DOCSLIB.ORG

ZNF143-Mediated H3K9 Trimethylation Upregulates CDC6 by Activating MDIG in Hepatocellular Carcinoma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
ZNF143-Mediated H3K9 Trimethylation Upregulates CDC6 by Activating MDIG in Hepatocellular Carcinoma Author Manuscript Published OnlineFirst on April 20, 2020; DOI: 10.1158/0008-5472.CAN-19-3226 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. ZNF143-mediated H3K9 trimethylation upregulates CDC6 by activating MDIG in hepatocellular carcinoma Lili Zhang1*, Qi Huo2*, Chao Ge1, Fangyu Zhao1, Qingqing Zhou1, Xiaoxia Chen3, Hua Tian1, Taoyang Chen4, Haiyang Xie5, Ying Cui6, Ming Yao1, Hong Li1#, Jinjun Li1# 1 State Key Laboratory of Oncogenes and Related Genes, Shanghai Cancer Institute, Renji Hospital, Shanghai Jiaotong University School of Medicine, Shanghai 200032, China 2 Department of Medical Oncology, The First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310003, China. 3 Med-X Research Institute, Shanghai Jiao Tong University, Shanghai 200030, China 4 Qi Dong Liver Cancer Institute, Qi Dong 226200, China 5 Department of General Surgery, the First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou 310000, China 6 Cancer Institute of Guangxi, Nanning 530027, China * These authors contributed equally to this work. # Co-corresponding authors Running Title: ZNF143 promotes cell proliferation in HCC 1 Downloaded from cancerres.aacrjournals.org on September 23, 2021. © 2020 American Association for Cancer Research. Author Manuscript Published OnlineFirst on April 20, 2020; DOI: 10.1158/0008-5472.CAN-19-3226 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. #Address for correspondence: Jinjun Li, Ph.D. or Hong Li, Ph.D. State Key Laboratory of Oncogenes and Related Genes, Shanghai Cancer Institute, Renji Hospital, Shanghai Jiaotong University School of Medicine Add: 25/Ln 2200 Xietu Road, Shanghai 200032, China E-mail: [email protected] or [email protected] Tel: +86-21-64432140 or +86-21-64067346 Conflict of interest statement: No potential conflicts of interest were disclosed. 2 Downloaded from cancerres.aacrjournals.org on September 23, 2021. © 2020 American Association for Cancer Research. Author Manuscript Published OnlineFirst on April 20, 2020; DOI: 10.1158/0008-5472.CAN-19-3226 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Abstract Zinc finger protein 143 (ZNF143) belongs to the zinc finger protein family and possesses transcription factor activity by binding sequence-specific DNA. The exact biological role of ZNF143 in hepatocellular carcinoma (HCC) has not been investigated. Here we report that ZNF143 is overexpressed in HCC tissues and its overexpression correlates with poor prognosis. Gain- and loss-of-function experiments showed that ZNF143 promoted HCC cell proliferation, colony formation, and tumor growth in vitro and in vivo. ZNF143 accelerated HCC cell-cycle progression by activating cell division cycle 6 (CDC6). Mechanistically, ZNF143 promoted expression of CDC6 by directly activating transcription of histone demethylase mineral dust-induced gene (MDIG), which in turn reduced H3K9me3 enrichment in the CDC6 promoter region. Consistently, ZNF143 expression correlated significantly with MDIG and CDC6 expression in HCC. Collectively, we propose a model for a ZNF143-MDIG-CDC6 oncoprotein axis that provides novel insight into ZNF143 which may serve as a therapeutic target in HCC. 3 Downloaded from cancerres.aacrjournals.org on September 23, 2021. © 2020 American Association for Cancer Research. Author Manuscript Published OnlineFirst on April 20, 2020; DOI: 10.1158/0008-5472.CAN-19-3226 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Introduction Hepatocellular carcinoma (HCC) is the most common cause of death worldwide, and the molecular mechanism of uncontrolled HCC progression remains unclear (1). Accumulating evidence has suggested that dysregulation of the cell cycle is one of the most important hallmarks of HCC (2). A selective CDK4/6 inhibitor showed encouraging results in preclinical models of HCC and might represent a novel therapeutic strategy for HCC treatment (3). Elucidation of the mechanisms underlying the pathogenesis and molecular biology of dysregulated cell cycle in HCC is fundamental for the development of effective therapeutic treatments. Zinc finger protein 143 (ZNF143) can be activated by IGF1 and is a transcription factor of the C2H2 family. This protein contains a transcription activation domain, 7 Kruppel-like C2H2 zinc finger motif domain, and a C-terminal domain (4,5). Some studies have shown that ZNF143 possesses potent oncogenic properties and can promote growth (6,7). In prostate cancer, ZNF143 is involved in cisplatin resistance by regulating the transcription of DNA repair genes (8). Additionally, ZNF143 is closely related to tumor malignancy via regulating cell motility and exerting tumor suppressive effects in breast cancer (9). Intriguingly, Haibara et al. found that two small molecules inhibit ZNF143 activity, suggesting an opportunity for cancer therapeutics (10). To date, the exact biological role of ZNF143 in HCC has not been investigated. 