This article isThis article by protected copyright. All rightsreserved. 10.1111/jeu.12524 differences thisbetween andVersion version the ofRecord.c Please the through copyediting, typesetting, pagination and proofreading process, to whichmay lead This article acceptedhas been for publication andundergone fullpeer review buthasnotbeen +44number: Telephone 2079425387;e CromwellMuseum, ofThe LifeSciences, NaturalHistoryCorrespondence:Department Bass, David PlaceRoscoff, 1 Austria f Gower Stree e d Russia c TheWeymouth Nothe, DT48UB, UK b SW7 5BD, UK a M Gardner David Bass Terrestrial Flagellates,including Rhizarian ‘NovelCladeRevealed 10’ Bass al. et Article :Original Article type 0000 ID: (Orcid BERNEY DR. CÉDRIC 0000 ID: (Orcid JANOUŠKOVEC MR. JAN :0000 ID (Orcid BASS DAVID PROF.
Institute ofInstitute Microbiology, Universityof Innsbruck,Technikerstraße6020 25, Innsbruck, Institute Acceptedpresent address: ofUniversity CollegeDepartment Genetics,Evolution London, British University of Columbia,Botany Vancouver Department, Canada V6T1Z4,BC, Centrefor Environment.Fisheries Barrack andAquacultureScience (Cefas), Road, LifeSciences,Department of NaturalHistory Museum, The Cromwell London Road, Article
forSciences,Biology RussianInlandof ofBorok Waters, 152742, Academy --- a a,b , t, London,WC1E UK t, 6BT, Aquavolon Neuhauser S , Tikhonenkov, DV
Georges Teissier,29680 France Roscoff,
Sorbonne &CNRS,Stati UMRAD2M, Université
Road, LondonSW7 5BD,Road, UK
are
f , Hartik F reshwater and - 0002 - 0001 c,d , Foster R Foster , ainen H - - 0001 9883 Aquavolon - 8689
-
as - 6547 7823) - 9907) - a mail
, Mylnikov AP , Abundantand Planktonic Diverse a - , Dyal P S 749X)
n. gen. R
hizarian
a , Janouskovec
c
,
Berney C
P rotists ite ite this asdoi: article and
a,1
on Biologique de J
Environment, Environment, d,e
, Keeling, PJ d ,
This article isThis article by protected copyright. All rightsreserved. al. 2009a;Hess al.2012; et al. 2013).BerneyNCs et 2,3and5remain ( Micrometromonas NC6al. 2017a);et belongs agroup including to 2016),(Shiratori etal.which acladewith forms Abollifer genera efforts: the order MarimonadidaaccountsNC1,for most al.2011) of (Howeet including severaloftheseinitialNCshaveSince been iden 2004 Cladesand (NCs)to numbered1 9. been ascercozoanthey havesince referredanythingtheir biology; to Novel about were2004)that too revealedlineages known noveldistantly relatedto infer taxa to ofthephylumCercozoa sequencingenvironmental (Bass &Cavalier survey al. 2010;JonesLKM11et fungietal.2011). group(Lara related to Likewise,the first 2004) etLópez andMALV(marineal. García the alveolates; 2001)lineages,and forexampletaxonomicstatus, variousMASTMass the (marine stramenopiles; Someof & Basstheseareregularly andacquireown 2005). detected their quasi diversityof undescribedinvastof the sampled protistsmajority habitat types (Richards SEQUENCING sequencing,environmental Aquavolonida, Rhizaria hoantraniAquavolon Key words Cercozoa (Filosa),EndomyxaRetaria. and which representsthe likely oneofdeepest lineagesintheRhizaria, evolutionary common lineage with sediments. orga frequently includedetected Aquavolonida less Earlierandyet undetected as inmarinebranching environments. in lineages diverse whichradiationprotists, aremostdiversified ofplanktonic habitatsfreshwater in extractions rarely very Screeningglide onsurfaces. of Tremula leastconnectedone other andarebyat possess naked ofNC10,members named Aquavolonidanov.. here The ord. and two speciesof describesequencingplanktonic studiessamples.Wenew infreshwater a genusand Rhizarian ‘Novel10 Clade ABSTRACT AcceptedAurigamonas Article A. dientrani Pseudopirsonia
(Shiratori etal.the 2014); first longifila
The suggeststhat 18SrRNAgenephylogeny withlineage
and eukaryovorous
heterodynamic of the has reve 18S environmentalgene samples rRNAfrom n. gen.n.n. sp.,which , they rotate around andonly whenthey rotate swimming theirlongitudinalaxis ,
(Howe et al. 2011; this study); al.2011; NC7 (Howe et Agitata , Aquavolon dientraniAquavolon
- (Kühn al et specific PCR primers re specific PCR primers ’ (NC10) isfrequently’ (NC10) 18S detectedby rRNA gene ; Bass; andal. 2009b);ofet NC8 ispart Vampyrellida (Basset
biflagellate protists, biflagellate protists,
flagella, whose kinetosomes lie at a right angle to eachto lierightangle a flagella,whose kinetosomes at tremulids .
2004),
represent the morphologicallyrepresent first characterized member of NC4memberof be wasshown to
fibril. , Cercozoa, ,
a wide range of environmentala wideof DNA range Auranticordis
and uncharacterized 'Noveland 12', uncharacterized Clade Unlikeclosestknown their relative Lecythium Metopion veals Aquavolon
nisms from soilsnisms from andfreshwater
that Tremula, includes Pansomonadida tified bycelltified isolationorculturing
(Chantangsi and al.2008), et , Aquavolonidaa forms
Aquavolonida Metromonas and and
slightly metabolic cells hoantrani Diaphoropodon 18S rRNA, separatefrom , and,
n. gen. n. sp.,gen.n. n.
consists of consists Trachyrhizium - aled alarge Smith ana al. et
(Dumack - a
This article isThis article by protected copyright. All rightsreserved. l Aquavolon and transmission microscopyas two new electron (TEM) genuswithin species thenew wetland Vietnambelongshowedto in NC10.described them These were to light using analysis of18S agene flagellates reser rRNAsequencesof isolated from samples, aswell asfluorescent insituhybridizationphylogenetic Further, (FISH). clade this In Tierra del Fuego. lineagesshown be are to Simonal. (2015) and(2017), et Yietal. and (2013) (except again PCC4AU2004), (except NC12),allwhich to the of Lepère cercozoansequences belongs inFig.4 of al. (2008) et al. 2013),‘NovelBerney in et etI’ (2007,2008)(except Lefèvre clade PCC4A al. A50in al. et (2005), inLefrancet Richards (2005)(notA51,which vampyrellid; isa Keyinformationprovenance. these examplesLG21 abouttheirof are: the onsetat this inGenBankof wit we cloneswork, environmental identified Antarctic Supplementary tosubtropicalTablefrom lakes. all alistof S1provides NC10 samples, being inplanktonic exclusively detected andalmostfreshwater veryfrequently remainedItishowever remarkable far uncharacterized. Likewise,NC10 hasso unaffiliated, some supported cladesplus single original suggeststhe whichstrongly correspond NC12 may twoseparate, sometimes to relatedlargerdiversityof environmentalsequences has originallyBass al. basissequencesanalysedin et onthe 2009a.Sincethena defined of lacking, despiteits frequency diversityinawide environments. NC12 and rangeof was inform and relatives sediments soil. inhabitsfreshwater Cellular Tremula branching al. 2016;et of the root recent On 2009a;the basisof al.2011). phylogenomicanalyses Howeet placingthe core Cercozoa(previouslyfrom both appear Filosa) an distinct exact positionwithintypicallyphylogenetic Rhizariaremains unresolved, butthey These11, and12. lineages grouptogetherwithTheirsupport. sometimes moderate NCsal. mosFurther weredefinedin et(2009a),the Bass amoeba including flagellate the (2004) ismo phylogenetic methods have ‘Basal alsoshownthat &Cavalier GroupT’inBass availabilityfiloseand data a classof amoebae.More improvedGranofilosea, al. Leander andBasset 2010a), (2009a)showedNC5 that isasubcladeof with althoughuncharacterized, phylogenetically NC2groups Accepted in study,morphologicalineages onour isolates, this uncovered observations andthe Article - specific PCR primers tosoil, PCRscreen and freshwater, primers DNAspecific marine environmental study Cercomonas Penardeugenia longifila rhizarian . In In 18Sthe lightof rRNA. NC10shared byall gene sequence signatures rhizarian Krabberødal. 2017) et
re morphologically and phylogenetically diverse thanthatlabelre morphologically phylogenetically diverse and suggests, we investigateddiversity environmental ando the ecology , a biflagellate gliding cell (ATCC 50530), whicha biflagellate (ATCCalong, cell gliding 50530), withits direct
lineages. NC11 was shown by Howe et al. (2011)Howeet contain by NC11wasshown to lineages. radiation between Cercozoa (Filosa) andEndomyxa+Retaria Cercozoa(Filosa) between radiation (Sierra
and PCC4AU2004), theclade’and freshwater ‘Cercozoa PCC4AU2004), Taib al. in et Discomonas
(Dumack etal. 2017b). well but variably represented in peatbogs inArgentinian in well butvariably represented , this group may therefore, thisgroupmay
(Chantangsi 2010b)andthetestate &Leander the OTUs identified asbelonging NC10in to in al( Laraet -
sequence lineages. sequence
been revealed,analysis of t relevanthere beingt NCs10, 2015 Clautriavia form onethe of deepest d Endomyxa al. et (Bass ) ation NC12isstill for ,
in which NC10
- f NC10f byusing 01 andLG01
(Ch voir and h antangsi & antangsi - for Smith U2004,
- 12 This article isThis article by protected copyright. All rightsreserved. Accepted Petriwere from dishes picked washed and in Co strainsIsolationprotist of in and aligned FinchTV(http://www.geospiza.com/finchtv/) in(Hall BioEdit 1999). primers usingthesame onanABI sequenced Positive PCRproducts ACGACGGCC AGT cloned TOPO into 72°Cat the min. ampliconsfinal for the appropriate Purified of extension. length were 30 sec.(nested PCR)of at 95°C,3072°C,at 65°C,at sec.and2min. followed5 by 95°C,typicallyat 2 min. PCR) consistingfollowed of30 cycles by (first or25cycles PCR doneinvolume25μl amplificationsof were atotal withanamplificationprofile positionthese prim of V4fprimers PCRprimersV4fapproach: first with verify thei to correspondingPCR primers the NC10 to s1259Fwithprimers and sB2n,semi clone wasachievedtwo a libraries using C5fnested PCRwithprimers V8fprimers PCRstrategies). Strategy first withI: primers C7f PCR(seeof distinctsets primers Results fortherationaleo andspecificity basedonatwo DNAenvironmental both screening, ArticleTwostrategies withdistinctlevels PCR specificity NC10 usedfor ofto were 201 usedstudies inother(Bass &Cavalier Soilfor (MPBiomedicalsMarine LLC, DNAUK). environmental previously extractions CTAB/phenol biofilms newlyformed onceramictiles placedintheRiverLambourn,UKbyastandard using Qiagen&Tissue the DNAKit Blood (Qiagen, from Germany), Extraction Hilden, al. (2016)the were for presentstudy.DNAext alsoused was sizeriverμm fractions), biofilms,and werethestudy Grossman usedfor of soilset that DNA filteredμmand2 the from District from (<2 samples English lakewater Lake Environmental DNANC10 and screening clon andMaterials Methods nov. ord. Aquavolonida, other ofwe NC10 likelyhabitatthe phenotype members, formally and rename group lp 3 - ; Hartikainen et al. 2014; Logares et al. Hartikainen also 2014;Logareset 2014); al. were et 16, Kat - - r strict specificitystrict a subsetofNC10r tofollowing usingthe semi NC10C6r and II:firstNC10EndoR1.Strategy PCR andV2f withprimers - 1, and1, Colp - chloroform extractionand fromchloroform soils method, usi - TAM13for vectorsand usingprimers screened (5' - ers. 3') and M13rev (5' 3') andM13rev
wereprotocol cleaneda polyethylene (PEG) usingglycol and
-
11 were isolated11 were - NC10. Supplementary TableNC10.the sequence S2provides Supplementary and - NC andV8r - - nested PCR with primers s1259Fnested PCRprimers EndoR1. with and NC10and C7r - Smith 2004; Bass et al. 2009a,Smith 2004;Basset Berneyb; al. et - - - CACAAA AGG CAGCTA CCA TGA step,semi specific FISHspecific used probeswedesigned were - NC.Construction ofEndomyxa as single byaglass micropipette as cells a - e librarysequencing 377 sequencer. Sequences edited were series of 20μm series of - NC10and with sB2n,nestedPCR - - -
nested PCRPCR first approach: step, nestedPCRusing approach NC10, semi racted from filteredracted water used screening. for ng theFastDNA SPINKit droplets - nested PCRwith
- CGT TGTAAA - NC andC9r
of Pratt’s Pratt’s of - - f thesef PCR enriched nested PCRnested - 3').
