Dedifferentiation Alters Chondrocyte Nuclear Mechanics During in Vitro

Home , Chondrocyte

bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Dedifferentiation alters chondrocyte nuclear mechanics during in vitro

culture and expansion

Authors

Soham Ghosh 1, 2, *, Adrienne K. Scott 3, Benjamin Seelbinder 3, Jeanne E. Barthold 3,

Brittany M St. Martin 3, Samantha Kaonis 2, Stephanie E. Schneider 3, Jonathan T. Henderson

4, Corey P. Neu 3

Affiliations

1 Department of Mechanical Engineering, Colorado State University, Fort Collins, CO 2 School of Biomedical Engineering, Colorado State University, Fort Collins, CO 3Department of Mechanical Engineering, University of Colorado Boulder, Boulder, CO 4 Weldon School of Biomedical Engineering, Purdue University, West Lafayette, IN

* Correspondence: [email protected]

ABSTRACT

Dedifferentiation of chondrocytes during in vitro passaging before implantation, and post

implantation in vivo, is a critical limitation in cartilage tissue engineering. Several biophysical

features define the dedifferentiated state including a flattened cell morphology and increased

stress fiber formation. However, how dedifferentiation influences nuclear mechanics, and the

possible long-term implications of this state, are unknown. In this study, we investigated how

chondrocyte dedifferentiation affects the mechanics of the chromatin architecture inside the

cell nucleus and the gene expression of the structural proteins located at the nuclear envelope.

Through an experimental model of cell stretching and a detailed spatial intranuclear strain

quantification, we identified that strain is amplified and distribution of strain within the

chromatin is altered under tensile loading in the dedifferentiated state. Further, using a

confocal microscopy image-based finite element model and simulation of cell stretching, we

found that the cell shape is the primary determinant of the strain amplification inside the

chondrocyte nucleus in the dedifferentiated state. Additionally, we found that nuclear

envelope proteins have lower gene expression in the dedifferentiated state suggesting a

weaker nuclear envelope which can further intensify the intranuclear strain amplification. Our

results indicate that dedifferentiation and altered nuclear strain could promote gene

expression changes at the nuclear envelope, thus promoting further deviation from

chondrocyte phenotype. This study highlights the role of cell shape on nuclear mechanics and

lays the groundwork to design biophysical strategies for the maintenance and enhancement of

the chondrocyte phenotype during expansion with a goal of successful cartilage tissue

engineering.

SIGNIFICANCE

Chondrocytes dedifferentiate into a fibroblast-like phenotype in a non-native biophysical

environment. Using high resolution microscopy, intranuclear strain analysis, finite element

method based computational modeling, and molecular biology techniques, we investigated

how mechanical force causes abnormal intranuclear strain distribution in chondrocytes during

the dedifferentiation process. Overall, our results suggest that the altered cell geometry aided

by an altered or weakened nuclear envelope structure are responsible for abnormal

intranuclear strain during chondrocyte dedifferentiation that can further deviate chondrocytes

to a more dedifferentiated state.

INTRODUCTION

Cartilage tissue engineering has received specific attention in the attempt to treat

osteoarthritis, a debilitating disease affecting a large worldwide population (1).

Pharmaceutical therapies to treat this degenerative disease are limited, and current disease

management protocol relies on lifestyle changes and the use of drugs to ameliorate pain or to

reduce inflammation. Tissue engineering and regenerative medicine are promising

approaches with the goal to rebuild the damaged articular cartilage to restore the functions of

the knee joint (2).

Autologous Chondrocyte Implantation (ACI) is a promising approach for cartilage

tissue engineering, where chondrocytes extracted from the patient are expanded in vitro and

then implanted back in the knee joint to regenerate functional articular cartilage (2–4).

However, there are two critical challenges that limit the potential widespread application of

this technology. First, from clinical follow up studies, it is now apparent that the success of

the ACI treatment is limited because of post-operative fibrosis that leads to inferior

biomechanical and functional response of the knee joint (5–9). The post-operative fibrosis is

probably triggered by the dedifferentiation of the chondrocytes to fibroblast-like phenotype

after implantation because the chondrocytes experience a mechanically fibrous and stiffer

tissue microenvironment different than the native healthy cartilage environment, not

conducive to the maintenance of the chondrocyte phenotype. The second critical challenge of

ACI involves the expansion of the chondrocytes in vitro. During the expansion process and

passaging, the chondrocytes dedifferentiate into fibroblast-like cells while cultured on a two-

dimensional (2D) monolayer culture. Consequently, the scalability of the ACI technology is

limited because growing enough cells for a large defect requires extensive time, which can

further dedifferentiate chondrocytes in 2D culture. bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Changes in mechanical loading of chondrocytes might lead to chondrocyte

dedifferentiation in vivo and in vitro. Static and dynamic loading on the chondrocyte and its

complex interaction with the pericellular matrix (PCM) and extracellular matrix (ECM)

probably plays a critical mechanobiological role (10–13) in the dedifferentiation process (14).

Mechanical stretching on chondrocytes in the native cartilage environment is shown to induce

several pathophysiological responses mediated by several mechanobiological pathways (15–

17). In vitro, the monolayer culture of chondrocytes on a dish imparts a passive two-

dimensional mechanical stretch on the cell, aided by the flat cell shape and contractile forces

imparted by F-actin stress fibers. Dedifferentiated chondrocytes in monolayer culture have a

higher cell stiffness mediated by a cell membrane-F actin adhesion mechanism (18),

indicating higher contractile forces within the cell. Interestingly, several studies indicate that

if the cells are instead encapsulated in a three-dimensional (3D) environment, the

chondrocyte phenotype prevails. Even the late passage chondroblasts (a term used to define a

cell showing the phenotype of both chondrocyte and fibroblast) redifferentiate into

chondrocytes (19, 20) when cultured in 3D, suggesting that releasing cell contraction

experienced in 2D ameliorates the dedifferentiation.

The mechanical loading not only affects the chondrocyte cytoskeletal mechanics, but

also it reaches and affects the cell nucleus as well (21–23) which might have unknown

implications in the chondrocyte dedifferentiation process. The mechanics of the cell nucleus

and its biological implication, termed as nuclear mechanobiology has recently been shown to

be important in numerous biological contexts - in diseases (24, 25), gene expression (26),

differentiation (27, 28), developmental biology (29) and tissue homeostasis (30). The study of

nuclear mechanobiology investigates how the mechanical microenvironment (i.e., stretch,

compression and shear) affects the spatiotemporal function of the nuclear envelope, the

nucleoskeleton, the chromatin architecture, and hence the gene regulation. A recent study bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

elucidated that the loss of extracellular matrix stiffness and the lack of three-dimensional

chondrocyte matrix decreases the chondrocyte cell and nuclear stiffness, suggesting the

critical role of cell mechanical environment in the chondrocyte phenotype maintenance and

nuclear mechanics (31). Another recent study discovered that under shear stress, the

chondrocyte nucleus experiences complex strain pattern resulted by heterogeneous

intranuclear chromatin architecture, further highlighting the importance of chondrocyte

nuclear mechanics (32). However, in the context of chondrocyte dedifferentiation it is not

understood how the mechanical stretch and gradual dedifferentiation affects the intranuclear

mechanics and the structural proteins of the nuclear envelope. Such knowledge could be

potentially exploited for improving cartilage tissue engineering as intranuclear mechanics can

directly affect the genomic expression stability of cells (33).

In this study, we hypothesized that cell spreading of chondrocytes during expansion

processes results in altered cell mechanics leading to an abnormal strain burden in the nucleus

via flat cell morphology and weaker nuclear envelope. To test this hypothesis, we

mechanically stretched the chondrocytes in a controlled manner to visualize the strain

anomaly in early passage and late passage chondrocyte nuclei using a technique already

established before in the context of studying chondrocyte dedifferentiation and pathology

(34–36). We found an amplified strain magnitude and an abnormal distribution of strain

inside the chromatin of the chondrocyte that might be the cause of further degeneration of the

chondrocyte phenotype, as indicated by changes in gene expression of the dedifferentiated

chondrocytes compared to early passage chondrocytes. Next, using an image-based

computational modeling of cell stretching we found that the flattened cell morphology is a

key mediator of higher strain inside the cell nucleus. Gene expression studies of chondrocytes

suggested a mechanically weaker nuclear envelope in later passages thus indicating an bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

additional potential mechanism of amplified mechanical strain inside the cell nucleus at later

passages.

METHODS

Chondrocyte extraction and culture

Primary bovine chondrocytes were harvested from the load-bearing region of the

medial condyle from young bovine joints less than six months old (37, 38). The cells were

seeded directly on the substrate after harvesting and these cells were described as Population

Doubling 0 (PD0) cells, corresponding to passage 0. Harvested cells were cultured in

DMEM-F12 with 10% FBS and passaged at around 80% confluency on petri dishes

(Corning, 430165) until Population Doubling 8 (PD8), corresponding to passage 4.