4 Downloaded from cancerres.aacrjournals.org on September 23, 2021. © 2020 American Association for Cancer Research. Author Manuscript Published OnlineFirst on April 20, 2020; DOI: 10.1158/0008-5472.CAN-19-3226 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. An increasing body of evidence suggests that epigenetic changes such as DNA methylation and other post-translational modifications of chromatin play critical roles in HCC tumorigenesis (11,12). Of these epigenetic alterations, dynamic histone modifications play a pivotal role in the regulation of gene transcription (13). Histone methylation can be regulated by histone methyltransferase and demethylases. Mineral dust-induced gene (MDIG), also known as myc-induced nuclear antigen with a molecular weight of 53 kDa (MINA53), was first identified in alveolar macrophages obtained from coal miners (14), contains one JmjC domain and can demethylate H3K9me3 (15,16). Numerous studies have demonstrated that MDIG is overexpressed in malignancies and can promote cell migration, cell cycle transition and proliferation (14,17). Various studies have shown that functionally related genes involved in epigenetic reprogramming can be controlled by specific transcription factors (18,19). Elucidation of the epigenetic alterations induced by transcription factors will provide more comprehensive and precise insight into the regulatory mechanisms of transcription factors. In the current study, we identified cell division cycle 6 (CDC6) as a downstream target gene of ZNF143 during the regulation of cell cycle in HCC. ZNF143 promoted CDC6 expression by attenuating the enrichment of H3K9me3 in CDC6 promoter region through activation of MDIG. Our findings reveal the fundamental roles of ZNF143 in cell cycle control and identify the ZNF143-MDIG-CDC6 axis as a potential target for anticancer therapy. 5 Downloaded from cancerres.aacrjournals.org on September 23, 2021. © 2020 American Association for Cancer Research. Author Manuscript Published OnlineFirst on April 20, 2020; DOI: 10.1158/0008-5472.CAN-19-3226 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Materials and Methods Human tissues Human primary HCC/matched adjacent noncancerous liver tissue specimens were obtained with informed consent from the Guangxi Cancer Institute (Nanning, China), Zhejiang University (Hangzhou, China) and the Qidong Liver Cancer Institute (Qidong, China). None of the patients received preoperative radiation or chemotherapy. This study was approved by the Research Ethics Committee of Renji Hospital, Shanghai Jiao Tong University School of Medicine and in accordance with Declaration of Helsinki. Written informed consent was received from participants prior to inclusion in the study. The Cancer Genome Atlas (TCGA) and HCCDB cohort The mRNA expression data were downloaded from TCGA database (https://tcga-data.nci.nih.gov/tcga/). HCCDB data were directly downloaded from the HCCDB dataset (http://lifeome.net/database/hccdb/home.html) (20). Immunohistochemistry (IHC) Tissue microarrays (TMAs) were constructed, and the diagnosis was confirmed by three pathologists. IHC was performed as previously described (21). Briefly, the sections were incubated overnight with ZNF143, MDIG and CDC6 at 4°C and then evaluated by two independent observers in a blinded manner. The antibodies used in this study were anti-ZNF143 (HPA003263, 1:10, Sigma-Aldrich), 6 Downloaded from cancerres.aacrjournals.org on September 23, 2021. © 2020 American Association for Cancer Research. Author Manuscript Published OnlineFirst on April 20, 2020; DOI: 10.1158/0008-5472.CAN-19-3226 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. anti-MDIG/MINA53 (PA5-31300, 1:25, Invitrogen), anti-CDC6 (HPA050114, 1:10, Sigma-Aldrich) and anti-Ki67 (GT209429, 1:50, GeneTech). Scores of staining intensity were: 0, negative; 1, weak; 2, moderate; 3, strong. Scores of positively stained cell proportion were: 0, no positive; 1, <10%; 2, 10%–35%; 3, 35%–75%; 4, >75%.The results were scored 0 to 4 by two independent investigators. A score of 0–2 was considered to represent low expression and a score of 3–4 was considered to represent high expression. Cell culture The human HCC cell lines MHCC-97L, MHCC-LM3, and MHCC-97H were kindly provided by the Liver Cancer Institute of Zhongshan
Load more

