Application of a Simplified Marker-Assisted Backcross

Biologia 69/4: 463—468, 2014 Section Botany DOI: 10.2478/s11756-014-0335-2

Application of a simpliﬁed marker-assisted backcross technique for hybrid breeding in rice

Zhijuan Ji1,3,JianyaoShi2, Yuxiang Zeng1,QianQian1,3* & Changdeng Yang1*

1State Key Lab of Rice Biology, China National Rice Research Institute, Hangzhou 310006,China; e-mail: [email protected]; [email protected] 2Seed Management Station of Zhejiang Province, Hangzhou 310020,China 3College of Agronomy, Shengyang Agricultural University, Shenyang 110866,China

Abstract: Hybrid rice has contributed greatly to the self-sufficiency of the food supply in China. However, bacterial blight is a major disease that limits hybrid rice production in China. The study was conducted to develop an efficient breeding technique to improve the bacterial blight resistance in hybrid rice. A marker-assisted backcross breeding technique was adopted to improve HN189, an elite restorer line containing the Pi1 gene. This breeding technique was simplified to foreground selection with only one generation of backcrossing and background selection based on phenotypic selection. A novel bacterial blight resistance gene, Xa23, was introgressed into HN189. Two improved restorer lines, HBH145 (with one generation of backcrossing) and HBH146 (with two generations of backcrossing), were obtained that had a significant bacterial blight resistance advantage over HN189. The corresponding hybrid combination Tianyou H145 (Tianfeng A / HBH145) was certified one year earlier than Qianyou H146 (Qianjiang 1A / HBH146). The use of the marker-assisted backcross breeding technique with one generation of backcrossing and without background selection in rice breeding programs shortened the breeding period of the rice. Key words: bacterial blight resistance; hybrid rice; marker-assisted backcross breeding; Xa23 gene

Introduction sources for three-line hybrid breeding programs (Huang et al. 2012). Resistance genes in a three-line hybrid Rice (Oryza sativa L.) is a staple food crop in China line display heterozygous genotypes. A completely dom- that feeds more than 60% of the population and con- inant BB resistance gene with a broad resistance spec- tributes nearly 40% of total calorie intake (Cheng et trum is needed in the restorer lines. al. 2007). Hybrid rice can significantly increase rice To date, at least 38 BB resistance genes conferring yields compared with conventional varieties and have host resistance against various races of Xoo have been contributed a great deal to the self-sufficiency of the identified (Bhasin et al. 2011; Kumar et al. 2012). Sev- food supply in China. However, bacterial blight (BB) eral of these genes have already been incorporated into caused by Xanthomonas oryzae pv. oryzae (Xoo)isone rice cultivars that are now widely cultivated in many of the most destructive bacterial diseases that affect countries (Huang et al. 1997; Singh et al. 2001; Sun- hybrid rice production. The infection of plants at the daram et al. 2007). The genes Xa4 and Xa21 have been maximum tillering stage results in a yield reduction of widely used in hybrid rice breeding in China. However, 20% and, in severe cases, as much as 50% (Mew et al. these two genes do not confer ideal BB resistance for 1993). breeding programs. The level of resistance of F1 rice The majority of the male sterile lines that are hybrids carrying the Xa4 resistance gene to BB is low widely used in China are susceptible to BB (Zhang because of its incomplete dominance. The Xa21 gene, 2009); restorer lines contain recessive resistance genes which has a broad resistance spectrum, is completely or genes with a narrow resistance spectrum. Nearly 90% dominant but generally expresses resistance from the of rice hybrids in China are susceptible to BB (Zhang late tillering stage onwards, and its resistance level is af- 1995). Varietal resistance is an essential strategy for fected by its genetic background (Zhai et al. 2002). The controlling this disease. Restorer lines are more eas- xa5 gene, which is naturally found only within the Aus ily improved through breeding techniques than ster- subpopulation of rice (Garris et al. 2003), provides re- ile lines, and the incorporation of BB resistance genes cessive resistance to several Xoo races from the Philip- into restorer lines would help strengthen the parental pines.

