Performance Comparison of a Flic H7 Real-Time PCR Assay with an H7

2195

Journal of Food Protection, Vol. 72, No. 10, 2009, Pages 2195–2197

Research Note

Performance Comparison of a fliCh7 Real-Time PCR Assay with an H7 Latex Agglutination Test for Confirmation of the H Type of Escherichia coli O157:H73

NEELAM NARANG,1* PINA M. FRATAMICO,2 GLENN TILLMAN,1 KITTY PUPEDIS,1 AND WILLIAM C. CRAY, JR.1

1U.S. Department of Agriculture, Food Safety and Inspection Service, Outbreak Section of the Eastern Laboratory, 950 College Station Road, Athens, Georgia 30605; and 2U.S. Department of Agriculture, Agricultural Research Service, Eastern Regional Research Center, 600 East Mermaid Lane, Wyndmoor, Pennsylvania 19038, USA

MS 09-069: Received 11 February 2009/Accepted 8 May 2009

ABSTRACT Escherichia coli O157:H7 is a foodborne pathogen that causes hemorrhagic colitis and hemolytic uremic syndrome. Positive identification of E. coli O157:H7 is made using biochemical tests and specific antisera or latex agglutination reagents for the O157 and H7 antigens. However, under certain conditions, some E. coli O157:H7 isolates can appear to be nonreactive with H7 antisera and may require multiple passages on motility medium to restore H7 antigenicity. In this study, we compared the performance of a real-time PCR test with that of a method using latex agglutination reagents to detect the presence of the fliCh7 gene or the H7 antigen, respectively, in E. coli O157:H7 isolates. One hundred twenty-six E. coli strains were tested including reference strains and strains isolated from meat. Lyophilized E. coli O157:H7 isolates were rehydrated and were plated on sheep blood agar without passage on motility medium. All strains were analyzed in parallel by a real-time PCR test targeting the fliCh7 gene and by a latex agglutination test that detects the H7 antigen. The real-time PCR assay showed 100% agreement with the H7 status reported for reference strains and E. coli O157:H7 meat isolates. The latex agglutination test results agreed with the H7 status reported for the E. coli O157:H7 reference strains and non-O157:H7 strains, except for one, E. coli O117:H7; however, 42% (42 of 100) of the E. coli O157:H7 meat isolates tested negative for the H7 antigen by latex agglutination. The real-time fliCh7 PCR test can be used to confirm E. coli O157:H7 strains that are not expressing the immunoreactive H7 antigen.

Enterohemorrhagic Escherichia coli O157:H7 is a PCR technology is being used due to its rapidity, foodborne pathogen of major public health significance that sensitivity, and specificity as an alternative to or in causes hemorrhagic colitis and hemolytic uremic syndrome conjunction with culture-based and immunology-based (6–8). Foods of bovine origin, fresh produce, and contam- methods for pathogen detection (2–5). The purpose of this inated water have been linked to outbreaks of E. coli study was to analyze E. coli O157:H7 isolates and compare O157:H7 infection. Rapid detection and accurate identifica- the performance of a real-time PCR assay that detects the tion of this pathogen are critical to prevent contaminated food fliCh7 gene with the performance of a latex agglutination test from reaching consumers. Positive identification of E. coli that detects the H7 antigen. O157:H7 is made using biochemical tests to identify an isolate as E. coli and by serological confirmation of the O157 MATERIALS AND METHODS and H7 antigens by latex agglutination using specific antisera Bacterial strains. One hundred twenty-six E. coli strains (9, 10). Latex agglutination tests are rapid and inexpensive. were tested, which included 5 O157:H7 ATCC reference strains, 5 However, some isolates are nonmotile or are motile but non-O157 strains that were H7 positive (2 each of O117:H7 and show a weak reaction with typing reagents, making a O79:H7 and 1 O55:H7), 16 non-O157 strains that were H7 determination of presence of the H7 flagellar antigen negative (2 O125:H25, 1 each of O88:H25, O165:25, O111:H2, 2 difficult. Other isolates may require multiple passages on O145:H , O45:H21, O22:H21, O45:H2, O103:H2, O26:H2, motility medium before the H7 antigen is detected (11), O95:NM, O126:H27, O22:H5, O121:H9, and O85:H1), and 100 adding days to the analysis. O157:H7 strains isolated from meat, of which 10 strains were involved in outbreaks (Table 1). The strains were obtained from the U.S. Department of Agriculture (USDA) Food Safety and * Author for correspondence. Tel: 706-546-3618; Fax: 706-546-3518; E-mail: [email protected]. Inspection Service and the USDA Agricultural Research Service, { Mention of specific brand or trade names does not constitute endorsement Eastern Regional Research Center (ERRC), culture collections. or selectivity by the U.S. Department of Agriculture, Food Safety and The strains were lyophilized (Kinetics Thermal Systems, Stone Inspection Service, over similar products that might also be suitable. Ridge, NY) and stored at 270uC. 2196 NARANG ET AL. J. Food Prot., Vol. 72, No. 10

