DOCSLIB.ORG

Performance Comparison of a Flic H7 Real-Time PCR Assay with an H7

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Performance Comparison of a Flic H7 Real-Time PCR Assay with an H7 2195 Journal of Food Protection, Vol. 72, No. 10, 2009, Pages 2195–2197 Research Note Performance Comparison of a fliCh7 Real-Time PCR Assay with an H7 Latex Agglutination Test for Confirmation of the H Type of Escherichia coli O157:H73 NEELAM NARANG,1* PINA M. FRATAMICO,2 GLENN TILLMAN,1 KITTY PUPEDIS,1 AND WILLIAM C. CRAY, JR.1 1U.S. Department of Agriculture, Food Safety and Inspection Service, Outbreak Section of the Eastern Laboratory, 950 College Station Road, Athens, Georgia 30605; and 2U.S. Department of Agriculture, Agricultural Research Service, Eastern Regional Research Center, 600 East Mermaid Lane, Wyndmoor, Pennsylvania 19038, USA MS 09-069: Received 11 February 2009/Accepted 8 May 2009 ABSTRACT Escherichia coli O157:H7 is a foodborne pathogen that causes hemorrhagic colitis and hemolytic uremic syndrome. Positive identification of E. coli O157:H7 is made using biochemical tests and specific antisera or latex agglutination reagents for the O157 and H7 antigens. However, under certain conditions, some E. coli O157:H7 isolates can appear to be nonreactive with H7 antisera and may require multiple passages on motility medium to restore H7 antigenicity. In this study, we compared the performance of a real-time PCR test with that of a method using latex agglutination reagents to detect the presence of the fliCh7 gene or the H7 antigen, respectively, in E. coli O157:H7 isolates. One hundred twenty-six E. coli strains were tested including reference strains and strains isolated from meat. Lyophilized E. coli O157:H7 isolates were rehydrated and were plated on sheep blood agar without passage on motility medium. All strains were analyzed in parallel by a real-time PCR test targeting the fliCh7 gene and by a latex agglutination test that detects the H7 antigen. The real-time PCR assay showed 100% agreement with the H7 status reported for reference strains and E. coli O157:H7 meat isolates. The latex agglutination test results agreed with the H7 status reported for the E. coli O157:H7 reference strains and non-O157:H7 strains, except for one, E. coli O117:H7; however, 42% (42 of 100) of the E. coli O157:H7 meat isolates tested negative for the H7 antigen by latex agglutination. The real-time fliCh7 PCR test can be used to confirm E. coli O157:H7 strains that are not expressing the immunoreactive H7 antigen. Enterohemorrhagic Escherichia coli O157:H7 is a PCR technology is being used due to its rapidity, foodborne pathogen of major public health significance that sensitivity, and specificity as an alternative to or in causes hemorrhagic colitis and hemolytic uremic syndrome conjunction with culture-based and immunology-based (6–8). Foods of bovine origin, fresh produce, and contam- methods for pathogen detection (2–5). The purpose of this inated water have been linked to outbreaks of E. coli study was to analyze E. coli O157:H7 isolates and compare O157:H7 infection. Rapid detection and accurate identifica- the performance of a real-time PCR assay that detects the tion of this pathogen are critical to prevent contaminated food fliCh7 gene with the performance of a latex agglutination test from reaching consumers. Positive identification of E. coli that detects the H7 antigen. O157:H7 is made using biochemical tests to identify an isolate as E. coli and by serological confirmation of the O157 MATERIALS AND METHODS and H7 antigens by latex agglutination using specific antisera Bacterial strains. One hundred twenty-six E. coli strains (9, 10). Latex agglutination tests are rapid and inexpensive. were tested, which included 5 O157:H7 ATCC reference strains, 5 However, some isolates are nonmotile or are motile but non-O157 strains that were H7 positive (2 each of O117:H7 and show a weak reaction with typing reagents, making a O79:H7 and 1 O55:H7), 16 non-O157 strains that were H7 determination of presence of the H7 flagellar antigen negative (2 O125:H25, 1 each of O88:H25, O165:25, O111:H2, 2 difficult. Other isolates may require multiple passages on O145:H , O45:H21, O22:H21, O45:H2, O103:H2, O26:H2, motility medium before the H7 antigen is detected (11), O95:NM, O126:H27, O22:H5, O121:H9, and O85:H1), and 100 adding days to the analysis. O157:H7 strains isolated from meat, of which 10 strains were involved in outbreaks (Table 1). The strains were obtained from the U.S. Department of Agriculture (USDA) Food Safety and * Author for correspondence. Tel: 706-546-3618; Fax: 706-546-3518; E-mail: [email protected]. Inspection Service and the USDA Agricultural Research Service, { Mention of specific brand or