* Corresponding author

c 2014 Institute of Botany, Slovak Academy of Sciences 464 Z. Ji et al.

Table 1. Gene linked markers for the BB resistance gene (Xa23) and the blast resistance gene (Pi1).

Gene Marker LG Forward sequence Reverse sequence AT

Xa23 C189 11 TAAGTTCTACATCGACCCCA CACATGAAGAGCTGGAAACG 58 Pi1 RM224 11 ATCGATCGATCTTCACGAGG TGCTATAAAAGGCATTCGGG 55

LG – linkage group; AT – annealing temperature

Conversely, the Xa23 gene has a broader resistance BC1F6 (backcrossed once and self-pollinated five times), and spectrum to different BB races, displays very high re- HBH146, from BC2F5 (backcrossed twice and self-pollinated sistance levels during all growth stages, and is highly four times), were selected using the MABB technique. heritable (Zhang et al. 1998, 2001). Zhou et al. (2011) PCR amplification determined that there was no genetic background ef- 23 Expressed sequence tag (EST) marker C189, which is linked fect on the expression of the Xa gene, suggesting that to Xa23 (Wang et al. 2005), was used for foreground selec- Xa23 is of great value in breeding rice hybrids with BB tion in the backcrossed and self-pollinated generations. The resistance. SSR marker RM224 (Prasad et al. 2009) was used to se- The marker-assisted backcross breeding (MABB) lect the BC1F1 generation that was homozygous for the Pi1 technique is usually used to improve disease resistance gene. while preserving identical backgrounds by repeatedly DNA samples were extracted from fresh leaves using a crossing to a recurrent parent. The MABB technique of- simple one-step method as follows: samples with a length ten involves two steps: marker-assisted selection (MAS) of approximately 3 mm were immersed in Buffer A containing 100 mM Tris-HCl (pH 9.5), 1 M KCl, and 10 mM for the gene of interest, known as foreground selection, EDTA. The sample was crushed using a multi-sample tis- and MAS for recovery of the recurrent parent genome, sue lyser (Jingxin Technology Co. Ltd., Shanghai, China). known as background selection (Chevalet & Mulsant Supernatants were collected by centrifugation at 4000 rpm 1992). Although background selection is very useful for for 5 min. rapid recovery of the recurrent parent genome, its use Polymerase chain reactions (PCR) were performed in in breeding programs is constrained by the limitation a15µL reaction volume containing 0.8 µL of supernatant, of detecting polymorphisms with markers such as sim- 2× PCR Buffer, 2 mM dNTPs, 0.9 µM primer pairs, and ple sequence repeats (SSRs), its cost, and the need for 0.3 U of KOD FX polymerase (Toyobo Co. Ltd., Shang- hai, China). The reaction mixture was initially denatured timely execution (Singh et al. 2012). ◦ at 94 C for 2 min followed by 30 cycles of PCR amplifica- The aim of the present study was targeted intro- tion with the following parameters: 10 s of denaturation at 23 ◦ ◦ ◦ gression of the Xa gene into restorer lines using a 98 C, 30 s of primer annealing at 50 C for RM224 or 53 C simplified MABB technique. Background selection with for marker C189, and 1 min of primer extension at 68 ◦C. markers was omitted. Backcrossing generation num- Finally, the reaction mixture was maintained at 68 ◦Cfor bers were evaluated for recovery of the recurrent par- 7 min before completion. The amplified product was elec- ent genome by agronomic trait investigation of the new trophoretically resolved on a 2% agarose gel for marker C189 BB-resistant restorer lines. Their respective hybrid rice and an 8% denaturing polyacrylamide gel for RM224. combinations were further investigated. Evaluation of the agronomic traits of the improved lines To evaluate the agronomic traits of the improved restorer Material and methods lines, HBH145, HBH146, and the recurrent parent HN189 were planted in a randomized complete block design in Plant materials and breeding strategy Hangzhou in the summer of 2006. Tests were performed in HN189, which contains the Pi1 gene, is a restorer line bred three replicates. In each replicate, each plot consisted of six by our research group; it has blast disease resistance in the rows with 12 plants per row, with a planting density of 17 cm field and was used as the recurrent parent for the introgres- between plants and 17 cm between rows. Water and fertilizer sion of the BB resistance gene Xa23 from the donor, CBB23 were managed regularly. Five individual plants in the middle (provided by Mr. Zhao Kaijun of Chinese Academy of Agri- of each plot were used to measure agronomic traits, includ- cultural Sciences). The derived F1 line was backcrossed with ing plant height, panicle number per plant, spikelet number HN189 to produce BC1F1 seed. BC1F1 generation plants per panicle, seed setting rate, and 1000-grain weight. that were heterozygous for the Xa23 gene and homozygous Crosses were made between sterile lines (Qianjiang 1A, for the Pi1 gene were selected through the use of molecu- Tianfeng A, and Chuangxian A) and the improved restorer lar markers (Table 1). The gene-positive plants with max- lines. The F1 hybrid lines were grown in a yield evaluation imum phenotypic similarity to the recurrent parent were plot in Hangzhou in the summer of 2007. The yield evalu- selected from the BC1F1 generation. Some of the selected ation test was performed in three replicates. In each repli- BC1F1 individuals were backcrossed with HN189 to gen- cate, each of the plots consisted of seven rows with 12 plants erate BC2F1 seed. Others were self-pollinated to generate per row, with a planting density of 17 cm between plants BC1F2 seed. Using MAS techniques, the BC2F1 heterozy- and 30 cm between rows. Each replicate was contained in 2 gous for the Xa23 gene and the BC1F2 homozygous for the a4.3m area. Water and fertilizer were managed regularly. Xa23 gene were self-pollinated. The resulting BC2F2 that Five individual plants in the middle of each replicate were were homozygous for the Xa23 gene and the BC1F3 were used to measure agronomic traits, including plant height, further self-pollinated, and phenotypic selection was em- panicle number per plant, spikelet number per panicle, seed ployed until the lines were stable. The lines HBH145, from setting rate, and 1000-grain weight. The yield per plot was Application of backcross technique in rice 465