.
- Cells 20 - NC,
This article isThis article by protected copyright. All rightsreserved. AcceptedisolateColp general eukaryotic isolatesThe rRNA sequence of fullColp 18S gene Full& phylogenetic analyses 18SrRNAgene sequencing microscope. ultramicrotome. TEMobservations weredone mixtureof 50, 70,and20minutes(30, 96,100%; Finally, ineachstep). cells embedded were ina 1°C (pH at30 buffer 7.2) for andOsO glutaraldehyde 2% For transmissionfixed cells electronmicroscopy(TEM), were centrifuged, in 0.6% a DICcontrastobjectivethe videocamcorderCanon (40x)and H1s. XL and Colp AVTMC analog camera HORN video waterequipped aDICandphasecontrast immersion with objectives(63x)and the Light of microscopy observations passaging. No.oneextraction (Cat. MC85200). year kit continuousAlldied after of threecultures Genomictemperature). DNAfresh extracted from cells was DNA theEpicentre using the prey of and bycentrifugation collected (1 culturesgrown in laboratory wereharvested following abundance eating peak after most using bacterium the chrysophyte ArticleAll onthe strains werepropagated microscopyCulturing and by Vietnam CátTiênissued of administration permits bythe National Field HI9828under meter instruments). studiesconducted inVietnam (Hanna were characteristics Hydrochemistry were4.36 ppm). measured using multiparameter the May nearBauProvince,Vietnam. Tranglake,BìnhThuận S.R. pond within surroundedpine trees 108.426602E) white by(11.066331N, sand dunes Clone Colp collected May on 107.365586E),(11.509471N, ĐắcDong LuaVillage, NaiProvince,S.R.Vietnam a sample c from water 8.42, 108.183158E)(11.122526N, onMay2013 10th (WaterTemp. collected 33.08°C,pH f detritus medium 9th conductivity .
2013 Temp.36.72°C,pH6.17, (Water romSuoiviet.), Bình Da Reservoir(HồSuốiThuậnVietnam Province,S.R. Đá, - Clone Colp 11 araldite
- - - 11 wasisolated a from w Russian Tropical Centre, Coastal Branch(NhaTrang,Vietnam).Russian Tropical Centre,
11 was obtained with general eukaryotic primers PF111 wasobtained primersandFAD4 general eukaryotic with Spumella
wereusing by made 15
96 µS/cm, TDS96 µS/cm, Clone 48ppm,DO6.30ppm). Kat
and and primers 18SFUprimers and of 18SRUal. 2016),while that (Tikhonenkov et th Pseudomonas - 16 wasisolateda from near
2012 (Water Temp. 27.5°C,Temp. 1.4ppm).TDS2012 DO pH5.77, (Water 36ppm, aontaining material decayingplant from wetland nearfarmland sp. strainOF epon
-
4 (Luft 1961). Ultrathin 1961). (Luft sectionswereobtained 60 min,and inanalcohol series and dehydrated acetone
(final concentration) prepared using a 0.1 M cacodylateM (finala 0.1 prepared using concentration) Colp a bodonid
fluorescens Zeiss AxioPlan2 Imaging mic - 40 (both f ater sample with detritusater bottom inasmall boggy - - 1009/S.Light microscopy of observations 16
were
Parabodo 0000 x reshwater) grown inmediumreshwater) Pratt’s by by
co as food (Tikhonenkov et al. as food (TikhonenkovCells et2014). made by using
- using the JEM using the shore water sample shore water withbottom nductivity - 16 and Kat 16
g
for 10 minutes, room for caudatus Park, Vietnam,andauthorized
Sample 30 µS/cm,TDS DO 15ppm, - 1 wasamplifiedusing a
- strain BAS
1011electron (Japan) roscope equipped with with equipped roscope Zeiss AxioScope A.1
was collected on - 1 wasisolated
using a - 1 or the 1 or
Kat
LKB - 1
This article isThis article by protected copyright. All rightsreserved. eachof batch ACCAGACTTGCCCTCC NC10 designed: overnight.Two totheplanktonicprobes specific were oligonucleotide NC10 of clade (HRP) ofhorseradish and10%blockingreagent) containing 2 μl dodecyl sulfate peroxidase Tris deionized 0.9MNaCl,(35% formamide, 20 mM wascarriedoutbycoveringHybridization pieces filter with20 μl of Tris EDTA,20mM 3% H fil the peroxidases minimize endogenous equilibrated in50µl PBSand0.3% being Priorto processed. pore0.6 μm ml samplesantibody werefixed200 withformaldehydefilteredthrough staining. and TSA for NC10were beenfrequently detectedbyPCR had prepared Newly f collected TSA wasconstructedfromthe remainingtree sample. burn 1,000were every Th sampled generations. correction substitutionapplieda four aGTR matrix, included cold withmillionone generations each MC Two separate Stamatakis 2014 analyses performed wi were performed on theCIPRES al. Gateway (Miller Science et 2010).Maximumlikelihood 2013) toomitambiguously andmasked Phylogenetic positions. were aligned analyses Endomyxa wereg the knownCercozoa of previouslypublished diversity and sequences representative Sequenceincluding newclonedandisolate alignments our numbers study this generated in (5' TGG using anEndomyxa thecorrespondingsamples) wasamplified from DNAextractionandsequenced soil the (one ofNC10identified inEndomyxa phylotypes halfdideoxyThe first oft sequencing. al. 2014).(Tikhonenkov etProductswere then clonedandSanger sequencedby
Accepted Article-
CCT CTAAGAAGTCATTCT CCA ACG - - - FISH and flagellar stainingand FISH flagellar in (trees sampled before the inbefore the andconsensuslikelihoodreached stationarity) (treessampleda plots 2 3') and a phylotype - - O C6 (5’ C6 labeled probe (stock at 50 ng/μl)labeled at a probe(stock and a humidchamber incubating in 2 . The filters were washed 3 times . Thewere 3times filterswith washed fresh NaCl, wash (0.9M buffer 5mM MG760572,MG818163 NC10 and - - size polycarbonate filters. Thefilsize filters. polycarbonate CTCCACTTCTTGGGTGCC hybridisations
the covarion model. All parameters were the covarionmodel.All fromthe Trees estimated data. parameters - ) and v3.2.5) Bayesian(Ronquist analysesusingMrBayes al. et V4 (5’ V4 reshwater plankton samp 3 - enerated usingenerated 7 MAFFT v. (e
HCl 7.5),0.01%sodiumdodecylsulfate). (pH runs werecarried starting 5 withrandomlygenerated trees out for - biased forward primer sA4 primer biased forward
- were inNCBI deposited the under GenBank database GTATTCACAGCAATAAGCCTGCTT - - specific reverse primer inspecific hypervariable primer V7r reverse regionV7, hybridisation 3’) (Amann et al.1990 3’) (Amann et . To testfor any . by endogenousfalse positives caused th the program RaxMLthe program th v
-
triton MG818165,and he 18Senvironmental of rRNA gene cloneWsoil
and heatedchains.The three evolutionarymodel the filters werethe filterssliced and small wedges into
in ters were10 incubatedfor mins with10µl of - les from from les 3’). e first 1.25 Me first 1.25 generations werediscarded as humid ters were stored at −80 °C at weredark until stored ters inthe - 3'). The3'). 18Sgenesequences rRNA The (5’ probeEUK516 - en2 (5' - )
ins
- waspositive usedasa control for chamber for 1hour 40°C.Thento chamber at category autocorrelated gamma the EnglishDistrict Lake - -
MG818 HCl 7.5),0.01%sodium (pH - i algorithm) (Katoh andStandley enriched clone libraries from soil librariesenriched clone from 8
- (Stamatakis (Stamatakis CWG TGA CWG AAC TGCRGA - 835 derived sequencesderived and - 3’) and more specific3’) andmore -
MG818856. MG818856.
hybridization buffer buffer hybridization et al 2008;et - FISH and flagella -
in which t 40°C
accession -
nc14 2012). This article isThis article by protected copyright. All rightsreserved. were diversity invariousenvironmentsendomyxan that conductedatthe NHMas part To addressthis issue, we resultsgeneralpreliminary the relied of on ofsurveys if any. sequencesthat Icouldstrategy highpreviouslyknown, aspecificity haveso to ‘core’ Aquavolonida biofilmsandriver However, (Table inassociationwith the 1). PCR used primers in PCR plankton sampl although exclusively couldbeidentifiedAquavolonida habitats, not infreshwater only in toa Applying that I rangeofterrestrial PCRand marine samples strategy showed available at the NC10 i.e. Aquavolonida, diversityof waspublicly that environmental clones Table Supplementary First, targeting S2). PCRwe primers designed ‘core’ DNAenvironmental PCR using extractions two different strategies (Table and 1 outWe set toexplore diversityAquavolonidaandof the ecology DiversityandAquavolonida NC10) habitat rangeof(= Results coverslips 5 for minutes.Theyw were4°C. Thefilters washed inPBS 5times and0.3% ( withtimes PBS a 1:200 withhoursblockingSamples washed solutionand3at4°C. were for 5 incubated monocolonal with4% BSA 10 minutes.for Samples wererinsedin(1x in PBSandincubated blockingsolution Immediately afterthe TSA in dark). the buffer fresh everyreplacingwith werefilters thenin washed pre Theadded 30minutesroomeachand for temperaturedark. toat filterincubated inthe instructions (Perkinas perkit E 150.05% Tween room temperature. minutes 20)for at TSAmade up Fluorescein was 42°C.Filtersat were equilibrated(0.1MTris TNTbuffer in After stringenthybridization conditions. hybridisations peroxidases.remove formamide concentration The wasalsoin test reduced wit 2)incubationfilters of weredetected), fluorescence controlperoxidasesfurther aprobe(no procedures undertaken:1) without were Acceptedabcam Article hybridisation
) was) andsamplewas dilutedinblocking1 solution incubatedfor hourat 1:400
sealed,
the onset of this studythe onsetofthis (PCRTable strategyI;seeSupplementary S1).
