CRISPR-Cas9 GENE EDITING of CDK5RAP2 in HUMAN PLURIPOTENT STEM

CRISPR-Cas9 GENE EDITING OF CDK5RAP2 IN HUMAN PLURIPOTENT STEM

CELLS, DERIVATION OF GENETICALLY STABLE CLONAL LINES AND ™ Scientists Helping Scientists | WWW.STEMCELL.COM FORMATION OF CEREBRAL ORGANOIDS USING THE STEMdiff™ HUMAN CEREBRAL ORGANOID CULTURE SYSTEM Leon H. Chew1, Adam Añonuevo1, Adam J. Hirst1, Allen C. Eaves1,2, Terry E. Thomas1, Sharon A. Louis1, and Vivian M. Lee1 1STEMCELL Technologies, Vancouver, BC, Canada 2 Terry Fox Laboratory, BC Cancer Agency, Vancouver BC, Canada

Introduction Compound Modeling human disease using human pluripotent stem cells (hPSCs), in combination with Control Heterozygote Heterozygote CRISPR-Cas9 gene editing, are emerging as important strategies for studying mechanisms of A pathogenesis. We used the ArciTect™ CRISPR-Cas9 system to generate clones harboring a C-terminus truncation of CDK5 regulatory subunit-associated protein 2 (CDK5RAP2), a gene associated with the development of primary microcephaly (Lancaster et al, Nature 2013). We successfully generated stable clones which we further characterized for cell quality attributes (karyotype, pluripotency, morphology, and marker expression) prior to differentiation into cerebral organoids using STEMdiff™ Human Cerebral Organoid Kit. 46,XY 46,XY 46,XY

Methods B 4 4 4 3 3 3 A CRISPR-Cas9 Gene Editing B Cell Quality AssaysC Cerebral Organoid Formation 2 2 2

Repeat CRISPR-Cas9 Gene Editing for Compound Heterozygote 1 1 1 - G-Banding (p5) Number Copy Number Copy Number Copy - Passage Clones - hPSC Genetic Analysis Kit (p5,8,10) Deliver RNP Complex to Low-Density Medium hPSC (p6-p10) Morphology Expand Clones by - Extract Genomic DNA - Trilineage Differentiation (p5) Morphology Morphology Morphology Dissociated hPSCs Single-Cell Exchange to Initiate Organoid RT-qPCR Clump Passaging - Perform Sanger Sequencing - hPSC Marker Expression (p1,5,10) RT-qPCR RT-qPCR RT-qPCR 0 0 0 Using Electroporation Seeding mTeSR™1 Formation Immunostaining at CDK5RAP2 Locus - Morphology (p1-10) p q p q p p q q p q p q q q p r1q r4p r8q 0p 7q 8 0q r1q r4p r8 7q 8 0 r1q r8 8 0 rX h h h r1 r12 2 h h h 10 r12 r1 1 h hr4p h 12 r17 c c c h h hr1 hr1 hr hrX c c c hr h h hr hr2 hrX c c c hr10p hr h hr1 hr2 h c c c c c c c c c c c c c c c c c c hPSC Maintenance Clump Passage hPSCs using ReLeSR™ Chromosomal Region Chromosomal Region Chromosomal Region FIGURE 4. Gene-Edited CDK5RAP2 Clones are Genetically Stable Day 0 3 6 11 18 Day 0 5 7 10 18 A) Karyograms of control and edited cell lines show normal diploid karyotype at passage 5. An elevated level of mTeSR™1 + CloneR™ mTeSR™1 EB Formation Induction Expansion Maturation Medium Medium Medium Medium polyploidy was observed in both the heterozygote (~20%) and compound heterozygote (~33%) cell lines compared to typical background levels in hPSCs (<10%). This may indicate a potential error in chromosome B) FIGURE 1. ArciTect™ CRISPR-Cas9 Gene Editing and Cerebral Organoid Workﬂow segregation at metaphase or in cytokinesis. Edited cell lines were screened for recurrent karyotypic abnormalities at 9 loci, all cell lines displayed normal diploid copy number at p5 and p10. A) ArciTect™ CRISPR-Cas9 ribonucleoprotein, in complex with a guide RNA targetting CDK5RAP2, was formed A B and introduced into a blood-derived hPSC line (STiPS-B004) using electroporation. Transfected cells were Compound 1.2 1.1 Control incubated at 37°C for 3 days in mTeSR™1 + CloneR™. After single-cell dissociation, cells were seeded at a Control Heterozygote Heterozygote 1.0