Fig. 1. A – C1F1 generation selection using C189 and RM224 markers; B – Confirmation of the Xa23 and Pi1 genes for the hybrid rice combinations and their parents using C189 and RM224 markers. 1 – HBH145; 2 – Tianfeng A; 3 – Tianyou H145; 4 – HBH146; 5 – Qianjiang 1A; 6 – Qianyou H146. obtained by averaging the yield of the three replicates. BB six of 21 plants that were heterozygous for the Xa23 and blast disease resistance were evaluated by artificial in- gene and homozygous for thePi1 gene were selected oculation in the field. and used to generate BC2F1 and BC1F2 seed sepa- New hybrid lines with better economic traits were se- rately. In the BC2F1 generation, 19 plants that were lected for regional trials in Zhejiang Province, which in- heterozygous for the Xa23 gene were identified; the cluded seven different test sites in the province. five best plants with maximum morphological similarity to HN189 were selfed to develop BC2F2 families. Disease resistance evaluation The BC1F2 and BC2F2 plants that were homozygous BB and blast resistance were evaluated by artificial inocula- 23 tion over the course of breeding. Isolates of the two diseases for the Xa gene were identified and advanced to gen- were provided by Mr. Tao Rongxiang of Zhejiang Academy erate BC2F5 and BC1F6 generations through pedigree of Agricultural Sciences. selection. Agro-morphological trait selection was con- Plants were inoculated with BB disease isolates using ducted in every generation (Fig. 2). the leaf-clipping method. Lesion length (LL) was measured 25 days after inoculation. The heartleaf-injecting method Effects of generation numbers of backcrossing on agro- was used during the middle tillering stage to evaluate the nomic traits level of blast disease resistance. Lesions were measured five The agronomic traits of lines HBH145 and HBH146 days before harvest (Tao et al. 2006). were analyzed in comparison with the recurrent parent HN189 (Table 2). The 1000-grain weight, seed setting Results rate, spikelet number per panicle, panicle number per plant, and plant height of the two lines were similar to Marker-assisted foreground selection those of HN189. With the exception of BB resistance, To develop HBH145 and HBH146, the F1 plants from there were no significant differences in the agronomic the cross HN189 ×CBB23 were tested for hybridity traits of the two lines, indicating that elite progeny lines using the Xa23-linked molecular marker C189. Gene- could be achieved with one or two generations of back- positive F1 plants were backcrossed to generate 90 crossing. Normally, HBH146 (BC2F5) would be planted BC1F1 plants, which were subjected to screening with for one more season than HBH145 (BC1F6). However, the C189 and RM224 markers (Fig. 1A). Based on to shorten the breeding period, a single generation of agro-morphological similarity to the recurrent parent, backcrossing was deemed sufficient. 466 Z. Ji et al.