trade names does not constitute endorsement Eastern Regional Research Center (ERRC), culture collections. or selectivity by the U.S. Department of Agriculture, Food Safety and The strains were lyophilized (Kinetics Thermal Systems, Stone Inspection Service, over similar products that might also be suitable. Ridge, NY) and stored at 270uC. 2196 NARANG ET AL. J. Food Prot., Vol. 72, No. 10 TABLE 1. E. coli isolates tested for H7 by latex agglutination and fliCh7 PCR tests No. of latex test– and fliCh7 No. of latex test–negative and Strain Total no. tested PCR–positive isolates fliCh7 PCR–positive isolates Reference E. coli O157:H7 5 5 0 Reference E. coli non-O157, H7 negative 16 0 0 Reference E. coli non-O157, H7 positive 5 4 1 E. coli O157:H7 strains isolated from meat 100 58 42 Non–E. coli O157 strains 4 0 0 Primers and probe. The primers targeting the fliCh7 gene consisted of 94uC for 2 min, followed by 40 cycles of 94uC for and probe (4) designed at the USDA-ERRC were obtained from 20 s, 60uC for 60 s, and 72uC for 50 s. IDT DNA Technologies (Coralville, IA). The primers used were fliCh7-1068 F (59 TACCATCGCAAAAGCAACTCC 39) and RESULTS AND DISCUSSION FliCh7-1314 R (59 GTCGGCAACGTTAGTGATACC 39). The The primers and probe targeting the flich7 gene were probe used was fliCh7-p 59 TET-CGGCTGCCGCGACATCTT- CAAT 39-BHQ1. specific for E. coli O157 and non-O157 E. coli strains possessing the H7 antigen, with representative real-time Agglutination assay. One milliliter of brain heart infusion fluorescence curves as shown in Figure 1. Agarose gel broth was added to the lyophilized culture. The culture was electrophoresis of the reaction mixture confirmed the resuspended by mixing gently with an inoculating loop, and a presence of the specific 247-bp flich7 PCR product loopful of resuspended culture was streaked onto sheep blood agar (Fig. 2). The real-time PCR assay showed 100% agreement plate (Remel, Lenexa, KS), incubated at 35uC for 18 h, and then with the H7 status reported for the reference strains and the analyzed by a commercial latex agglutination test (Remel) (12). E. coli O157:H7 meat isolates. The latex agglutination test Essentially, for each isolate, one drop of test latex solution (anti–E. results agreed with the H7 status reported for the reference coli O157 or H7) was dispensed onto separate wells of test slide. A E. coli O157 isolates (Table 1) except for one isolate portion of isolated colony to be tested was thoroughly emulsified with a plastic stick in the drop. Each drop was spread, and the slide (O117:H7), which showed a negative reaction. However, was rotated in a circular motion for up to 1 min or until 42% (42 of 100) of the E. coli O157:H7 meat isolates tested agglutination was evident. The positive and negative controls negative for the H7 antigen by latex agglutination (Table 1). from the kit were tested in parallel. Confirmatory testing of E. coli O157:H7 requires identification of the O (lipopolysaccharide) and H (flagellar) Preparation of DNA template and real-time PCR. The antigens. However, some E. coli O157:H7 strains show a isolated colonies from blood agar plates were suspended in 100 ml negative reaction with the H7 latex agglutination test and of saline and heated at 99uC for 10 min. After cooling on ice, the may require multiple passages on motility test medium to | tubes were centrifuged at 16,000 g for 2 min, and the obtain expression of the flagella (1), delaying identification supernatant was used as the DNA template. The PCR mixture of E. coli O157:H7 isolates. If the H7 type is not was prepared using OmniMix HS beads (Fisher Scientific, Pittsburgh, PA) reconstituted according to the manufacturer’s determined, the strain will not be correctly identified as instructions, which contained 1.5 U TaKaRa hot-start Taq belonging to serotype O157:H7. In the present study, 42% polymerase, 200 mM deoxynucleoside triphosphates, 4 mM of the isolates were negative by the latex agglutination test. MgCl2, 25 mM HEPES, pH 8.0 per 25-ml of reaction mixture, and then 0.25 mM concentrations of each primer and a 0.125 mM concentration of probe were added. To 22.5 ml of reaction mixture, 2.5 ml of template DNA was added. The PCR was performed using a Smart Cycler II (Cepheid, Sunnyvale, CA); the cycling protocol FIGURE 1. PCR assay graph displaying amplification of E. coli O157:H7–positive isolates with a Ct (threshold cycle) value of 15 using fliCh7 primers and probe. There was no signal with E. coli FIGURE 2. An agarose gel showing a 247-bp PCR product of the O157:H7–negative isolate. fliCh7 gene. J. Food Prot., Vol. 72, No. 10 FLICH7 PCR AND H7 LATEX AGGLUTINATION TEST 2197 The negative test results were likely due to insufficient 2. Fields, P. I., K. Blom, H. J. Hughes, L. O. Helsel, P.
