401 subjects were on AED treatment. Differences in trace elements according to medication usage was investigated using ANOVA, and associations between trace elements and thyroid parameters were analysed using (non-) linear regression models. Results: Study participants were not deficient in any of the trace elements analyzed.
    [Show full text]
  • Ata Grant Recipients: Publications
    American Thyroid Association Grant Recipients: PUBLICATIONS 2003 KNAUF, J. “Tyrosine kinase receptor oncogenes and prostanoid biosynthesis: Role of RET/PTC-induced activation of PGE2 synthase in thyroid tumorigenesis” 1. Puxeddu E, Mitsutake N, Knauf JA, Moretti S, Kim HW, Seta KA, Brockman D, Myatt L, Millhorn DE, Fagin JA 2003. Microsomal prostaglandin E2 synthase-1 is induced by conditional expression of RET/PTC in thyroid PCCL3 cells through the activation of the MEK-ERK pathway. J Biol Chem 278:52131- 52138. 2. Knauf JA, Ouyang B, Croyle M, Kimura E, Fagin JA 2003. Acute expression of RET/PTC induces isozyme-specific activation and subsequent downregulation of PKCepsilon in PCCL3 thyroid cells. Oncogene 22:6830-6838. 3. Knauf JA, Kuroda H, Basu S, Fagin JA 2003. RET/PTC-induced dedifferentiation of thyroid cells is mediated through Y1062 signaling through SHC-RAS-MAP kinase. Oncogene 22:4406-4412. 4. Wang J, Knauf JA, Basu S, Puxeddu E, Kuroda H, Santoro M, Fusco A, Fagin JA 2003. Conditional expression of RET/PTC induces a weak oncogenic drive in thyroid PCCL3 cells and inhibits thyrotropin action at multiple levels. Mol Endocrinol 17:1425-1436. JACOBSON, E. “Molecular determinants of the presentation of immunogenic thyroglobulin peptides by HLA-DR3” New to the thyroid field; no prior thyroid publications XU, XIULONG* “BRAF gene mutation and oncogenesis of papillary thyroid carcinomas” * ThyCa award 1. Xu X, Quiros RM, Maxhimer JB, Jiang P, Marcinek R, Ain KB, Platt JL, Shen J, Gattuso P, Prinz RA 2003. Inverse correlation between heparan sulfate composition and heparanase-1 gene expression in thyroid papillary carcinomas: a potential role in tumor metastasis.
    [Show full text]
  • The Long Non-Coding RNA Meg3 Is Dispensable for Hematopoietic Stem Cells
    www.nature.com/scientificreports OPEN The long non-coding RNA Meg3 is dispensable for hematopoietic stem cells Received: 10 October 2018 Pia Sommerkamp1,2,3, Simon Renders1,2, Luisa Ladel1,2, Agnes Hotz-Wagenblatt 4, Accepted: 2 January 2019 Katharina Schönberger1,2,5, Petra Zeisberger1,2, Adriana Przybylla1,2, Markus Sohn1,2, Published: xx xx xxxx Yunli Zhou6, Anne Klibanski6, Nina Cabezas-Wallscheid1,2,5 & Andreas Trumpp1,2 The long non-coding RNA (lncRNA) Maternally Expressed Gene 3 (Meg3) is encoded within the imprinted Dlk1-Meg3 gene locus and is only maternally expressed. Meg3 has been shown to play an important role in the regulation of cellular proliferation and functions as a tumor suppressor in numerous tissues. Meg3 is highly expressed in mouse adult hematopoietic stem cells (HSCs) and strongly down-regulated in early progenitors. To address its functional role in HSCs, we used MxCre to conditionally delete Meg3 in the adult bone marrow of Meg3mat-fox/pat-wt mice. We performed extensive in vitro and in vivo analyses of mice carrying a Meg3 defcient blood system, but neither observed impaired hematopoiesis during homeostatic conditions nor upon serial transplantation. Furthermore, we analyzed VavCre Meg3mat-fox/pat-wt mice, in which Meg3 was deleted in the embryonic hematopoietic system and unexpectedly this did neither generate any hematopoietic defects. In response to interferon-mediated stimulation, Meg3 defcient adult HSCs responded highly similar compared to controls. Taken together, we report the fnding, that the highly expressed imprinted lncRNA Meg3 is dispensable for the function of HSCs during homeostasis and in response to stress mediators as well as for serial reconstitution of the blood system in vivo.
    [Show full text]
  • The Dlk1 and Gtl2 Genes Are Linked and Reciprocally Imprinted
    Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press RESEARCH COMMUNICATION entially methylated cis-acting imprinting control ele- The Dlk1 and Gtl2 genes are ment (Thorvaldson et al. 1998). Third, a majority of im- linked and reciprocally printed genes for which a function has been identified imprinted code for proteins involved in the control of embryonic growth (Tilghman 1999). Jennifer V. Schmidt,1,2 Paul G. Matteson,2 Given the role of imprinted genes in fetal growth it is Beverly K. Jones, Xiao-Juan Guan, not surprising that they are often expressed in the pla- and Shirley M. Tilghman3 centa, the primary tissue regulating nutrient transfer be- tween mother and fetus. To identify new imprinted Howard Hughes Medical Institute and Department genes, we designed an allelic differential display strategy of Molecular Biology, Princeton University, Princeton, (Hagiwara et al. 1997) using placental mRNA derived New Jersey 08544 USA from two closely related species of North American deer mice, Peromyscus maniculatus (BW) and Peromyscus Genes subject to genomic imprinting exist in large chro- polionotus (PO). These mice display a high degree of mosomal domains, probably reflecting coordinate regu- polymorphism (Vrana et al. 1998), making them useful lation of the genes within a cluster. Such regulation has for screens that depend on allelic differences. been demonstrated for the H19, Igf2, and Ins2 genes that We report here the paternal-specific expression of the share a bifunctional imprinting control region. We have Delta-like (Dlk1) gene in both Peromyscus and the labo- identified the Dlk1 gene as a new imprinted gene that is ratory mouse genus Mus.
    [Show full text]