Influence of Garlic Or Its Main Active Component Diallyl Disulfide on Iron

Available online at www.sciencedirect.com

Nutrition Research 30 (2010) 85–95 www.nrjournal.com

Influence of garlic or its main active component diallyl disulfide on iron bioavailability and toxicity Afef Nahdia,b, Imen Hammamia, Carole Brasse-Lagnelb, Nathalie Pilardb, ⁎ Mohamed Hedi Hamdaouic, Carole Beaumontb, , Michèle El Maya aUnité de recherche n° 01/UR/08-07, Laboratoire d'histologie-embryologie et biologie cellulaire, Faculté de Médecine de Tunis, 1007 Tunis, Tunisie bINSERM U773, Université Paris Diderot Paris 7, UFR de médecine site Bichat, 75018, Paris, France cUnité de Recherche sur l'Anémie Nutritionnelle et la Biodisponibilité des Oligoéléments, Ecole Supérieure des Sciences et Techniques de la Santé de Tunis, BP 176 Bab-Souika, Tunisie Received 6 November 2009; revised 15 January 2010; accepted 15 January 2010

Abstract

Garlic is regularly consumed and is known to have diverse biologic activities, particularly due to its antioxidant properties. In this study, we hypothesized that crude garlic can prevent iron-mediated oxidative stress in a rat model of nutritional iron overload, and we used an in vitro model to confirm the results. For the in vivo studies, rats received a basal diet supplemented with or without carbonyl iron (3%) and were fed distilled water or garlic solution (1g/kg body weight) by gavage for 3 weeks. The presence of both garlic and iron led to a 2-fold increase in plasma iron and a 50% increase in liver iron as compared with iron alone. However, garlic did not offer any protection against iron-induced oxidative stress. Duodenal divalent metal transporter-1 mRNA expression was fully repressed by iron and by the combined treatments but was also reduced by garlic alone. To confirm these data, we tested the effect of diallyl disulfide, one of the active components in garlic, in vitro on polarized Caco-2 cells. A 24-hour treatment decreased iron uptake at the apical side of Caco-2 cells but increased the percentage of iron transfer at the basolateral side. This probably resulted from a modest induction of ferroportin mRNA and protein expression. These results suggest that garlic, when given in the presence of iron, enhances iron absorption by increasing ferroportin expression. The presence of garlic in the diet at the dose studied does not seem to protect against iron-mediated oxidative stress. © 2010 Elsevier Inc. All rights reserved. Keywords: Iron absorption; Ferroportin; Garlic; Oxidative stress; Rats; Caco-2 cells Abbreviations: AOPP, advanced oxidation protein products; DADS, diallyl disulfide; DMEM, Dulbecco's modified Eagle's medium; DMSO, dimethyl sulfoxide; DMT1, divalent metal transporter-1; Fe-NTA, iron-nitrilotriacetate; FPN1, ferroportin-1; MDA, malondialdehyde; PBS, phosphate-buffered saline; PIs, protease inhibitors; RT-qPCR, real- time quantitative polymerase chain reaction.

1. Introduction iron-mediated oxidative stress is thought to be a significant factor in the pathogenesis of iron-overload disease. Iron- Iron, the most abundant transition metal in the body, is catalyzed lipid peroxidation promotes the formation of required by all mammalian cells for growth and survival. highly reactive aldehydes, such as malondialdehyde (MDA) However, excess iron in the body is potentially toxic, and and 4-hydroxynonenal [1]. These molecules form covalent links to proteins, phospholipids, and DNA and cause ⁎ Corresponding author. INSERM U773, Centre de Recherche considerable tissue damage. Biomédicale Bichat Beaujon CRB3 Université Paris Diderot Paris 7, UFR de Médecine site Bichat, 75018 paris cedex 18, France. Tel.: +33 1 57 27 75 In humans, iron homeostasis is based on the tight control 56; fax: +33 1 57 27 75 31. of intestinal iron absorption and recycling of heme iron by E-mail address: [email protected] (C. Beaumont). tissue macrophages. There is no physiologic system to

0271-5317/$ – see front matter © 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.nutres.2010.01.004 86 A. Nahdi et al. / Nutrition Research 30 (2010) 85–95 eliminate the iron absorbed in excess of body requirements proteins, including DMT1 [29] and FPN1 [30], and is the and iron losses only result from sloughing of epithelial cells most commonly used model to study iron transport. in addition to menstrual blood loss in women [2]. Two Therefore, because garlic is largely used in Mediterranean crucial proteins are involved in intestinal iron absorption: cooking, it is important to evaluate its impact on iron divalent metal transporter-1 (DMT1) present at the apical absorption and toxicity. membrane of duodenal enterocytes, exerting iron uptake into the cell and ferroportin-1 (FPN1) present in the basolateral 2. Methods and materials membrane, exporting iron to the circulation. The amount of iron absorbed from the diet is influenced by multiple factors 2.1. Plant extract including iron content of the diet, the level of iron stores and the rate of erythropoiesis, inflammation, and pregnancy [3]. The variety of garlic (A sativum) used in the present study Iron homeostasis is mainly regulated by hepcidin, a has pink bulbs and was purchased from a local market. This peptide secreted by the liver in response to iron loading [4,5] type of garlic contains 2.1% of proteins, 30% of carbohy- and inflammation [6]. On the reverse, iron-deficiency drates, 1.5% of fibers, 0.2% of fat, 0.015% of vitamins, and anemia, stimulation of erythropoiesis, hypoxia, and dyser- 0.7% minerals. Everyday, cloves were peeled, sliced, ground ythropoietic disorders, all these conditions have been shown to a paste, and then suspended in distilled water to 0.3 mg/ to fully repress hepcidin gene expression (see Darshan and mL to minimize volatile compound loss. The homogenate Anderson [7] for review]. This protein regulates plasma iron was centrifuged at 3000 × g for 10 minutes to remove availability by limiting duodenal iron absorption and release particulate matter, and the supernatant fraction was used for of iron by macrophages through binding to ferroportin, the experiment. inducing its internalization and degradation [8,9]. 