Load more

Recommended publications
  • Serotyping of Bdellovibrios by Agglutination and Indirect Immunofluorescence
    INTERNATIONAL JOURNAL OF SYSTEMATICBACT~RIOLOGY. Oct. 1983, p. 816-821 Vol. 33, No. 4 0020-7713/83/040816-06$02.00/0 Copyright 0 1983, Internationnl Union of Microbiologicdl Societie\ Serotyping of Bdellovibrios by Agglutination and Indirect Immunofluorescence M. E. SCHELLING’* AND S. F. CONTI’ Department Biology, Texus A &M Unitwsit?, College Station, Texus 77843‘ und University of Mussa ch us et t s , A rn ii erst, Muss N c h iiset t J 0 1 002’ A comparative serological study was undertaken to clarify the uncertain interrelationships among various bdellovibrios. A total of 17 predacious (host- dependent) strains and 12 nonpredacious strains were serotyped. Strains were grouped into serotypes on the basis of positive agglutination and strongly positive fluorescence cross-reactions. The results of division of the strains into serogroups by these two methods were identical. Bdellovihrio starrii strain A3.12 and Bdellovibrio stolpii strain UKi2 were found to be antigenically distinct from each other and from the group of strains comprising Bdellovihrio hacteriovorus; the latter was found to be an antigenically heterogeneous group consisting of at least nine serogroups. All nonpredacious strains were found to be related antigenically to their obligately predacious counterparts. An antigen(s) common to all of the Bdellovibrio strains examined was exhibited as weakly positive fluorescence. Selected strains of Bdellovihrio were studied by Ouchterlony immunodiffusion, which confirmed the serogrouping results and provided a technically simple method of serotyping. Further immunochemical characterization of the strains of Bdellovihrio in conjunction with increased knowledge of other differences among strains will likely result in the formation of additional species of Bdellovihrio.
    [Show full text]
  • Igm Autoantibody Testing by Latex Agglutination Nephelometry and Elisa in Patients with Rheumatoid Arthritis
    European Journal of Molecular & Clinical Medicine ISSN 2515-8260 Volume 07, Issue 08, 2020 Comparative Study Of Rheumatoid Factor - Igm Autoantibody Testing By Latex Agglutination Nephelometry And Elisa In Patients With Rheumatoid Arthritis Dr.C. Devi1, Dr.R. Ravichandran2, Dr. Logeswari Selvaraj3, Dr.S. Ramesh4, Dr.T. Aarthipriya5 1,2,3,4,5Senior Assistant professor Department of Microbiology, Government Kilpauk Medical College, Chennai mail id: [email protected] ABSTRACT Objectives: To test Rheumatoid factor (RF) IgM autoantibody in Patients with Rheumatoid Arthritis by various methods like latex agglutination, Nephelometer and ELISA. Comparative analysis of the sensitivity and specificity of the tests performed. Materials and Methods: The study was conducted for a period of six months from June 2018 to November 2018 in a tertiary care hospital in Chennai. 90 patients attending Rheumatology OPD or admitted in the ward with the diagnosis of Rheumatoid arthritis, satisfying the inclusion and exclusion criteria were taken up for the study. Inclusion criteria: Clinically diagnosed Rheumatoid Arthritis patient as per revised ACR 1987 classification criteria. Duration of symptoms (1yr- early (RA) 1 Yr. (Established RA). Exclusion Criteria: Those with systemic connective tissue diseases like SLE, Scleroderma, MCTD, Sjogren syndrome, those with chronic liver diseases, tuberculosis, subacute Bacterial endocarditis, Pregnancy, Lympho reticular malignancies are excluded for the study. Those with onset 16 years of age are also excluded. Under aseptic precautions about 3ml of blood was collected from each Patient. Rheumatoid factor (RF) IgM was tested for each patient by all three methods Latex agglutination, Nephelometry and ELISA. Results: IgM rheumatoid factor (RF) was detected in the sera of 90 patients with Rheumatoid Arthritis.