Recommended publications
  • 2017.08.28 Anne Barry-Reidy Thesis Final.Pdf
    REGULATION OF BOVINE β-DEFENSIN EXPRESSION THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF DUBLIN FOR THE DEGREE OF DOCTOR OF PHILOSOPHY 2017 ANNE BARRY-REIDY SCHOOL OF BIOCHEMISTRY & IMMUNOLOGY TRINITY COLLEGE DUBLIN SUPERVISORS: PROF. CLIONA O’FARRELLY & DR. KIERAN MEADE TABLE OF CONTENTS DECLARATION ................................................................................................................................. vii ACKNOWLEDGEMENTS ................................................................................................................... viii ABBREVIATIONS ................................................................................................................................ix LIST OF FIGURES............................................................................................................................. xiii LIST OF TABLES .............................................................................................................................. xvii ABSTRACT ........................................................................................................................................xix Chapter 1 Introduction ........................................................................................................ 1 1.1 Antimicrobial/Host-defence peptides ..................................................................... 1 1.2 Defensins................................................................................................................. 1 1.3 β-defensins .............................................................................................................
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Aiolos Overexpression in Systemic Lupus Erythematosus B Cell
    Aiolos Overexpression in Systemic Lupus Erythematosus B Cell Subtypes and BAFF-Induced Memory B Cell Differentiation Are Reduced by CC-220 This information is current as Modulation of Cereblon Activity of September 27, 2021. Yumi Nakayama, Jolanta Kosek, Lori Capone, Eun Mi Hur, Peter H. Schafer and Garth E. Ringheim J Immunol 2017; 199:2388-2407; Prepublished online 28 August 2017; Downloaded from doi: 10.4049/jimmunol.1601725 http://www.jimmunol.org/content/199/7/2388 http://www.jimmunol.org/ Supplementary http://www.jimmunol.org/content/suppl/2017/08/26/jimmunol.160172 Material 5.DCSupplemental References This article cites 131 articles, 45 of which you can access for free at: http://www.jimmunol.org/content/199/7/2388.full#ref-list-1 Why The JI? Submit online. by guest on September 27, 2021 • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Author Choice Freely available online through The Journal of Immunology Author Choice option Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2017 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606.
    [Show full text]
  • Detection of Pathogenic Isoforms of IKZF1 in Leukemic Cell
    cancers Article Detection of Pathogenic Isoforms of IKZF1 in Leukemic Cell Lines and Acute Lymphoblastic Leukemia Samples: Identification of a Novel Truncated IKZF1 Transcript in SUP-B15 Weiqiang Zhao 1,*, Ying Li 2 , Chenjiao Yao 2 , Guojuan Zhang 1, Kevin Y. Zhao 1, Wei Chen 1, Peng Ru 1, Xiaokang Pan 1, Huolin Tu 1 and Daniel Jones 1 1 The James Comprehensive Cancer Center and Solove Research Institute, The Ohio State University, Columbus, OH 43210, USA; [email protected] (G.Z.); [email protected] (K.Y.Z.); [email protected] (W.C.); [email protected] (P.R.); [email protected] (X.P.); [email protected] (H.T.); [email protected] (D.J.) 2 The Department of Pediatrics and Department of Hematology, Xiang-Ya Third Hospital, Changsha 410013, China; [email protected] (Y.L.); [email protected] (C.Y.) * Correspondence: [email protected]; Tel.: +1-6142934210 Received: 27 August 2020; Accepted: 22 October 2020; Published: 28 October 2020 Simple Summary: Abnormal RNA splicing plays a fundamental role in leukemogenesis in acute lymphoblastic leukemia (ALL). Many cases of high-risk B-cell ALL cases, including BCR-ABL1+ and BCR-ABL1-like ALL, share a common molecular mechanism of aberrant fusion transcripts involving tyrosine kinase genes combined with dysregulation of the transcription factor and lymphocyte differentiation factor IKZF1. Dysfunction of IKZF1 in ALL is caused by mutation and gene deletion but also alternative splicing resulting in exon skipping with production of aberrant IKZF1 proteins. We report here an assay to detect aberrantly spliced isoforms of IKZF1 in ALL to assist in diagnosis, outcome prediction, and therapy selection in ALL and the identification of a novel altered IKZF1 product in a model ALL cell line.
