DOCSLIB.ORG

CRISPR-Cas9 GENE EDITING of CDK5RAP2 in HUMAN PLURIPOTENT STEM

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
CRISPR-Cas9 GENE EDITING of CDK5RAP2 in HUMAN PLURIPOTENT STEM CRISPR-Cas9 GENE EDITING OF CDK5RAP2 IN HUMAN PLURIPOTENT STEM CELLS, DERIVATION OF GENETICALLY STABLE CLONAL LINES AND ™ Scientists Helping Scientists | WWW.STEMCELL.COM FORMATION OF CEREBRAL ORGANOIDS USING THE STEMdiff™ HUMAN CEREBRAL ORGANOID CULTURE SYSTEM Leon H. Chew1, Adam Añonuevo1, Adam J. Hirst1, Allen C. Eaves1,2, Terry E. Thomas1, Sharon A. Louis1, and Vivian M. Lee1 1STEMCELL Technologies, Vancouver, BC, Canada 2 Terry Fox Laboratory, BC Cancer Agency, Vancouver BC, Canada Introduction Compound Modeling human disease using human pluripotent stem cells (hPSCs), in combination with Control Heterozygote Heterozygote CRISPR-Cas9 gene editing, are emerging as important strategies for studying mechanisms of A pathogenesis. We used the ArciTect™ CRISPR-Cas9 system to generate clones harboring a C-terminus truncation of CDK5 regulatory subunit-associated protein 2 (CDK5RAP2), a gene associated with the development of primary microcephaly (Lancaster et al, Nature 2013). We successfully generated stable clones which we further characterized for cell quality attributes (karyotype, pluripotency, morphology, and marker expression) prior to differentiation into cerebral organoids using STEMdiff™ Human Cerebral Organoid Kit. 46,XY 46,XY 46,XY Methods B 4 4 4 3 3 3 A CRISPR-Cas9 Gene Editing B Cell Quality AssaysC Cerebral Organoid Formation 2 2 2 Repeat CRISPR-Cas9 Gene Editing for Compound Heterozygote 1 1 1 - G-Banding (p5) Number Copy Number Copy Number Copy - Passage Clones - hPSC Genetic Analysis Kit (p5,8,10) Deliver RNP Complex to Low-Density Medium hPSC (p6-p10) Morphology Expand Clones by - Extract Genomic DNA - Trilineage Differentiation (p5) Morphology Morphology Morphology Dissociated hPSCs Single-Cell Exchange to Initiate Organoid RT-qPCR Clump Passaging - Perform Sanger Sequencing - hPSC Marker Expression (p1,5,10) RT-qPCR RT-qPCR RT-qPCR 0 0 0 Using Electroporation Seeding mTeSR™1 Formation Immunostaining at CDK5RAP2 Locus - Morphology (p1-10) p q p q p p q q p q p q q q p r1q r4p r8q 0p 7q 8 0q r1q r4p r8 7q 8 0 r1q r8 8 0 rX h h h r1 r12 2 h h h 10 r12 r1 1 h hr4p h 12 r17 c c c h h hr1 hr1 hr hrX c c c hr h h hr hr2 hrX c c c hr10p hr h hr1 hr2 h c c c c c c c c c c c c c c c c c c hPSC Maintenance Clump Passage hPSCs using ReLeSR™ Chromosomal Region Chromosomal Region Chromosomal Region FIGURE 4. Gene-Edited CDK5RAP2 Clones are Genetically Stable Day 0 3 6 11 18 Day 0 5 7 10 18 A) Karyograms of control and edited cell lines show normal diploid karyotype at passage 5. An elevated level of mTeSR™1 + CloneR™ mTeSR™1 EB Formation Induction Expansion Maturation Medium Medium Medium Medium polyploidy was observed in both the heterozygote (~20%) and compound heterozygote (~33%) cell lines compared to typical background levels in hPSCs (<10%). This may indicate a potential error in chromosome B) FIGURE 1. ArciTect™ CRISPR-Cas9 Gene Editing and Cerebral Organoid Workflow segregation at metaphase or in cytokinesis. Edited cell lines were screened for recurrent karyotypic