, 0.3% Triton0.02%, X, sodium azide)14°C. hourat for Primaryantibody, anti
to determine whether the patchydetermineto the whether specificprobesignal wasbytoo caused es: we ines: alsodetectedAquavolonida freshwatersediments phylotypes they moremayof allow divergentAquavolonida notdetection nd 0.3% nd 0.3% - acylated tubulin antibodywasacylated mouse (Sigma) producedindiluted
and examinedunderaNikonand microscope. A1confocal filters hadfilters t ere then mounted with Vectasheld containing DAPI and the ere thenmounted Vectasheldcontaining DAPIthe with and triton - FISH hree five -
lmer) and50µl fluorophore was of workingsolution lmer) warmed TNT andincubated 15mins 55°C buffer at for X.Secondary antibody protocol 5The minutes. were filters removed andairdried(still
- minute (asbefore) buffer wash stepswith
the filters werethe filters fixed in 4%
h 3% hydrogen peroxide to h 3%hydrogenperoxide goatanti triton - HCl (pH 7.5), 0.15M7.5), NaCl,HCl (pH
X on slidesanddried air
- by screeningby mouse formaldyde igG
TRITC lineages,
in PBS
This article isThis article by protected copyright. All rightsreserved. r only allSouthernlineage Vietnam to belong Colp The novel three isolates Morphology ofthenovel isol designany lineage wereusedto detect theprimers. those that inaddition to IItargetsdiversitystrategy of a much organismsstrategy broader than PCRI, it didnot clone Wsoil (Aquavolonida NC10 the newspecies,beformally describedto The elsewhere. earliestbranching lineage isolated aglid strain, sequencebiofilm.Thedivergentriver single, inAquavolonida NC10 freshwatersediments,this paper(seewasdetectedinsoils,and Thislineage below). NC10 contrastwere by D) that identified not planktonic samples.Aquavolonida infreshwater Aquavolonida,Belowthreewe ‘core’ agradeofearlier identified howev Noandclone libraries.morphological our them; isavailable information anyof for diversedistinctsubgroups AitoAiii;themost bothamong Aiis GenBank sequences NC10Aquavolonida andbiofilm,form thebulk river diversity ofAquavolonida andhere are freshwater planktonicclonedsamples, andafew freshwater sequencesfrom sediments previouslyGenBank,all cloned identified sequencesfrom our sequences using diversityof Aquavolonida 18SPCR rRNAstrategyII, gene with identified phylotypes I(Tablewith ofPCR Figureshowstree the strategy 1). 1 aBayesianphylogenetic diversity of Aquavolonida, andappliedto the primers these samehabi We PCR I. strategy usedAll primers ‘core’wouldbe missedbythe relativesin ofthese toAquavolonida of some themAquavolonida, highly withsequencessimi also (morphologically describedshowed to ‘core’ them below) berelatedto flagellatesreservoir sequencesof a isolatedand wetlandinVietnam from DNA parallel, In extraction. prelim toprimer obtainitsfullreverse 18SrRNAsequence fromthe gene corresponding soil specific affinities ‘core’WedesignedaWsoil phylogenetic to Aquavolonida. nove twoverydistinct,Vampyrellida) samples, weidentified(at Table clonesoilsgeneratedSupplementary In from libraries S2). withthese primers diversityof core Cerc (using abroadCercozoa Endomyxa12 designedexplore widely10to possiblediversityof to as as andNCs the a researcof Acceptedange. We create the new genus Article Aquavolonida - tremulids B comprises B comprises er
Ai is thesubgrouptargetedFISH probes(seebelow). Ai byour ), h project on Endomyxa (data not shown).This on was h project Endomyxanot screeningeffort (data
and was so
and NC12 as outgroups. ‘Core’ Aquavolonida, which compris ‘Core’ Aquavolonida, NC12asoutgroups. which and
lineage for which we have data on bothcell which data lineage for wehave morphologyhabitatand most of ourmostspeciesof in twonew isolateddescribed andthe strains, therefore - ing flagellate with a similar gross morphology gross anding flagellate to withasimilar feedingmode A. The NC10 A. - ozoausing (Filosa) ‘anti D) is composed entirely of environmental of sequencesD) iscomposed entirely (including -
specific forward primer), whilespecific primer), excludingthe overwhelming forward far exclusivelyfar insoil detected Even samples. PCR though low ates
-
designed PCR strategy IItodesignedstrategy morebroadly the target PCR 16, Kat frequencyother to compared soil
Aquavolon inaryphylogenetic thefull analysis18SrRNA of gene - A radiation is subdividedA radiation phylogenetically intothree l phylotypes (clones l phylotypes(clones - 1, and1, Colp Aquavolonida
(see the Taxonomic Summary below) Taxonomic (see the Summary to - Filosa’primers reverse (see - 11 from freshwater biotopes of 11 from
NC10 lar to clone to lar Dsoil - B. At present this isthe present this B. At
and Wsoil)thatand showed endomyxans - branching lineages (B branching lineages - Dsoil C isanother
tat types tested tested types tat labelled .
-
specific
es all like
lineage - This article isThis article by protected copyright. All rightsreserved. Acceptedconsistsof 3C (Fig.microtubules The 1begins microtubular band the plasmamembrane3D, F (Fig. plasma (Fig.3C membrane 3D Kinetosome 1(basalbody of one fibril(Fig.3A) bodies lie subapicallyflagella typical insert with axonemes(9+2) iscoveredThea plasma cell onlywith surface Ultrastructure not seenintheculture. (Fig. 2 becomewider vacuole a isformed cells.nevercaptured all available prey the absence eukaryotic of However, prey. A. of flagellumThepart the doeswrap aroundtheanterior anterior body. not rapidly Petri rare usually nearthebottomof swimdishesvery and located subapically. the cell theapart from level celldepression,directs backwardandtrails the lateral at behind of the celltimes lies alon length, Articleandforward atcell Theposteriorflagellummovements directsswimming. isabout2 anterior flagellumis1.5 Two long lateral ofthecell point body(Fig rostrum. Aremarkable anterior roundish. middle inthe No lateraldepression issituated anterior endo wide. The Cells areelongated microscopyLight hoantraniAquavolon Aquavolon undistinguishable sp. (typeThen. twoare morphologicallythe genus).other speciesisolates of in it samples. IsolateColp lineageaccommodate this in detected soils,freshwater sediments,biofilm andriver hoantrani ). s 18S rRNA gene sequence and is here describeds 18SrRNAand sequenceas ishere gene The d
(Fig. 2B heterodynamic approximately at a right ata leastapproximately andconnected angle eachother are byat to istal 5 dient
- is apre 7
microtubules3D (Fig. end eachto 9transition of fibers isconnectedwith kinetosome the - rani D)
. and haveidenticalKat 18SrRNAgenesequences;and
. A2A . (Fig.shown) contractile vacuoleandnucleus (not Two microtubuleswith central contactthe - t theposteriorendcell of
oval, slightly metabolic,7 slightlynot flattened, oval, dator, feeding on other flagellatesdator, feedingonother (e.g. Thecontains cytoplasm light n. sp. and Colp sp. n.
F n. gen. n. , - G 16 is distinct fromthe 16 isdistinct isolatesother two morphologically bothand ).
- , 2 times longer2 times makes cellweakwaving its bodylength, f the cellwiderf isusuallyposterioroneandbothare thanthe Division
H). fla - gella originate near the anteriorgellaoriginate the (Fig cellend near F) The microtubular band2 n.(Fig. 2A sp. posterior g the cell body at the anterior part ofthe anterior cellat theg the part stands body cell and .
. Somemicrotubules
from the from
was not observed. Reproduction or resting cystswasobserved.Reproductionwereor resting not 2A , G - - 11 ,G, ). D
). Pseudopodia were not observed. Pseudopodia not ). were flagellum) longµm) isvery (more1 than (Fig. The cell possesses Cannibalism was not observed. A largenot observed. Cannibalism food was I is ). Thethis band aresurrounded microtubules of
kinetosomeand 1 contains regarded asaco A. - G) (cloneG) Colp - hoantrani body feeding the following andcells
membrane - refracting granules (Fig. 2 (Fig. refracting granules
( mr
starts fromkinetosomestarts a 2
(Fig. 3A (Fig. did t ) Aquavolon Aquavolon . extend - two actively andnot feedvery Two sm - 16) - bodonids specific isolate. 10 μmlong and3.5
axosome
- wide D)
from ly .
ooth The basal flagella
glide on microtubular bands. microtubularbands. hoantrani ) and) up to 14 up to - 1 isdescribed as t
he (Fig. 3C). heterodynamic .