Imaging and geometrical characterization of chondrocytes

PD0 and PD8 chondrocytes were cultured on cell culture petri dishes (Corning), and

StageFlexer Type I Collagen treated membranes (FlexCell International Corp) for 24 hours

prior to fixation to allow for complete adhesion. Chondrocytes were fixed with cold 4%

paraformaldehyde (Electron Microscopy Sciences) in 1X PBS, washed with 1X PBS three

times, permeabilized in 0.1% Triton X-100 (Sigma Aldrich), and again washed with 1X PBS

three times. Next, cells were incubated with DAPI (Thermo Fisher Scientific) for nuclear

DNA staining (1:500) and Alexa Fluor 488 phalloidin (Thermo Fisher Scientific) for

cytoplasmic F-actin staining (1:500). Fluorescent images of the PD0 and PD8 chondrocytes

were captured using an inverted confocal microscope (Nikon Eclipse Ti AIR, Location, USA)

with a 10´ air objective and a 60´ oil objective. Cells to image were chosen at random and

distributed across the substrate. The area, the length and the aspect ratio of both the cell and

the nucleus for imaged cell were measured using the image analysis software, Fiji.

Gene expression analysis on PD0 and PD8 chondrocytes bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Total RNA was extracted from the PD0 and PD8 chondrocytes from Type I Collagen

treated membranes (FlexCell International Corp.) using AurumTM Total RNA Mini Kit,

reverse transcribed into cDNA via iScriptTM Reverse Transcription Supermix. Real-time

quantitative PCR was performed with SsoAdvancedTM Universal SYBR® Green Supermix

in a CFX96 Touch™ thermocycler (all kits and devices from Bio-Rad Laboratories) using 10

ng of cDNA/ reaction. All data was normalized to the reference genes HPRT1 and RPL10A.

Primers were custom designed, and sequences are listed in Supplementary Table 1.

Experimental set up for chondrocyte mechanical stretching

The FlexCell (FlexCell International Corp.) cell stretching device was used to apply

controlled biaxial mechanical stretching on the chondrocytes. StageFlexer Type I Collagen

treated membranes (FlexCell International Corp.) were used for the chondrocyte culture and

stretching. The device was modified for custom imaging specific to the current application

using a two-photon microscope (Olympus with a tunable Mai-Tai laser set at 540-600 nm).

The first modification was to convert it from a vacuum device to a positive pressure device

by placing a cap above the substrate (Figure S1a). The second modification was to drill out

the bottom support bracket under the loading post to allow for the objective to fit inside the

device. The magnitude of the substrate stretch varied linearly with change in pressure,

controlled by a pressure regulator programmed using a Labview interface (Figure S1b-c). To

calculate the substrate deformation, a previously developed technique was used (39). Briefly,

the technique tracked the displacement of beads pre-embedded in the membrane during

stretching. Subsequently, strain in the substrate was analyzed using the finite element

method. Thus, the equibiaxial stretch mode on the substrate and on the cells was validated

(Figure S1d-e).

Live chondrocyte stretching and imaging bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Cells were incubated on the substrate for 24 hours to allow for complete adhesion

prior to the stretching experiments. Nuclear DNA was stained with Hoechst 34580 (Life

Technologies) before loading the substrate on the stretching device. The cells remained in the

culture medium during imaging. Two photon microscopy (Olympus, 740 nm wavelength, 250

mW power for imaging the nucleus) with a 40´ water objective was used to capture three

images three minutes apart (Figure S1b) prior to stretching. The substrate, and in turn the

chondrocytes, were then stretched. Next, three more images were captured after finding the

chondrocytes in the new location. For each image capture the transmitted light was also used

to visualize the overall cell shape.

Spatial strain quantification inside the nucleus

Chondrocyte nucleus images captured before and after stretching were used to

quantify spatial strain inside the nucleus with a technique called deformation microscopy (40,

41). Briefly, the image texture of the intranuclear space was utilized to achieve a high

resolution intranuclear displacement map. Several strain measures including hydrostatic

(related to volume change), deviatoric (related to shape change), and shear (angular

deformation) were then computed from the displacement map. Hydrostatic strain was further

categorized into tensile and compressive strain. A Hill’s function-based thresholding of the

nuclear image was performed (42) to distinguish the heterochromatin (high chromatin

density) and euchromatin (low chromatin density) domains.

Image based modeling and simulation of strain in chondrocytes

A computational model was developed to quantify the influence of changes in cell

geometry and mechanical properties on the deformation of nucleus at PD0 and PD8

chondrocytes. Supplementary Note explains the details of the image-based modeling and

strain analysis. Briefly, PD0 and PD8 chondrocytes were cultured, fixed, and stained for bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

DNA, F-actin and vinculin to image the nucleus, cytoplasm and focal adhesion complex

respectively (Figure 5a). Three representative cells from each group were chosen at random

for subsequent analysis. For each representative cell, the intracellular and intranuclear spaces

were segmented to create three separate domains of cytoplasm, heterochromatin and

euchromatin. Based on the confocal image stack, a three-dimensional geometry was created,

meshed and imported into a finite element method software (COMSOL Multiphysics 5.3,

Burlington, MA, USA). Further, appropriate governing equations and boundary condition

were used to solve for the strain in the cytoplasm, heterochromatin and euchromatin.

Effect of mechanical property on cell and nuclear strain: parametric study

A parametric study with the in silico cell model was used to investigate the effect of

the cell mechanical properties on the intranuclear strain. For the parametric study, the elastic

moduli of the cytoskeleton, euchromatin, and heterochromatin domains were varied for the

PD0 and PD8 chondrocytes, while all other parameters (density and Poisson’s ratio) were

held constant. Subsequently density and Poisson’s ratio were varied independently while

other mechanical parameters were held constant. The values chosen for each parametric study

are shown in Supplementary Table 2. The values assigned for each mechanical property are

physiologically relevant and represent the extreme ends of the property value. The

hydrostatic strain solution at each material node with the baseline mechanical properties

(cytoplasm: Young’s modulus E = 500 Pa in PD0, and 900 Pa in PD8; euchromatin, E = 1000

Pa in PD0 and PD8; heterochromatin, E = 4000 Pa in PD0 and PD8), was compared against

each new solution with a change in the parameter to assess how much the hydrostatic strain

solutions differed when the parameters were varied.

Statistical analysis bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

For cell and nuclear geometry analysis, t-test was performed with significance at

p<0.01. For strain comparison between groups, t-test was performed with significance at

p<0.05. For gene expression analysis study, t-test was performed with significance at p<0.01.

For the analysis of the parametric studies pertaining to the computational model, slope m and

coefficient of determination R2 was calculated using linear regression.

RESULTS

Cell and nuclear geometry and morphology

Early passage (PD0) chondrocytes displayed a round morphology with no visible F-

actin stress fiber formation on either substrate: Type I Collagen treated membrane and the

tissue culture plate (TCP) (Figure 1a). The nucleus was mostly located at the cell center.

Late passage (PD8) cells, in contrast, showed a larger cell area, F-actin stress fiber formation,

and the nucleus was often located off-center. Further quantification of the geometrical

measures revealed that for all substrates the cell area increased by almost five times and the

nuclear area increased by almost two times in PD8 cells compared to PD0 cells (Figure 1b).

Additionally, the cellular and nuclear morphology of chondrocytes cultured on the Type I

Collagen coated StageFlexer membranes showed similar phenotypes as they showed on

tissue culture plate (TCP), which validated our approach of chondrocyte culture for the

mechanical stretching experiment. Along with the cell geometry changes, the nuclear area

compared to cell area, and the nuclear linear dimension compared to cell linear dimension

decreased significantly in PD8 compared to PD0, a hallmark of deviation from the

chondrocyte like phenotype to hypertrophic chondrocyte phenotype, as observed in native

cartilages. In PD0, cell aspect ratio was maintained close to 1, signifying a round cell shape.

In PD8, cell aspect ratio deviated significantly from 1, suggesting irregularly shaped cells.

The nuclear aspect ratio showed a small deviation from the value 1 in PD8 compared to PD0

chondrocytes on collagen coated substrate, although the effect was not statistically bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

significant. Irrespective of population doubling number, both the cell and nuclear area

increased with the increasing stiffness of the substrate (stiffness of TCP > stiffness of Type I

Collagen treated membrane), which was expected because a higher stiffness promotes larger

cell and nuclear area through higher spreading of cells (43).

Passage specific gene expression of extracellular matrix proteins

Dedifferentiation of chondrocytes was associated with changes in extracellular matrix

specific proteins. The gene expression of chondrocyte specific proteins (SOX9, ACAN,

PRG4, COMP, COL2A1) decreased with dedifferentiation, while the fibroblast marker

specific gene expression (COLA1, VIM, S100A4, Thy1) increased (Figure 2). Our gene

expression data with young bovine articular cartilage chondrocyte agrees with previous

reports of chondrocytes extracted from adult human knee articular cartilage (44), adult pig

knee articular cartilage (45) and young bovine meniscus (46).

Complex spatial intranuclear strain pattern

With the significant changes in cell morphology and gene expression between the

PD0 and PD8 cell, we hypothesized that cellular geometry might influence strain transfer to

the nucleus, contributing to mechanosensitive signaling that drives the dedifferentiation

process. High resolution intranuclear spatial strain maps revealed an inhomogeneous

deformation inside PD0 cell nuclei, while PD8 cell nuclei displayed a larger strain

concentration at specific nuclear locations (Figure 3a). Shear and deviatoric strain values

were comparable in PD0 and PD8. The hydrostatic strain values in the PD0 nuclei were lower

overall (up to 0.35) compared to PD8 nuclei (up to 0.75), signifying that the PD8 nuclei

displayed a magnified deformation for the same applied deformation on the cell surface. In

PD0 cells, heterochromatin and euchromatin did not show any preferential strain localization.