    [Show full text]
  • Routine Quantification of Rheumatoid Factor by Rate Nephelometry
    Ann Rheum Dis: first published as 10.1136/ard.44.6.379 on 1 June 1985. Downloaded from Annals of the Rheumatic Diseases, 1985, 44, 379-383 Routine quantification of rheumatoid factor by rate nephelometry P J ROBERTS-THOMSON, R McEVOY, T LANGHANS AND J BRADLEY From the Department of Clinical Immunology, Flinders Medical Centre, South Australia 5042 SUMMARY In a cross-sectional study of over 3000 consecutive serum specimens the levels of rheumatoid factor (RF) measured by rate nephelometry (Beckman ICS II) were compared with values obtained by the more traditional methods of sheep cell agglutination (Rose-Waaler) and latex agglutination. Similar values for sensitivity and specificity were found for all three methods for rheumatoid arthritis, with nephelometry giving slightly higher levels of sensitivity for other rheumatic disorders. A significant correlation (r=0-46, p<001) was found between the nephelometric and Rose-Waaler method for 147 consecutive seropositive specimens. Of interest, however, several disparate results were observed, and explanations for these were sought. Longitudinal studies of RF were performed in 49 seropositive patients over a two-year period. The nephelometric method was considered superior compared with the other techniques because of its ability to detect changes in absolute levels at earlier stages and its low interassay coefficient of variance (11%). copyright. We conlcude that the nephelometric technique appears suitable for routine diagnostic use, offers several advantages compared with more traditional methods, and is no more expensive per test specimen than the Rose-Waaler technique. http://ard.bmj.com/ Traditionally, rheumatoid factor (RF) has been interaction of RF with heat aggregated human IgG.
    [Show full text]
  • Classic Methods Revisited Widal Agglutination Test − 100 Years Later
    Postgrad Med J 2000;76:80–84 © The Fellowship of Postgraduate Medicine, 2000 Classic methods revisited Postgrad Med J: first published as 10.1136/pmj.76.892.80 on 1 February 2000. Downloaded from Widal agglutination test − 100 years later: still plagued by controversy Lateef A Olopoenia, Aprileona L King Summary Agglutination is a classic serologic reaction that results in clumping of a cell sus- We review the significance of the pension by a specific antibody, directed against a specific antigen. Such tests have Widal agglutination test in the been widely used for detection of antibodies against various disease-producing diagnosis of typhoid fever. Over micro-organisms in serum for a long time. The Widal agglutination test, devel- 100 years since its introduction as oped by F Widal in 18961 to aid in the diagnosis of typhoid fever, utilises a sus- a serologic means of detecting the pension of killed Salmonella typhi as antigen, to detect typhoid fever in serum presence of typhoid fever, the from suspected S typhi-infected patients who present with febrile illness. The Widal test continues to be plagued value and clinical application of the Widal test in developed countries has with controversies involving the diminished considerably in recent years2 and a large number of antigenically quality of the antigens used and related determinants of both typhoid and non-typhoid Salmonella organisms are interpretation of the result, par- now recognised. We therefore decided to review the significance of this ticularly in endemic areas. Areas sero-diagnostic test for typhoid fever in modern medicine, and to discuss new of concern with clinical and labo- and innovative alternative diagnostic tests.