2
kinetosome to
E perished ,
C F ). The ). the ) are ) , D
n. gen.n. – ). Cells). surface 5 μm nd - in 3
. This article isThis article by protected copyright. All rightsreserved. BothAquavolonidafilters. many cellsonthesame probe illuminated infrequently seenonallexamined.In contrast,the filters broadlytargetedeukaryotic NC10 were determine usedto morphology the ‘core’the planktonic (lineage of Aquavolonida 18STablebetween andV6 ofthe rRNAthe conservedregion (Supplementary V5 2) Two TSA TSA seenwereculture. inthe not absenceeukaryotic prey. of Like previous the species, pseudopodia2N posteriorly (Fig. Sometimes1). after contactwith thesubstrate,short, the relatively canform cells wide (Supplementa gliding axes, substrate aroundonly rarely onthe their granulesrefracting cytoplasm. observedinthe were Cellswithrotation usuallyswim the anteriorA contractiletoend2H vacuolenucleussituatedclose (Fig. and level depression behi andtrails lateral of flagellumis 2 Sometimes 2 flagellumof species reach8.5 in other and the wi dientrani bodyplan,The morphology, andin sameas general feeding arethe Aquavolon reservedcytoplasmof inthe substancewerefound bodies of likelyTheseE). structures organelles, representextrusivewhich resemble dark spherical osmiophilic prey longitudinalfor The andcytopharynxor groove cytostome 4D). food vacuole(Fig. caudatus engulfed preyondifferent eukaryote stages digesting. The of by small 4 (Fig.3A, observed havetubular to cristae of The3A).the (Fig. narrowed endofGolgidirects to kinetosomes nucleus apparatus A nucleus been established. by darkamorphous material. G th
Accepted Articletypical - L - wider ), makesfast flapping very movement FISH of freshwaterof samplesFISH planktonic
- Ai; Fig. 1). Cells specific Fig.1). greenfluorophoreAi; showing the p of the
v
- is also characterized by alsois characterized structure nucleusSeveral islocated the (Fig.3D). near mitochondria were some cercomonads and some cercomonadsand (see FISH probesdesignedspecificFISH in varia target to motifsthe esicules withnucleolus anterior endandlateraldepression (Fig.2 dientrani anterior flagellumthe of cell.wraps aroundanteriorpart the The posterior A. - 2.5 times cell longer the body,also than standsapartfrom the cell atthe
flat dientrani
, mitochondrial
lies close to the closeto nucleuslies (Fig.3 n. sp. (Fig. sp. 2H n.
A
is very short, abouttheshort, is verycell halfof slightly (Fig. or longer length
. is situated close to the kinetosomis situatedclose the to - hoantrani A. stainedare granules Division
The details of dientrani cristae , elongated O - Pseudosporida ( - 11 μm. In with11 μm. contrast P) (clonesKat
), or produce), or asingle‘tail’(Fig.2 pseudopodium
phagocytoses the cells of eukaryotic prey intact. intact. thecellsofeukaryoticprey phagocytoses wasobserved.Reproductionor resting not cysts
captures o
and putative nd the cell. the nd s at swimming invisible.s atandoften A, arrangement -
oval,slightly metabolic, notflattenedcells B). TheB). co embedded vesicles4B, insidethe (Fig. ther fl - G 1 andColp
Incertae Incertae (Fig. 4F).
, 4C). Food4C). vacuoles, the contain H, ki agellates and inthe perishes netoplast I ). Cells than areslightly larger
ntractile vacuole of microtubularof havenot bands A. hoantrani es (Fig. 3A,C, D, sedis
- remnants of 11) engulf Small areabsent. ) are visible) insidethe )
. Spherical. granules - ry materials,ry Video ble region V4andinble region A. specific probes robe werevery , the anterior , hoantrani ,
surrounded Parabodo muciferous muciferous , N G ). Light). , 4A)., . A. P
- ). This article isThis article by protected copyright. All rightsreserved. AcceptedEndomyxato relationship Cercozoa (= than core inthecladeis also NC10,NC12 comprising a closer found Tremulida, and supporting allPhytomyxea, Vampyrellida, Endomyxa(e.g. clades unique from substitution A of substitution substitution and clonesMPE2 environmental Theand alllackcladeNC10, CCW46) of thesesignatures. NC12,Tremulida, consisting groups( lineages.Closely related lineages,combinatibut their C5fprimer a non C9rprimer from A substitution C(U) They consist weprimers designed PCR (see for strategyTable II Supplementary Table 1and S2). below followingin thehelixnumbering (environment NC10 Aquavolonida), main asdefinedi.e.comprisingfour Aquavolonida here, lineagesNC10 Sequ EndomyxaBass al.2009a). andFilosawith et areconsistentprevious (e.g. studies but isclearlydistincttherest Filosa).Relationships fromofCercozoa(= within & Ep Nakaiand al.2012) anoxygen et Articlepillarsmoss sequence in freshwater from anAntarctic lake(cloneMPE2 lineages aforms clade withTremulida,the twomain lineages and NC12, comprising twosingle analysiswhichBayesian in phylogenetic stronglyNC10 a(Aquavolonida supported the phylogeneticreassessed Aquavolonida of position Figure within Rhizaria.shows 6 a full Using thenew ImprovedAquavolonida phylogenyof the hybridization stringency. two independent and probes tested formamideconcentrations arange of moderating presenceby the across peroxidases.patchysignalwasconsistent Further, of thethe probe;these neither that patchysignalwas ofsuggested limited andtestedin byhydrogenperoxidefor control treatment, a this were in for tested Endogenous(see Methods).various ways were peroxidases cases localizedhalfdistinctof theareas intheposterior to cell (Fig. Unusually to (andincontrast the pan morphologicaland typesizerange withingiven thetwo the for same the independentlysignal, generated i.e. flagellated cellsth of - stein, 2003). Thistostein, 2003).issister wholeEndomyxa,albeit without clade strongsupport, ence signatures in the 18S the signatures rRNAence in gene G(A) - binding part of part binding
- - in heli NC). NC)
of A of
al lineagesofarexclusively in are soils).Thesesignatures found of , andspeci , a two - - Someof thesesignatures can befoundin part other eukaryotic x U to U U to C -
11 (variable region V2, primer V2f 11 (variable V2,primer region length 18S rRNAlength geneinthisstudy, we generated sequences - T to complementarysubstitutions the ofhelix 3'stem 25(conservedregion between V5, V4and - B (= B (= - - A in helix G T( U
C)
in heli to Ato loop inthe bet Aquavolon
on is uniquely found only in, and uniquely all foundonlyon is sharedby, NC10 in, fic motif oftwo fic motif - G(A)in helix x - -
26
tremulids 45 (variable primerV8r region V8, depleted marine environment (clone CCW46; Stoeck (cloneCCW46; depleted environment marine 29 (variable region V5)and region 29 (variable and issupportedby CCW46 -
eukaryotic control), thewas control), ribosomalprobeinalleukaryotic
ord. nov. ord.
n. gen.), NC10gen.), n. Wuyts et al. et Wuyts 48 (conserved region between V8 and V9, (conservedregion between48 V8and
, NC12, and environmental clones MPE2 clones, NC12,environmental and adjacent
(Table 2) ween 20and21characteristic helices of
Filosa). from U from (
2000 - substitutions - NC)
C (= isolateand C (= Lapot), NC10 clearly support the clearly monophyly support of Filoreta -
A toG ) and ) were , one, complementary
a complementary , Aquavolon - Gromia C and G from a false positivea caused
a complementary (AU instead of YG) in (AU instead of hybridisation e same
5). Possible causes - reflected inthe NC). Finally,a , Ascetosporea) , - A (= ‘core’ A (=
spp., above. spp., - C to detailed
without - 26;
) - - 26 D This article isThis article by protected copyright. All rightsreserved. Accepted twoavailable for phenotypicdata are only Tremula will beformally biflagellates elsewhere) withmorphological affinities described to it containsthat swimming both (newgenus phenotypic thefirsttime By providing for on membersAquavolonida, data of showwe 18S lower of diversity types thanNC10 frequ frequency than NC10 freshwater sediments,biofilm.However, andriver in samples. Thelineage new includingthe genus restricted toD) seems PCRobtained basal strategyIIinTable Themost with we 1). (NC10 detected lineage onlysuggestingthat NC10 otherdetect By contrast,wecouldn't in Aquavolonidalineages planktonic column inthewater (predominantly diverse, widelygenetically andfreshwater very distributed, habitats presentinmost in sa highinplanktonic necessarilyoccur cells density donot positive Therefore, PCRresults. although ourTSA (NC10 ofand that most diversitybelongs to the subclade target planktonicdiversityof 18S from sedimentsthan fromand types) riverbiofilm, samples NC10 freshwater sediments biofilms.Howeand to associated NC10strategies showthat eachhabitat diversityof Aquavolonida andrelative bothPCR range lineage.First, Articleour environmentalTheof results DNA screening al. 2017).et al. 2016;Yi NC10 readily whenfreshwater detect to samples applied ( as eveninlarge inmarineundetected environments, To soilsmembersfreshwater toAquavolonidasediments. date however, of remain many more basalthem phylotypes can be to found inotherterrestrial habitats,from NC10 (lineage Aquavolonida clade terrestrialPCR twocomplementary andmarine habitatsstrategies using distinct with lakesscreening worldwide.environmentalDNAOur of extraction samplessequencesderived planktonic) from (mostly collectedfreshwater invarious onsetofthisstudy,NC10At the al. (Basset 2009a) onlyknownenvironmental was from Discussion BioMarKs ency than NC10 - - specific primers (seeFig.1 primers and revealsthatthese 'core' specific Table1) although - positives more higher generatedsignificantly amuch A only) (anduncovered Ai). Even recently flooded soil/grassland sites produced a high frequency of floodedAi). Evenrecently soil/grassland sitesproducedahighfrequency longifila
(Logares et al. 2014)(Logares et and , the firstdescribedNC11, taxon (HoweAtpresent, from al.2011). et - - A. NC10 D, andinfreshwatersedimentsandbiofilm lower river at soils,
- - A have adapted to a planktonic adaptedtoa (see the A have results lifestyle exclusivelyA arenot but canalsobefoundin planktonic,
and wasdetectedat - A) seem to represent bulkthedi to the A) seemof - B andNC10
as genuinely planktonic protists - Tara A (seeFig.1). (B fourAquavolonida& C)of lineages. Aqua - - D also both seem to compriseto seemamuch D also both Oceans (deal. 2015),which Vargaset Aquavolon volon also provide information about the provide also informationabout relatively - - scale, broadlytargetescale, FISH results indicate that NC10that results indicate FISH
soils
) andgliding (isolateLapot, which ) ver, PCR (targetingver, strategyI ed by our TSAed byour
it wasdetectedlower at
Lara et al 2015;Lara et
(NC10 high frequency in mples, they appear to be to mples, theyappear s from a selection a of s from - B) wasfound insoils, ). versity of theclade,versity