Alternatively, in PD8 cells high strain was associated with heterochromatin, which are bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

pockets of high-density chromatin. The high strain regions in PD8 nuclei were most likely

associated with local stress fibers in the cytoplasm, which was also predicted from the model

as explained later (Figure 5). Most nuclear areas displayed a tensile strain, while

compressive strain prevailed in some nuclear areas (Figure 3b). The histograms further

showed, in detail, that the high chromatin density areas, i.e. the heterochromatin takes a more

tensile strain burden compared to euchromatin in PD8 cells.

Abnormal nuclear strain associated under tension in dedifferentiated cells

In dedifferentiated chondrocytes, the nucleus experienced an abnormal strain burden.

In PD0 chondrocytes, the heterochromatin showed higher strain both in the tensile and the

compressive modes (Figure 4a), suggesting that the heterochromatin might play a protective

role to maintain a low strain burden in euchromatin. In PD8 chondrocytes, where the stiffer

cell most likely imparted higher tension on the nuclear periphery, the heterochromatin

experienced a significantly higher strain in tension and a lower strain in compression.

Quantitative analysis (Figure 4b) further illustrated the strain differences as revealed by

deformation microscopy. Thus, the protective effect of heterochromatin seemed to diminish

in PD8 dedifferentiated cells.

Computational analysis of cell stretching

To understand why the PD8 chondrocyte nuclei experienced magnified strain, we

performed the computational analysis of cell stretching and visualized the intranuclear strain

due to the applied cell stretch. The computational analysis and the parametric study where the

chondrocyte stretch was simulated, reveals that the intracellular and intranuclear strains are

primarily influenced by the cell shape and geometry, while the mechanical properties of the

cytoskeleton have a smaller effect on the nuclear strain. A lower 3D aspect ratio (maximum

linear dimension parallel to the culture surface/ maximum cell height) of the cells promoted a bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

lower strain in the nucleus as evident in the PD0 chondrocytes which were round in shape

(Figure 5a, Figure S5). On the contrary, a larger 3D aspect ratio promoted a higher strain in

the nucleus of PD8 chondrocytes which were flat in shape (Figure 5a, Figure S5).

Volumetric hydrostatic strain maps showed key representative deformation features inside the

PD0 and PD8 chondrocyte models (Figure 5a, Figure S5). The spatial hydrostatic strain

distribution showed that on average, larger hydrostatic tensile strains were observed in the

PD8 cell nucleus in comparison to the PD0 cell nucleus (Figure 5b). The higher strains in the

nucleus were primarily associated with the cell protrusions, that were in the primary direction

of tension propagation inside the cell (Figure 5a). These computational observations matched

with the experimental observations, where some areas of the nucleus were associated with

larger strains, likely due to the vicinity to the cell protrusions which were rich in F-actin

stress fibers (Figure 3a). Overall larger hydrostatic tensile strains were observed in the PD8

cell nucleus in comparison to the PD0 cell nucleus from the computational studies (Figure

5a, Figure 5b), which agreed with the experimental measurement (Figure 3).

The parametric study showed that changing the mechanical properties had a less

significant effect on the simulated strain of the system, when compared with the effect of cell

shape and geometry. For example, as the elastic modulus of the cytoskeleton varied in

comparison to the baseline initial values (E = 500 Pa for PD0 and E = 900 Pa for PD8), the

strain pattern at each individual node in the nucleus remained similar as characterized by the

R2 ~ 0.98 in most cases (Supplementary Table 3). The range of strain values changed with

varying elastic modulus as characterized by deviation of slope m from 1, but overall, for the

same elastic modulus (E = 100 Pa, 300 Pa, 700 Pa and 1100 Pa), the range of strain and

maximum strain were higher in PD8 chondrocyte nuclei compared to PD0 chondrocyte nuclei

(Figure 5c). The change in the heterochromatin and euchromatin elastic modulus had minor

effect on the intranuclear strain distribution and values (Figure S2, Supplementary Table bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

3). The varied Poisson’s ratio of cytoskeleton, euchromatin and heterochromatin also did not

have a significant effect on the hydrostatic strain solutions at each nuclear node (Figure S3,

Supplementary Table 4). However, the strain values in the nucleus for the PD0 and PD8

geometries varied by about a factor of two, as shown by the volumetric hydrostatic strain

maps and histograms showing the distribution of strain (Fig 5a, Figure 5b). Therefore,

changing the shape of the cell had the primary impact on the resulting nuclear strain range

and magnitude compared to the material properties of the cell.

Passage specific gene expression of nuclear envelope proteins

In addition to a change in geometry, we hypothesized that structural changes in the

nuclear envelope could also lead to abnormal strain transfer to the chondrocyte nucleus. We

found that dedifferentiation of chondrocytes was associated with a lower expression of

several structural proteins in the nucleus (Figure 6), in addition to gene expression changes

in extracellular matrix specific proteins (Figure 2). Expression of some key nuclear envelope

related proteins such as Lamin B1, Lamin B2, Emerin and SUN 2 remained constant in the

dedifferentiated state. Expression of some other proteins which provide stability to the

nuclear envelope such as Lamin A/C, Nesprin 1, Nesprin 2, SUN 1 and Lemd3 decreased

significantly. The highest decrease was associated with Lemd3 protein, which has a direct

role in controlling the TGF-b and the BMP pathways, both critical factors in chondrogenic

expression. SUN 1 is one of the two SUN proteins of the LINC (Linker of Nucleoskeleton

and Cytoskeleton) complex which protrudes through the nuclear membrane, and its decreased

expression severs the connection between the cytoskeleton and nucleoskeleton (25). Nesprin

1 and Nesprin 2 specifically bind to actin in cytoskeleton, and Lamin A/C creates a mesh-like

structure under the inner nuclear membrane providing mechanical integrity to the cell nuclear

envelope (25). Overall, this data suggested a weaker nuclear envelope, which in turn may

amplify the intranuclear strain. bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

DISCUSSION

In this study, we investigated the mechanical behavior of early passage chondrocytes

and dedifferentiated late passage chondrocytes, to elucidate the passage dependent gradual

deviation from the chondrocyte phenotype. We found that the nuclear mechanics played a

role behind this elusive chondrocyte behavior. The proposed mechanobiological model

(Figure 7) summarizes possible contributing factors to the dedifferentiation process.

Essentially, we hypothesize that the fate of chondrocytes is in a positive feedback loop where

a chondrocyte is driven toward a fibroblast phenotype in two typical scenarios – after

implantation in vivo, and before implantation during monolayer culture in vitro. In the

proposed model, the mechanical stretch of the nucleus is a trigger, which can be induced by

repeated biomechanical stretching in vivo, or during cell spreading and 2D cell shape

maintenance in vitro. Utilizing a flattened cell shape and weaker nuclear envelope in

dedifferentiated chondrocytes, the stretch causes amplified intranuclear strain and abnormal

chromatin strain pattern thar are opposite to that of early passage chondrocyte. Such

abnormal strain could shift the gene expression pattern to a more fibroblast specific lineage,

which further increases the stretch on the nucleus, thus completing the positive feedback

loop.

Several studies thoroughly investigated what molecular changes happen with passage-

driven dedifferentiation, and it was found that chondrogenic gene expression decreases and

fibroblast specific expression increases with passaging (47, 48). A time lapse observation

study was performed using chondrocyte specific reporter Col11a2 to investigate whether the

dedifferentiation was triggered by the chondrocyte division and proliferation, or by outgrowth

of fibroblasts prevailing from the start of culture, but neither of these two mechanisms

seemed to be the reason behind the dedifferentiation (49). Attempts have been previously

made to understand the dedifferentiation mechanism, and subsequently redifferentiate the bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

dedifferentiated cells to chondrocyte phenotype. Three dimensional encapsulation of late

passage cells showed redifferentiation potential in several hydrogel systems such as agarose

(50), polyethelene glycol and chondroitin sulfate (51), alginate (52, 53), dense collagen (20),

and high density pellet culture (54, 55). There are several proposed mechanisms of how 3D

culture promotes redifferentiation, such as the involvement of cytokines (56, 57) and

microRNA (58). Our findings from this study suggests a biophysical mechanism in line with

the existing reports. 3D culture decreases the stress fiber formation inside the cell and also

imparts a round shape to the cell and nucleus (59). Therefore, in 3D, tension on the nucleus

drastically reduces, changing the loading mode on the nucleus to compressive, potentially

halting the dedifferentiation positive feedback loop proposed. Thus, the present study

explains the redifferentiation mechanism in 3D. However, the 3D hydrogel-based therapy is

not widely accepted for MACI procedure due to a lack of understanding the passaging limit

of chondrocytes in the 2D environment and the inability of chondrocytes to substantially

proliferate in the 3D environment (60).