TABLE 1. E. coli isolates tested for H7 by latex agglutination and fliCh7 PCR tests

No. of latex test– and fliCh7 No. of latex test–negative and Strain Total no. tested PCR–positive isolates fliCh7 PCR–positive isolates

Reference E. coli O157:H7 5 5 0 Reference E. coli non-O157, H7 negative 16 0 0 Reference E. coli non-O157, H7 positive 5 4 1 E. coli O157:H7 strains isolated from meat 100 58 42 Non–E. coli O157 strains 4 0 0

Primers and probe. The primers targeting the fliCh7 gene consisted of 94uC for 2 min, followed by 40 cycles of 94uC for and probe (4) designed at the USDA-ERRC were obtained from 20 s, 60uC for 60 s, and 72uC for 50 s. IDT DNA Technologies (Coralville, IA). The primers used were fliCh7-1068 F (59 TACCATCGCAAAAGCAACTCC 39) and RESULTS AND DISCUSSION FliCh7-1314 R (59 GTCGGCAACGTTAGTGATACC 39). The The primers and probe targeting the flich7 gene were probe used was fliCh7-p 59 TET-CGGCTGCCGCGACATCTT- CAAT 39-BHQ1. specific for E. coli O157 and non-O157 E. coli strains possessing the H7 antigen, with representative real-time Agglutination assay. One milliliter of brain heart infusion fluorescence curves as shown in Figure 1. Agarose gel broth was added to the lyophilized culture. The culture was electrophoresis of the reaction mixture confirmed the resuspended by mixing gently with an inoculating loop, and a presence of the specific 247-bp flich7 PCR product loopful of resuspended culture was streaked onto sheep blood agar (Fig. 2). The real-time PCR assay showed 100% agreement plate (Remel, Lenexa, KS), incubated at 35uC for 18 h, and then with the H7 status reported for the reference strains and the analyzed by a commercial latex agglutination test (Remel) (12). E. coli O157:H7 meat isolates. The latex agglutination test Essentially, for each isolate, one drop of test latex solution (anti–E. results agreed with the H7 status reported for the reference coli O157 or H7) was dispensed onto separate wells of test slide. A E. coli O157 isolates (Table 1) except for one isolate portion of isolated colony to be tested was thoroughly emulsified with a plastic stick in the drop. Each drop was spread, and the slide (O117:H7), which showed a negative reaction. However, was rotated in a circular motion for up to 1 min or until 42% (42 of 100) of the E. coli O157:H7 meat isolates tested agglutination was evident. The positive and negative controls negative for the H7 antigen by latex agglutination (Table 1). from the kit were tested in parallel. Confirmatory testing of E. coli O157:H7 requires identification of the O (lipopolysaccharide) and H (flagellar) Preparation of DNA template and real-time PCR. The antigens. However, some E. coli O157:H7 strains show a isolated colonies from blood agar plates were suspended in 100 ml negative reaction with the H7 latex agglutination test and of saline and heated at 99uC for 10 min. After cooling on ice, the may require multiple passages on motility test medium to | tubes were centrifuged at 16,000 g for 2 min, and the obtain expression of the flagella (1), delaying identification supernatant was used as the DNA template. The PCR mixture of E. coli O157:H7 isolates. If the H7 type is not was prepared using OmniMix HS beads (Fisher Scientific, Pittsburgh, PA) reconstituted according to the manufacturer’s determined, the strain will not be correctly identified as instructions, which contained 1.5 U TaKaRa hot-start Taq belonging to serotype O157:H7. In the present study, 42% polymerase, 200 mM deoxynucleoside triphosphates, 4 mM of the isolates were negative by the latex agglutination test.