Ct) Heterozygote

2 Δ 0.9 density of 400 cells per 10 cm dish in mTeSR™1 + CloneR™ and incubated at 37°C for 3 days. A full medium Δ 0.8 Compound Heterozygote 0.7 change was performed with mTeSR™1, then cells were incubated for an additional 5 days. Single clones were 0.6 0.5 then selected and expanded in mTeSR™1 in 24-well plates for 7 days. At the first passage, genomic DNA was 0.4 Normalized 0.3 purified and the CDK5RAP2 locus was amplified by polymerase chain reaction (PCR); product was sent for 0.2 Fold Change (Δ Change Fold 0.1 Sanger sequencing to determine whether editing occurred. Out of approximately 24 clones selected, 2 - 3 clones 0.0 were chosen that harbored a heterozygous frameshift mutation that led to a premature stop codon. A second DAPI ACTIN CDK5RAP2 Control round of CRISPR-Cas9 gene editing was initiated (indicated by black arrow) with these heterozygous clones to Compound generate a compound heterozygous clone harboring a mutation in both CDK5RAP2 alleles that led to a premature Heterozygote Heterozygote stop codon. B) All clones were dissociated into clumps using ReLeSR™ and expanded in mTeSR™1. Clones C 6 6×10 Control were also further characterized by the following phenotypic and functional assays: low-resolution karyotyope by 5×106 Heterozygote Compound Heterozygote G-Banding (p5), screening for high-resolution karyotypic abnomalities at 9 loci using hPSC Genetic Analysis Kit ACTIN CDK5RAP2 4×106

(p5, p8, and p10), differentiation potential using STEMdiff™ Trilineage Differentiation Kit (p5), marker expression 3×106 for OCT4 (p1, p5, and p10) and cell morphology assessment. Stable genetic clones harboring the CDK5RAP2 2×106 C) C-terminus truncation were used between p6 and p10 to generate human cerebral organoids. Cerebral 1×106 organoids were generated using STEMdiff™ Cerebral Organoid Kit. RNA was extracted on Day 5, 7, 10, and 18 Cumulative Cell Number 0 5 μm 0123456 and assayed by RT-qPCR for neuronal markers (DCX and TUJ1), and neural progenitor markers (PAX6 and SOX2). 5 μm

DAPI CDK5RAP2 Passage Cryosectioning and immunostaining were also performed on Day 18 organoids for PAX6 and TUJ1. FIGURE 5. CDK5RAP2 is Mislocalized in the Compound Heterozygote Clone During Cell Division but Does Not Impact Growth Rates of hPSCs Results A) Representative images of hPSCs undergoing metaphase show distinct localization of CDK5RAP2 (purple) at A B Oﬀ- # of each pole of the mitotic spindle marked by ACTIN (green) in both the control and heterozygote cells. Nuclei are Sequence PAM Locus Posion target Mismatches Site detected? marked by DAPI (grey). No localization of CDK5RAP2 (purple) to the mitotic spindle is observed in the compound Gene: CDK5RAP2 AATTACGAGAGTCCCTCTCC AGG -- N/A heterozygote. B) RT-qPCR analysis of CDK5RAP2 transcript in hPSCs shows decreased transcript expression in the Locaon: chr9:-120409275 Gene: Non-coding compound heterozygote compared to the control and heterozygote (n=3 timepoints per data point, average +/- AATGACTGGAGTCCCTCTCC AGG 3 Locaon: chr6:-8206596 No SEM, normalized to Control; P ≤ 0.0001 when comparing compound heterozygote to heterozygote) C) The growth Gene: Non-coding ACTTTCTAGAGCCCCTCTCC AAG 4 No rates of hPSCs in all clonal cell lines were not signiﬁcantly different, (n=3 technical replicates per data point, Locaon: chr3:-169758580 Gene: Non-coding average +/- SEM; P > 0.05). AAATTCAAGAGCCCCTCTCC CAG 4 No Locaon: chr9:-36717798 A B Day 5 Day 7 Day 10 Day 18 1,000,000 Control C Control 900,000 Heterozygote 800,000 Compound Heterozygote

Control 700,000 ) 2 600,000 500,000 Heterozygote 400,000 Area (µm 300,000

Heterozygote 200,000 100,000 Compound Heterozygote 0 5 6 7 8 9 101112131415161718 Day Compound 500 μm Heterozygote Compound Control Heterozygote Heterozygote C Heterozygote D Compound Heterozygote

FIGURE 2. ArciTect™ CRISPR-Cas9 Gene Editing of CDK5RAP2 Generates an Early Stop Codon 2.0 DCX 2.0 TUJ1 ns ** ns * Ct) Ct) Δ A) Δ 1.5 1.5 Δ Primary sequence of CDK5RAP2. Disease mutations associated with primary microcephaly are shown in Δ