Redifferentiation in 2D culture could be a promising approach as cells can be

expanded to a large enough quantity, and their retrieval is straightforward. Several different

approaches have been attempted to achieve this goal. Molecular biological interventions

include the AIMP1 downregulation using siRNA to restore the TGF-b pathway (61),

inhibition of BMP-2 using melanoma inhibitory activity protein (62) and upregulation of

Sonic Hedgehog (Shh) pathway (63). Another approach is to induce stressed condition to the

cells such as hypothermia (64), hypoxia (65), and applying intermittent hydrostatic pressure

(66), but the underlying mechanism of stress-induced redifferentiation has not been

completely explored. Importantly, disrupting the contractile function of the cytoskeleton,

which in turn would change the deformation of the nucleus, is also a promising technique to

prevent dedifferentiation (67, 68). Finally, epigenetic modifications of the dedifferentiated bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

cells is a new approach on the horizon, where the chromatin architecture is directly targeted

for redifferentiation (69). The outcome of our study which suggests a flattened cell,

potentially weaker nuclear envelope suggested by the gene expression data, and amplified

intranuclear strain pushes the chondrocyte phenotype toward a fibroblast; could provide

biophysical design strategies to maintain chondrocyte phenotype in 2D culture. Potential

approaches include overexpressing the nuclear envelope proteins while passaging the cells

which can probably maintain the cells in chondrocyte phenotype with a round cell

morphology. Additionally, it is also known the extent 2D cultured chondrocyte are able to

redifferentiate when introduced into 3D culture after the expansion process, suggesting a

possible ‘mechanical memory’ of the cells. This study lays the framework to further

investigate how the mechanics gradually affects the chondrocyte phenotype possibly through

a plastic and permanent change through intranuclear chromatin architecture, beyond which

the chondrocyte memory is completely lost and therefore redifferentiaion becomes

impossible.

Visualization of intranuclear strain in chondrocytes in the context of dedifferentiation

and a weakened nucleus brings new insight of how the heterochromatin and euchromatin

distributes the strain in a mechanically challenging condition. This finding can be of potential

interest to the broad nuclear mechanobiology research, where research efforts have been

made specific to chondrocytes (70) and mesenchymal stem cells with chondrogenic potential

(27, 28, 71, 72) over recent years to understand the etiology of cartilage degeneration and

regeneration.

Both the modeling and experimental results suggested that the chondrocyte 3D aspect

ratio significantly affected the resulting intranuclear strain. In the computational model, as the

chondrocyte 3D aspect ratio increased from PD0 to PD8, the tensile strain experienced by the

nucleus increased under the same boundary conditions. The trend was consistent across a bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

sample size of three cells for both PD0 and PD8. This trend confirmed the experimental data

that indicated an overall increase in hydrostatic tensile strain found in the nucleus of the PD8

chondrocytes in comparison to the PD0 chondrocytes. Although major trends were confirmed

by the computational model, the exact values of strain reported by the model would not be

the same as the experimental results. These inconsistencies were expected due to the

simplicity of the isotropic linear elastic model in the computational framework. The

parametric study demonstrated that a change in the mechanical properties in the

computational model did not have a large effect on the solution of stress and strain at each

material node. Therefore, the cell and nuclear geometry changed from PD0 and PD8 was a

major factor determining the abnormal increase in tensile strain in the nucleus of the PD8

cell. For example, even if the cytoskeleton stiffness increased in both the PD0 to PD8 cell,

the predominate factor that caused an increased nuclear strain was the change in cell

geometry toward a flattened shape as the chondrocyte dedifferentiated.

CONCLUSION

In conclusion, we found that the flattened cell shape and potentially weaker nuclear

envelope of expanded chondrocytes leads to an induced abnormal intranuclear strain. We

propose that this abnormal nuclear stain could be a major factor driving chondrocyte

dedifferentiation to a fibrotic phenotype of cells in monolayer culture, and potentially in

mechanically challenged native cartilage after implantation. Abnormal intranuclear strain and

weaker nuclear envelope are the key components of the proposed mechanobiological circuit

that works in a positive feedback loop to deviate the chondrocyte from its original phenotype.

The findings of this study have the potential to advance the autologous chondrocyte

implantation (ACI) procedure by rational, biophysics-driven tissue engineering design

strategy.

SUPPORTING MATERIAL bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Supporting material can be found online at Biophysical Journal Website

AUTHOR CONTRIBUTIONS

S.G., B.S., and C.P.N. conceptualized the study, J.H., B.S., J.E.B., B.S.M.M., A.K.S., S.E.S.,

and S.G. performed the experiments, S.G. analyzed the data with the contribution from S.K.;

A.K.S. performed the simulation and the computational study, S.G wrote the manuscript with

contribution from all other authors, C.P.N. provided the funding and resources.

ACKNOWLEDGEMENTS

The authors would like to acknowledge funding from NIH R01 AR063712, NIH R21

AR064178, NIH R21 AR066230, NSF CAREER1349735.

CONFLICT OF INTEREST

The authors declare no conflict of interest. bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

REFERENCES

1. Martel-Pelletier, J., A.J. Barr, F.M. Cicuttini, P.G. Conaghan, C. Cooper, M.B.

Goldring, S.R. Goldring, G. Jones, and J. Pelletier. 2016. Osteoarthritis. Nature

Reviews Disease Primers. 2:1–18.

2. Makris, E.A., A.H. Gomoll, K.N. Malizos, J.C. Hu, and K.A. Athanasiou. 2015.

Repair and tissue engineering techniques for articular cartilage. Nature Reviews

Rheumatology. 11:21–34.

3. Brittberg, M., A. Lindhal, A. Nilsson, C. Ohlsson, O. Isaksson, and L. Peterson. 1994.

Treatment of deep cartilage defects in the knee with autologous chondrocyte

transplantation. New England Journal Of Medicine. 331:889–895.

4. Brittberg, M. 2010. Cell carriers as the next generation of cell therapy for cartilage

repair: A review of the matrix-induced autologous chondrocyte implantation

procedure. The American Journal of Sports Medicine. 38:1259–1271.

5. Saris, D.B.F., J. Vanlauwe, J. Victor, M. Haspl, M. Bohnsack, Y. Fortems, and B.

Vandekerckhove. 2008. Characterized chondrcoyte implantation results in better

structural repair when treating symptomatic cartilage defects of the knee in a

randomized controlled trial versus microfracture. The American Journal of Sports

Medicine. 36:235–246.

6. Saris, D.B.F., J. Vanlauwe, J. Victor, K.F. Almqvist, R. Verdonk, and J. Bellemans.

2009. Treatment of symptomatic cartilage defects of the knee characterized

chondrocyte implantation results in better clinical outcome at 36 months in a

randomized trial compared to microfracture. The American Journal of Sports

Medicine. 37:10–19.

7. Zarkadis, N.J., N.A. Kusnezov, E.J. Garcia, M.P. Pallis, and B.R. Waterman. 2014.

Return to preoperative function after autologous cartilage implantation of the knee in bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

active military servicemembers. The Orthopaedic Journal of Sports Medicine. 5:1–8.

8. Niethammer, T., S. Valentin, A. Ficklscherer, M. Gülecyüz, M. Pietschmann, and P.

Müller. 2015. Revision surgery after third generation autologous chondrocyte

implantation in the knee. International Orthopaedics. 39:1615–1622.

9. Wada, Y., A. Watanabe, T. Yamashita, T. Iobe, and H. Moriya. 2003. Evaluation of

articular cartilage with 3D-SPGR MRI after autologous chondrocyte implantation.

Journal of Orthopaedic Science. 8:514–517.

10. Guilak, F., W.R. Jones, H.P. Ting-Beall, and G.M. Lee. 1999. The deformation

behavior and mechanical properties of chondrocytes in articular cartilage.

Osteoarthritis and Cartilage. 7:59–70.

11. Guilak, F., and V.C. Mow. 2000. The mechanical environment of the chondrocyte: a

biphasic finite element model of cell-matrix interactions in articular cartilage. Journal

of Biomechanics. 33:1663–1673.

12. Kim, E., F. Guilak, and M.A. Haider. 2008. The dynamic mechanical environment of

the chondrocyte: A biphasic finite element model of cell-matrix interactions under

cyclic compressive loading. Journal of Biomechanical Engineering. 130:1–22.

13. Julkunen, P., W. Wilson, J.S. Jurvelin, and R.K. Korhonen. 2009. Composition of the

pericellular matrix modulates the deformation behaviour of chondrocytes in articular

cartilage under static loading. Medical & Biological Engineering & Computing.

47:1281–1290.

14. Sanchez-Adams, J., H.A. Leddy, A.L. McNulty, C.J. O’Conor, and F. Guilak. 2014.

The mechanobiology of articular cartilage: bearing the burden of osteoarthritis.

Current Rheumatology Reports. 16:1–9.

15. Akagi, M., S. Nishimura, K. Yoshida, T. Kakinuma, T. Sawamura, H. Munakata, and

C. Hamanishi. 2006. Cyclic tensile stretch load and oxidized low density lipoprotein bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

synergistically induce lectin-like oxidized ldl receptor-1 in cultured bovine

chondrocytes, resulting in decreased cell viability and proteoglycan synthesis. Journal

of Orthopaedic Research. 24:1782–1790.