Fig. 2. Scheme showing the use of the marker-assisted backcross breeding (MABB) technique to develop new restorer lines containing the Xa23 gene in the HN189 recipient parental background.

Table 2. Agronomic trait analysis of the restorer lines in the ﬁeld test.

Line Bacterial blight Blast resistance 1000-grain Seed setting Spikelet number Panicle number Plant height resistance level† level weight (g) rate (%) per panicle per plant (cm)

HN189 HS R 37.90 ns‡ 79.69 ns 146.0 ns 9.3 ns 92.5 ns HBH145 R R 38.17 ns 79.14 ns 145.4 ns 8.7 ns 93.1 ns HBH146 R R 38.35 ns 79.19 ns 145.7 ns 9.0 ns 92.7 ns

† R, resistant; HS, highly susceptible. ‡ ns, nonsigniﬁcant based on ANOVA.

Evaluation of the improved restorer lines in hybrid rice lected to attend the regional trial in Zhejiang Province. breeding Before evaluation in the regional trial, the leaves of The restorer lines HBH145 and HBH146 were fur- the hybrid rice Tianyou H145 (Tianfeng A ×HBH145) ther crossed with the sterile lines Tianfeng A, Qian- and Qianyou H146 (Qianjiang 1A ×HBH146) were col- jiang 1A, and Chuanxiang A. The yields and economic lected to ensure the presence of the disease resistance traits of the different combinations were investigated genes Xa23 and Pi1 using the MAS technique with the in a plot test (Table 3). The results demonstrated linked markers C189 and RM224 (Fig. 1B). The anal- that Tianyou H145 (3.24 kg/plot), Qianyou H146 (3.25 ysis confirmed that Tianyou H145 and Qianyou H146 kg/plot), Qianyou H145 (3.16 kg/plot), and Chuanxi- contained the heterozygous resistance genes Xa23 and angyou H145 (3.19 kg/plot) reached a significant level Pi1, which were transferred from the improved restorer of plot yield with better economic traits. The spikelet lines. number per panicle of Qianyou H146 reached 177.8. The The agronomic traits, disease resistance, and yields investigation of BB and blast disease resistance indi- of Tianyou H145 and Qianyou H146 in the regional tri- cated that most of the new hybrid lines were resistant to als are reported in Table 4. The average yield of the the two diseases, with the exception of Chuanxiangyou seven sites over two years was calculated. On average, H145, which had moderate resistance to blast disease. the yield of Tianyou H145 increased 4.31% over that The two best hybrid combinations, Tianyou H145 (3.24 of Shanyou 10, while the yield of Qianyou H146 in- kg/plot) and Qianyou H146 (3.25 kg/plot), were se- creased 5.05% over that of Shanyou 10. The BB and Application of backcross technique in rice 467

Table 3. Economic trait analysis of the hybrid lines in ﬁeld plot tests.