abnormalities at 9 loci, all cell lines displayed normal diploid copy number at p5 and p10. A) ArciTect™ CRISPR-Cas9 ribonucleoprotein, in complex with a guide RNA targetting CDK5RAP2, was formed A B and introduced into a blood-derived hPSC line (STiPS-B004) using electroporation. Transfected cells were Compound 1.2 1.1 Control incubated at 37°C for 3 days in mTeSR™1 + CloneR™. After single-cell dissociation, cells were seeded at a Control Heterozygote Heterozygote 1.0 Ct) Heterozygote 2 Δ 0.9 density of 400 cells per 10 cm dish in mTeSR™1 + CloneR™ and incubated at 37°C for 3 days. A full medium Δ 0.8 Compound Heterozygote 0.7 change was performed with mTeSR™1, then cells were incubated for an additional 5 days. Single clones were 0.6 0.5 then selected and expanded in mTeSR™1 in 24-well plates for 7 days. At the first passage, genomic DNA was 0.4 Normalized 0.3 purified and the CDK5RAP2 locus was amplified by polymerase chain reaction (PCR); product was sent for 0.2 Fold Change (Δ Change Fold 0.1 Sanger sequencing to determine whether editing occurred. Out of approximately 24 clones selected, 2 - 3 clones 0.0 were chosen that harbored a heterozygous frameshift mutation that led to a premature stop codon. A second DAPI ACTIN CDK5RAP2 Control round of CRISPR-Cas9 gene editing was initiated (indicated by black arrow) with these heterozygous clones to Compound generate a compound heterozygous clone harboring a mutation in both CDK5RAP2 alleles that led to a premature Heterozygote Heterozygote stop codon. B) All clones were dissociated into clumps using ReLeSR™ and expanded in mTeSR™1. Clones C 6 6×10 Control were also further characterized by the following phenotypic and functional assays: low-resolution karyotyope by 5×106 Heterozygote Compound Heterozygote G-Banding (p5), screening for high-resolution karyotypic abnomalities at 9 loci using hPSC Genetic Analysis Kit ACTIN CDK5RAP2 4×106 (p5, p8, and p10), differentiation potential using STEMdiff™ Trilineage Differentiation Kit (p5), marker expression 3×106 for OCT4 (p1, p5, and p10) and cell morphology assessment. Stable genetic clones harboring the CDK5RAP2 2×106 C) C-terminus truncation were used between p6 and p10 to generate human cerebral organoids. Cerebral 1×106 organoids were generated using STEMdiff™ Cerebral Organoid Kit. RNA was extracted on Day 5, 7, 10, and 18 Cumulative Cell Number 0 5 μm 0123456 and assayed by RT-qPCR for neuronal markers (DCX and TUJ1), and neural progenitor markers (PAX6 and SOX2). 5 μm DAPI CDK5RAP2 Passage Cryosectioning and immunostaining were also performed on Day 18 organoids for PAX6 and TUJ1. FIGURE 5. CDK5RAP2 is Mislocalized in the Compound Heterozygote Clone During Cell Division but Does Not Impact Growth Rates of hPSCs Results A) Representative images of hPSCs undergoing metaphase show distinct localization of CDK5RAP2 (purple) at A B Off- # of each pole of the mitotic spindle marked by ACTIN (green) in both the control and heterozygote cells. Nuclei are Sequence PAM Locus Posion target Mismatches Site detected? marked by DAPI (grey). No localization of CDK5RAP2 (purple) to the mitotic spindle is observed in the compound Gene: CDK5RAP2 AATTACGAGAGTCCCTCTCC AGG -- N/A