16. Millward-Sadler, S., M.O. Wright, L.W. Davies, G. Nuki, and D.M. Salter. 2000.

Mechanotransduction via integrins and interleukin-4 results in altered aggrecan and

matrix metalloproteinase 3 gene expression in normal, but not osteoarthritic, human

articular chondrocytes. Arthritis & Rheumatism. 43:2091–2099.

17. Holmvall, K., L. Camper, S. Johansson, J.H. Kimura, and E. Lundgren-Akerlund.

1995. Chondrocyte and chondrosarcoma cell integrins with affinity for collagen type 2

and their response to mechanical stress. Experimental Cell Research. 221:496–503.

18. Sliogeryte, K., L. Botto, D.A. Lee, and M.M. Knight. 2016. Chondrocyte

dedifferentiation increases cell stiffness by strengthening membrane-actin adhesion.

Osteoarthritis and Cartilage. 24:912–920.

19. Caron, M.M.J., P.J. Emans, M.M.E. Coolsen, L. Voss, D.A.M. Surtel, A. Cremers,

L.W. Van Rhijn, and T.J.M. Welting. 2012. Redifferentiation of dedifferentiated

human articular chondrocytes : comparison of 2D and 3D cultures. Osteoarthritis and

Cartilage. 20:1170–1178.

20. Rosenzweig, D.H., F. Chicatun, S.N. Nazhat, and T.M. Quinn. 2013. Cartilaginous

constructs using primary chondrocytes from continuous expansion culture seeded in

dense collagen gels. Acta Biomaterialia. 9:9360–9369.

21. Ofek, G., R.M. Natoli, and K.A. Athanasiou. 2009. In situ mechanical properties of the

chondrocyte cytoplasm and nucleus. Journal of Biomechanics. 42:873–877.

22. Guilak, F., J.R. Tedrow, and R. Burgkart. 2000. Viscoelastic properties of the cell

nucleus. Biochemical and Biophysical Research Communications. 269:781–786.

23. Guilak, F. 1995. Compression-induced changes in the shape and volume of the bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

chondrocyte nucleus. Journal of Biomechanics. 28:1529–1541.

24. Denais, C.M., R.M. Gilbert, P. Isermann, A.L. McGregor, M. Te Lindert, B. Weigelin,

P.M. Davidson, P. Friedl, K. Wolf, and J. Lammerding. 2016. Nuclear envelope

rupture and repair during cancer cell migration. Science. 352:353–358.

25. Isermann, P., and J. Lammerding. 2014. Nuclear mechanics and mechanotransduction

in health and disease. Current Biology. 23:R1113-1121.

26. Tajik, A., Y. Zhang, F. Wei, J. Sun, Q. Jia, W. Zhou, R. Singh, N. Khanna, A.S.

Belmont, and N. Wang. 2016. Transcription upregulation via force-induced direct

stretching of chromatin. Nature Materials. 15:1287–1296.

27. Driscoll, T.P., B.D. Cosgrove, S.-J. Heo, Z.E. Shurden, and R.L. Mauck. 2015.

Cytoskeletal to Nuclear Strain Transfer Regulates YAP Signaling in Mesenchymal

Stem Cells. Biophysical Journal. 108:2783–2793.

28. Heo, S.J., S.D. Thorpe, T.P. Driscoll, R.L. Duncan, D.A. Lee, and R.L. Mauck. 2015.

Biophysical regulation of chromatin architecture instills a mechanical memory in

mesenchymal stem cells. Scientific Reports. 5:16895.

29. Szczesny, S.E., and R.L. Mauck. 2017. The Nuclear option : evidence implicating the

cell nucleus in mechanotransduction. Journal of Biomechanical Engineering-

Transactions of the ASME. 139:0210061–0210061.

30. Dingal, P.C.D.P., A.M. Bradshaw, S. Cho, M. Raab, A. Buxboim, J. Swift, and D.E.

Discher. 2015. Fractal heterogeneity in minimal matrix models of scars modulates

stiff-niche stem-cell responses via nuclear exit of a mechanorepressor. Nature

Materials. 14:951–960.

31. McCreery, K.P., X. Xu, A.K. Scott, A.K. Fajrial, S. Calve, X. Ding, and C.P. Neu.

2021. Nuclear stiffness decreases with disruption of the extracellular matrix in living

tissues. Small. 17:2006699. bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

32. Reynolds, N., E. Mcevoy, S. Ghosh, J.A.P. Pérez, C.P. Neu, and P. Mcgarry. 2021.

Image-derived modeling of nucleus strain amplification associated with chromatin

heterogeneity. Biophysical journal. 120:1323–1332.

33. Nava, M.M., Y.A. Miroshnikova, L.C. Biggs, D.B. Whitefield, F. Metge, J. Boucas, H.

Vihinen, E. Jokitalo, X. Li, J.M.G. Arcos, C.M. Niessen, B. Hoffmann, R. Merkel,

K.N. Dahl, and S.A. Wickstrom. 2020. Heterochromatin-driven nuclear softening

protects the genome against mechanical stress-induced damage. Cell. 181:800–817.

34. Das, R.H.J., H. Jahr, J.A.N. Verhaar, L.J.C. van Der, O.G.J.V.M. Van, and H.

Weinans. 2008. In vitro expansion affects the response of chondrocytes to mechanical

stimulation. Osteoarthritis and Cartilage. 16:385–391.

35. Liu, Q., X. Hu, X. Zhang, X. Duan, P. Yang, F. Zhao, and Y. Ao. 2016. Effects of

mechanical stress on chondrocyte phenotype and chondrocyte extracellular matrix

expression. Scientific Reports. 6:1–8.

36. Honda, K., S. Ohno, K. Tanimoto, C. Ijuin, N. Tanaka, T. Doi, Y. Kato, and K. Tanne.

2000. The effects of high magnitude cyclic tensile load on cartilage matrix metabolism

in cultured chondrocytes. European Journal of Cell Biology. 79:601–609.

37. Neu, C.P., A.H. Reddi, K. Komvopoulos, T.M. Schmid, and P.E. Di Cesare. 2010.

Increased friction coefficient and superficial zone protein expression in patients with

advanced osteoarthritis. Arthritis and Rheumatism. 62:2680–2687.

38. Neu, C.P., A. Khalafi, K. Komvopoulos, T.M. Schmid, and A.H. Reddi. 2007.

Mechanotransduction of bovine articular cartilage superficial zone protein by

transforming growth factor ?? signaling. Arthritis and Rheumatism. 56:3706–3714.

39. Ghosh, S., J.C. Dutton, and B. Han. 2014. Measurement of spatiotemporal intracellular

deformation of cells adhered to collagen matrix during freezing of biomaterials.

Journal of Biomechanical Engineering. 136. bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

40. Ghosh, S., B. Seelbinder, J.T. Henderson, R.D. Watts, A.K. Scott, A.I. Veress, and

C.P. Neu. 2019. Deformation microscopy for dynamic intracellular and intranuclear

mapping of mechanics with high spatiotemporal resolution. Cell Reports. 27:1607–

1620.

41. Ghosh, S., J.G. Cimino, A.K. Scott, F.W. Damen, E.H. Phillips, A.I. Veress, C.P. Neu,

and C.J. Goergen. 2017. In vivo multiscale and spatially-dependent biomechanics

reveals differential strain transfer hierarchy in skeletal muscle. ACS Biomaterials

Science and Engineering. 3:2798–2805.

42. Ghosh, S., V.C. Cuevas, B. Seelbinder, and C.P. Neu. 2021. Image‐Based

Elastography of Heterochromatin and Euchromatin Domains in the Deforming Cell

Nucleus. Small.

43. Cuvelier, D., M. Thert, Y. Chu, S. Dufour, J. Thie, M. Bornens, P. Nassoy, and L.

Mahadevan. 2007. The Universal Dynamics of Cell Spreading. Current Biology.

17:694–699.

44. Lin, Z., J.B. Fitzgerald, J. Xu, C. Willers, D. Wood, A.J. Grodzinsky, and M.H. Zheng.

2008. Gene expression profiles of human chondrocytes during passaged monolayer

cultivation. Journal of Orthopaedic Research. 1230–1237.

45. Darling, E.M., P.E. Pritchett, B.A. Evans, R. Superfine, S. Zauscher, and F. Guilak.

2009. Mechanical Properties and Gene Expression of Chondrocytes on Micropatterned

Substrates Following Dedifferentiation in Monolayer. Cellular and Molecular

Bioengineering. 2:395–404.

46. Gunja, N.J., and K.A. Athanasiou. 2007. Passage and reversal effects on gene

expression of bovine meniscal fibrochondrocytes. Arthritis Research and Therapy.

9:1–12.

47. Schnabel, M., S. Marlovits, G. Eckhoff, I. Fichtel, L. Gotzen, V. Vecsei, and J. bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Schlegel. 2002. Dedifferentiation-associated changes in morphology and gene

expression in primary human articular chondrocytes in cell culture. Osteoarthritis and

Cartilage. 10:62–70.

48. Ma, B., J.C.H. Leijten, L. Wu, M. Kip, C.A. Van Blitterswijk, J.N. Post, and M.

Karperien. 2013. Gene expression profiling of dedifferentiated human articular

chondrocytes in monolayer culture. Osteoarthritis and Cartilage. 21:599–603.