2.2. Animals and diets Garlic (Allium sativum) is a frequently used plant in Mediterranean cooking. In Tunisia, it is regularly con- Twenty male Wistar rats weighing between 180 and 200 g sumed at various doses both crude and cooked, and its were purchased from Charles River Laboratories (L'Ar- potential medical properties have been recognized for bresle, France), housed in stainless steel cages, and thousands of years [10,11]. In addition, garlic plays maintained in a controlled environment under standard therapeutic effects such as in treatment of hypercholester- conditions of temperature (25 ± 2°C), humidity, and light olemia [12,13], prevention of atherosclerosis [14,15],and (12-hour light/dark cycle, lights on 0700-1900). The rats of some cancers [16,17]. It also presents anticoagulant were allowed to acclimatize in the animal facility for a period [18,19] and antihypertensive [20] properties. In contrast, of 1 week before the beginning of the study. During that excess consumption of garlic has been reported to cause period of time, they received a commercial pellet diet toxicity, including anemia and gastrointestinal problems (SAFE, Augy, France) and water ad libitum. Animals were [21]. Some laboratories have reported that powder [22] or cared in accordance with criteria outlined in the European crude [23,24] garlic preparations altered male reproductive Convention for the Protection of Laboratory Animal, and the tract function. study had obtained institutional approval. Its impact on iron metabolism has only been poorly The diet [31] used during the experiment was prepared investigated. Some studies have reported that garlic oil every 3 days by thoroughly mixing the ingredients and suppresses iron-nitrilotriacetate (Fe-NTA)–mediated hepatic chemical compounds (Table 1) to obtain a homogeneous oxidative stress, tumor promotion, and toxicity [25]. Others paste that was dried at 45°C, sliced, and stored at 4°C for a also observed that pretreatment of animals with garlic oil short time. The basal diet contained 50 mg Fe/kg diet as attenuates oxidative stress, toxicity, and hyperproliferative FeSO4 7H2O. This iron supply corresponds to recommended response mediated by Fe-NTA in rat kidney [26]. supply in growing rats and is slightly lower than recom- In the present study, we hypothesized that garlic can mended supplies in humans [32]. For the iron-treated group, prevent iron-induced oxidative damage. We investigated the this diet was supplemented with 3% carbonyl iron (Sigma effects of chronic administration of crude garlic on intestinal Chemical Co, St Louis, Mo). A fixed amount of distilled iron absorption in rats fed a normal diet or an iron- water was given daily to the animals by gavage, containing supplemented diet and on the parameters of oxidative stress. or not the garlic extract (1 g/kg body weight). In addition, to get a better insight into the effects of garlic at 2.3. Experimental protocol the intestinal level, we studied iron absorption and transfer in Caco-2 cells grown in normal condition (ie, without iron To investigate the effects of chronic administration of supplementation) using diallyl disulfide (DADS), one of the crude garlic on iron metabolism and oxidative stress, rats main active [17] and the most studied components of garlic. were weighed and randomly assigned into 4 groups of 5 Caco-2 cells were selected because they have an enterocyte- animals each and treated for 3 weeks as follows: like phenotype, expressing numerous small intestinal brush border enzymes and nutrient transporters [27,28].In Control group received the basal diet and was fed distilled addition, this cell line expresses the key iron transport water by gavage once a day. A. Nahdi et al. / Nutrition Research 30 (2010) 85–95 87 Table 1 quantification using an IL test (Instrumentation Laboratory, Ingredient composition of the basal diet fed to rats during the experimental Lexington, Mass) on an Olympus AU400 automate. period Ingredients Content (g/kg diet) 2.5. Markers of oxidative stress a Powder skim milk 400 Plasma advanced oxidation protein products (AOPPs) Corn oil 55 were assayed as described [34]. Briefly, plasma diluted in Maize starch 300 Sucrose 180 phosphate-buffered saline (PBS) and chloramine standard L-Cysteine 1 solutions were mixed with 1.16 M potassium iodide solution. Choline 1.5 After incubation for 6 minutes, pure acetic acid was added CaCo3 20 and optical density was read at 340 nm (with a reference Na3PO4 20 filter at 490 nm). Advanced oxidation protein product NaCl 5 KCl 5 content in samples was determined by comparison with the Vitamin mixture b 10 predetermined chloramine standard curve. Mineral mixture c 2.3 The levels of lipid peroxidation products thiobarbituric FeSO4 0.2 acid–reactive substances, mainly MDA, were assessed in a As source of protein. tissues according to the method of Buege and Aust [35], and b Vitamin mixture (unit/kg of mixture): synthetic vitamin A concentrate, protein content in supernatants was determined using α 250 000 UI; cholecalciferol, 50 000 UI; -tocopherol acetate, 0.100 g; Bradford method [36]. thiamin hydrochloride, 0.100 g; riboflavin sodium phosphate, 0.075 g; pyridoxine hydrochloride, 0.100 g; ascorbic acid, 2.500 g; nicotinamide, 2.6. Histology 0.500 g; dexpanthenol, 0.200 g. c Mineral mixture without iron (g/100 g mineral salt): MgSO47H2O, Liver tissue was fixed in formalin, routinely processed, 73.82; ZnSO 7H O, 19.66; MnSO H O, 4.22; CuSO 5H O, 0.73; KIO , 4 2 4 2 4 2 3 and embedded in paraffin. Three-micrometer-thick paraffin 0.06; Na2SeO3, 0.9. sections were stained with Perls' Prussian Blue method for iron visualization. Iron group received the basal diet supplemented with carbonyl iron (3%) and was fed distilled water by gavage. 