heterozygote. B) RT-qPCR analysis of CDK5RAP2 transcript in hPSCs shows decreased transcript expression in the Locaon: chr9:-120409275 Gene: Non-coding compound heterozygote compared to the control and heterozygote (n=3 timepoints per data point, average +/- AATGACTGGAGTCCCTCTCC AGG 3 Locaon: chr6:-8206596 No SEM, normalized to Control; P ≤ 0.0001 when comparing compound heterozygote to heterozygote) C) The growth Gene: Non-coding ACTTTCTAGAGCCCCTCTCC AAG 4 No rates of hPSCs in all clonal cell lines were not significantly different, (n=3 technical replicates per data point, Locaon: chr3:-169758580 Gene: Non-coding average +/- SEM; P > 0.05). AAATTCAAGAGCCCCTCTCC CAG 4 No Locaon: chr9:-36717798 A B Day 5 Day 7 Day 10 Day 18 1,000,000 Control C Control 900,000 Heterozygote 800,000 Compound Heterozygote Control 700,000 ) 2 600,000 500,000 Heterozygote 400,000 Area (µm 300,000 Heterozygote 200,000 100,000 Compound Heterozygote 0 5 6 7 8 9 101112131415161718 Day Compound 500 μm Heterozygote Compound Control Heterozygote Heterozygote C Heterozygote D Compound Heterozygote FIGURE 2. ArciTect™ CRISPR-Cas9 Gene Editing of CDK5RAP2 Generates an Early Stop Codon 2.0 DCX 2.0 TUJ1 ns ** ns * Ct) Ct) Δ A) Δ 1.5 1.5 Δ Primary sequence of CDK5RAP2. Disease mutations associated with primary microcephaly are shown in Δ (black), protein-protein interacting regions (grey) and centrosome-binding domain (green) is found in the 1.0 1.0 Normalized Normalized C-terminus. Box: Designed guide RNA primary sequence is highlighted in orange. B) Off-target gene editing was 0.5 0.5 TUJ1 PAX6 Fold Change(Δ Fold Change(Δ determined by Sanger sequencing at loci predicted as possible off-target sites for the designed guide RNA 0.0 0.0 5 7 0 8 5 7 y y 1 1 y y 10 18 a a y y a a y y targetting CDK5RAP2. Results confirmed that no off-target editing occurred at the loci assayed. Mismatched D D a a D D a a D D D D bases are highlighted in red. C) DNA and amino acid sequences obtained from Sanger sequencing of the control, 2.0 PAX6 2.0 SOX2 Ct) heterozygous, and compound heterozygous cell lines reveal a 2 base-pair (Heterozygote) and 4 base-pair Ct) PAX6 Δ 1.5 Δ 1.5 Δ (Heterozygote/Compound Heterozygote) deletion leading to a frameshift and premature stop codon. * ** Δ ns ** 1.0 1.0 Normalized 0.5 Normalized 0.5 A Phase Contrast B DAPI C OCT4 D PAX6 SOX17 Brachyury Fold Change(Δ Fold Change(Δ 0.0 0.0 5 7 0 5 7 8 y y 1 18 y y 10 1 a a y y a a y y 50 μm D D a a D D a a TUJ1 D D D D FIGURE 6. CDK5RAP2 Decreases Cerebral Organoid Size and Impacts Marker Expression at Day 18 A) Representative phase contrast image of organoids generated from hPSCs at each stage of organoid formation. 2 Control B) Area measurements (μm ) at each stage of organoid formation show a decreased size in the CDK5RAP2 compound heterozygote mutant at all stages compared to the control (n=4, 12-16 organoids per data point, average +/- SEM; P ≤ 0.05 when comparing control to compound heterozygote). C) RT-qPCR analysis of organoids at each stage of cerebral organoid formation reveals a difference in neural progenitor marker expression (SOX2 and PAX6) and neuronal marker expression (DCX and TUJ1) in the compound heterozygote compared to control at Day 18.