49. Minegishi, Y., K. Hosokawa, and N. Tsumaki. 2013. Time-lapse observation of the

dedifferentiation process in mouse chondrocytes using chondrocyte-specific reporters.

Osteoarthritis and Cartilage. 21:1968–1975.

50. Benya, P.D., and J.D. Shaffer. 1982. Dedifferentiated chondrocytes reexpress the

differentiated collagen phenotype when cultured in agarose gels. Cell. 30:215–224.

51. Smeriglio, P., J.H. Lai, F. Yang, and N. Bhutani. 2015. 3D hydrogel scaffolds for

articular chondrocyte culture and cartilage generation. Journal of Visualized

Experiments. 10:1–6.

52. Cooke, M.E., M.J. Pearson, R.J.A. Moakes, C.J. Weston, E.T. Davis, W. Simon, L.M.

Grover, M.E. Cooke, M.J. Pearson, R.J.A. Moakes, and L.M. Grover. 2017. Geometric

confinement is required for recovery and maintenance of chondrocyte phenotype in

alginate. APL Bioengineering. 1:1–13.

53. Hsieh-Bonassera, N.D., I. Wu, J.K. Lin, B.L. Schumacher, A.C. Chen, K. Masuda,

W.D. Bugbee, and R.L. Sah. 2009. Expansion and redifferentiation of chondrocytes

from osteoarthritic Cartilage : cells for human cartilage tissue engineering. Tissue

Engineering Part A. 15:3513–3523.

54. Tallheden, T., C. Karlsson, A. Brunner, J. Van Der Lee, R. Hagg, R. Tommasini, and

L.M. Anders. 2004. Gene expression during redifferentiation of human articular

chondrocytes. Osteoarthritis and Cartilage. 12:525–535. bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

55. Schulze-Tanzil, G., P. De Souza, H.V. Castrejon, T. John, H.J. Merker, A. Scheid, and

M. Shakibaei. 2002. Redifferentiation of dedifferentiated human chondrocytes in high-

density cultures. Cell and Tissue Research. 308:371–379.

56. Schulze-tanzil, G. 2009. Activation and dedifferentiation of chondrocytes :

Implications in cartilage injury and repair. Annals of Anatomy. 191:325–338.

57. Duan, L., B. Ma, Y. Liang, J. Chen, W. Zhu, M. Li, and D. Wang. 2015. Cytokine

networking of chondrocyte dedifferentiation in vitro and its implications for cell-based

cartilage therapy. American Journal of Translational Research. 7:194–208.

58. Hong, E., and A.H. Reddi. 2013. Dedifferentiation and redifferentiation of articular

chondrocytes from surface and middle zones : changes in micrornas-221/-222, -140

and -143/145 expression. Tissue Engineering Part A. 19:1015–1022.

59. Lele, T.P., R.B. Dickinson, and G.G. Gundersen. 2018. Mechanical principles of

nuclear shaping and positioning. Journal of Cell Biology. 217:3330–3342.

60. Huang, B.J., J.C. Hu, and K.A. Athanasiou. 2016. Effects of passage number and post-

expansion aggregate culture on tissue engineered, self-assembled neocartilage. Acta

Biomaterialia. 43:150–159.

61. Ahn, J., H. Kumar, B.H. Cha, S. Park, Y. Arai, I. Han, S.G. Park, and S.H. Lee. 2016.

AIMP1 downregulation restores chondrogenic characteristics of dedifferentiated /

degenerated chondrocytes by enhancing TGF- β signal. Cell Death and Disease.

7:e2099-12.

62. Payr, S., B. Tichy, C. Atteneder, M. Michel, T. Tiefenboeck, N. Lang, S. Nuernberger,

S. Hajdu, E. Rosado-balmayor, S. Marlovits, and C. Albrecht. 2017. Redifferentiation

of aged human articular chondrocytes by combining bone morphogenetic protein-2 and

melanoma inhibitory activity protein in 3D-culture. PloS One. 12:1–14.

63. Lin, L., Q. Shen, T. Xue, X. Duan, X. Fu, and C. Yu. 2014. Sonic hedgehog improves bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

redifferentiation of dedifferentiated chondrocytes for articular cartilage repair. PLOS

One. 9.

64. Bomhard, A. Von, J. Faust, A.F. Elsaesser, S. Schwarz, K. Pippich, and N. Rotter.

2017. Impact of expansion and redifferentiation under hypothermia on chondrogenic

capacity of cultured human septal chondrocytes. Journal of Tissue Engineering. 8:1–

13.

65. Babur, B.K., P. Ghanavi, P. Levett, W.B. Lott, T. Klein, J.J. Cooper-White, R.

Crawford, and M.R. Doran. 2013. The interplay between chondrocyte redifferentiation

pellet size and oxygen concentration. PLOS One. 8:1–12.

66. Heyland, J., K. Wiegandt, C. Goepfert, S. Nagel-Heyer, E. Ilinich, U. Schumacher, and

R. Portner. 2006. Redifferentiation of chondrocytes and cartilage formation under

intermittent hydrostatic pressure. Biotechnology Letters. 28:1641–1648.

67. Rottmar, M., R. Mhanna, S. Guimond-Lischer, V. Vogel, M. Zenobi-Wong, and K.

Maniura-Weber. 2014. Interference with the contractile machinery of the fibroblastic

chondrocyte cytoskeleton induces re-expression of the cartilage phenotype through

involvement of PI3K, PKC and MAPKs. Experimental Cell Research. 320:175–187.

68. Furumatsu, T., E. Matsumoto-Ogawa, T. Tanaka, Z. Lu, and T. Ozaki. 2014. ROCK

inhibition enhances aggrecan deposition and suppresses matrix metalloproteinase-3

production in human articular chondrocytes. Connective Tissue Research. 55:89–95.

69. Duan, L., Y. Liang, B. Ma, W. Zhu, and D. Wang. 2015. Epigenetic regulation in

chondrocyte phenotype maintenance for cell-based cartilage repair. American Journal

of Translational Research. 7:2127–2140.

70. Henderson, J.T., G. Shannon, A.I. Veress, and C.P. Neu. 2013. Direct measurement of

intranuclear strain distributions and RNA synthesis in single cells embedded within

native tissue. Biophysical Journal. 105:2252–2261. bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

71. Heo, S.J., W.M. Han, S.E. Szczesny, B.D. Cosgrove, D.M. Elliott, D.A. Lee, R.L.

Duncan, and R.L. Mauck. 2016. Mechanically induced chromatin condensation

requires cellular contractility in mesenchymal stem cells. Biophysical Journal.

111:864–874.

72. Heo, S.J., T.P. Driscoll, S.D. Thorpe, N.L. Nerurkar, B.M. Baker, M.T. Yang, C.S.

Chen, D.A. Lee, and R.L. Mauck. 2016. Differentiation alters stem cell nuclear

architecture, mechanics, and mechano- sensitivity. eLife. 5:1–21.

FIGURES

Figure 1. Dedifferentiation of chondrocytes in a monolayer culture was associated with a change in cell and nucleus phenotype. (a) Population Doubling 0 (PD0) – corresponding to passage 0 and Population Doubling 8 (PD8) – corresponding to passage 4 chondrocytes were stained for actin (phalloidin-GFP) and DNA (DAPI) to visualize cells and nuclei respectively using confocal microscopy at two different magnifications. Culture conditions included Type I collagen treated membranes and tissue culture plate (TCP). Irrespective of culture condition, the PD0 chondrocytes were smaller, rounder and displayed fewer actin stress fibers than the PD8 chondrocytes. (b) Several biophysical features were used to quantify the dedifferentiation mediated cell morphology changes between the PD0 and PD8. From PD0 to PD8, the cell and nuclear area increased, the nuclear dimensions increased compared to the cell dimensions, cells lost their round shape and approached more irregular shape; while nuclei maintain their round shape relatively higher compared to cells. *p < 0.01, number of cells analyzed > 60 from 3 different biological replicates.

Figure 2. Dedifferentiation of chondrocytes in monolayer culture caused changes in extracellular matrix (ECM) related gene expression. Chondrocyte dedifferentiation from PD0 to PD8 was associated with an increase in the fibroblast specific ECM markers, and decrease in chondrocyte specific ECM markers. Except Thy1, all other gene expression changes were significant with p < 0.01, ns = not significant, number of samples = 4. bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Figure 3. Passage dependent complex spatial strain patterns emerged inside the chondrocyte nucleus upon mechanical stretching of chondrocytes. (a) Using a FlexCell cell stretching device, a controlled equibiaxial stretch was applied to a collagen treated membrane culturing chondrocytes (Figure S1). Nuclei were imaged before stretching (undeformed) and at the stretched condition (deformed), followed by intranuclear spatial strain quantification using deformation microscopy, a technique developed previously (40). In PD0 cells, which were round shaped, magnitude of all the strain measures - hydrostatic (volume change related), deviatoric (shape change related) and shear were comparable with respect to each other. The high strain pockets were uniformly distributed in the nucleus irrespective of the chromatin density. Inset shows rescaled strain map in PD0 nucleus. In PD8 cells, which were irregular shaped, hydrostatic strain was significantly increased with respect to PD0 cells suggesting strain amplification, while deviatoric and shear strains are comparable in both PD0 and PD8 cell nuclei. High strain pockets (marked with star) were associated with the heterochromatin (high chromatin density regions), in the vicinity of cell protrusions known to be enriched with F-actin stress fibers. Cytoplasm image in the bright field is shown in the inset (not in the same scale as the nucleus images), with yellow arrow to show the cell protrusion adjacent to the high hydrostatic strain pocket. (b) Hydrostatic strain in the nucleus was mostly tensile, while deviatoric and shear strains followed mostly a normal distribution commensurate with the tensile cell stretching modality. Plots show histograms of the intranuclear elements for different strain measures for the representative nuclei in (a). In the PD0 nucleus, the bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

heterochromatin (high density chromatin) and euchromatin (low density chromatin) strain distribution mostly overlapped, while in the PD8 nucleus the heterochromatin showed a higher tensile strain in most elements. Inset shows rescaled strain distribution for PD0 nucleus.