MgCl2, 25 mM HEPES, pH 8.0 per 25-ml of reaction mixture, and then 0.25 mM concentrations of each primer and a 0.125 mM concentration of probe were added. To 22.5 ml of reaction mixture, 2.5 ml of template DNA was added. The PCR was performed using a Smart Cycler II (Cepheid, Sunnyvale, CA); the cycling protocol

FIGURE 1. PCR assay graph displaying amplification of E. coli O157:H7–positive isolates with a Ct (threshold cycle) value of 15 using fliCh7 primers and probe. There was no signal with E. coli FIGURE 2. An agarose gel showing a 247-bp PCR product of the O157:H7–negative isolate. fliCh7 gene. J. Food Prot., Vol. 72, No. 10 FLICH7 PCR AND H7 LATEX AGGLUTINATION TEST 2197

The negative test results were likely due to insufficient 2. Fields, P. I., K. Blom, H. J. Hughes, L. O. Helsel, P. Feng, and B. expression of the H7 antigen. The isolates were grown under Swaminathan. 1997. Molecular characterization of the gene encoding H antigen in E. coli and development of a PCR restriction fragment conditions that were not designed to enhance motility. Sowers length polymorphism test for identification of E. coli O157:H7 and et al. (11) evaluated commercial H7 latex reagents and found O157:NM. J. Clin. Microbiol. 35:1066–1070. that sensitivity was increased by procedures that enhanced 3. Fratamico, P. M., and L. K. Bagi. 2007. Comparison of methods for motility. Also, the latex test kit package insert recommends detection and isolation of cold- and freeze-stressed Escherichia coli that isolates that test negative be passed on motility medium O157:H7 in raw ground beef. J. Food Prot. 70:1663–1669. before a final result for the H7 antigen is reported. 4. Fratamico, P. M., and C. DebRoy. 2007. Detection of Escherichia coli O157:H7 in food using real-time multiplex PCR assay targeting Fields et al. (2) developed a PCR restriction fragment stx1, stx2, wzy O157 and the fliCh7 or eae genes, abstr. P3-69. 94th length polymorphism assay to identify and characterize the Annu. Meet. IAFP, Lake Buena Vista, FL, 8 to 11 July 2007. gene encoding the FliCh7 antigen in E. coli. The entire 5. Gannon, V. P. J., S. D’Souza, T. Graham, R. K. King, K. Rahn, and coding sequence of the fliC gene was amplified. Digestion S. Read. 1997. Use of flagellar H7 gene as a target in multiplex PCR of the product with RsaI generated a unique banding pattern assays and improved specificity in identification of enterohemorrhagic E. coli strains. J. Clin. Microbiol. 35:656–662. that could be used to identify E. coli O157 isolates that 6. Griffin, P. M., and R. V. Tauxe. 1991. The epidemiology of carried the fliCh7 gene The method eliminated the need for infections caused by Escherichia coli O157:H7, other enterohemor- passaging isolates on motility medium and has been used as rhagic E. coli and the associated hemolytic uremic syndrome. a diagnostic tool for characterization of nonmotile E. coli Epidemiol. Rev. 13:60–98. O157 strains. However, PCR restriction fragment length 7. Karch, H., M. Bielaszewska, M. Bitzan, and H. Schmidt. 1999. polymorphism has a longer analytical time than does real- Epidemiology and diagnosis of Shiga toxin-producing Escherichia coli infections. Diagn. Microbiol. Infect. Dis. 34:229–234. time PCR. 8. Karmali, M. A. 1989. Infection by verocytotoxin-producing Esche- The PCR test described in the present study, which richia coli. Clin. Microbiol. Rev. 2:15–38. targets the E. coli fliCh7 gene, can be used to rapidly con- 9. March, S. B., and S. Ratnam. 1986. Sorbitol-MacConkey medium for firm E. coli O157:H7 isolates that show a negative H7 detection of Escherichia coli O157:H7. J. Clin. Microbiol. 25:1043– agglutination reaction. A positive PCR test result for the 1047. gene that encodes for the H7 flagellin (fliC ) can be used to 10. March, S. B., and S. Ratnam. 1989. Latex agglutination test for h7 detection of Escherichia coli serotype O157. J. Clin. Microbiol. 27: establish the identity of an isolate as E. coli O157:H7 (12). 1675–1677. 11. Sowers, E. G., J. G. Wells, and N. A. Strockbine. 1996. Evaluation of ACKNOWLEDGMENT commercial latex reagents for identification of O157 and H7 antigens We thank Todd Lauze for his technical assistance. of Escherichia coli. J. Clin. Microbiol. 34:1286–1289. 12. U.S. Department of Agriculture. 1998. Detection, isolation, and REFERENCES identification of Escherichia coli O157 and O157:NM (nonmotile) from meat products, chap. 5.04, p. 1–15. Microbiology laboratory 1. Feng, P., P. I. Fields, B. Swaminathan, and T. S. Whittam. 1996. guidebook, 3rd ed. U.S. Department of Agriculture, Food Safety and Characterization of nonmotile variants of Escherichia coli O157 and Inspection Service, Washington, DC. Available at: http://www.fsis. other serotypes by using an antiflagellin monoclonal antibody. J. usda.gov/Science/Microbiological_Lab_Guidebook/index.asp. Revised Clin. Microbiol. 34:2856–2859. 28 January 2008.