2.7. Caco-2 Cell cultures Garlic group received the basal diet and was given garlic extract (1g/kg body weight) by gavage once a day. To confirm the effect of garlic on intestinal iron Garlic + iron group received the basal diet supplemented absorption, we used an in vitro model of polarized cultured with carbonyl iron (3%) and was orally treated with garlic Caco-2 cells treated with one of the most active compounds solution (1g/kg body weight). of garlic: DADS. The animals received a fixed amount of food everyday, Caco-2/TC7 cell line was obtained from Dr M. Rousset and the remaining food was weighed to calculate the daily (INSERM U505, Paris, France) and was grown at 37°C in a food intake per group. 5% CO2, 95% air incubator. Dulbecco's modified Eagle's medium (DMEM; Invitrogen-Gibco, Cergy-Pontoise, At the end of the experimental period, the rats were weighed, France) supplemented with 10% fetal calf serum, 1% anesthetized by isofluorane (intraperitoneally), and killed. nonessential amino acids, 2 mmol glutamine, 100 U/mL μ Blood was immediately collected in heparinized vials and penicillin, and 100 g/mL streptomycin was used. Cells 3 2 centrifuged at 3000 × g for 15 minutes. Plasma was stored were seeded at a density of 12 × 10 cells/cm onto 100-mm frozen at −80°C until use. Liver, heart, spleen, and kidneys were dishes. After reaching 80% to 90% confluence, cells were dissected out, weighed, and sectioned, and then tissue fragments trypsinized and seeded onto permeable membrane filter μ were kept at −80°C. Duodenum was removed, rinsed with cold supports (Transwell, 24- or 12-mm diameter, 0.4- m pore 0.9% NaCl, and opened lengthwise, and mucosa was scraped size; Corning, Life Sciences, NY) and fed every 2 days with from the organ with a clean glass microscope slide. This supplemented DMEM. The cells were grown for 11 days manipulation was performed on ice. Mucosa was immediately after confluence, and serum-free DMEM was added 24 hours suspended in RNA extraction solution and frozen at −80°C. before experiments. They were then cultured for 24 hours in the absence or in the presence of dimethyl sulfoxide (DMSO; 0.1%) or DADS (100 μmol in DMSO). Diallyl disulfide 2.4. Iron metabolism (CH2 = CHCH2SSCH2CH = CH2; purity 80%) and DMSO Plasma iron and transferrin concentrations were quantified were purchased from Sigma-Aldrich (Lyon, France). using an Olympus AU400 automate (Beckman-Coulter, High 2.8. Iron uptake studies Wycombe, UK). Transferrin saturation was determined using the following formula: serum iron (μmol/L)/transferrin Caco-2 cells were grown on 12-mm permeable mem- concentration (g/L) × 4. brane filter, and formation of a monolayer of confluent cells Tissue iron content was determined by acid digestion of was checked by measuring the transepithelial electrical tissue samples as described previously [33], followed by iron resistance with an epithelial volt-ohmmeter (Millicell-ERS, 88 A. Nahdi et al. / Nutrition Research 30 (2010) 85–95 Millipore, France). At confluence, normal transepithelial Table 2 electrical resistance values were greater than 310 Ω/cm2. Sequence of oligonucleotides used for the qPCR experiments Twenty-four hours before iron absorption studies, cells were mRNA name Primer Primer sequences (forward and reverse) incubated with DMSO 0.1% or DADS 100 μmol in DMSO names added on their apical side. Then the medium was removed, Actin Rat actin 5′ ATCGTGGGCCGCCCTAGGCACCA 3′ and cells were rinsed 3 times with Hank's Balanced Salt 5′ TTGGCCTTAGGGTTCAGAGGGG 3′ DMT1 Rat 5′ GGCCTGTCGTTCCTGGACT 3′ Solution (HBSS) pH 6.5 on the apical side and with HBSS ′ ′ μ IRE-DMT1 5 GCTGGTATCTTCGCTCAGCAG 3 pH 7.5 on the basal side. A 10- mol solution of iron was Hum 5′ CTTCATATCTGCCTCTTCCCC 55 3 added at the apical side, consisting in a mixture of FeCl IRE-DMTI 3′ AAATCTGAGACTGACTGGACC (10 μCi/mL; PerkinElmer, Boston, Mass) and cold Fe-NTA Ferroportin Hum FPNI 5′ GGAGATCACAACCGCCAGA (FeCl mixed with a 4-fold molar excess of nitrilotriacetic 5′ AAGGAATTTTGCAGAGGTCAGGT 3 ′ ′ acid) dissolved in HBSS adjusted to pH 6.5. After 120-min S14 ribosomal Hum S14 5 CAGGACCAAGACCCCTGGA 3 protein 5′ ATCTTCATCCCAGAGCGAGC 3′ incubation, aliquots were removed from the basal and apical Hepcidin Rat Hepc 5′ TTCTCCTCCTTGCCAGCC 3′ chambers, media were discarded, and the cell monolayer 5′ TCTGCCCTGCTTTCTTCC 3′ was rinsed twice with radio immuno precipitation assay (RIPA) buffer (50 mmol Tris pH 8, 150 mmol NaCl, 1% (Immobilon Western kit; Millipore). The protein band was Triton X-100, 0.1% sodium dodecyl sulfate) and scrapped assessed according to its apparent molecular weight into 500 μL of RIPA buffer. Aliquots of medium and the compared with standard proteins (Protein Ladder Plus; whole cell lysates were then subjected to scintillation Fermentas Life Sciences, Saint-Rémy-lès-Chevreuse, counting to determine iron uptake (liquid scintillation France). As an internal control, blots were also incubated analyzer TMI-CARB 2300 TR, PACKARD). Total iron with an anti β-actin antibody (Sigma-Aldrich). absorption was calculated as the total counts in both the cell layer and the basal chamber. The percentage of iron transfer 2.10. RNA extraction and quantitative real-time polymerase was calculated as the ratio of the total amount of iron present chain reaction in the basal chamber at the end of the incubation period to the total iron absorption. Total RNAs were extracted from tissue or cultured cells using RNA-PLUS reagent (Q-Biogene, Europe) according to the manufacturer's recommendations. The cDNAs were 2.9. Western blotting obtained by reverse transcription of 1 μg of total RNAs in a μ Caco-2 cells were washed once with PBS and scraped final volume of 100 L. Real-time quantitative polymerase gently in a cold fresh solution of PBS/EDTA 2 mmol. After chain reaction (RT-qPCR) was performed in duplicate with the centrifugation for 5 minutes at 1400 rpm in the cold, the CHROMO IV Detector (MJ Research, Boston, Mass) using supernatant was removed and the cell pellet was resus- SYBR Green