Load more

Recommended publications
  • BR27069-Stemdiff™ Cerebral Organoid
    CEREBRAL ORGANOIDS STEMdiff™ Cerebral Organoid Kit Scientists Helping Scientists™ | WWW.STEMCELL.COM TABLE OF CONTENTS 3 Introduction 4 Cerebral Organoid Formation 5 Cerebral Organoid Characterization 7 Performance of STEMdiffTM Cerebral Organoid Kit vs. Unqualified Reagents 7 Product Information 7 References Introduction For the Culture and Maturation of Why Use the STEMdiff™ Cerebral Organoid Kit? Human Cerebral Organoids PHYSIOLOGICAL. Three-dimensional in vitro system The metazoan brain is a highly complex and organized structure. recapitulates the developmental processes and Two-dimensional (2D) neural cultures derived from human organization of the developing brain. pluripotent stem cells (hPSCs) are useful models to study the nervous INNOVATIVE. Serum-free human pluripotent stem system, but they are limited in their capacity to recapitulate the cell-based model enables the study of development and complex organization of brain tissues. disease processes. hPSC-derived cerebral organoids are three-dimensional (3D) in vitro OPTIMIZED. Formulation is optimized for increased culture systems that recapitulate the developmental processes and efficiency of organoid formation. organization of the developing human brain. They provide a physiologically relevant in vitro model for the RELIABLE. Rigorous raw material screening and study of neurological development and disease processes that extensive quality control testing ensure reproducibility are unique to the human nervous system. Cerebral organoids and minimal lot-to-lot variability. have important applications in studying human brain development SIMPLE. Convenient format and easy-to-use protocol. and neurological disorders such as autism, schizophrenia or brain defects caused by Zika virus infection. The STEMdiff™ Cerebral Organoid Kit is a serum-free culture system that is designed to generate cerebral organoids from human embryonic stem (ES) cells observed during in vivo human brain development.
    [Show full text]
  • Optimization of Cerebral Organoid Culture from Embr
    CALIFORNIA STATE UNIVERSITY, NORTHRIDGE Growing Brains to Study Development: Optimization of Cerebral Organoid Culture from Embryonic Stem Cells A thesis submitted in partial fulfillment of the requirements For the degree of Master of Science in Biology By Jessie Erin Buth December 2015 The thesis of Jessie Erin Buth is approved: __________________________________ ____________________________________ Dr. Aida Metzenberg Date __________________________________ ____________________________________ Dr. Randy Cohen Date __________________________________ ____________________________________ Dr. Cindy Malone, Chair Date California State University, Northridge ii Table of Contents Signature Page ii List of Figures iii Abstract vi Chapter 1: Introduction 1 Chapter 2: Methods 15 Chapter 3: Results 23 Chapter 4: Discussion 50 References 55 Appendix: Supplemental Methods 59 List of Figures Figure 1: Human organoid protocol (Cell line H9) and morphology at various time points. 23 Figure 2: Review of cortex development. 24 Figure 3: V-bottomed 96-well plates improve aggregate formation and generates a thick neuroepithelial layer on day 18 compared to U-bottomed 96-well plates. 25 Figure 4: Plating at 9,000 cells per well on day 0 generates thickest continuous neuroepithelial layer compared to other cell numbers. 26 Figure 5: Addition of the BMP inhibitor (LDN193189) does not improve the efficiency of producing FOXG1+ cortical progenitors and inhibits formation of continuous N-cadherin+ apical membrane. 27 Figure 6: Fold change in gene expression of cortical markers increases as stem cell markers decrease in human cortical organoids over time by qPCR. 28 Figure 7: Human embryonic stem cells efficiently form cortical progenitors with 81.7% of total live cells per organoid positive for cortical marker FOXG1 at day 18.
    [Show full text]
  • Modelling Heme-Mediated Brain Injury Associated with Cerebral Malaria In
    www.nature.com/scientificreports OPEN Modelling heme-mediated brain injury associated with cerebral malaria in human brain cortical organoids Adriana Harbuzariu1*, Sidney Pitts1, Juan Carlos Cespedes1, Keri Oxendine Harp1, Annette Nti1, Andrew P. Shaw2, Mingli Liu1 & Jonathan K. Stiles1* Human cerebral malaria (HCM), a severe encephalopathy associated with Plasmodium falciparum infection, has a 20–30% mortality rate and predominantly afects African children. The mechanisms mediating HCM-associated brain injury are difcult to study in human subjects, highlighting the urgent need for non-invasive ex vivo human models. HCM elevates the systemic levels of free heme, which damages the blood-brain barrier and neurons in distinct regions of the brain. We determined the efects of heme on induced pluripotent stem cells (iPSCs) and a three-dimensional cortical organoid system and assessed apoptosis and diferentiation. We evaluated biomarkers associated with heme-induced brain injury, including a pro-infammatory chemokine, CXCL-10, and its receptor, CXCR3, brain-derived neurotrophic factor (BDNF) and a receptor tyrosine-protein kinase, ERBB4, in the organoids. We then tested the neuroprotective efect of neuregulin-1 (NRG-1) against heme treatment in organoids. Neural stem and mature cells diferentially expressed CXCL-10, CXCR3, BDNF and ERBB4 in the developing organoids and in response to heme-induced neuronal injury. The organoids underwent apoptosis and structural changes that were attenuated by NRG-1. Thus, cortical organoids can be used to model heme-induced cortical brain injury associated with HCM pathogenesis as well as for testing agents that reduce brain injury and neurological sequelae. Brain organoids are self-assembled three-dimensional (3D) aggregates derived from pluripotent stem cells (iPSCs) with cell types and formations that mimic the embryonic human brain1–7.