- FISH probes d surveyssuch samples, Grossman Grossman et such - A - This article isThis article by protected copyright. All rightsreserved. include the Eukaryovoryis also relatively in rare and cysts. Aquavolon orientations longitudinalalsoflagella, axes. insertion of They sharesubapical the same Aquavolon flagellates, imbricateans known flagella, Tremula ofthenucleus.posterior part paranuclearwhichwithmicrobody (or body)amorphouscontents, usuallyjoinsthe Cercomonadida,and Glissomonadida, Granof axoneme likely(Howeal. 2011). is intracellular et although byultrastructuralthe proximal studies,the of unconfirmed posterior part T. pronounced mediumnotch(HoweIn al.2011). contrastto et spindleroundedelongated or or Tremula Tremula Phylogenetically, frequencybased ric ondetection representing freshwater habitatsshould informativeabundance, abouttheirtrue which bemore relatively Single attempts. infrequentlyusedinisolation cell This theyhaveagene isperhapsbecause 12 diversity10 to in broadercladehas been the comprising isolated NCs into diversityof cellis interesting andperhapslifestyles.It so little types the thatof large includingandhabitat soils,sediments,wa types membersNC12of that arefoundinabroaderrangeofbothmarineandnon environmental showUnlikeprevious sequencing Tremulida, Aquavolonidaresults and studies. our sequencing surveys, findings willenable m NC10 orAs comprisemoreeukaryovorousleast lesssimilar,probably swimmingflagellates. betweenrelationship NC10 Aquavolon and absentfrom soils,(4)TSA probably diverse, the most later specific of locomotion (1)their morphologicalHowever, the more similarityto distantlyrelated
Acceptedlongifila Article - A sequences are frequently detected in freshwater plankton environmental inplankton frequently detected freshwater A sequencesare metromonads
, up to now to theup within 12 only, identifiedprotistNCs10to
which are simultaneously incontactwith (Howesimultaneously which arethe substratum All al.2011). et is so far unique in Rhizaria with respect to its uniqueto withexceptionallyso far inrespect gliding Rhizaria is onboth long longifila
do not appear to insertdo notappearto closetogether as shown by light2),andstronglyas shownmicroscopy(Fig. (5)the by supportedsister lacks microbodies,mushroom swimsalmost perpetually, but similartotheputative metromonads , narrow posteriorandtheir , cell end, themitochondria but shapeof cristae,
glideonly.their posteriorVery unusually onflagellum for
is similarly a non is similarly a Aquavolon , glissomonads - Aquavolon divergingNC10
Metromonas simplex - A and NC10A and
can be most directly most can be compared morphologically with
- shaped cell and, like and, shaped cell , (3) theinference (3) from sequencingenvironmental that , - amoeboid b , known glissomonad pansomonads members - A are predominantly foundinplanktonic predominantly habitats A are - - FISH resultsconcordantwithmorphology of B, together suggestthat thesetwolineagesB, together at - like bodies granules), (refractile ral requirement for eukaryotic prey,ral requirement which rhizarian h lineageappearsbehigh. diversity,to ilosea ( iflagellate heterotrophic witha protist ore informed interpretationsuch of
and ter column,which ter suggestsawider of
at the the cell;however,anterior endof Aquavolon
both taxa rotatingalong their Katabia , cercomonads, cercomonads, ,
Metopion
flagellates. Otherexample flagellates. Massisteria Aquavolon, gromovi - sorting surveys of sorting Aquavolon, can be distinguished from distinguished from can be fluens
) by the absenceby the ) a of of known phenotype. has
(Karpov etal.2003), thecofiloseans , and , the variably rhizarian Tremula the kinetocysts kinetosome -
flagella of marine culture
, (2) the , s , and, . are
-
This article isThis article by protected copyright. All rightsreserved. within Rhizaria. andTr Aquavolonida of andcomparativebiflagellate. Phylogenomic genomic analyses includingmembers Retaria, Tremulida 18Ssequence rRNA signature a potential lineagethe deepest third at phylogeni confirmedthey are toformclade) particularsignificance. a 18S becomesof rRNA gene the clade phylogenetic Tremulida positionAquavolonida, comprising of on theothe assemblages,major Cercozoa Filosa) (= and oneside, Endomyxa onthe Retaria plus RhizariaRecent analyses showsplittwo basal phylogenomic on abetween focusing 1992). about of angle of zoospores brassicae fr ranges plasmodiophorids different in kinetosomes two between angle the Interestingly, 1984). related Sorospha 1.6 long: very usually also are with similarity 1962) non Bertaud, & paradinids (Hedley gametes relativel apparently (Myl cristae tubular with mitochondria has e.g. protists, anim endoparasites which filopodia Endomyxa, to producing clade sister organisms a as NC12 and (NC11) Our but ( fibersthin short layer( of membrane thanarather membrane complexthinbilayerenvelope outer of andan haptosomes from cells, usually pansomonad Accepted ArticleAurigamonas - Aquavolon flag als aein hlgntc nlss lcs C0 (including NC10 places analysis phylogenetic Bayesian metromona
Plasmodiophora brassicae Plasmodiophora
lae spores ellated and that theancestral (e.g. (e.g. om 150° in 150° om era es placebetweenes itassemblages thesemakes it twomajorRhizaria, which of -
(Barr & Allan, 1982; Miller & Dylewski, 1983; Buczacki & Clay, 1984). 1984). Clay, & Buczacki 1983; Dylewski, & Miller 1982; Allan, & (Barr NC12 c r sider (e.g. Sierraal. 2016; et (Ascetosporea) :
the bodonids Aurigamonas Aurigomonas veronicae Hartikainen et al 2014; Ward et al 2016, 2018) 2016, al et Ward 2014; al et Hartikainen ). Interestingly,). both the pnopr subterranea Spongospora
also possesses
f ad lns srmnpl algae stramenopile plants, land of 180° to each other and a bulging ring at the points of insertion (Merz, insertion of points the at ring bulging a and other each to 180° ds reticulopodial amoeba amoeba reticulopodial biflagellate lade may be sister to Endomyxa besister of the may radiation highly diverse lade +
y and and
emulida are now required to resolve thedeepestemulidarelationships to arenowrequired Polymyxa graminis Polymyxa rare in Endomyxa. in rare ,
(e.g. (e.g. chrysomonads Aurigamonas (Talley et al., 1978). However, 1978). al., et (Talley metrom ), lacking), flagellarhairs, and ina simpleplasma having solis om lglae zoospores. flagellated form
haplosporidians zoospores of zoospores
rhizarian two (Table 2)
, – onads (Vickerman et al. 2005),whichwhole(Vickerman et capture prey
1.8 rhizopodia Aquavolon
wide are appreciably shorter (0.5 μm) (Buczacki & Clay, Clay, & (Buczacki μm) (0.5 shorter appreciably are
in lacking large extrusive organelles (or in organelles(or lacking largeextrusive , or euglenids., μm in in μm ) or axopodia ) rhizarian
phenotype was likelyphenotype was aunicellularheterotrophic we that , hypothesize theAquavolonida
, microtubularbands. Filoreta marina Filoreta
Gromia Krabberødal. 2017 et in 30° to show a lateral insertion of the flagella at an an at flagella the of insertion lateral a show ’ and nikov & nikov Plasmodiophorida, ad reticulopodia and ,
) Polymyxa and .
Aquavolon divergence.
p produce lasmodiophorid Aurigamonas Woronina pythii Woronina Myl
- like appendages ( (e.g. (e.g. Aquavolon ’ nikov betae
Other Other the (Bass et al 2009 al et (Bass s
ehue e a 2014) al et Neuhauser shares some morphological morphological some shares flagellated
On thebasisashared of kinetosomes of kinetosomes 2011 , but ,
nlds many includes (Barr & Allan, 1982) and and 1982) Allan, & (Barr in ). In the In this context, ). ascetosporeans
have long kinetosomes, have differs ultrastructurallydiffers Aquavol which s .
) others and . Many (Phytomyxea) Flagellate
haptopodia dispersal cells or or cells dispersal
and the Plasmodiophora Plasmodiophora on
b are free are
) are ), Tremulida Tremulida ), kinetosomes kinetosomes NC12 (if NC12 (if , which also also which ,
the closely closely the amoeboid amoeboid
cell - produce produce obligate obligate ) - s are are s living The and and and and This article isThis article by protected copyright. All rightsreserved. AcceptedRegistration Zoobank Etymology Eukaryovorous mitochondriaRapidly havetubularcristae. rarel swimmingand Single nucleusthe cellvacuole anteriorly.Several located body. contractile and metabolic,withnot flattened, leastby atone fibril. flagella Diagnosis Aquavolon itscommonrepresent most phenotype. Etymology order.chosen the hencethename locomotion, for morphological and habitats. Lineages Aq within eukaryovorous willof theorder evidence,other members butnotnecessarily likely all bebiflagellated, ofthe ordermembers with a they werewe reversed cannotexclude secondarily lostor in that gen. i.e.in study, consistingat this of to corresponds the MPE2 clonesenvironmental ArticleTremula apply the specified notifanyof followingclause: namedoes withinthe fall clade: the Remarks helixthe 3'stem of (al 25 substitutionsa specificoftwo adjacent(AUinsteadYG)in motif of a non inhelixG(A) one A 11,complementarysubstitution from two complementaryconsistingof s the rhizarian lineages sharing Diagnosis Eukaryota implyto thatallnot intendedareactual lineages swimmers. the genus,describedreflects tendencyofthecladean adaptto to aquatic exclusivelynon ecological (seemingly its phylogeneticof statisticalunifying support, (high signatur sequence Aquavolonida ofWe describetheneworderNC10 includemembers all to onthebasis Taxonomic summary The sequencedefining lineages,are found signaturesfour order inbut the these kinetosomes longifila . ; Rhizaria;Aquavolonidanov. ; Bass ord. andBerney . Defined as the leastinclusiveDefined the containinglastof . the commonancestor as clade . Unicellular . protist Thisnode isa n. gen.n. . Derived. from . From. , unicellular protists andunicellularprotists are , .
Howeand Cavalier aqua Tikhonenkov, Mylnikov,and Bass behavioural rhizarian
The p lieright approximatelyata a angle eachother to
.
= water, = water, Latin,and urn:lsid:zoobank.org:act:635F34CC - l boldin underlined and basedapplya crown definitionintendedto toqualifying clade; Aquavolon osterior kinetosome is osterior
uavolonida are here are uavolonida - clade previouslyreferredtoasNovel Clade 10asidentified more divergent18SrRNA sequence. 26, CCW remarkable depression inthemiddle pointof lateral lateral with twosmooth a
adaptationaquatic lifestylewith toanaswimming
unique combination of unique combination leastwhich lineages, of four one contains ubstitutions from U - , first described and first order, genusinthe , Smith 2011 - - marine) coherence.Thisbased marine) name, on theonly 46, NAMAKO
expected tobe volo subapical
= to fly,Latin.= to
, hypothesised Table2)
very or the or the organismsmatching
-
20, andCCA33.Aquavolonida - long ( A toG 18S rRNA - T to C(T)T to heterodynamic , and, all their descendants restricted terrestrial to
> - - 265E
C and from G C and from 1 μm).
y gliding protist. y gliding protist. to showto gradual a as sequence signatures - - Based onexisting G(A) inhelixG(A) and 48, 4F6C yet unidentified
C nd areconnected es) andes) ell
- - flagella binding part of part binding 88A4 slightly habitat, Aquavolon - C to C(U) C to likely to - .
The
but is .
-
n. n.