(black), protein-protein interacting regions (grey) and centrosome-binding domain (green) is found in the 1.0 1.0 Normalized Normalized C-terminus. Box: Designed guide RNA primary sequence is highlighted in orange. B) Off-target gene editing was 0.5 0.5 TUJ1 PAX6 Fold Change(Δ Fold Change(Δ determined by Sanger sequencing at loci predicted as possible off-target sites for the designed guide RNA 0.0 0.0

5 7 0 8 5 7 y y 1 1 y y 10 18 a a y y a a y y targetting CDK5RAP2. Results conﬁrmed that no off-target editing occurred at the loci assayed. Mismatched D D a a D D a a D D D D bases are highlighted in red. C) DNA and amino acid sequences obtained from Sanger sequencing of the control, 2.0 PAX6 2.0 SOX2 Ct) heterozygous, and compound heterozygous cell lines reveal a 2 base-pair (Heterozygote) and 4 base-pair Ct) PAX6 Δ 1.5 Δ 1.5 Δ (Heterozygote/Compound Heterozygote) deletion leading to a frameshift and premature stop codon. * ** Δ ns ** 1.0 1.0

Normalized 0.5 Normalized 0.5 A Phase Contrast B DAPI C OCT4 D PAX6 SOX17 Brachyury Fold Change(Δ Fold Change(Δ 0.0 0.0

5 7 0 5 7 8 y y 1 18 y y 10 1 a a y y a a y y 50 μm D D a a D D a a TUJ1 D D D D FIGURE 6. CDK5RAP2 Decreases Cerebral Organoid Size and Impacts Marker Expression at Day 18 A) Representative phase contrast image of organoids generated from hPSCs at each stage of organoid formation. 2 Control B) Area measurements (μm ) at each stage of organoid formation show a decreased size in the CDK5RAP2 compound heterozygote mutant at all stages compared to the control (n=4, 12-16 organoids per data point, average +/- SEM; P ≤ 0.05 when comparing control to compound heterozygote). C) RT-qPCR analysis of organoids at each stage of cerebral organoid formation reveals a difference in neural progenitor marker expression (SOX2 and PAX6) and neuronal marker expression (DCX and TUJ1) in the compound heterozygote compared to control at Day 18. (n=4, 12-16 organoids per data point, average +/- SEM, normalized to Control; ns: P > 0.05, *: P ≤ 0.05, **: P ≤ 0.01). D) Immunostaining of Day 18 organoids reveals an increase in the neuronal marker TUJ1 (green) and decrease in the neural progenitor marker PAX6 (purple) in cortical layer regions, in Heterozygote compound heterozygote clones compared to control and heterozygote clonal cell lines. Ventricular zone-like regions are marked by a white dashed line. Summary Established a work ﬂow for gene editing, cell quality, and generation of stable gene-edited clones using the ArciTect™ CRISPR-Cas9 system Compound

Heterozygote 100 μm 100 μm 100 μm 500 μm CDK5RAP2 truncation leads to mislocalization of CDK5RAP2 from mitotic spindles during mitosis FIGURE 3. Gene-Edited CDK5RAP2 Clones Exhibit hPSC Morphology and Pluripotency CDK5RAP2 C-Terminus truncation clones generate smaller cerebral organoids compared to a A) Representative phase contrast morphology of stable hPSC clones exhibit multi-layering and dense packing control, and exhibit increased neuronal marker expression and decreased neural progenitor similar to the control cell line. B) The nuclei of hPSC colonies are marked by DAPI (grey) C) Clonal cell lines marker expression, similar to data from Lancaster et al. expressed the undifferentiated cell marker OCT4(OCT3) (green). D) Differentiation potential for each clonal cell line was assessed using STEMdiff™ Trilineage Differentiation Kit. All clonal cell lines exhibited high differentiation References: Lancaster MA, Renner M, Martin CA, Wenzel D, Bicknell LS, Hurles ME, Homfray T, Penninger JM, Jackson AP, Knoblich JA. Cerebral organoids potential to ectoderm (PAX6), endoderm (SOX17) and mesoderm (Brachyury). model human brain development and microcephaly. Nature. 2013 Sep 19;501(7467):373-9.

TOLL-FREE PHONE 1 800 667 0322 • PHONE 1 604 877 0713 • [email protected] • [email protected] FOR GLOBAL CONTACT DETAILS VISIT OUR WEBSITE

FOR RESEARCH USE ONLY. NOT INTENDED FOR HUMAN OR ANIMAL DIAGNOSTIC OR THERAPEUTIC USES. STEMCELL TECHNOLOGIES INC.’S QUALITY MANAGEMENT SYSTEM IS CERTIFIED TO ISO 13485 MEDICAL DEVICE STANDARDS.