    [Show full text]
  • Stem Cells, Genome Editing and the Path to Translational Medicine
    Stem Cells, Genome Editing, and the Path to Translational Medicine The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Soldner, Frank and Rudolf Jaenisch. "Stem Cells, Genome Editing, and the Path to Translational Medicine." Cell 175, 3 (October 2018): P615-632 © 2018 Elsevier Inc As Published http://dx.doi.org/10.1016/j.cell.2018.09.010 Publisher Elsevier BV Version Author's final manuscript Citable link https://hdl.handle.net/1721.1/125973 Terms of Use Creative Commons Attribution-NonCommercial-NoDerivs License Detailed Terms http://creativecommons.org/licenses/by-nc-nd/4.0/ HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Cell. Author Manuscript Author manuscript; Manuscript Author available in PMC 2019 October 18. Published in final edited form as: Cell. 2018 October 18; 175(3): 615–632. doi:10.1016/j.cell.2018.09.010. Stem cells, genome editing and the path to translational medicine Frank Soldner1 and Rudolf Jaenisch1,2,3 1The Whitehead Institute, 455 Main Street, Cambridge, MA 02142, USA 2Department of Biology, Massachusetts Institute of Technology, 31 Ames Street, Cambridge, MA 02139, USA Summary The derivation of human embryonic stem cells (hESCs) and the stunning discovery that somatic cells can be reprogrammed into human induced pluripotent stem cells (hiPSCs) holds the promise to revolutionize biomedical research and regenerative medicine. In this review, we focus on disorders of the central nervous system and explore how advances in human pluripotent stem cells (hPSCs) coincide with evolutions in genome engineering and genomic technologies to provide realistic opportunities to tackle some of the most devastating complex disorders.
    [Show full text]
  • Building Three-Dimensional Human Brain Organoids Sergiu P
    Building three-dimensional human brain organoids Sergiu P. Paşca The organogenesis of the human central nervous system is an intricately culture methods, to self-organize into brain spheroids or organoids. orchestrated series of events that occurs over several months and These organoid cultures can be derived from any individual, can be ultimately gives rise to the circuits underlying cognition and behavior. guided to resemble specific brain regions, and can be employed to model There is a pressing need for developing reliable, realistic, and complex cell-cell interactions in assembloids and to build human circuits. personalized in vitro models of the human brain to advance our This emerging technology, in combination with bioengineering and other understanding of neural development, evolution, and disease. Pluripotent state-of-the-art methods for probing and manipulating neural tissue, has stem cells have the remarkable ability to dierentiate in vitro into any of the potential to bring insights into human brain organogenesis and the the germ layers and, with the advent of three-dimensional (3D) cell pathogenesis of neurological and psychiatric disorders. Brain organogenesis in vitro and in vivo Brain organogenesis in vitro and in vivo Brain assembloids Methods for generating neural cells in vitro aim to recapitulate Spinal Forebrain Forebrain Blastocyst Cerebral Dorsal Pallial-subpallial assembloid key stages of in vivo brain organogenesis. Folding of the Neural Neural cord Paired recordingOptogenetics Pharmacology fold crest cortex Glutamate uncaging ectoderm-derived neural plate gives rise to the neural tube, Embryonic Yo lk sac Region 1 Region 2Region 3 which becomes enlarged on the anterior side to form the stem cell Neural groove Ventral Inner cell forebrain in the central nervous system (CNS).