RCR according to the manufacturer's protocol. pended in lysis buffer (10 mmol Tris-HCl pH 7, 1 mmol Amplification of specific transcripts was confirmed by melting curves profiles generated at the end of the PCR program. MgCl2) containing protease inhibitors (PIs; Sigma P 8340 PIs cocktail) and phenylmethanesulphonylfluoride (PMSF) Primers used for amplification are indicated in Table 2.From (10 μg/mL). After 3 freeze-thaw cycles, cell suspension tissue, each target gene (R) was normalized arbitrarily on Ct β Δ − was centrifuged at 3500 rpm for 10 minutes at 4°C; the value for -actin ( Ct = CtR Ctβ-actin) or ribosomal S14 supernatant containing microsomal and cytosolic fractions mRNA. The relative amount of R mRNA levels between treated −ΔΔCt ΔΔ Δ was again centrifuged at 75 000 revolutions/min (Beckman groups is given by 2 ,where Ct = [ Ct(R) of treated − Δ TLA100 rotor) for 45 minutes to separate the crude group] [mean of Ct(R) of control group]. Relative gene membrane fractions from the cytosolic proteins. Membrane expression is normalized to 1.0 (100%) of controls. pellets were resuspended in tris NaCl EDTA (TNE) buffer 2.11. Statistical analyses (100 mmol NaCl, 10 mmol Tris-HCl pH 7, and 10 mmol EDTA) containing PIs and PMSF. Fifteen micrograms of Results are expressed as the means ± SD. Statistical proteins of microsomal fraction was used for immunoblot- analyses were performed using SPSS 10.0 for Windows ting. Proteins were diluted in Laemmli buffer and loaded (SPSS, Chicago, Ill). For the in vivo study, to determine onto a 12% sodium dodecyl sulfate–polyacrylamide gel and whether there were differences between all groups, a electroblotted onto polyvinylidene fluoride (PVDF) mem- Kruskal-Wallis test was performed and was followed by a brane. The blots were then incubated with rabbit FPN nonparametric Mann-Whitney U test to determine signi- antibody (dilution 1:3000), a kind gift from D. Haile, San ficant (P b .05) differences between pairs of groups (n = 5). Antonio, Tex, followed by incubation with peroxidase For the in vitro study, a 1-way analysis of variance test was conjugated AffiniPure goat antirat immunoglobulin G performed to determine whether there were differences (Jackson ImmunoResearch Laboratories, Inc, West Grove, between all groups, and it was followed by Bonferroni post PA, USA; dilution 1:30 000). Ferroportin was revealed hoc test if P b .05 to determine the significant differences using an enhanced chemiluminescence detection system between the 2 groups. A. Nahdi et al. / Nutrition Research 30 (2010) 85–95 89 3. Results more pronounced accumulation in the combined group (Fig. 1C, D) than in the iron supplemented group (Fig. 1A, 3.1. Effect of garlic and/or iron administration on B). Rare iron-overloaded Kuppfer cells (hepatic macro- body weight phages) were also present (Fig. 1B, D; arrow heads) but their We induced nutritional iron overload in rats using contribution to liver iron load was very low. carbonyl iron in the diet. The animals were fed an iron supplemented diet for 3 weeks, with or without garlic 3.3. Effect of garlic administration on markers of supplementation. All the body weights were increased at the oxidative stress end of the treatment. The presence of iron in the diet significantly reduced the food intake during the 3-week Iron in excess is known for inducing oxidative stress and period from 637 ± 15 g in the controls to 511 ± 32 g (P = .008) garlic for exerting either antioxidant or oxidant properties in the iron group and 425 ± 54 g (P = .008) in the garlic + iron depending on the ingested doses. Hence, we tested their group. Therefore, the body weight gain of the rats was lower respective effects using AOPP as markers of protein with iron alone (73 ± 25 g; P b .01) and with garlic + iron oxidative damage mediated by excess plasma iron. We (21.2 ± 14 g; P = .01) than in control group (153 ± 10 g). The foundthatonlythecombinationofgarlicandiron presence of garlic alone barely reduced the food intake (611 ± increased plasma AOPP, probably as a result of the 20 g versus 637 ± 15 g), and consequently, the weight gain important increase in serum iron (Table 3). Tissue iron was only moderately attenuated with garlic alone compared overload was accompanied by enhancement in lipid with control (133 ± 7.5 versus 153 ± 10 g; P = .01). peroxidation as shown by a significant increase in tissue MDA concentrations in iron supplemented group (Fig. 2, 3.2. Effect of garlic administration on serum and tissues left panels), in all tissues except the spleen. In the liver, iron concentrations there was a perfect correlation between MDA level and tissue iron content (R2 = 0.67), when the results of the 4 Iron alone induced a significant increase in serum iron and groups were combined (Fig. 2, on the right). This suggests transferrin saturation as well as a more than 10-fold increase that the presence of garlic in the diet does not offer in liver iron. There was also a 3-fold increase in spleen iron protection against iron-mediated oxidative damage. In the and only a moderate increase in heart or kidney iron content heart, there was a 2-fold increase in MDA content (Fig. 2, (Table 3). Interestingly, the presence of both iron and garlic on the left), despite a very modest increase in tissue iron induced a 2-fold increase in serum iron and a transferrin (Table 3), suggesting that the heart is a more sensitive saturation above 100%. There was also a noticeable, although organ to iron-mediated toxicity than the liver. In the not significant, increase in transferrin saturation in the kidney, there was only a moderate increase in MDA in the presence of garlic alone, suggesting that garlic increases treated groups (Fig. 2, on the left) and a significant intestinal iron absorption. Consequently, the presence of both correlation (R2 = 0.27) between MDA level and kidney iron and garlic induced a significant increase (1.5-fold) in the iron content (Fig. 2, on the right). extent of iron overload in liver as compared with the iron group but did not aggravate the iron burden in the other 3.4. Effect of garlic and/or iron administration on liver organs. In the presence of garlic alone, there was a slight hepcidin and duodenal DMT1 expressions significant increase in heart iron level (Table 3). Observation of Perls-stained liver sections from rats Nutritional iron overload is known to induce hepcidin receiving iron alone or garlic + iron showed that iron was gene expression [5]. Indeed, we found a robust increase in predominantly deposited in the periportal hepatocytes with a hepcidin mRNA level after iron ingestion (Fig. 3A), and