    [Show full text]
  • I M M U N O L O G Y Core Notes
    II MM MM UU NN OO LL OO GG YY CCOORREE NNOOTTEESS MEDICAL IMMUNOLOGY 544 FALL 2011 Dr. George A. Gutman SCHOOL OF MEDICINE UNIVERSITY OF CALIFORNIA, IRVINE (Copyright) 2011 Regents of the University of California TABLE OF CONTENTS CHAPTER 1 INTRODUCTION...................................................................................... 3 CHAPTER 2 ANTIGEN/ANTIBODY INTERACTIONS ..............................................9 CHAPTER 3 ANTIBODY STRUCTURE I..................................................................17 CHAPTER 4 ANTIBODY STRUCTURE II.................................................................23 CHAPTER 5 COMPLEMENT...................................................................................... 33 CHAPTER 6 ANTIBODY GENETICS, ISOTYPES, ALLOTYPES, IDIOTYPES.....45 CHAPTER 7 CELLULAR BASIS OF ANTIBODY DIVERSITY: CLONAL SELECTION..................................................................53 CHAPTER 8 GENETIC BASIS OF ANTIBODY DIVERSITY...................................61 CHAPTER 9 IMMUNOGLOBULIN BIOSYNTHESIS ...............................................69 CHAPTER 10 BLOOD GROUPS: ABO AND Rh .........................................................77 CHAPTER 11 CELL-MEDIATED IMMUNITY AND MHC ........................................83 CHAPTER 12 CELL INTERACTIONS IN CELL MEDIATED IMMUNITY ..............91 CHAPTER 13 T-CELL/B-CELL COOPERATION IN HUMORAL IMMUNITY......105 CHAPTER 14 CELL SURFACE MARKERS OF T-CELLS, B-CELLS AND MACROPHAGES...............................................................111
    [Show full text]
  • Saline–Indirect Antiglobulin Test
    Saline–indirect antiglobulin test J.R. Hamilton A saline–indirect antiglobulin test (IAT) is performed without Reagents/Supplies addition of enhancement media to increase the binding of antibody to the red blood cell antigen during the 37°C incubation. Reagents Supplies Although infrequently used as a primary means for antibody • Antibody detection or • Test tubes (10 × 75 or 12 × detection or identification, this test is useful because of the identification RBCs 75 mm) variety of possible applications in antibody identification studies. • 0.9 percent saline or PBS, • Pipettes pH 6.5–7.5 It is critical to the test sensitivity to allow enough incubation time • Calibrated serofuge and/or (30–60 minutes) for maximum antibody binding to occur. The • Antihuman globulin cell washer (polyspecific or anti-IgG) saline test can also be subject to a direct agglutination reading • Calibrated timer after immediate spin, room temperature, or incubation at 37°C • IgG-coated reagent RBCs before conversion to the IAT. This step allows further flexibility in assessing the reactivity of directly agglutinating allo- or RBCs = red blood cells; PBS = phosphate-buffered saline. autoantibodies in tests performed at 37°C or lower temperatures. Immunohematology 2019;35:156–158. Procedural Steps Key Words: saline, IAT, antibody identification • Add two drops plasma or serum to properly labeled tube. • Add one drop 2–5 percent reagent/donor RBC suspension. • Centrifuge, and perform immediate spin reading (if desired). Principle • Incubate 30–60 minutes at 37°C. • Centrifuge, and perform 37°C reading (if desired). The saline–indirect antiglobulin test (IAT) or saline– • Wash three to four times in isotonic saline/PBS.
    [Show full text]
  • 1. Introduction to Immunology Professor Charles Bangham ([email protected])
    MCD Immunology Alexandra Burke-Smith 1. Introduction to Immunology Professor Charles Bangham ([email protected]) 1. Explain the importance of immunology for human health. The immune system What happens when it goes wrong? persistent or fatal infections allergy autoimmune disease transplant rejection What is it for? To identify and eliminate harmful “non-self” microorganisms and harmful substances such as toxins, by distinguishing ‘self’ from ‘non-self’ proteins or by identifying ‘danger’ signals (e.g. from inflammation) The immune system has to strike a balance between clearing the pathogen and causing accidental damage to the host (immunopathology). Basic Principles The innate immune system works rapidly (within minutes) and has broad specificity The adaptive immune system takes longer (days) and has exisite specificity Generation Times and Evolution Bacteria- minutes Viruses- hours Host- years The pathogen replicates and hence evolves millions of times faster than the host, therefore the host relies on a flexible and rapid immune response Out most polymorphic (variable) genes, such as HLA and KIR, are those that control the immune system, and these have been selected for by infectious diseases 2. Outline the basic principles of immune responses and the timescales in which they occur. IFN: Interferon (innate immunity) NK: Natural Killer cells (innate immunity) CTL: Cytotoxic T lymphocytes (acquired immunity) 1 MCD Immunology Alexandra Burke-Smith Innate Immunity Acquired immunity Depends of pre-formed cells and molecules Depends on clonal selection, i.e. growth of T/B cells, release of antibodies selected for antigen specifity Fast (starts in mins/hrs) Slow (starts in days) Limited specifity- pathogen associated, i.e.