Hybrid lines Cross Bacterial Blast Plant Panicle Spikelet Seed setting Thousand-grain Yield per blight resistance height number number rate (%) weight (g) plot (kg) resistance level (cm) per plant per panicle level†

Qianyou H146 Qianjiang 1A/ R R 107.2 ns‡ 19.7 ns 177.8** 87.0 ns 29.0* 3.25** HBH146 Qianyou H145 Qianjiang 1A/ R R 108.1 ns 18.3 ns 153.1 ns 85.0 ns 30.0* 3.16* HBH145 Tianyou H145 Tianfeng A/ R R 112.5* 16.3* 172.6** 82.0 ns 31.7** 3.24** HBH145 Tianyou H146 Tianfeng A/ R R 110.3 ns 16.0* 172.0** 78.0* 29.5* 2.83 ns HBH146 Chuanxiangyou H145 Chuanxiang R MR 111.1* 15.3** 159.5 ns 80.7 ns 28.0 ns 3.19* A/ HBH145 Chuanxiangyou H146 Chuanxiang R R 114.2* 14.3** 159.1 ns 88.7 ns 35.0** 2.97 ns A/ HBH146 Shanyou 10 (CK) Zhengshan HS MS 103.3 19.3 157.6 87.0 27.5 2.89 97A/ Miyang 46

* Significant at the 0.05 level based on ANOVA. ** Significant at the 0.01 level based on ANOVA. † R, resistant; MR, moderately resistant; MS, moderately susceptible; HS, highly susceptible. ‡ ns, nonsignificant based on ANOVA.

Table 4. The disease resistance level and agronomic traits of the hybrid lines in the regional trials in Zhejiang Province.

Line Blast Bacterial Whole Plant Panicle Spikelet Seed setting Thousand- Yield resistance blight growth height number per number per rate (%) grain (kg/ha) level† resistance duration (cm) ha (×104) panicle weight (g) level (day)

Tianyou R MR 126.3 112.5 226.5 142.1 82.3 31.6 8058.0 H145 Shanyou 10 MS S 125.6 112.3 243.0 143.2 84.0 27.2 7725.0 (CK) ‡

Qianyou MR MR 125.4 110.2 247.5 134.3 86.4 29.5 8545.5 H146 Shanyou 10 MS HS 127.5 109.1 237.0 135.5 86.6 28.1 8134.5 (CK)