Table 3 Serum iron indices, plasma AOPP, and tissue iron concentrations of rats Groups Serum iron (μmol) Transferrin Plasma AOPP Liver iron Kidney iron Spleen iron Heart iron (n = 5) saturation a (%) (μmol) (μg Fe/g tissue) (μg Fe/g tissue) (μg Fe/g tissue) (μg Fe/g tissue) Control 26.7 ± 3.2 39.0 ± 10.4 210.5 ± 67 63.6 ± 7.6 59.4 ± 3.3 296.2 ± 21.1 72.4 ± 5.1 Iron 41.3 ± 8.2 ⁎ 80.0 ± 24.3A 149.4 ± 52 998.8 ± 45.4A 84.8 ± 7.7A 1040.7 ± 84.5A 105.7 ± 13.6 ⁎ Garlic 33.8 ± 7.8 63.8 ± 19.6 162.4 ± 19 70.6 ± 3.1 59.7 ± 1.6 184.0 ± 16.3 88.4 ± 2.7A Garlic +Iron 79.8 ± 4.9⁎,†,C 136.8 ± 14.4A,B,C 350.6 ± 177 1535.2 ± 105.4A,B,C 116.0 ± 15.1A 1122.0 ± 106.2A,C 101.1 ± 10.4⁎,‡ Control group and garlic group received the basal diet. Both iron groups (with and without garlic) received the basal diet supplemented with carbonyl iron (3%). All animals were fed distilled water by gavage, with or without garlic extract (1g/kg body weight). Treatments lasted for 3 weeks. Results correspond to the means ± SD of 5 animals. The different pairs of groups were compared using the Mann-Whitney U test. a Transferrin saturation was calculated using the formula serum iron (μmol/L)/Tf (g/L) × 4. ⁎ P = .01, A: .01 b P b .05 versus control. † P = .02, B: .02 b P b .05 versus iron-overloaded rats. ‡ P = .01, C: .01 b P b .05 versus garlic-treated rats. 90 A. Nahdi et al. / Nutrition Research 30 (2010) 85–95

Fig. 1. Iron accumulation in rat liver. Control and garlic groups received the basal diet. Both iron groups (with and without garlic) received the basal diet supplemented with carbonyl iron (3%). All animals were fed distilled water by gavage, with or without garlic extract (1g/kg body weight). Treatments lasted for 3 weeks. Perls' Prussian blue coloration (A and C: ×100; B and D: ×400) of liver sections from iron (A, B) and garlic + iron (C, D) group. A and C, Blue iron deposits predominantly in the periportal hepatocytes in iron loaded rats (A) with a portal-central gradient (the arrows ➞ indicate portal areas) that is more pronounced in the combined group (C). B and D. Magnification of portal areas with more iron accumulation in the parenchymal tissue (⇨) of combined group (D) than in iron-loaded group (B). Blue colored Kuppfer cells (arrow head) are rare.

there was no impairment when garlic was present in addition effect of garlic (or one of its constituents) on iron to iron. absorption using an in vitro model of cultured Caco-2 To try to elucidate the origin of the increased iron overload cells. Diallyl disulfide was used instead of garlic because it observed in the presence of both iron and garlic, we measured is one of the most biologically active compounds [17] isoform I DMT1 mRNA expression in the duodenum. There found in crude garlic. A monolayer of confluent Caco-2 are 4 DMT1 isoforms, resulting from alternative splicing and was challenged with DADS (100μmol) for 24 hours. Iron the use of 2 alternative upstream promoters [37]. We limited absorption and transfer were studied using 55Fe-NTA. our analysis to the mRNA encoding isoform I, the Treatment with DADS resulted in a significant reduction in predominant isoform in the duodenum. Iron, with or without the total amount of iron absorbed at the apical side during garlic supplementation, fully repressed DMT1 expression a 120-minute incubation period (P = .02, Bonferroni post (Fig. 3B). In addition, we found a significant reduction (P = hoc test) as compared with the control group (DMSO- .01, Mann-Whitney U test) in DMT1 expression in garlic- treated cells), as shown in Fig. 4A. However, there was an treated group as compared with control. increase in the percentage of iron transferred to the basolateral side of the cells after incubation with DADS for 24 hours (P b .01, Bonferroni post hoc test), indicating 3.5. Effect of DADS on iron absorption and protein that more iron was released by cells toward the basal expression in Caco-2 cells chamber (Fig. 4B). Considering that duodenum DMT1 expression was To investigate whether DADS-induced changes in iron repressed in garlic-treated rats, we wanted to confirm the absorption or transfer were mediated by changes in A. Nahdi et al. / Nutrition Research 30 (2010) 85–95 91

Fig. 2. Markers of oxidative stress in tissue. Control and garlic groups received the basal diet. Both iron groups (with and without garlic) received the basal diet supplemented with carbonyl iron (3%). All animals were fed distilled water by gavage, with or without garlic extract (1g/kg body weight). Malondialdehyde content (left) from the 4 groups of rats was measured in liver, heart, kidney, and spleen. Malondialdehyde contents were plotted against the corresponding tissue iron concentrations (right). Results correspond to the means ± SD of 5 rats (Mann-Whitney U test). aP b .01, A.01 b P b .05 versus control, cP b .01, C.01 b P b .05 versus garlic-treated rats. expression of iron transporter proteins, isoform 1 DMT1 and Stimulating Caco-2 cells with DADS induced no change FPN1 expression were determined in Caco-2 cells grown in DMT1 mRNA level (Fig. 4C)butresultedina with normal iron concentrations. significant increase in ferroportin expression, both at the 92 A. Nahdi et al. / Nutrition Research 30 (2010) 85–95 clove is crushed, the odorless precursor alliin is rapidly converted into allicin, which decomposes instantly into other