    [Show full text]
  • Common Serology Tests and Their Problems
    Common Serology Tests and their problems Dr. Anand Shah (MD Microbiology) PD Hinduja Hospital Serology • What is the definition? • A. Amplification and detection of genetic material • B. Cell culture of viruses • C. Measuring antibody or antigen in body fluids • D. Microscopic examination of body fluids Detection • Detection of antigen-antibody complex • Antigen-antibody complex requires specific conditions – temperature – pH • Complex may be directly visible or invisible Detection Directly visible – agglutination, precipitation Invisible • requires specific probes (enzyme-labelled anti- immunoglobulin, isotope-labelled anti-immunoglobulin, etc.) • binds Ag-Ab complex and amplifys signals • signals can be measured by naked eyes or specific equipment e.g. in ELISA, RIA, IFA Methods for Ag-Ab detection • Precipitation • Agglutination • Hemagglutination and hemagglutination inhibition • Viral neutralization test • Radio-immunoassays • ELISA • Immunoflourescence • Immunoblotting • Immunochromatography Precipitation Principle – soluble antigen combines with its specific antibody – antigen-antibody complex is too large to stay in solution and precipitates Examples – flocculation test – immuno-diffusion test – counter-immuno-electrophoresis (CIEP) Flocculation test (precipitation reaction) Principle – precipitate, a concentrate of fine particles, is usually visible (macroscopically or microscopically) because the precipitated product is forced to remain suspended Examples – VDRL slide flocculation test – RPR card test – Kahn’s test for syphilis
    [Show full text]
  • Standardization and Evaluation of Iga and Igm Gel Column Agglutination for Direct Antiglobulin Testing
    Standardization and Evaluation of IgA and IgM Gel Column Agglutination for Direct Antiglobulin Testing ABSTRACT BACKGROUND: Diagnosis of autoimmune hemolytic anemia is commonly confirmed with a positive direct antiglobulin test. When standard direct antiglobulin testing is negative and immune mediated hemolysis is suspected, further serological investigation is needed. STUDY DESIGN: A column agglutination assay for the direct detection of human immunoglobulin A (IgA) and human immunoglobulin M (IgM) was standardized with anti-human IgA and anti-human IgM using recombinant IgA anti-D and monoclonal IgM anti-D. The standardized IgA/IgM detection assay was used to evaluate clinical samples submitted to the immunohematology reference laboratory. RESULTS: A standardized working dilution of 1:500 was established for anti-human IgA and anti-human IgM in the column agglutination assay. Sixty-one clinical samples were evaluated identifying three reactive samples. These samples included: an IgA and IgM positive sample, an IgA positive sample, and an IgM positive sample. CONCLUSION: A standardized column agglutination assay for the direct detection of IgA and IgM may be effective when evaluating patients for suspected immune mediated hemolysis when routine direct antiglobulin testing is negative. 1 Introduction Autoimmune hemolytic anemia (AIHA) is a relatively uncommon disease process with an incidence between 1 and 3 per 100,000 individuals.1 Diagnosis of AIHA is commonly confirmed with a positive direct antiglobulin test (DAT). Routine DATs use polyspecific anti-human globulins (AHG) able to detect Immunoglobulin-G (IgG) and complement components (C3b, C3d) on red blood cells. If the polyspecific DAT is positive, monospecific AHGs are used to differentiate if IgG, complement, or both are present on red cells.