    [Show full text]
  • Accompanies CD8 T Cell Effector Function Global DNA Methylation
    Global DNA Methylation Remodeling Accompanies CD8 T Cell Effector Function Christopher D. Scharer, Benjamin G. Barwick, Benjamin A. Youngblood, Rafi Ahmed and Jeremy M. Boss This information is current as of October 1, 2021. J Immunol 2013; 191:3419-3429; Prepublished online 16 August 2013; doi: 10.4049/jimmunol.1301395 http://www.jimmunol.org/content/191/6/3419 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2013/08/20/jimmunol.130139 Material 5.DC1 References This article cites 81 articles, 25 of which you can access for free at: http://www.jimmunol.org/content/191/6/3419.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on October 1, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Global DNA Methylation Remodeling Accompanies CD8 T Cell Effector Function Christopher D. Scharer,* Benjamin G. Barwick,* Benjamin A. Youngblood,*,† Rafi Ahmed,*,† and Jeremy M.
    [Show full text]
  • Association of Gene Ontology Categories with Decay Rate for Hepg2 Experiments These Tables Show Details for All Gene Ontology Categories
    Supplementary Table 1: Association of Gene Ontology Categories with Decay Rate for HepG2 Experiments These tables show details for all Gene Ontology categories. Inferences for manual classification scheme shown at the bottom. Those categories used in Figure 1A are highlighted in bold. Standard Deviations are shown in parentheses. P-values less than 1E-20 are indicated with a "0". Rate r (hour^-1) Half-life < 2hr. Decay % GO Number Category Name Probe Sets Group Non-Group Distribution p-value In-Group Non-Group Representation p-value GO:0006350 transcription 1523 0.221 (0.009) 0.127 (0.002) FASTER 0 13.1 (0.4) 4.5 (0.1) OVER 0 GO:0006351 transcription, DNA-dependent 1498 0.220 (0.009) 0.127 (0.002) FASTER 0 13.0 (0.4) 4.5 (0.1) OVER 0 GO:0006355 regulation of transcription, DNA-dependent 1163 0.230 (0.011) 0.128 (0.002) FASTER 5.00E-21 14.2 (0.5) 4.6 (0.1) OVER 0 GO:0006366 transcription from Pol II promoter 845 0.225 (0.012) 0.130 (0.002) FASTER 1.88E-14 13.0 (0.5) 4.8 (0.1) OVER 0 GO:0006139 nucleobase, nucleoside, nucleotide and nucleic acid metabolism3004 0.173 (0.006) 0.127 (0.002) FASTER 1.28E-12 8.4 (0.2) 4.5 (0.1) OVER 0 GO:0006357 regulation of transcription from Pol II promoter 487 0.231 (0.016) 0.132 (0.002) FASTER 6.05E-10 13.5 (0.6) 4.9 (0.1) OVER 0 GO:0008283 cell proliferation 625 0.189 (0.014) 0.132 (0.002) FASTER 1.95E-05 10.1 (0.6) 5.0 (0.1) OVER 1.50E-20 GO:0006513 monoubiquitination 36 0.305 (0.049) 0.134 (0.002) FASTER 2.69E-04 25.4 (4.4) 5.1 (0.1) OVER 2.04E-06 GO:0007050 cell cycle arrest 57 0.311 (0.054) 0.133 (0.002)
    [Show full text]
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Detecting Global in Uence of Transcription
    Detecting global inuence of transcription factor interactions on gene expression in lymphoblastoid cells using neural network models Neel Patel Case Western Reserve University William S. Bush ( [email protected] ) Case Western Reserve University Research Article Keywords: Transcription factors, Gene expression, Machine learning, Neural network, Chromatin-looping, Regulatory module, Multi-omics Posted Date: April 15th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-406028/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Detecting global influence of transcription factor interactions on gene expression in lymphoblastoid cells using neural network models. Neel Patel1,2 and William S. Bush2* 1Department of Nutrition, Case Western Reserve University, Cleveland, OH, USA. 2Department of Population and Quantitative Health Sciences, Case Western Reserve University, Cleveland, OH, USA.*-corresponding author(email:[email protected]) Abstract Background Transcription factor(TF) interactions are known to regulate target gene(TG) expression in eukaryotes via TF regulatory modules(TRMs). Such interactions can be formed due to co- localizing TFs binding proximally to each other in the DNA sequence or over long distances between distally binding TFs via chromatin looping. While the former type of interaction has been characterized extensively, long distance TF interactions are still largely understudied. Furthermore, most prior approaches have focused on characterizing physical TF interactions without accounting for their effects on TG expression regulation. Understanding TRM based TG expression regulation could aid in understanding diseases caused by disruptions to these mechanisms. In this paper, we present a novel neural network based TRM detection approach that consists of using multi-omics TF based regulatory mechanism information to generate features for building non-linear multilayer perceptron TG expression prediction models in the GM12878 immortalized lymphoblastoid cells.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Transcriptome Analysis of Complex I-Deficient Patients Reveals Distinct