oil-soluble compounds, such as diallyl sulfide, DADS, diallyl trisulfide, and ajoene [39]. At the same time, S-allylcysteine is formed via a pathway other than alliin/allicin pathway [39]. All these compounds of garlic are biologically active [17]. Any of these components can theoretically increase iron bioavailability form carbonyl iron. In addition to allicin, a single clove of garlic contains several other compounds that can interfere with iron bioavailability such as polyphenols, a potent inhibitor of iron absorption [40], or vitamin C, a reducing agent that enhances iron absorption [41]. Our experiments in Caco-2 cells suggest that DADS tend to prevent iron uptake at the apical side of the enterocytes without altering DMT1 expression. These results suggest that DADS could reduce iron availability, although this effect may only be seen with Fe-NTA, the chemical form of iron used in the cell experiments. The second mechanism by which garlic can interfere with intestinal iron absorption is by inducing changes in gene expression. Interestingly, we found that garlic alone diminished DMT1 mRNA expression in rat duodenal Fig. 3. Changes induced by iron and/or garlic in liver hepcidin and duodenal DMT1 expression. Control and garlic groups received the basal enterocytes, as compared with rat fed a normal diet diet. Both iron groups (with and without garlic) received the basal diet without garlic supplementation. This did not lead to supplemented with carbonyl iron (3%). All animals were fed distilled water reduced iron stores, at least not on the time scale of the by gavage, with or without garlic extract (1g/kg body weight). A, Liver experiments (3 weeks). This reduction in DMT1 duodenal hepcidin mRNAs were measured by quantitative RT-qPCR and normalized mRNA is probably not attributable to DADS because this to actin mRNA. B, Duodenum DMT1 mRNAs were measured by RT- qPCR and normalized to actin mRNA. Results correspond to the means ± component alone does not change DMT1 expression in SD of 5 rats (Mann-Whitney U test). aP = .01 versus control, bP = .02 Caco-2 cells. This result is at odds with the observation versus garlic-treated rats. that garlic enhances intestinal iron absorption, as shown by a modest increase in transferrin saturation in the presence of garlic alone, or by a 50% increase when both iron and mRNA (P b .01, Bonferroni post hoc test, Fig. 4D) and garlic are given to the animals. Based on the observation protein level (Fig. 4E). made in Caco-2 cells that DADS induces ferroportin expression at both the mRNA and protein levels, it is possible to speculate that garlic increases duodenal 4. Discussion ferroportin expression, leading to increased export of iron, with a net increase in intestinal iron absorption. In the present study, we investigated the influence of However, this would have to be confirmed by measuring garlic (or its main active component, DADS) on iron ferroportin expression in the duodenum. bioavailability and toxicity using in vivo (rats fed iron There was a huge increase in hepcidin mRNA expression adequate diet or 3% iron carbonyl supplemented diet) and in in iron-overloaded rat livers, irrespective of the presence of vitro (the human intestinal Caco-2 cells) models. We chose garlic in the diet. This is in agreement with previous studies carbonyl iron as a source of iron because it is a frequently showing that nutritional iron overload increases hepcidin used compound in nutritional iron-overload models. We expression [42]. However, this increase was not sufficient to found that garlic increased iron absorption as shown by prevent increased intestinal iron absorption and onset of increased plasma iron levels and higher degree of liver iron iron overload. overload when iron was given in the presence of garlic. High-iron diet is known to enhance lipid peroxidation in Under our conditions, the presence of garlic in the diet did vivo, as measured by thiobarbituric acid–reactive substances not bring about any obvious protection against iron-mediated [43]. The production of reactive oxygen species by iron is oxidative stress. mainly through the Fenton reaction, which eventually There are several possible mechanisms by which garlic catalyzes the formation of hydroxyl radicals from superoxide can increase intestinal iron absorption. First, it can or hydrogen peroxide [44]. These observations are consistent contribute to iron mobilization from the diet acting either with immunohistochemical detection of increased levels of as a chelator or as a reducing agent [38]. When a garlic MDA and 4-hydroxynonenal adducts in liver and plasma A. Nahdi et al. / Nutrition Research 30 (2010) 85–95 93

Fig. 4. Effect of DADS (main active component of garlic) on iron uptake and protein expression in Caco-2 cells. Caco-2 cells were grown on filters, and confluent cells were incubated in control medium (control), with 0.1% DMSO alone (DMSO) or with 100 μmol DADS in DMSO (DADS). For the iron uptake studies, 55Fe-NTA with a final concentration of 10 μmol of iron was added at the apical side and the cells were incubated for 120 minutes. The total iron uptake (A) represents the sum of the iron transferred in the basal chamber and of the iron remaining in the cells after the 120-minute incubation period. Results are expressed as dpm/well. The percentage of iron transfer (B) is the ratio of the total amount of iron present in the basal chamber at the end of the incubation period to the total iron uptake. For gene expression studies, the cells were incubated for 24 hours in control medium (control), in the presence of DMSO alone (DMSO) or in the presence of DADS (DADS, 100 μmol dissolved in DMSO). Divalent metal transporter-1 (C) and ferroportin (D) mRNAs were measured by RT-qPCR and normalized to S14 mRNA. Ferroportin protein (E) was measured by Western blotting. Actin was used as an internal standard. Results correspond to the means ± SD (Bonferroni post hoc test). aP b .01, bP = .02 versus DMSO-treated cells.