This article isThis article by protected copyright. All rightsreserved. AcceptedGene sequence inVietnam. S.R. management sample contributed to significantly andfieldorganization collection trips and Etymology Vietnam. Province, S.R. Type locality Type Figure Reproductionpseudopodium. restinghave or cysts not short, relativelyCells canform produce or widepseudopodia tail posteriorly single stands apartfrom the levelcell cell. atthe lateraldepression behindthe of andtrails is 2 ofthecell.The flagellum anterior part posterior flapping swimming invisible,fast at movements andoften may depression. Diagnosis Aquavolon FE547535EE1F Registration Zoobank MG760572 Gene sequence inVietnam. S.R. management sample contributedto significantly andfieldorganization collection trips and Etymology Đá,viet.), Type locality ArticleType Figure the newspecies hapantotype). (a University Colp Type material Reproductionor resting have cysts been not found in levelcell trails at the lateraldepression,backward behind of directs and thecell. of the length,alongliespart the thecellanteriorapartfrom bodyatand stands and directs anterior flagellumis1.5 than posteriorroundish. wide. oneandbothare μm The Theanteriorendiswider Diagnosis hoantraniAquavolon Type species C0EC7E84E778 - 16, isdepositedMarine Invertebrate Collection, in Museum,BeatyBiodiversity
Bình Thuận Province, S.R. Vietnam.Bình ThuậnProvince,S.R. of Britishof Colu . Elongated. Cells. elongated are . dientrani . NamedDr.. after Hoan Vietnamese Tran, biologist andecologist, who . NamedMr.. after TranVietnamese DucDien, biologi atforward cellflagellum Theposterior 2 is about swimming.
Anteriorflagellum cellis aboutthe halfof length orslightly longer, makes . Figure illustrateslive. 2I a cellof . . Wetland water with waterdecayingplantWetland material,. Village, Đắc Lua DongNai from withdetritus Water freshwater. bottom Suoi Da Reservoir(HồSuối Figure strain alivecell 2Aillustrates of Colp . . Achemically block of fixedresin Aquavolon
. Thegene. 18SrRNA se . Thegene GenBankAccessionNumber . 18SrRNA sequence hasthe n. sp. n.
n. sp. n. - oval 8.5 cells . -
2 times longer2 times makes cellflapping its bodylength, movements urn:lsid:zoobank.org:act:3E585A8A mbia as MI mbia as hoantrani Tikhonenkov, Mylnikov,and Bass Tikhonenk
- oval with lateral depression, 7 depression, oval withlateral
- - . PR210. Thisname constitutesthe
11 μm long11 μm with ov, Mylnikov, and BassMylnikov,andov, quence has the GenBankAccessionNumber quence hasthe A.
-
embedded cells of the typestrain, the embedded cells of dientrani - 2.5 times
wider culture been in found . -
16.
an - .
9459
longer than the celllonger thanthe body,
terior end andlateral - wraps 10 μm long 3.5 10 μm and st and ecologist, who andecologist, st - 4E1F
around the culture - bearing type of bearing - - 3 times cell the 956B .
- – 5 This article isThis article by protected copyright. All rightsreserved. AcceptedCavernomonas Cercomonadida: of classification Snell,Cabral J., Smallbone, Jr,C.&Cavalier J., Howe,Bass,D., Mylnikov,Vickerman,A.T., A.P., K., Chao,E.E. Cercozoa:Grano Wylezich, &Cavalier C. Chao,Bass,D., E.E. Microbiol., Cercozreveals highglobalbiodiversityof remarkably Bass,D. & Cavalier graminis D.J Barr, mixed populationsanalyzing microbial 1990 Ama LITERATURE CITED assistanceMaberly fortheEnglish and providing from District. samples Lake andtheir assistancewithsampling.trip management (Nha ArticleVietnam,as well asthe thesupporteda Schroedingerat NHM. byFellowshiphosted Frenchawarded the Government by viaAgenceNationaledelaRecherche. OCEANOMICS ’Investissementsd’Avenir’by the programme (A funding UniEuk GBMF5257project, / and (grant www.unieuk.org), wasalso supported SocietyProtistologists andtheof and Moore Gordon Betty current Foundation for Grant DB NE/H009426/1 andCB)(to (to grants NE/H000887/1 DB).RFby wassupported SciencesCouncil Engineering ResearchCanada of and (227301) toPJK, FASORussia of assignment no (theme 17 (no. from the grants This by wasBasicRussian workFoundation supported Research for Acknowledgments 377340713E8C Registration Zoobank MG818163 nn, R.I. . We thankHoanDr. Q.Tranand withTran DucDiensample collection helpin for Trang, Vietnam), especially Nguyen Thị Hai Thanh and Tran Thanh Quang, for Trang, Vietnam),especiallyNguyenHaiand Thanhfor ThanhTran Quang, Thị - Combination of16S rRNA in - 04 -
.S. & Allan.S. Aid funding TheNatural to HistoryMuseum. (Plasmodiophoromycetes).
- 54:2393 00899, 17 .
, Binder, B.J.
gen.n. filosea cl. n. andn. filosea cl. Proteomyxidea revised. - , P.M.E , - 2404. 2404.
Smith, T.2004.Phylum Smith, - -
Y., Nikolaev,Y., Yabuki,A., Ishida, S., K. 04 . Protist, - staff of thestaff of Vietnam Smith, T.Smith, 2009b. Phylogenynovelreticulosefilose naked ofand - urn:lsid:zoobank.or , 00565) DTandAPM to Olson, R.J.
. 1982.
160:483 - targeted oligonucleotide probes with flow cytometryoligonucleotide probeswith fortargeted C
Zoospore ultrastructure of ercomonas
Can.J. Bot. , . Appl. Environ.Microbiol., . Chisholm,S.W. . AAAA. - 521. - g:act:C99A3C2D - Russian Tropical Centre, Coastal Branch RussianTropical Centre,
specific environmental DNA analysis , - A18 Eocercomonas -
Smith, T. 2009a. Smith, and in the framework ofthestateand framework in the 60:2496 -
118012690098
oa (Protozoa). We alsothankProf.Stephen CB tothe isgrateful International , Devereux,R. - 2504. Protist, - I., Berney,I., C., Pakzad,U.,
- Polymyxa AF23 , Paracercomonas
NR - Y., EdwardsY., 56
Phylogeny andPhylogeny 160:75 - - - 4A48 : 5) Int. J.Syst.Evol. 11 1919
& , - from the Natural BTBR Stahl, D.A. - - - ACE0 109. 1925 and NERC
SN was - 0008)
. -
, and,
This article isThis article by protected copyright. All rightsreserved. Accepted10.1371/journal.pone.0031165. vampyrellidof revisited. amoebae Sausen,Hess,S., the M. 2012.Sheddingon vampires: N. &Melkonian, light phylogeny oviformis Hedley doi:10.1111/jeu.12474 Testate Amoebae Cercozoa), De Thecofilosea, TestateRedescription the Amoeba of Bonkowski,Dumack, Clauß, K., &Völcker, M., S. amoeba genus 2017b. Siemensma, F.&Bonkowski,Dumack, K., M. Rediscoveryofthetestate and nine species. novel diversityof B. S.C. &Leander, 2010b. Chantangsi, An tothe SSUrDNA barcodingapproach sp. n. a novelphylogenetic positionmarine of sand B. S.C. &Leander, Chantangsi, 10.1186/1471 Auranticordis phylogenya marine of interstitialtetraflagellate withputativeendosymbionts: Article C.,Esson, Chantangsi, H. J.&Leander, B. Science Wincker, P.,&Karsenti, 2015. E.Eukaryoticin plankton the diversity sunlit ocean. Raes,J G.,Gorsky, N., Hingamp,P., Grimsley, Not,F., Ogata, Iudicone,D., H., S., Pesant, Kandels Scalc Jaillon, Horák, A., O., Lima Bittner,J.M., L.,Chaffron,M., Dunthorn, S., Flegontova,Engelen,S., O., Guidi, L., Le BescotC., Henry, N., Audic,S., Decelle,de Vargas,C., J.,Mahé,Logares,R.,Berney, Lara,E., F., development in Buczacki,& ClayS.T. the oceans:predatory cercozoanISME marine amoebaehabitats.7:2387 in J., Berney,C.,S.,F.,Mahé, Romac, Santini,Siano,R., &D. S., Bass, 2013.Vampires in o, E., Siano,R., Vincent,C.,o, Dimier, F., Zingone, Picheral, Searson, A., M., S., Protist ,
., Sieracki,M.E., Speich,Stemmann,., L.,Sunagawa, S., S., Weissenbach, J., - R.H., R.H., 348 Lewis, S.; TaraAcinas,S.; Lewis, OceansBork,Bowler, Coordinators, S.G., P.,C.,
( Sarcodina)
marine interstitial cercozoans, including descriptions of fourmarine interstitialcercozoans,includingofnovelgenera descriptions : , 161:133,
1261605. doi: 10.1126/science.1261605. doi: 1261605. , N.,Probert,, I.,Carmichael, M., Poulain, Romac, J., S., Colin,Aury, S., - quadriverberis & 2180
Penardeugenia Plasmodiophora brassicae Bertaud
with Agglutinated Tests in Tests the Agglutinated with Cercozoa. - 8 . - , C.M , - 123. J. Protozool.J. 47.
, Int. J.Syst. Evol. Microbiol.
W.S. 1962.W.S.
- . 1984.. Mendez, G., Lukeš,Mendez, G., J.,Malviya, S., Morard,R., Mulot, M.,
n. gen.n. sp.et (Cercozoa). Saedeleerand Annotations 1934,
(Thau 2010a. lifeUltrastructure, cycle and molecular
PLoS 7:e31165.doi: One, Someobservations zoospore onsecondary
9 : Electron
matomonadida, Imbricatea). matomonadida, 79 Diaphoropodon archeri - 87 .
. Trans. Br.Trans. Mycol.Soc. S. 2008.Morphologyand molecular
- dwelling cercozoan: - Microscopic of Observations
E. 2017a.Phylogeny and , 60:1962 ,
BMC Microbiol J. Euk.Microbiol.,in press -
(Chlamydophryidae, 1977. on thePolyphyly of Clautriavia
Protist 82: 339
., 8:123. doi:., , in press. - 344. Gromia biflagellata -
99.