† R, resistant; MR, moderately resistant; MS, moderately susceptible; S, susceptible; HS, highly susceptible. ‡ Shanyou 10 (CK) exhibited different agronomic trait values when planted in different regions. Data were collected from the summary of the regional trials and production test results from 2010 to 2012 by the Seed Management Station in Zhejiang Province. blast resistance levels of Tianyou H145 and Qianyou genes into hybrid rice combinations to improve BB re- H146 were middle-resistant or resistant and superior to sistance levels (Basavaraj et al. 2010; Zhou et al. 2011; that of Shanyou 10. Huang et al. 2012; Luo et al. 2012). After two years of regional tests and one year of The MABB technique is often adopted in breed- production test, Tianyou H145 was awarded the Variety ing for disease resistance traits. However, background Certificate for Zhejiang Province in 2013. Qianyou H146 selection by detecting polymorphisms using markers is has completed the two-year test in the regional trials of laborious and costly. Background selection using mark- Zhejiang Province. ers for the improvement of a variety may be indispens- able if the variety has been popularly applied in a large Discussion area. However, if the trait of a new line reaches a similar or better level than the recurrent parent through Hybrid rice technology has greatly contributed to in- phenotypic selection, background selection with mark- creased rice production in China over the last 40 years. ers tends to constrain the selection of the better traits. However, many popular cultivated hybrids are suscepti- Furthermore, a single generation of backcrossing could ble to BB because of the susceptibility of their parental shorten the breeding period. lines to BB disease (Zhang 2009). Therefore, efforts To accommodate the reality of breeding programs, have been made to introgress different BB resistance the MABB technique was simplified in the present 468 Z. Ji et al. study through the use of a single generation of back- equilibrium surrounding the xa5 locus of rice (Oryza sativa crossing and background selection based on pheno- L.). Genetics 165: 759–769. Huang B., Xu J.Y., Hou M.S., Ali J. & Mou T.M. 2012. Intro- typic selection. We developed two advanced versions of gression of bacterial blight resistance genes Xa7, Xa21, Xa22 HN189 with BB resistance using the simplified MABB and Xa23 into hybrid rice restorer lines by molecular marker- technique. Tianyou H145 will be certificated before assisted selection. Euphytica 187: 449–459. Qianyou H146 because of the reduced backcrossing gen- Huang N., Angeles E., Domingo J., Magpantay G., Singh S., Zhang G., Kumaravadivel N., Bennett J. & Khush G. eration. 1997. Pyramiding of bacterial blight resistance genes in rice: In the present study, foreground selection for the marker-assisted selection using RFLP and PCR. Theor. Appl. Xa23 gene was followed by phenotypic selection. Back- Genet. 95: 313–320. crossing was conducted once or twice with no agronomic Kumar P.N., Sujatha K., Laha G.S., Rao K.S., Mishra B., Virak- tamath B.C., Hari Y., Reddy C.S., Balachandran S.M., Ram trait penalty in the final improved lines (Table 1). Back- T. et al. 2012. Identification and fine-mapping of Xa33, a ground selection with markers was not conducted at novel gene for resistance to Xanthomonas oryzae pv. oryzae. each backcross generation or in the newly improved re- Phytopathol. 102: 222–228. Luo Y., Sangha J.S., Wang S., Li Z., Yang J. & Yin Z. 2012. storer lines. To ensure food security for the increasing Marker-assisted breeding of Xa4, Xa21 and Xa27 in the re- population, raising the yield ceiling of rice remains a storer lines of hybrid rice for broad-spectrum and enhanced priority in China (Cheng et al. 2007). The yield and disease resistance to bacterial blight. Mol. Breed. 30: 1601– disease resistance traits of the hybrid rice were our pri- 1610. Mew T., Alvarez A., Leach J. & Swings J. 1993. Focus on bacte- mary concern in this study. Therefore, the MAS tech- rial blight of rice. Plant Dis. 77: 5–12. nique for background selection in the improved restorer Prasad M.S., Kanthi B.A., Balachandran S., Seshumadhav M., lines was omitted. Mohan K.M. & Viraktamath B. 2009. Molecular mapping of rice blast resistance gene Pi-1 (t) in the elite indica variety In conclusion we can demonstrate that one gener- Samba mahsuri. World J. Microbiol. Biotechnol. 