proteins of rats maintained on diets containing iron carbonyl antioxidant defenses are probably sufficient to prevent iron- [45-47]. In the present work, we only observed increased mediated oxidation. plasma AOPP in rats receiving both iron and garlic. This is In tissues, we observed marked differences in terms of compatible with the observation that serum iron is very high oxidative responses. In the spleen, neither iron nor garlic in this condition, and transferrin saturation is more than affected MDA content. In the liver, there was a highly 100%. This most certainly results in the presence of significant correlation between tissue iron content and MDA nontransferrin-bound iron, although we were not able to levels when combining the results from the 4 groups of assess this directly. This form of iron is particularly toxic and animals. This result suggests that MDA levels reflect iron- prone to favor the formation of reactive oxygen species [48]. mediated toxicity and that garlic does not offer any In the other conditions tested in this study, the plasma protection. In the heart, there was a greater dispersion of 94 A. Nahdi et al. / Nutrition Research 30 (2010) 85–95 the results, probably because of the increased sensitivity of [10] Agarwal KC. Therapeutic action of garlic constituents. Med Res Rev the heart to iron-mediated toxicity [49,50]. Finally, in the 1996;16:111-24. [11] Tattelman E. Health effects of garlic. Am Fam Physician 2005;72: kidney, iron with and without garlic, but also garlic alone, 103-6. increased MDA contents. This is contradictory with results [12] Mahmoodi M, Islami MR, Asadi Karam GR, Khaksari M, Sahebgha- from the literature showing that pretreatment of animals with dam Lotfi A, Hajizadeh MR, et al. Study of the effects of raw garlic garlic oil attenuates oxidative stress and toxicity mediated by consumption on the level of lipids and other blood biochemical factors Fe-NTA in rat kidney [26]. However, one limitation of our in hyperlipidemic individuals. Pak J Pharm Sci 2006;19:295-8. [13] Yeh YY, Yeh SM. Garlic reduces plasma lipids by inhibiting hepatic study is the high dose of garlic that was used. It has been cholesterol and triacylglycerol synthesis. Lipids 1994;29:189-93. reported that the beneficial effects obtained by low doses of [14] Koscielny J, Klüssendorf D, Latza R, Schmitt R, Radtke H, Siegel G, garlic (up to 500 mg/kg) on oxidative stress might be lost in et al. The antiatherosclerotic effect of Allium sativum. Atherosclerosis the presence of higher doses of 1 g/kg and above [51]. 1999;144:237-49. Association between organosulfur compounds and iron [15] Siegel G, Klüssendorf D. The anti-atheroslerotic effect of Allium sativum: statistics re-evaluated. Atherosclerosis 2000;150:437-8. metabolism [52,53] is seldom studied. Our data suggest [16] Galeone C, Pelucchi C, Dal Maso L, Negri E, Montella M, Zucchetto that consumption of crude garlic could modify iron A, et al. Allium vegetables intake and endometrial cancer risk. Public metabolism through changes in iron export via ferroportin. Health Nutr 2008;6:1-4. The nutritional relevance of such data to humans remains [17] Shukla Y, Kalra N. Cancer chemoprevention with garlic and its to be determined. Even if our data were somehow constituents. Cancer Lett 2007;247:167-81. [18] Chan KC, Yin MC, Chao WJ. Effect of diallyl trisulfide-rich garlic oil conflicting, due to the different models and more likely on blood coagulation and plasma activity of anticoagulation factors in to the different iron status in the in vivo and in vitro rats. Food Chem Toxicol 2007;45:502-7. models used, they highlight the need for additional studies [19] Steiner M, Li W. Aged garlic extract, a modulator of cardiovascular testing different doses of garlic and possible interactions risk factors: a dose-finding study on the effects of AGE on platelet between iron therapy and garlic intake. These studies functions. J Nutr 2001;131:980S-4S. [20] Silagy CA, Neil HA. A meta-analysis of the effect of garlic on blood would be of interest for countries where there is a large pressure. Hypertension 1994;12:463-8. consumption of garlic and where nutritional anemia is still [21] Amagase H, Moriguchi T, Kasuga S. Comparison of oxidative damage a public health concern. of garlic preparation including enteric-coated garlic powder preparation and allicin-derived compounds on erythrocyte and duodenum. Phytomed supplement 2000;II:118. Acknowledgment [22] Dixit VP, Joshi S. Effects of chronic administration of garlic (Allium sativum Linn) on testicular function. Indian J Exp Biol 1982;20: We are grateful to the Tunisian Ministry of Superior 534-6. Education and Scientific Research for financial support. [23] Hammami I, Nahdi A, Mauduit C, Benahmed M, Amri M, Ben Amar A, et al. The inhibitory effects on adult male reproductive functions of crude garlic (Allium sativum) feeding. Asian J Androl 2008;10: 593-601. References [24] Hammami I, Amara S, Benahmed M, El May MV, Mauduit C. Chronic crude garlic-feeding modified adult male rat testicular markers: [1] Khan MF, Wu X, Tipnis UR, Ansari GA, Boor PJ. Protein adducts of mechanisms of action. Reprod Biol Endocrinol 2009;7:65. malondialdehyde and 4-hydroxynonenal in livers of iron loaded rats: [25] Agarwal MK, Iqbal M, Athar M. Garlic oil ameliorates ferric quantitation and localization. Toxicology 2002;173:193-201. nitrilotriacetate (Fe-NTA)–induced damage and tumor promotion: [2] Batts KP. Iron overload syndromes and the liver. Modern Pathol 2007; implications for cancer prevention. Food Chem Toxicol 2007;45: 20:S31-9. 