    van der Lee et al. BMC Genomics (2015) 16:691 DOI 10.1186/s12864-015-1883-8 RESEARCH ARTICLE Open Access Transcriptome analysis of complex I-deficient patients reveals distinct expression programs for subunits and assembly factors of the oxidative phosphorylation system Robin van der Lee1†, Radek Szklarczyk1,2†, Jan Smeitink3,HubertJMSmeets4, Martijn A. Huynen1 and Rutger Vogel3* Abstract Background: Transcriptional control of mitochondrial metabolism is essential for cellular function. A better understanding of this process will aid the elucidation of mitochondrial disorders, in particular of the many genetically unsolved cases of oxidative phosphorylation (OXPHOS) deficiency. Yet, to date only few studies have investigated nuclear gene regulation in the context of OXPHOS deficiency. In this study we performed RNA sequencing of two control and two complex I-deficient patient cell lines cultured in the presence of compounds that perturb mitochondrial metabolism: chloramphenicol, AICAR, or resveratrol. We combined this with a comprehensive analysis of mitochondrial and nuclear gene expression patterns, co-expression calculations and transcription factor binding sites. Results: Our analyses show that subsets of mitochondrial OXPHOS genes respond opposingly to chloramphenicol and AICAR, whereas the response of nuclear OXPHOS genes is less consistent between cell lines and treatments. Across all samples nuclear OXPHOS genes have a significantly higher co-expression with each other than with other genes, including those encoding mitochondrial proteins. We found no evidence for complex-specific mRNA expression regulation: subunits of different OXPHOS complexes are similarly (co-)expressed and regulated by a common set of transcription factors. However, we did observe significant differences between the expression of nuclear genes for OXPHOS subunits versus assembly factors, suggesting divergent transcription programs.
    [Show full text]
  • Novel Gene Targets Detected by Genomic Profiling in a Consecutive Series of 126 Adults with Acute Lymphoblastic Leukemia
    Acute Lymphoblastic Leukemia ARTICLES Novel gene targets detected by genomic profiling in a consecutive series of 126 adults with acute lymphoblastic leukemia Setareh Safavi,1 Markus Hansson,2 Karin Karlsson,2 Andrea Biloglav,1 Bertil Johansson,1,3 and Kajsa Paulsson1 1Division of Clinical Genetics, Department of Laboratory Medicine, Lund University; 2Division of Hematology, Skåne University Hospital, Lund University; and 3Department of Clinical Genetics, University and Regional Laboratories, Region Skåne, Lund, Sweden ABSTRACT In contrast to acute lymphoblastic leukemia in children, adult cases of this disease are associated with a very poor prognosis. In order to ascertain whether the frequencies and patterns of submicroscopic changes, identifiable with single nucleotide polymorphism array analysis, differ between childhood and adult acute lymphoblastic leukemia, we performed single nucleotide polymorphism array analyses of 126 adult cases, the largest series to date, includ- ing 18 paired diagnostic and relapse samples. Apart from identifying characteristic microdeletions of the CDKN2A, EBF1, ETV6, IKZF1, PAX5 and RB1 genes, the present study uncovered novel, focal deletions of the BCAT1, BTLA, NR3C1, PIK3AP1 and SERP2 genes in 2-6% of the adult cases. IKZF1 deletions were associated with B-cell pre- cursor acute lymphoblastic leukemia (P=0.036), BCR-ABL1-positive acute lymphoblastic leukemia (P<0.001), and higher white blood cell counts (P=0.005). In addition, recurrent deletions of RASSF3 and TOX were seen in relapse samples. Comparing paired diagnostic/relapse samples revealed identical changes at diagnosis and relapse in 27%, clonal evolution in 22%, and relapses evolving from ancestral clones in 50%, akin to what has previously been reported in pediatric acute lymphoblastic leukemia and indicating that the mechanisms of relapse may be similar in adult and childhood cases.
    [Show full text]