    [Show full text]
  • Organoid Based Personalized Medicine: from Bench to Bedside Yaqi Li1,2†, Peiyuan Tang3†, Sanjun Cai1,2, Junjie Peng1,2 and Guoqiang Hua3,4*
    Li et al. Cell Regeneration (2020) 9:21 https://doi.org/10.1186/s13619-020-00059-z REVIEW Open Access Organoid based personalized medicine: from bench to bedside Yaqi Li1,2†, Peiyuan Tang3†, Sanjun Cai1,2, Junjie Peng1,2 and Guoqiang Hua3,4* Abstract Three-dimensional cultured organoids have become a powerful in vitro research tool that preserves genetic, phenotypic and behavioral trait of in vivo organs, which can be established from both pluripotent stem cells and adult stem cells. Organoids derived from adult stem cells can be established directly from diseased epithelium and matched normal tissues, and organoids can also be genetically manipulated by CRISPR-Cas9 technology. Applications of organoids in basic research involve the modeling of human development and diseases, including genetic, infectious and malignant diseases. Importantly, accumulating evidence suggests that biobanks of patient- derived organoids for many cancers and cystic fibrosis have great value for drug development and personalized medicine. In addition, organoids hold promise for regenerative medicine. In the present review, we discuss the applications of organoids in the basic and translational research. Keywords: Organoids, Stem cells, Disease modeling, Biobanks, Personalized medicine Background phenocopy tumor heterogeneity is highly needed for re- Two-dimensional (2D) cultured cell lines have been the search on the mechanisms of cancer progression and ac- main in vitro research tool for the past decades. Cell quired drug resistance. In 1953, the first patient-derived lines are relatively cheap, easy to handle and can be ap- xenograft (PDX) models were successfully established plied to multiple experimental techniques. However, the (Toolan 1953). In this model, primary tumor tissue is establishment of a cell line is time-consuming and transplanted into immune-deficient mice, while tumor involves extensive genetic and phenotypic adaption to structure and the relative proportion of tumor cells and culture conditions.
    [Show full text]
  • Amsterdamprogram2019 022019.Pdf
    3D Cell Culture and Analysis Explore new dimensions in 3D cell modeling As we look to the future of innovation, creating more physiologically relevant models through the study of organoids and spheroids is becoming increasingly important. These three-dimensional (3D) models not only mimic cell functions, they also allow for more robust testing of compounds and a more representative analysis. That’s why we’ve compiled a collection of tested products, protocols, and seminal publications to help you accelerate the development of more realistic cellular models. Find out more about culturing and analyzing organoids and spheroids at thermofi sher.com/organoid For Research Use Only. Not for use in diagnostic procedures. © 2018 Thermo Fisher Scientifi c Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientifi c and its subsidiaries unless otherwise specifi ed. COL23163 1218 PG1965-PJT4432-COL23163-3D-CellModeling-SSCR-PrintAd-Global.indd 1 12/20/18 2:25 PM Stem Cells & Organoids in Development & Disease AMSTERDAM NETHERLANDS Welcome Dear Colleagues, On behalf of the International Society for Stem Cell Research (ISSCR), we warmly welcome you to beautiful Amsterdam for the International Symposia, “Stem Cells & Organoids in Development & Disease.” A leader in life science and health technologies, Amsterdam was recently ranked as one of the top academic and biomedical communities in Europe. Amsterdam’s culture of education and innovation makes it the perfect setting for this timely and important meeting. Research using organoids is rapidly advancing the field of stem cell science. Recent work has demonstrated that stem cells retain self-organizing properties in culture, recapitulating in vivo processes and forming organ- like tissues.