1634-40. [3] Frazer DM, Anderson GJ. Iron imports. I. Intestinal iron absorption [26] Iqbal M, Athar M. Attenuation of iron-nitrilotriacetate (Fe-NTA)– and its regulation. Am J Physiol Gastrointest Liver Physiol 2005;289: mediated renal oxidative stress, toxicity and hyperproliferative G631-5. response by the prophylactic treatment of rats with garlic oil. Food [4] Pigeon C, Ilyn G, Crouselaud B, Leroyer P, Turlin B, Brissot P, et al. A Chem Toxicol 1998;36:485-95. new mouse liver specific gene, encoding a protein homologous to [27] Chantret I, Rodolosse A, Barbat A, Dussaulx E, Brot-Laroche E, human antimicrobial peptide hepcidin, is overexpressed during iron Zweibaum A, et al. Differential expression of sucrase-isomaltase in overload. J Biol Chem 2001;276:7811-9. clones isolated from early and late passages of the cell line CaCo-2: [5] Nicolas G, Viatte L, Lou DQ, Bennoun M, Beaumont C, Kahn A, et al. evidence for glucose-dependent negative regulation. J Cell Sci 1994; Constitutive hepcidin expression prevents iron overload in a mouse 107:213-25. model of hemochromatosis. Nat Genet 2003;34:97-101. [28] Mahraoui L, Rodolosse A, Barbat A, Dussaulx E, Zweibaum A, [6] Ganz T. Molecular pathogenesis of anemia of chronic disease. Pediatr Rousset M, et al. Presence and differential expression of SGLT1, Blood Cancer 2006;46:554-7. GLUT1, GLUT2, GLUT3 and GLUT5 hexose-transporter mRNAs in [7] Darshan D, Anderson GJ. Interacting signals in the control of hepcidin CaCo-2 cell clones in relation to cell growth and glucose consumption. expression. Biometals 2009;22:77-87. Biochem J 1994;298:629-33. [8] Nemeth E, Tuttle MS, Powelson J, Vaughn MB, Donovan A, Mc Vey [29] Tandy S, Williams M, Leggett A, Lopez-Jimenez M, Dedes M, Ward D, et al. Hepcidin regulates cellular iron efflux by binding to Ramesh B, et al. Nramp2 expression is associated with pH-dependent ferroportin and inducing its internalization. Science 2004;306:2090-3. iron uptake across the apical membrane of human intestinal CaCo-2 [9] Delaby C, Pilard N, Gonçalves AS, Beaumont C, Canonne-Hergaux F. cells. J Biol Chem 2000;275:1023-9. Presence of the iron exporter ferroportin at the plasma membrane of [30] Thomas C, Oates PS. Ferroportin/IREG-1/MTP-1/SLC40A1 modu- macrophages is enhanced by iron loading and down-regulated by lates the uptake of iron at the apical membrane of enterocytes. Gut hepcidin. Blood 2005;106:3979-84. 2004;53:44-9. A. Nahdi et al. / Nutrition Research 30 (2010) 85–95 95

[31] Hamdaoui MH, Chahed A, Ellouze-Chabchoub S, Marouani N, Ben [43] Lafay S, Gueux E, Rayssiguier Y, Mazur A, Rémésy C, Scalbert A. Abid Z, Hédhili A. Effect of green tea decoction on long-term iron, Caffeic acid inhibits oxidative stress and reduces hypercholesterol- zinc and selenium status of rats. Ann Nutr Metab 2005;49:118-24. emia induced by iron overload in rats. Int J Vitam Nutr Res 2005;75: [32] Adrian J, Rabache M, Frangne R. Techniques d'analyse nutritionnelle. 119-25. In: Association pour la promotion Industrie Agriculture, editor. [44] Crichton RR, Wilmet S, Legssyer R, Ward RJ. Molecular and cellular Techniques d'analyse et de contrôle dans les industries agro- mechanisms of iron homeostasis and toxicity in mammalian cells. alimentaires. Paris: Technique et documentation; 1981. p. 393-420. J Inorg Biochem 2002;91:9-18. [33] Lyoumi S, Abitbol M, Andrieu V, Henin D, Robert E, Schmitt C, et al. [45] Carthew P, Dorman BM, Edwards RE, Francis JE, Smith AG. A Increased plasma transferrin, altered body iron distribution, and unique rodent model for both the cardiotoxic and hepatotoxic effects of microcytic hypochromic anemia in ferrochelatase-deficient mice. prolonged iron-overload. Lab Invest 1993;69:217-22. Blood 2007;109:811-8. [46] Houglum K, Filip M, Witztum JL, Chojkier M. Malondialdehyde and [34] Witko-Sarsat V, Friedlander M, Nguyen Khoa T, Capeillère-Blandin 4-hydroxynonenal protein adducts in plasma and liver of rats with iron C, Nguyen AT, Canteloup S, et al. Advanced oxidation protein overload. J Clin Invest 1990;86:1991-8. products as novel mediators of inflammation and monocyte activation [47] Whittaker P, Chanderbhan R, Clavert R, Dunkel V. Cellular and in chronic renal failure. J Immunol 1998;161:2524-32. molecular responses in the Sprague-Dawley rat to chronic iron [35] Buege JA, Aust SD. Microsomal lipid peroxidation. Methods Enzymol overload. J Trace Elem Exp Med 1994;7:19-31. 1978;52:302-10. [48] Cabantchik ZI, Breuer W, Zanninelli G, Cianciulli P. LPI-labile [36] Bradford MM. A rapid and sensitive method for the quantitation of plasma iron in iron overload. Best Pract Res Clin Haematol 2005;18: microgram quantities of protein utilizing the principle of protein-dye 277-87. binding. Anal Biochem 1976;72:248-54. [49] Lekawanvijit S, Chattipakorn N. Iron overload thalassemic cardiomy- [37] Hubert N, Hentze MW. Previously uncharacterized isoforms of opathy: iron status assessment and mechanisms of mechanical and divalent metal transporter (DMT)-1: implications for regulation and electrical disturbance due to iron toxicity. Can J Cardiol 2009;25: cellular function. Proc Natl Acad Sci U S A 2002;99:12345-50. 213-8. [38] Dairam A, Fogel R, Daya S, Limson JL. Antioxidant and iron-binding [50] Yang T, Dong WQ, Kuryshev YA, Obejero-Paz C, Levy MN, properties of curcumin, capsaicin, and S-allylcysteine reduce oxidative Brittenham GM, et al. Bimodal cardiac dysfunction in an animal model stress in rat brain homogenate. J Agric Food Chem 2008;56:3350-6. of iron overload. J Lab Clin Med 2002;140:263-71. [39] Amagase H, Petesh BL, Matsuura H, Kasuga S, Itakura Y. Intake of [51] Banerjee SK, Maulik M, Mancahanda SC, Dinda AK, Gupta SK, garlic and its bioactive components. J Nutr 2001;131:955S-62S. Maulik SK. Dose-dependent induction of endogenous antioxidants in [40] Temme EH, Van Hoydonck PG. Tea consumption and iron status. Eur rat heart by chronic administration of garlic. Life Sci 2002;70: J Clin Nutr 2002;56:379-86. 1509-18. [41] Thankachan P, Walczyk T, Muthayya S, Kurpad AV, Hurrell RF. Iron [52] Freeman F, Kodera Y. Garlic chemistry: stability of S-(2-propenyl)2- absorption in young Indian women: the interaction of iron status with propene-1-sulfinothioate (allicin) in blood, solvents, and simulated the influence of tea and ascorbic acid. Am J Clin Nutr 2008;87:881-6. physiological fluids. J Agric Food Chem 1995;43:2332-8. [42] Harrison-Findik DD, Klein E, Crist C, Evans J, Timchenko N, Gollan [53] Klingberg J, Beviz A, Ohlson CG, Tenhunen R. Disturbed iron J. Iron-mediated regulation of liver hepcidin expression in rats and metabolism among workers exposed to organic sulfides in a pulp plant. mice is abolished by alcohol. Hepatology 2007;46:1979-85. Scand. J Work Environ Health 1988;14:17-20.