    [Show full text]
  • A Rapid, Point of Care Red Blood Cell Agglutination Assay for Detecting Antibodies Against SARS-Cov-2
    bioRxiv preprint doi: https://doi.org/10.1101/2020.05.13.094490; this version posted May 14, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. A rapid, point of care red blood cell agglutination assay for detecting antibodies against SARS-CoV-2 Authors: Robert L. Kruse1*, Yuting Huang2,3, Heather Smetana1, Eric A. Gehrie1, Tim K. Amukele1, Aaron A.R. Tobian1, Heba H. Mostafa1, Zack Z. Wang4* Affiliation: 1. Department of Pathology, Johns Hopkins University School of Medicine, Baltimore, Maryland 2. Department of Medicine, University of Maryland Medical Center Midtown Campus, Baltimore, Maryland 3. Division of Gastroenterology, Department of Medicine, Johns Hopkins University School of Medicine, Baltimore, Maryland 4. Division of Hematology, Department of Medicine, Johns Hopkins University School of Medicine, Baltimore, Maryland *To whom correspondence should be addressed: [email protected], [email protected] Abstract: The COVID-19 pandemic has brought the world to a halt, with cases observed around the globe causing significant mortality. There is an urgent need for serological tests to detect antibodies against SARS-CoV-2, which could be used to assess the prevalence of infection, as well as ascertain individuals who may be protected from future infection. Current serological tests developed for SARS-CoV-2 rely on traditional technologies such as enzyme-linked immunosorbent assays (ELISA) and lateral flow assays, which may lack scalability to meet the demand of hundreds of millions of antibody tests in the coming year. Herein, we present an alternative method of antibody testing that just depends on one protein reagent being added to patient serum/plasma or whole blood and a short five-minute assay time.
    [Show full text]
  • Red Cell Agglutination in Non-Humans
    Chapter 9 The Immune System: Red Cell Agglutination in Non-Humans Fred W. Quimby1 and Nancy V. Ridenour2 Cornell Veterinary College1 and Ithaca High School2 Ithaca, New York 14853 Fred is a Professor of Pathology at Cornell Medical and Cornell Veterinary Colleges. He received both V.M.D. and Ph.D. degrees from the University of Pennsylvania and later completed a post doctoral fellowship in Hematology at Tufts–New England Medical Center Hospital. Major research interests include immune system disorders of dogs and primates. He is a diplomate in the American College of Laboratory Animal Medicine, a member of the American Association of Veterinary Immunologists, and Executive Secretary of the World Veterinary Association Committee on Animal Welfare. He is the recipient of the Bernard F. Trum and Johnson and Johnson Focus Giving Awards and has authored more than 100 papers and is the editor of two books. Nancy is a biology teacher at Ithaca High School and instructor of Honors and Advanced Placement Biology courses. She received both B.S. and M.A.T. degrees from Cornell University. She has been actively involved in curriculum development including the production of a 70-exercise laboratory manual for Honors Biology. Involved in teacher education, Nancy has participated in all four semesters of the Cornell Institute for Biology Teachers. A recipient of the Bertha Bartholomew and Sigma Xi Awards and elected to the Committee on Biology Teacher Inservice Programs (National Research Council) and co-chairperson for “Prologue to Action, Life Sciences Education and Science Literacy” (sponsored by the U.S.P.H.S.).
    [Show full text]
  • Immunology and Serology
    LECTURE NOTES For Medical Laboratory Technology Students Immunology and Serology Selamawit Debebe Alemaya University In collaboration with the Ethiopia Public Health Training Initiative, The Carter Center, the Ethiopia Ministry of Health, and the Ethiopia Ministry of Education 2004 Funded under USAID Cooperative Agreement No. 663-A-00-00-0358-00. Produced in collaboration with the Ethiopia Public Health Training Initiative, The Carter Center, the Ethiopia Ministry of Health, and the Ethiopia Ministry of Education. Important Guidelines for Printing and Photocopying Limited permission is granted free of charge to print or photocopy all pages of this publication for educational, not-for-profit use by health care workers, students or faculty. All copies must retain all author credits and copyright notices included in the original document. Under no circumstances is it permissible to sell or distribute on a commercial basis, or to claim authorship of, copies of material reproduced from this publication. ©2004 by Selamawit Debebe All rights reserved. Except as expressly provided above, no part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or by any information storage and retrieval system, without written permission of the author or authors. This material is intended for educational use only by practicing health care workers or students and faculty in a health care field. Immunology and Serology Preface Immunology and serology is an advanced science dealing with how the human immune system organized, function and the different types of serological techniques. It is a very vast subject covering a wide area of technology.
    [Show full text]