This article isThis article by protected copyright. All rightsreserved. Amblard,C.E.,& SimeLefèvre, Roussel, B., Environ. Microbiol., picoeukaryotes: Ngando, T.2007.Unveili E., C.,Lefèvre, Bardot, Noël, Carrias, C., Viscogliosi,J.F., Amblard, E., C. & Sime Plankt. minerotrophic and peatland(Argentina), ombrotrophic delFuego inTierra pools 2015.Mataloni, G. Lara nov. a nanoflagellate Kühn morphological Biol. in Mol. Innovations Rhizaria. Evol.,34:1557 Tabrizi,2017.Single cell mega K. transcriptomics, Krabberød,A.K., Orr, Bråte,R.J.S., J.,Kristensen,Bjørklund, T., & Shalchian K.R. inimprovements performance andusability. Katoh,K. &Standley,D. 2013.MAFFT multip new flagellateaffinitieswith to soil Ekelund,F.,& Moestrup,Karpov,S.A., Ø. 2003. Nature 2011.T.A. Discoverynovelof intermediateredefines forms thefungaltre Jones,M.D.M., Forn,I., Gadhela,Egan, C., Bass,M.J., Massana,&Richards, D., R. diversityand ecologicalpartitioningof &Bass,Stentiford, G.D. D. 2014.Lineage H.,Hartikainen, Ashford,O.S., Berney, C.,B.,S.W., Baker Okamura,Feist, for analysis program Windows 95/98/NT. 1999.Hall, T.A. aBioEdit: user Protist, Cercozoa:new genera identifyNovel deep protists T. 2011. cultured D.,Howe, Bass, A.T., Scoble, Lewis,J., Vickerman, L., Arndt, K., H. &Cav 2269 communitya large analysis:keyfindingsof S.S., M.,Mahamdallie, Gardner, D.Hoffmann, D., Bass, & Boenigk,J. 2016. Grossmann, S.,L., Jensen,M., Heider, D.,Jost, Glücksman,E., H., Hartikainen,
Accepted description of Article , E., , Protist - , S., Medlin, , L.K., 2279. , 474:200,
Res 162:332 , Seppey, ,
.
, 155:143 , 37 Pirsonia -
Pseudopirsonia - evidence a molecular lake. from diversitystudy inadeepmeromictic 372. : 203. 645 , C.V.W., ,
Planktonic mol eukaryote 9:61 -
– 56.
655
& Eller, G.2004 Tremula inferred fromnuclearinferred -
ng fungal zooflagellates as members zooflagellatesoffreshwater ng fungal 71. . , González Garraza
-
, friendly biologica n. gen.andn. Micrometopion Heteromita haplosporidians . Phylogenetic positionthe parasitoid of Nucl. AcidsSymp.Ser., - specific molecularp specific -
scalesampling. molecular Pseudopirsonia mucosa Pseudopirsonia Mol. Biol.Mol. Evol. - ecular diversity: discriminationecular diversity: of - - encoded small subunit ri encoded subunit small le sequence alignment software alignment le version 7: sequence branching environmental DNAbranchingenvironmental clades of
Ngando, T.2008. , G., , (Cercomonadida). , l sequence alignment editor and alignment editor l sequence Katabia Minimassisteria - , Singer phyl
ISME J., ogeny, and the geneticbasisogeny,and of
gromovi , D., , ,
30:772 , Victoria, Quiroga robing revealsnovelrobing -
Thediversity molecular 8:177 1573. , Protistology
nov. gen., nov.nov. gen., sp. 41:95 Nudifila - 780.
(Drebes) comb. - bosomal DNA and
186. ISME J., - 98. life.e of , alier Peregrinia
-
Austin,C., , Protistan
3:30 -
10: Smith, , M., J.
- - - 41. , – . &
a
This article isThis article by protected copyright. All rightsreserved. Accepted (ed. Buczacki,perspective, S. T.),249 pp. can belearned Miller,C.E. WorkshopEnvironments 14 (GCE), Nov.2010,New Orleans,LA,pp 1 inference Proceedingsfor large trees.In ofphylogenetic the of Gateway Computing Pfeiffer, Miller,M.A., T. &Schwartz, 2010. W. Creating CIPRES the Gatewa Science zoospores of U. Merz, 1992. stramenopiles. K, &Pedrós Castresana, Guillou. RomariMassana, R., J.,Balagué,V., L., Groisillier, K, A., Valentin, 409:603 smallUnexpected diversityofeukar P.,F., RodriguezPedrósLópez García, Valera, Rozella E.,Lara, M Biol. divergentradiation and broadly aquatic ofparasites distributed in invertebrates. B.,Stone,D., Ward,Okamura, C., G.M.,D.2014. Wood, &Bass, ArticleH.,Hartikainen, Stentiford,G.D. Curr. eukaryotes. & Massanade Vargas,C. 2014. and Patterns rare R. of abundant marinemicrobial Simon,N., Stoeck,T., Santini,Siano,R., Wincker, P.,Zingone, S., Richards, T.A., A., Not, F.,H.,F., Ogata, Pawlowski,J.,Pernice,M.C.,S., Romac,Shalc Dunthorn,Decelle,J., Dolan, M., J.R., Edvardsen,B., Gobet, A.,Kooistra, W.H.,Mahé, Audic,Logares,R., S.,Bass,D., L.,Bittner, Boutte, C., Claverie,Christen,R., J.M., Environ. Microbiol., the compositionparasitesin thefreshwater small of Lepère,C.,2008. Domaizon,UnexpectedI. &Debroas,D. potential importanceof 5942. eukaryotes inlakes differin M.,Lefranc, Thenot, A., Lepère,C.small& Debroas,D. 2005.Geneticdiversityof plankton. f of reshwater reveals picoeukaryotes putative occurrenceparasitoids of high in the
24:807
- deepestbranching the cladeform fungi. of 607. PLoS One oreira, D. &oreira, Lopez , & , - - 812. Alió,C. 2004.
Spongospora Dylewski, D.P. 1983. Zoosporic plantDylewski,D.P. 1983.Zoosporic pathogensoflowerplants
Appl. Env Observationssecondaryand of onswimmingpatternmorphology from thelikesfrom of
Biol. 24:813 74:294
3 : e2324. doi: 10.1371/journal.pone.0002324.e2324. : doi: iron. Microbiol., 0 g bytheir status. trophic Phylogenetic and ecological analysis of novelPhylogenetic ecologicalof analysis marine and subterranea - 2949. - - García, P.2010.The environmentalclade and LKM11 821. , C., Berney, Feist,S.W.,Longshaw,Bateman, K.S., M., Woronina
yotes indeep .
70:3528 Plant Pathol.Plant ? In: Zoosporic plantIn: pathogensamodern ? - 283. - AcademicLondon. Press, Alió,& Moreira,D. 2001.C., - - 3534. plankton. sea Antarctic Protist, - Appl. Environ.Microbiol.,
eukaryote community. eukaryote
41:490
161:116 - 494. Mikrocytids
- 121. hian - 8.
Nature,
- Tabrizi, K., Tabrizi, Appl. 71:5935
are a – Curr. What
y - This article isThis article by protected copyright. All rightsreserved. A.,Stamatakis, Hoover, P. & Rougemont, J. for the 2008. A rapid algorithm bootstrap a A. 2014.RAxMLStamatakis, phylogeneticVersiontool for post 8:A analysis and 17:3610 occurrence oftypicalsystems. marinelineages freshwater inshallow López Deschamps, Restoux,Simon, P.,Moreira,N., Jardillier,L., D., G., Bertolino,& P. 983. 2016.EvolutionaryJ. Pawlowski, OriginsofRhizarian Parasites. González Sierra,R., Cañas Euk.J. Microbiol. Filose AmoebaRel Thecate Ishida,Shiratori,T. & K. Cercozoa). NewApparatus a Marimonad of Flagellate Yokoyama,Shiratori,T., A. & Ishida,K. Biol. large a choice modelspace. bayesianphylogenetic inferenceandmodel across B.,Larget, Liu, Suchard,M.A.& EfficientL., J.P. 2012.Mrbayes 3.2: Huelsenbeck, Teslenko,Ronquist, F., M.,VanDerMark,P.,Ayres, D.L., Darling,Höhna, A., diverse, distinctivegloballylineages. and dispersed diversityof freshwaterpicoeukaryotesmolecular an from oligotrophiclake reveals Richards, Vepritskiy,T.A., Gouliamova, A.A., D. &Nierzwicki diversity Richards,& Bass,T.A. 2005. free D.Molecular of screening phytomyxidof parasites. Neuhauser, S.,Kirchmair, M.,Bulman,S., &D. Bass, 2014.Cross fatty acid 2012. aquati Microflorae of Koi, Nakamua,Kohara,Y., A., K., Narita,T., &Naganuma,Niki,T. Yanagihara, K., H., Baba,Nakai,Abe,T., R., T.,Imura, marinaFiloreta Myl’nikov Acceptednalysis oflarge phylogenies. Article
61:539 - García, P. 2015.Complexcommunitiesof smallGarcía, protists andexpected - andusing distribution ameta 27. , A. P., & A. P., , - and 16S rRNA geneanalyses. García, L.N., Gile, L.N., G.H.,García, Slamovits, C.H.,Klopp, Restrepo, C., S.,Arzul, & I., Protist, -
542.
Bass et
- 63:722 Duarte, S.J., Burki,F., Schwelm, Dixelius, A., Fogelqvist,J., Duarte, C.,
Myl’nikov 165:808 - Cavalier I. 2016. - BMC Evol. Biol. 731. c moss pillars in a freshwater lake, East Antarctica, lake,East pillarsa freshwater basedc moss in on - ated to a Cercozoan Environmental Clade (Novel Clade 4). a CercozoanCladeto Clade(Novel4). Environmental ated , A. the of , A.2011.Thecellreticulopodial structure amoeba 824.
Bioinformatics -
Trachyrhizium urniformis Smith (Cercozoa). Smith (Cercozoa).
S., - analysis. - Kagoshima, H., Kanda,Kagoshima, H., Kanekiyo,A., H., I. 2014. Phylogeny, Ultr
Polar Biol.Polar 14: Abollifer globosa Abollifer 33.
30:1312
Curr. Op.Microbiol.,
35:425 Inland Biology Water
Environ. Microbiol.,Environ. - 1313. 1313.
n. g., n.sp.,g., a Noveln. Marine - 433.
- sp. nov. (Imbricatea,sp. nov.
living microbial eukaryotes: - Bauer, S.A. 2005 Bauer, astructure, andastructure, Flagellar
Mol. Biol.Mol. Evol - kingdom host shifts
8:240 Environ. Micro
7:1413 , 4 - : 252. 440
S., . The. - . 1425. –
Syst. 33:980 445. - biol.