Figure 4. Dedifferentiation of chondrocytes was associated with abnormal intranuclear strain, most prominently visible in hydrostatic strain measure. (a) Each data point represents the average spatial strain for one specific nucleus. At PD0 chondrocytes, heterochromatin strain and total strain in the nucleus were slightly higher than the euchromatin strain both in the tensile and compressive modes. At PD8 chondrocytes, total strain and heterochromatin strain were lower compared to euchromatin strain in compressive mode, thus signifying a dense incompressible heterochromatin. In tensile mode, the heterochromatin experienced a higher strain compared to euchromatin. (b) Averaging the strain over multiple nuclei showed that the hydrostatic tensile strain was significantly higher in heterochromatin and in the nucleus as a whole compared to euchromatin, thus signifying an abnormal strain burden in the PD8 nuclei when compared to the PD0 nuclei. *p < 0.05, number of nuclei analyzed is at least 6 from 3 different biological replicates.

Figure 5. The chondrocyte shape change from PD0 to PD8 were a major factor determining the deformation of the cell and nucleus. (a) Confocal image stack of the cell and nucleus, along with the focal adhesion complex was used to create a three-dimensional model. PD8 cells were flattened with higher area and higher 3D aspect ratio, compared to PD0 cells which were round shaped with lower area and lower 3D aspect ratio. Appropriate governing equations and boundary conditions were used to analyze intranuclear and intracellular strain using finite element method. As the cell geometry altered from PD0 to PD8 (i.e., increased 3D aspect ratio and cell area), the tensile strain experienced by the nucleus almost doubled bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

under the same boundary conditions, demonstrating the significant effect of the geometry change. (b) Histogram of the hydrostatic strain burden at the nuclear domain nodes. PD0 chondrocyte nuclei experienced lower value and lower range of strain, whereas PD8 chondrocyte nuclei experienced higher value and higher range of strain. (c) Cell morphology, not mechanical property was the key determinant of intranuclear strain. Irrespective of the population doubling status and geometry, the distribution of strain at computational nodes did not alter significantly with the variation of cytoskeleton elastic modulus (also see Figure S2- S4).

Figure 6. Dedifferentiation of chondrocyte in monolayer culture caused decrease in nuclear envelope related gene expression. Most nuclear envelope specific marker (e.g. Lamin A/C, nesprin 1 and 2 and SUN1) gene expression decreased in the dedifferentiated state. Significant (p < 0.01) gene expression change was observed in all cases except for the genes labeled with ns, ns = not significant, number of samples = 4.

Figure 7. Proposed mechanobiological model summarizing the chondrocyte dedifferentiation in monolayer culture. A positive feedback loop driven by the stretch on the nucleus, abnormal intranuclear strain and gene dedifferentiation specific gene expression potentially favors the dedifferentiation dynamics.

SUPPORTING MATERIALS

Dedifferentiation alters chondrocyte nuclear mechanics during in vitro

culture and expansion

Authors

Soham Ghosh 1, 2, *, Adrienne K. Scott 3, Benjamin Seelbinder 3, Jeanne E. Barthold 3,

Brittany M St. Martin 3, Samantha Kaonis2, Stephanie E. Schneider 3, Jonathan T. Henderson

4, Corey P. Neu3

Affiliations

* Correspondence: [email protected]

Supplementary Table 1. PCR Primer Sequences

Gene RefSeq Forward Reverse HPRT1 NM_001034035.2 ATTATGGACAGGACCGAACG CCAACAGGTCGGCAAAGAAC RPL10A NM_001015647.1 GCTGGCAAGTTCCCTTCCTT CACAGCACCTTCTTCATCTGG COL1A1 NM_001001135.2 ACGGTGGTACCCAGTTTGAA GACGCATGAAGGCAAGTTGG VIM NM_173969 CCCTGAACCTGAGGGAAACC CGTGATGCTGGGAAGTTTCG S100A4 NM_174595.2 TTCTTGGGGAAAAGGACGGAT TGGAAGTCCACCTCGTTGTC THY1 NM_001034765.1 GATCCAGGACTGAGCTCTCG GGCCACCTGTAAGACTGTTAGC SOX9 XM_005221337 GCGGAGATTGAAACTGACCT CTCTCCTCCCTCCTGCAAAGA ACAN NM_173981 AAGAGAGCCAAACAGCCGAC TCGCACAGCTTCTGGTCTGT PRG4 NM_001206633 CTGAAAACAGCCATGGAGTGG GCACAGCTTGATAAATCTTGAGAAG COMP NM_001166517 CGTTCTCTTGCTCACGCTGG GTCTCCTGGAGTTCGCGTAG COL2A1 NM_001001135.2 CAGGACGGGCAGAGGTATAATG CAGAGGACAGTCCCAGTGTCA LMNB1 NM_001103295.1 TGGGCGTCAGATTGAGTACG ACAGCTTGACTTGGGCATCA LMNB2 NM_001276353.1 TCTTTGAGGAGGAAGTGCGTG CGCCTGGGCCATCTTAAAGT EMD NM_203361.1 GCCAGGTCCGTGATGACAAT AAATAGGGCGGTAGTGTGCG SUN2 NM_001102319.1 GTGATGGGGAGTCAGAGCAC CTGAGGAGGGACCTAGCTGT LMNA NM_001034053.1 AAACAGCCTGCGTACAGCTC CACTCACGTGGTGGTGATGGA OBSCN NM_001102196 TGGTACAAAGATGGGAAGCCAG GAGTCGGCACCAGTCAAGTT N2B XM_002685260 CCTCAAACCTCTAGCTGGGAC GCATTGCCCTCCTTTTTGGA SYNE1 XM_002705239 AGCTGAAGTGGCTTTGGACTT TGGCCTTGCTCTGTTCAACT SYNE2 NM_001206586.1 CAAAAGGCGCGATCGAAGGA TTAAAGAAGTGAACCGCTGCCG SUN1 XM_003587860.2 GGGAGCTCCAGTATGCTTTGA ACACACTGGGGAGGAGTGTA LEMD3 NM_001192699.1 TTCCCCAGGCTCTTACTTGC TAGGCCAGTCCGAAGACGAA

Supplementary Table 2. Mechanical properties assigned to the computational domains for parametric study

Cytoskeleton Euchromatin Heterochromatin

Domain Domain Domain

Elastic Modulus (Pa) 100-1300 600-1400 2000-10000

Poisson’s Ratio 0.2-0.45 0.2-0.45 0.2-0.45

Density (kg/m3) 1000-1400 1000-1400 1000-1400

Supplementary Table 3. Summary of results with parametric study - elastic modulus

variation

Cytoskeleton elastic modulus variation PD0: Baseline E = 500 Pa PD8: Baseline E = 900 Pa m R2 m R2 E = 100 Pa 0.315 0.938 E = 500 Pa 0.706 0.985 E = 300 Pa 0.725 0.990 E = 700 Pa 0.870 0.997 E = 700 Pa 1.202 0.995 E = 1100 Pa 1.107 0.999 E = 1100 Pa 1.362 0.984 E = 1300 Pa 1.197 0.995

Euchromatin elastic modulus variation PD0: Baseline E = 1000 Pa PD8: Baseline E = 1000 Pa m R2 m R2 E = 600 Pa 1.327 0.959 E = 600 Pa 1.290 0.966 E = 800 Pa 1.133 0.992 E = 800 Pa 1.125 0.993 E = 1200 Pa 0.902 0.994 E = 1200 Pa 0.901 0.995 E = 1400 Pa 0.826 0.980 E = 1400 Pa 0.821 0.980

Heterochromatin elastic modulus variation PD0: Baseline E = 4000 Pa PD8: Baseline E = 4000 Pa m R2 m R2 E = 2000 Pa 1.007 0.941 E = 2000 Pa 0.953 0.898 E = 3000 Pa 1.004 0.991 E = 3000 Pa 0.988 0.984 E = 5000 Pa 0.996 0.996 E = 5000 Pa 1.002 0.991 E = 10000 Pa 1.002 0.994 E = 10000 Pa 0.979 0.883