    [Show full text]
  • Improving Tissue Differentiation in Cerebral Organoids
    Improving tissue differentiation in cerebral organoids Technical Journal Club Manfredi Carta 16.06.2020 Contents Introduction Protocol overview 1. hPSCs are incubated in human ES medium with low bFGF4 and ROCK inhibitor embryoid bodies (= 3D aggregates of hPSCs) 2. Transfer to neural induction medium (DMEM/F12, N2, GluMax, amino acids, heparin) 3. Transfer to Matrigel, grow in differentiation media (DMEM/F12, Neurobasal, B27 w/o Vitamin A, N2, β-ME, insulin, GluMax, amino acids) 4. Add Vitamin A to media, grow in spinning bioreactor bFGF4: basic fibrobl. growth factor 4 ROCK: Rho-associated protein kinase Spinning conditions Tissues grown in spinning bioreactor • developed contained large fluid-filled cavities (similar to ventricles) • apical localisation of neural N-cadherin • Were larger and more continuous than tissues grown in stationary suspension Fluid-filled cavity Retina-like pigmented epithelium SOX2+: neural progenitors Scale bars: 200µm TUJ1+: neurons Cerebral organoids: Anatomy Forebrain Choroid plexus Molecular layer Meninges Choroid plexus • Spinning conditions: anatomy reminiscent of brain regions • Organoids lacked vasculature, limited oxygen and nutrient diffusion: cell death in internal areas (TUNEL stain) Mammalian brain development • Neuroepithelium expands to generate radial glial stem cells (RG) • RG divide at the apical surface within the ventricular zone (VZ), generate neurons and intermediate progenitor cells (IPCs) • IPCs populate the subventricular zone (SVZ), neurons migrate through intermediate zone (IZ) to
    [Show full text]
  • Midbrain Organoids with an SNCA Gene Triplication Model Key Features of Synucleinopathy
    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.12.439480; this version posted April 12, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Midbrain organoids with an SNCA gene triplication model key features of synucleinopathy Running Title: Midbrain organoids model synucleinopathy Nguyen-Vi Mohamed1, Julien Sirois1, Janani Ramamurthy1, Meghna Mathur1, Paula Lépine1, Eric Deneault1, Gilles Maussion1, Michael Nicouleau1, Carol X.-Q. Chen1, Narges Abdian1, Vincent Soubannier1, Eddie Cai1, Harris Nami1, Rhalena A. Thomas1, Mahdieh Tabatabaei1,2, Lenore K. Beitel1, Karamjit Singh Dolt3, Jason Karamchandani1,2, Tilo Kunath3, Edward A. Fon1, Thomas M. Durcan1 1 Early Drug Discovery Unit (EDDU), Montreal Neurological Institute-Hospital, Department of Neurology and Neurosurgery, McGill University, 3801 University Street, Montreal, Quebec, H3A 2B4, Canada 2 C-BIG Biorepository (C-BIG), Montreal Neurological Institute-Hospital, McGill University, 3801 University Street, Montreal, Quebec, H3A 2B4, Canada 3 Centre for Regenerative Medicine, School of Biological Sciences, University of Edinburgh, 5 Little France Drive, Edinburgh EH16 4UU, UK Corresponding authors: Thomas M. Durcan: [email protected] and Edward A. Fon: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2021.04.12.439480; this version posted April 12, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.
    [Show full text]
  • Brain Organoids: Advances, Applications and Challenges Xuyu Qian1,2, Hongjun Song1,3,4,5 and Guo-Li Ming1,3,4,6,*
    © 2019. Published by The Company of Biologists Ltd | Development (2019) 146, dev166074. doi:10.1242/dev.166074 REVIEW Brain organoids: advances, applications and challenges Xuyu Qian1,2, Hongjun Song1,3,4,5 and Guo-li Ming1,3,4,6,* ABSTRACT human brain not only at the cellular level, but also in terms of Brain organoids are self-assembled three-dimensional aggregates general tissue structure and developmental trajectory, therefore generated from pluripotent stem cells with cell types and providing a unique opportunity to model human brain development cytoarchitectures that resemble the embryonic human brain. As and function, which are often inaccessible to direct experimentation. such, they have emerged as novel model systems that can be used Combined with recent technological advances, such as patient- to investigate human brain development and disorders. Although derived hiPSCs, genetic engineering, genomic editing, and high- brain organoids mimic many key features of early human brain throughput single cell transcriptomics and epigenetics, brain development at molecular, cellular, structural and functional organoids have revolutionized our toolboxes to investigate levels, some aspects of brain development, such as the formation development, diseases and evolution of the human brain. of distinct cortical neuronal layers, gyrification, and the establishment In this Review, we first introduce recent advances in brain of complex neuronal circuitry, are not fully recapitulated. Here, we organoid technologies, and their applications as model systems summarize recent advances in the development of brain organoid and discovery tools. We then discuss the hurdles that current methodologies and discuss their applications in disease modeling. In methodologies have yet to overcome, and offer feasible suggestions addition, we compare current organoid systems to the embryonic for future steps and objectives that would enable organoid human brain, highlighting features that currently can and cannot be technologies to progress further.