- This article isThis article by protected copyright. All rightsreserved. Berney,Yi,Z., C., Hartikainen, H., Mahamdallie,Gardner,M., Boenigk,S., Cavalier J., 28:4698 eukaryoticin area V4of pseudoknots small RNA. subunitribosomal 2000. J.,Wuyts, De P., Rijk, free betweenand2018. sequencingfillsEnvironmental gap parasitichaplosporidians the G.M.,Ward, Neuhauser, S., Groben, Ciaghi,Berney, R., Romac,S., C., S.,& Bass,D. invert enigmatican increasinglymarine but clade protistanof important of parasites Berney,S., &Bass, C., D.2016.A eDNAintoparamyxids: newphylogenyand insight W a belonging to soil sp.,a gen., n. Appleton,Vickerman,P.L., Clarke, K., K.J. & D.2005. Moreira, 63:220 Flagellate, UltrastructureMorphology,and SSUNewGene Sequence a Freshwater rRNAof Janouskovec Keeling D.V., Tikhonenkov J., &Mylnikov P.J. 2016.The A.P. 10.1371/j alveolatesof ancestral state and eukaryotes. nov.)nov. andAcavomonidianom.theirreconstructing contributionsto the Acavomonas peruviana &Keeling,2014.Aleoshin,V.V., P.J. Description of Tikhonenkov zoospores of Talley, Miller,&Braselton,M.R., C.E. 10.1371/journal.pone.0058950. diversity.into the freshwaterprotist affiliation SSUby genesgenerated rRNA massively of newinsights parallelsequencing: Mangot,Taib,N., J. 63. oxygenanalyses of Stoeck T,Epstein2003. fromNovel eukaryotic lineages S.small inferred RAxMLweb
AcceptedG.M.,ard, Bennett,Bateman,K., M., Stentiford, G.D., Kerr,R., Feist, S.W., Williams, Article
- livinggiantamoebae. ebrates. Comparative analysis of more thanComparative 3000sequencestwo more revealstheexistence of analysis of - 232. - 4708. ournal.pone.0095467. Neobodo borokensis
, D.V.,, Janouškovec, J.,Mylnikov,A.P., Mikhailov,Simdyanov, K.V., T.G., servers. Sorosphaera veronicae Int. J.Parasitol.
novel clade within the Cercozoa. novelthe Cercozoa. clade within - dwellingwith predatorunusual organisation helioflagellateand - - depleted marine environments. marineenvironments. depleted F., Domaizon,I., Bronner, Syst. Biol.Syst.
Van de Peer, Y.,Pison,Van Rousseeuw, dePeer, G., R.& De P.Wachter,
n. gen. two n. n.sp., new phyla (Colponemidia alveolate nom. J EukMicrobiol,
46:605
57:758 n. sp. (Kinetoplastea,n. Excavata). PLoS ONE .
- J.P. 1978. 19. Mycologia - 771.
in p in
PLoS ONE
ress. G. & Debroas, D. 2013.G. &Debroas,D. 8:e58950. doi:8:e58950. Protist
Noteson theultrastructure of 70:1241 Colponema vie
Appl. Environ.Microbiol.
156:335
9:e95467. doi:9:e95467. - 1247. - Aurigamonassolis
354. J. Eukaryot. MicrobiolJ. tnamica Nucl
Phylogenetic - eic subunit rRNAsubunit
sp.n. andsp.n.
Acids Re
69:2657
n. - s. -
.
This article isThis article by protected copyright. All rightsreserved. bootstrap ≥95%. and 0.95 blackfilled onnodes; BPP ≥ are indicated circlesindicatevaluesof ML ProbabilitiesBayesian Maximum bootstrapLikelihood Posterior and(ML) values (BPP) NC12, an otherbroad selectionof Filosa), rhizarians,including Cercozoa (= TremulidaNC11), (= including taxa new Figure the green signal.= 10µm. the plane Scalebar of specific TSA freshwaterCumbria, planktonWater, (Derwent UK). NC10 Nucleus blue (DAPI), = Figure 5 (E)µm, 0.2 µm. µm,(B 1 = reservesubstance.Scale (A) mitochondrion, nucleus,rs bar: n= fv food= extrusome, = putative vacuole,kp = kinetoplast mitochondrial = of substance. cr cristae Mitochondria. Contractile C. D. Foodvacuole. F.Reserve vacuole.E.Extrusome. Figure 4 tf =flagellum, Scale transition fibers. D, (A, C,I)1 bar: µm, mt =nucleus,nucleolus,2, mitochondria,mrt microtubules,n = nu=posterior pf microtubular k2=kinetosome =microtubular 1, mb2= kinetosome 2,mb1 band1, fv food contractile = axosome,cv = G vacuole, = ga of thekinetosomes.I.Some arrangement microtubularnucleus. the as bandsnear flagellum. C hoantraniAquavolon Figure 3 pseudopodium,ps =rglight vacuole,vacuole,= food fv ld lateraldepression, =nucleus,pf = n (A Figure 2 text. study 95%.Sequencesbol bootstrap ≥ this are shownin 0.95 andML generatedin bootstrap values nodes;black filled on indicatevalues areindicated BPP circles of ≥ ProbabilitiesBayesian as outgroups.Likelihood Posterior (BPP) andMaximum(ML) including taxa new Figure 1 Figure legends FEMS Ecol., Microbiol. Baikal revealsecologically communitiesandnove differentiated T. &Smith, D.2017. Bass, High throughputmicrobialsequencing of eukaryotes inLake
Accepted Article- G) and
6 . Bayesian. Aquavolonida of rRNAphylogeny diversity, SSU gene (NC10) . Bayesian position. Aquavolonida, the showing of rRNAphylogeny SSU gene TSA. The. nucleusand cell other of structures The. view, generalend thestructures anterior of flagellar cellof root andsome External. of morphology d Endomyxa,arbitrarily rootedd onRadiolaria (shorter A. - - D. Longitudinal sections of the cell.E D. Longitudinal of anterior endof sections FISH signal = green, flagellarFISH signal green, Confocalimage = orange. focussed stain= in dientrani - FISH ofputative lineageNC10
Aquavolon Aquavolon . A. The longitudinal section of the of c A. Thelongitudinal section . n. sp. n.
93(8). doi:10.1093/femsec/fix073.
isolate Kat - hoantrani hoantrani refracting5 µmallfigures. granules.Scalefor bar: Aquavolon hoantraniAquavolon - Parabodo caudatus
1 (H and and - A. dientrani A. dientrani P). - Ai af =anteriorflagellum,= cv contractile
(‘core’) Aquavolonida cells from (‘core’) Aquavolonida Aquavolon hoantrani
n. gen.,sp. n.isolate n. Colp , withtremulids, N and ell.B. Cross (boldina text),relation to of
, Parabodo caudatus (B, E
olgi apparatus, k1olgi apparatus, = cv = con - branched Retaria). l evolutionary radiations. l – = posterior flagellum,
H) 0.2 µm.H) 0.2 - - tractile vacuole,ex H. Relative section of the section the of . A. Nucleus.. B. - D, F) 0.5D, F)
C12 used , mt =,
- - 16 d –
This article isThis article by protected copyright. All rightsreserved. Accepted Articlehttps://yadi.sk/mail/?hash=jsf7XwEScPTOsgvjNRSf5UTcbJ9iAjh6mG6I4cGmALw%3D Video S2 Table S1 Table SUPPORTING INFORMATION S 1 . . . Sequences of the PCR primers used in this study. this in used ofthePCRprimers Sequences GenBank. in sequences Aquavolonida Aquavolon Aquavolon dientrani
swimming. Video can be accessed at at accessed be can swimming. Video
This article isThis article by protected copyright. All rightsreserved. PCR). the first in used the primers b a plankton Freshwater biofilm Freshwater river sediment Freshwater Soils gradient Estuarine plankton Marine sediment Marine Habitat type habitat type. PCR strategies Table 1
The only positive sample was from the freshwater end of the estuarine gradient. the estuarine of end fromthefreshwater was sample onlypositive The Accepted fal can generate strategy PCR this samples soil On Article
.
Detection of of Detection
.
Dashes indicate that the primer strategy did not amplify Aquavolonida from th from Aquavolonida notamplify did strategy primer the that indicate Dashes
16 out 16 out of 7 outof8 8 outof16 0 outof16 1 outof16 0 outof 0 outof positive samples Aquavol I PCR strategy Aquavolonida 32 32 onida
b a
-
'core'
18S rRNA 18S
phylotypes in various various phylotypes in 0 outof16 0 outof 0 outof samples positive II PCR strategy 16 16 out of 7 outof8 16 14 out of 16 11 out of se positives (amplification of lobose amoebae lobose of (amplification se positives
32 32
– – – detected lineage(s) Aquavolonida (33% of clones) (33% of NC10 clones) (20% of NC10 ( NC10 clones) (6% of NC10 37 -
general general % of clones) % of habitat types habitat - - - - A (67% of clones) and NC10 and clones) of A (67% and clones) of A (80% A (6 NC10 and ofclones) D (94% 3 Aquavolonida % of clones) and NC10 and clones) of %
using using two
diversity
NC10 different at
with with
- - - -
B B B B
This article isThis article by protected copyright. All rightsreserved. Filosa) underlined: complementary uni b AY2009C14 a 1579 and 1565 48, Helix 1506 and 1451 45, Helix and 1016 29, Helix 885 866 25, Helix 537 21, & helices 20 Between 248 11, Helix position Helix and NC12. and withTremulida andrelationship ord.nov. its Aquavolonida Table 2
Helix numbering according to Wuyts et al. 2000, and positions given using NC10 environmental clone clone environmental NC10 given using andpositions 2000, et al. Wuyts to according Helix numbering Bold and underlined: underlined: and Bold
Accepted Aquavolonida in found quely Article - - 1041 900 252 .
. -
545 Sequence signatures observed in the in observed signatures Sequence - - -
229 1587 1511 1053
(accession number number (accession single - - 878 and 878 and 234 - - -
1573 1573 1456 1028 sequence signatures supporting a clade comprising Aquavolonida, Tremulida, andNC12; Tremulida, Aquavolonida, clade a comprising supporting signatures sequence sequence signature signature sequence s
a
three complementary and two single two and complementary three [G [AA(C)GC [G [U [ [UUC(U [UC GCGGUAAU [R(A) motif Specific sequence C M U BBR GR(GA)U H UGCD] UGCD] R HQ219347 G D Y ord. nov. nov. ord. YY N C GC(A)UU] AU Y GG(CCA)GAG] GG(CCA)GAG] R D Y] GAU)UCNB Y - G(CA)YC shared by this clad this by shared B
A [BGCA - K RG
[R U] and ) areference. as YSVW R -
G
are are 18S rRNA gene supporting the monophyly monophyly supportingthe gene rRNA 18S C A G ^Y] C]
used as a diagnostic feature of this order; bold: thisof order; feature diagnostic a as used ] b K ]
- - GA]
e and e and
sequence signatures sequence
Endomyxa [YYYNYYRG(CA)CCU] [AGG(GA)UYRGNRRR] [UUC(UYGGAU)YYRYKRA] [UYMRYKG(YCA)GAG] GCGGUAAUU [R(A)UCGC] eukaryotes other in sequence Consensus [RCUYGC(R)YU] [AR(C)GCRAGU] [GAYRVR]
, but not core Cercozoa (= Cercozoa not core , but
-
[YBYRUC] -
that [GCGA^Y]
- together together
of of
-
-
are
two This article isThis article by protected copyright. All rightsreserved. Accepted Article
This article isThis article by protected copyright. All rightsreserved. Accepted Article
This article isThis article by protected copyright. All rightsreserved. Accepted Article
This article isThis article by protected copyright. All rightsreserved. Accepted Article