Supplementary Table 4. Summary of Summary of results with parametric study -

Poisson’s ratio variation

Cytoskeleton Poisson’s ratio variation PD0: Baseline n = 0.3 PD8: Baseline n = 0.3 m R2 m R2 n = 0.2 0.950 0.997 n = 0.2 0.959 0.998 n = 0.25 0.969 0.999 n = 0.25 0.974 0.999 n = 0.35 1.049 0.999 n = 0.35 1.042 0.999 n = 0.4 1.129 0.992 n = 0.4 1.113 0.995 n = 0.45 1.283 0.970 n = 0.45 1.251 0.983

Euchromatin Poisson’s ratio variation PD0: Baseline n = 0.3 PD8: Baseline n = 0.3 m R2 m R2 n = 0.2 1.249 0.994 n = 0.2 1.206 0.988 n = 0.25 1.136 0.998 n = 0.25 1.116 0.996 n = 0.35 0.834 0.994 n = 0.35 0.848 0.989 n = 0.4 0.631 0.954 n = 0.4 0.641 0.912 n = 0.45 0.379 0.728 n = 0.45 0.346 0.508

Heterochromatin Poisson’s ratio variation PD0: Baseline n = 0.3 PD8: Baseline n = 0.3 m R2 m R2 n = 0.2 1.028 0.983 n = 0.2 0.944 0.957 n = 0.25 1.015 0.995 n = 0.25 0.971 0.989 n = 0.35 0.984 0.994 n = 0.35 1.030 0.988 n = 0.4 0.965 0.974 n = 0.4 1.062 0.951 n = 0.45 0.945 0.936 n = 0.45 1.095 0.891

Supplementary Note: Simulation of Intranuclear Strain in Chondrocytes

Immunostaining of chondrocytes and imaging

Population Doubling (PD0) corresponding to passage 0 and Population Doubling

(PD8) corresponding to passage 4 chondrocytes were cultured, stained and imaged to

generate the image-based model for further analysis. Chondrocytes were incubated on the

Type I collagen coated substrate for 24 hours to allow for complete adhesion. Next,

chondrocytes were fixed with cold 4% paraformaldehyde (Thermo Fisher Scientific) in 1X

PBS, permeabilized in 0.1% Triton X-100 (Sigma Aldrich), and blocked with blocking buffer

consisting of 1% bovine serum albumin (Sigma Aldrich), 10% Natural Goat Serum (Sigma

Aldrich), 0.3% Tween 20 (Sigma Aldrich) in 1X PBS. Next, samples were incubated at 4°C

overnight with an anti-vinculin primary monoclonal antibody (Sigma Aldrich) in antibody

buffer (1% bovine serum albumin and 0.1% Tween in 1X PBS, at 1:50 dilution). Following

primary incubation, chondrocytes were washed, and incubated with a secondary antibody,

Alexa 546 anti-mouse, at 1:200 dilution (Thermo Fisher Scientific). To visualize the

nucleus/DNA and cytoskeleton F-actin, chondrocytes were stained with Hoechst 34580 (Life

Technologies) and Alexa Fluor 488 phalloidin (Thermo Fisher Scientific).

High magnification fluorescent z-stack images of the PD0 and PD8 chondrocyte

chondrocytes were captured using an inverted confocal microscope (Nikon Eclipse Ti AIR,

Location, USA) with a 60´ oil objective. Thirty z-planes were taken for each cell with a step

size that ranged from 0.2 µm to 0.3µm. Cells to image were chosen at random, distributed

across the dish.

Image based modeling of the chondrocyte cytoplasm and intranuclear space

From the z-stack of confocal microscope images, a three-dimensional model of both

PD0 and PD8 chondrocytes were reconstructed. A custom MATLAB (The Mathworks Inc., bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Natick, MA, USA) program was used to process the z-stack images of the nucleus, cytoplasm

consisting F-actin and cell surface focal adhesion complex containing vinculin. Using these

three markers, each cell was segmented into three domains: cytoplasm, euchromatin and

heterochromatin. The chromatin DNA in the nucleus, imaged in the blue channel, was

thresholded to define the euchromatin and the heterochromatin regions, using the same

technique described in the main text. The filamentous actin staining (green channel) was used

to determine the cytoplasm domain. Based on the segmented regions, sterolithography (STL)

files were created containing the triangulated surface information for each domain. These

sterolithography files were then imported into open-source mesh processing system MeshLab

(CNP, Rome, Italy) to further smooth the geometry (1). The smoothed geometries could then

be imported as STL files into a finite element software (COMSOL Multiphysics 5.3,

Burlington, MA, USA). Using a custom MATLAB code, the coordinates of the vinculin

location points with respect to the cell were found using the confocal images and mapped

onto the three-dimensional model using COMSOL with MATLAB interphase.

Governing equations and boundary conditions

After importing the 3D geometrical model in COMSOL, the cell was divided into

three computational domains: cytoplasm, euchromatin and heterochromatin. An equibiaxial

prescribed displacement boundary condition of 5 µm was imposed on the bottom surface of

the cell where the vinculin points were tracked and plotted as described above. All other

boundary conditions were set as free, meaning that no loads or constraints acted on the

boundaries and these boundaries were traction free.

Assuming linear elastic and isotropic materials for all three domains, the following

governing equations were used to solve for the stationary solution of stress and strain with the

applied boundary conditions previously described. bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

� = [(∇�) + ∇�] (1)

� = �� (2)

∇ ∙ � = 0 (3)

Equation (1) is the kinematic relation used to solve strain, ε, with the displacements, u. The

total stress, σ, was calculated using Hooke’s law (Equation (2)), where C is the stiffness

matrix and εel is the elastic strain. Additionally, equilibrium equation with negligible body

forces, Equation (3), was applied.

Computational Procedure

All STL files were imported as a mesh into a finite element solver COMSOL

Multiphysics 5.3 to create the three-dimensional solid geometry of the three domains. The

material properties were assumed as follows (2): cytoplasm, Young’s modulus E = 500 Pa in

PD0, and 900 Pa in PD8; heterochromatin, E = 4000 Pa in PD0 and PD8; euchromatin, E =

1000 Pa in PD0 and PD8. In all cases Poisson’s ratio was assumed to be 0.3 and density was

kept constant at 1200 kg/m3. For each computational domain, a fine tetrahedral meshing

scheme was used. Direct PARDISO solver was used to solve for stress and strain of the

computational domains. With the known calculated strain values, the hydrostatic strain was

found for each node with the following equation:

� + � + � � = 3

Supplementary Figures

Figure S1. Equibiaxial mechanical stretching set up for the membrane with validation of deformation. (a) FlexCell stretching device allowed the chondrocytes to be seeded and stretched using a controlled external pneumatic pressure, while the cell nucleus could be imaged using a two-photon microscope. (b) Imaging of the nucleus was performed every 3 minutes at the undeformed and deformed states of the chondrocytes. The deformation of chondrocytes was induced by the stretching of membrane using external pneumatic pressure. (c) Mean substrate strain with increasing pressure showing the calibration of the cell stretching set up. Red dotted rectangle signifies the pressure (100 kPa) that was used for all experiments in this study. (d) The nuclei moved with respect to each other while the membrane stretched as shown by the undeformed and deformed membrane images (top panel). A thresholding was done to track the centroid position of each individual nuclei (bottom panel). (e) Characterization of the membrane stretch quantified by the strain (3). The Exy strain was an order of magnitude lower than the Exx and Exy strain, confirming a nearly equibiaxial stretch in the membrane.

Figure S2. Effect of the euchromatin and heterochromatin elastic moduli on intranuclear deformation. Parametric study showed that geometry (early passage vs late passage) determined the range of strain in chondrocyte nucleus, even when the euchromatin and heterochromatin elastic moduli were varied. bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Figure S3. Effect of the cell domain Poisson’s ratio on deformation. Parametric study showed that geometry (early passage vs late passage) determined the range of strain in chondrocyte nucleus, even when the Poisson’s ratio was varied in cytoskeleton, euchromatin and heterochromatin.

Figure S4. Effect of the cell domain densities on deformation. Parametric study showed that the density of the cytoskeleton, euchromatin and heterochromatin had no effect on the intranuclear deformation (m = 1 and R2 = 1 in all cases). The reason is the material model we used for the chondrocyte deformation simulation had no density component. bioRxiv preprint doi: https://doi.org/10.1101/2021.04.26.441500; this version posted April 27, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.

Figure S5. Additional representative examples of PD0 (early passage) and PD8 (late passage) chondrocytes displaying the simulated intracellular and intranuclear strain.

REFERENCES

1. Corsini, M., P. Cignoni, and R. Scopigno. 2012. Efficient and flexible sampling with

blue noise properties of triangular meshes. IEEE Transactions on Visualization and

Computer Graphics. 18:914–924.

2. Kim, E., F. Guilak, and M.A. Haider. 2008. The dynamic mechanical environment of

the chondrocyte: A biphasic finite element model of cell-matrix interactions under

cyclic compressive loading. Journal of Biomechanical Engineering. 130:1–22.

3. Ghosh, S., J.C. Dutton, and B. Han. 2014. Measurement of spatiotemporal intracellular

deformation of cells adhered to collagen matrix during freezing of biomaterials.

Journal of Biomechanical Engineering. 136.