    [Show full text]
  • Gene Edited Fluorescent Cerebral Organoids to Study Human Brain Function and Disease
    Gene Edited Fluorescent Cerebral Organoids to Study Human Brain Function and Disease Thorsten Mueller ( [email protected] ) Ruhr-University Bochum, LMU Munich https://orcid.org/0000-0002-0173-3412 Lisa Bachmann Ruhr University Bochum: Ruhr-Universitat Bochum Lucia Gallego Villarejo Ruhr University Bochum: Ruhr-Universitat Bochum Natalie Heinen Ruhr University Bochum: Ruhr-Universitat Bochum David Marks Ruhr University Bochum: Ruhr-Universitat Bochum Research Article Keywords: Cerebral Organoids, CRISPR/Cas9 gene-editing, 3D cell culture, hiPSCs, brain function, brain disease Posted Date: March 2nd, 2021 DOI: https://doi.org/10.21203/rs.3.rs-248029/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/19 Abstract Cerebral organoids are a promising model to study human brain function and disease, though the high inter-organoid variability of the mini-brains is still challenging. To overcome this limitation, we introduce the method of labeled mixed organoids generated from two different human induced pluripotent stem cell (hiPSC) lines, which enables the identication of cells from different origin within a single organoid. The method combines a gene editing workow and subsequent organoid differentiation and offers a unique tool to study gene function in a complex human 3D tissue-like model. Using a CRISPR/Cas9 gene editing approach, different uorescent proteins were fused to β-actin or lamin B1 in hiPSCs and subsequently used as a marker to identify each cell line. Mixtures of differently edited cells were seeded to induce embryoid body formation and cerebral organoid differentiation. As a consequence, the development of the 3D tissue was detectable by live confocal uorescence microscopy and immunouorescence staining in xed samples.
    [Show full text]
  • Harvard Thesis Template
    MODELING HUMAN BRAIN DEVLEOPMENT AND DISEASES USING HUMAN INDUCED-PLURIPOTENT STEM CELL-DERIVED ORGANOIDS by XUYU QIAN A dissertation submitted to Johns Hopkins University In conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland December 2019 © 2019 Xuyu Qian All Rights Reserved. Abstract Brain organoids, three-dimensional cultures that model organogenesis, provide a new platform to investigate brain development. High cost, variability and heterogeneity currently limit the broad application of existing brain organoid technologies. My thesis work focuses on developing methods to generate forebrain organoids from human induced pluripotent stem cells (hiPSCs) using a custom-designed spinning bioreactor. Forebrain organoids recapitulate key features of human cortical development, including progenitor zone organization, neurogenesis, gene expression, and, notably, a well-defined outer radial glial cell (RGCs) layer resembling the human outer subventricular zone. An immediate application for brain organoids is to address the global health emergency of Zika virus (ZIKV)-induced microcephaly. Exposure of ZIKV to forebrain organoids revealed preferential, productive infection of RGCs. ZIKV infection leads to increased cell death and reduced proliferation, resulting in decreased neuronal cell layer volume and reduced overall organoid size, resembling microcephaly. Our forebrain organoids and SpinΩ bioreactor provide an accessible and versatile platform for modeling human brain development and disease, and for compound testing, including potential ZIKV antiviral drugs. Results from our ZIKV experiments reveal cellular mechanisms of ZIKV-induced microcephaly and have implications for therapeutic development. Another limitation of current organoid methods is interior hypoxia and cell death due to insufficient surface diffusion, preventing generation of architecture representative ii of late developmental stages.
    [Show full text]