25: 1765– ation of backcrossing was sufficient because the agro- 1769. nomic traits of the improved HBH145 line were re- Singh S., Sidhu J., Huang N., Vikal Y., Li Z., Brar D., Dhali- covered from the recurrent parent HN189. One grow- wal H. & Khush G. 2001. Pyramiding three bacterial blight resistance genes (xa5, xa13 and Xa21) using marker-assisted ing season was eliminated, and Tianyou H145 (Tian- selection into indica rice cultivar PR106. Theor. Appl. Genet. feng A / HBH145) was selected for the regional tri- 102: 1011–1015. als in Zhejiang Province one year earlier than Qianyou Singh V.K., Singh A., Singh S.P., Ellur R.K., Choudhary V., H146 (Qianjiang 1A / HBH146). These results demon- Sarkel S., Singh D., Krishnan S.G., Nagarajan M., Vinod K.K. et al. 2012. Incorporation of blast resistance into strate that marker-assisted foreground selection com- “PRR78”, an elite Basmati rice restorer line, through marker bined with one generation of backcrossing and pheno- assisted backcross breeding. Field Crops Res. 128: 8–16. typic selection can accelerate backcross breeding pro- Sundaram R.M., Vishnupriya M.R., Biradar S.K., Laha G.S., Reddy G.A., Rani N.S., Sarma N.P. & Sonti, R.V. 2007. grams and make them both cost-effective and labor- Marker assisted introgression of bacterial blight resistance in saving. Samba Mahsuri, an elite indica rice variety. Euphytica 160: 411–422. Tao R., Chen J. & Liao Q. 2006. Field manual of diseases and Acknowledgements pests in rice identification and resistance evaluation for the diseases and pests. China Agricultural Science and Technol- We thank Mr. Zhao Kaijun for providing the donor par- ogy Press, Beijing, pp 118–122. ent CBB23. We also thank Mr. Tao Rongxiang for his help Wang C., Qi H., Pan H., Li J., Fan Y. Zhang G. & Zhao K. 2005: in the disease-resistance evaluation. This work was finan- EST-Markers flanking the rice bacterial blight resistance gene 23 cially supported by the grant from Ministry of Agriculture Xa and their application in marker-assisted selection. Sci 38: (2012RG001-5), the Technological Key Project of Ministry Agri Sin. 1996–2001. (In Chinese with English abstract) Zhai W., Wang W., Zhou Y., Li X., Zheng X., Zhang Q., Wang of Agriculture of China on New Transgenic Variety Breed- G. & Zhu L. 2002. Breeding bacterial blight-resistant hybrid ing (2013ZX08001-02) and National Natural Science Foun- rice with the cloned bacterial blight resistance gene Xa21. dation of China (31221004). Mol. Breed. 8: 285–293. Zhang Q. 1995. Utilization and strategy of genes for resistance to rice bacterial blight in China. Acta Phytophyl. Sin. 22: References 241–245. Zhang Q. 2009. Genetics and improvement of bacterial blight Basavaraj S., Singh V.K., Singh A., Singh A., Singh A., Anand resistance of hybrid rice in China. Rice Science 16: 83–92. D., Yadav S., Ellur R.K., Singh D. & Krishnan S.G. 2010. Zhang Q., Lin S., Zhao B., Wang C., Yang W., Zhou Y., Li D., Marker-assisted improvement of bacterial blight resistance in Chen C. & Zhu L. 1998. Identification and tagging a new parental lines of Pusa RH10, a superfine grain aromatic rice gene for resistance to bacterial blight (Xanthomonas oryzae hybrid.Mol.Breed.26: 293–305. pv. oryzae) from O. rufipogon. Rice Genet. Newsl. 15: 138– Bhasin H., Bhatia D., Raghuvanshi S., Lore J.S., Sahi G.K., Kaur 142. B., Vikal Y. & Singh K. 2011. New PCR-based sequence- ZhangQ.,WangC.,ZhaoK.,ZhaoY.,CaslanaV.,ZhuX.,LiD. tagged site marker for bacterial blight resistance gene Xa38 & Jiang Q. 2001. Rice Genetics Newsletter, Vol. 18, 71 pp. of rice. Mol. Breed. 30: 607–611. Zhou Y.-L., Uzokwe V.N.E., Zhang C.-H., Cheng L.-R., Wang Cheng S.H., Cao L.Y., Zhuang J.Y., Chen S.G., Zhan X.D., Fan L., Chen K., Gao, X.-Q., Sun Y., Chen J.-J., Zhu L.-H. et al. Y.Y., Zhu D.F. & Min S.K. 2007. Super hybrid rice breeding 2011. Improvement of bacterial blight resistance of hybrid rice in China: achievements and prospects. J. Integ. Plant Biol. in China using the Xa23 gene derived from wild rice (Oryza 49: 805–810. rufipogon). Crop Protect. 30: 637–644. Chevalet C. & Mulsant P. 1992. Using markers in gene introgression breeding programs. Genetics 132: 1199–1210. Received September 26, 2013 Garris A.J., McCouch S.R. & Kresovich S. 2003. Population Accepted November 28, 2013 structure and its effect on haplotype diversity and linkage dis-