Final Report Is Submitted

Industry allocated project

number

SATI CFPA SAAPPA/SASPA DFTS Winetech

[email protected] [email protected] [email protected] [email protected] [email protected] Tel: 021 872-1438 Tel: 021 872-1501 Tel: 021 882-8470 Tel: 021 870 2900 Tel: 021 807 3387 X

Indicate (X) client(s) to whom this final report is submitted. Replace any of these with other relevant clients if required . ______

FINAL REPORT 2013

Programme & Project Leader Information

Research O rganisation Project leader Programme leader Title, initials, surname Roleen Carstens Dr Francois Halleen Present position Acting Research Leader: Plant Specialist Researcher Protection Address ARC Infruitec-Nietvoorbij ARC Infruitec-Nietvoorbij Private Bag X5026 Private Bag X5026 Stellenbosch Stellenbosch 7599 7599 Tel. / Cell no. (021) 809 3023 (021) 809 3040 Fax (021) 809 3002 (021) 809 3002 E-mail [email protected] [email protected]

Project Information

Research Organisation WW 06-37 Project number Project title The epidemiology and etiology of fungi associated with Esca disease of grapevine

Fruit kind(s) Wine grapes Start date (mm/yyyy) 01/04/2009 End date (mm/yyyy) 31/03/2013

Project keywords Wood rot, esca, Basidiomycetes, Hymenochaetales, Vitis vinifera

Approved by Research Organisation Programme leader (tick box) x

This document is confidential and any unauthorised disclosure is prohibited.

Final report 2

THIS REPORT MUST INCLUDE INFORMATION FROM THE ENTIREENTIRE PROJECT

Executive Summary Give an executive summary of the total project.

Internal and external symptoms associated with esca have been characterised and the fungi associated with each symptom type have been identified. Esca is a grapevine disease believed to be caused by a complex of fungal pathogens, namely Phaeomoniella chlamydospora , Pheaoacremonium spp. and Basidiomycete spp. (wood rot fungi). Before this study, the Basidiomycete spp. associated with the disease in South Africa were unknown. Basidiomycete isolates were obtained from 37 grape growing areas representative of all the main grape growing areas of South Africa. Phylogenetic analysis revealed 10 “unknown” Basidiomycete groups (taxa) all of which needed to be described. Phaeomoniella chlamydospora and six species of Phaeoacremonium including P. aleophilum , P. alvesii , P. parasiticum , P. iranianum, P. mortoniae and P. sicilianum were isolated of which the latter three were reported for the first time in South Africa. Other taxa that were found in association with esca vines include Eutypa lata , Phomopsis viticola , Phomopsis sp. 1, Diaporthe ambigua , Diplodia seriata , Neofusicoccum australe and N. parvum . Attempts to link several Basidiomycete fruiting bodies found in South African vineyards with the 10 taxa in order to conduct the taxonomic studies led to three successfull descriptions, namely Taxon 1, a new Fomitiporella species, Fomitiporia capensis and Phellinus resupinatus , as well as the successful identification of Taxon 7 and 8 as Inonotus setulosocroceus and Inonotus rickii / Ptychogaster cubensis , respectively.

Pathogenicity studies with representative isolates of the 10 new Basidiomycete taxa clearly showed that all ten have the ability to survive within grapevine wood after inoculation and cause internal discolouration and rot.

Aspects regarding the infection pathway of Basidiomycetes and the toxins and enzymes they produce were also investigated. Leaf scorching was observed on potted glasshouse vines after pruning wounds were inoculated with basidiospores obtained from Taxon 1 and 7. Spore trapping studies conducted in two vineyards in Stellenbosch also showed that basidiospores were released at a high rate from the end of May to the end of September whereafter it declined towards summer. However, this period coincides with the time when farmers prune (July/August) and remove unwanted shoots (September -November). Susceptible wounds could therefore be prone to infection if not treated properly.

Representative isolates of all ten Basidiomycete taxa were able to produce 4-hydroxybenzaldehyde, a toxin thought to be involved in pathogenicity. Basidiomycete species associated with grapevines from around the world were obtained, as well as four Fom. mediterranea isolates with a known history of 4-hydroxy-benzaldehyde for comparison studies. However, after extensive studies were conducted with this compound we came to the conclusion that it is not of importance. Enzyme tests conducted with the new South African taxa and other esca-related pathogens mentioned above showed that these basidiomycetes produce enzymes which are able to degrade cellulose and lignin both of which are structural components of wood. Some of the Basidiomycete isolates were able to produce lignin peroxidase, and the majority of the isolates were able to produce manganese peroxidase and laccase. All the basidiomycete isolates were able to produce cellulase and none were able to produce xylanase. Therefore, South African isolates compare well with other well-known esca and esca-related pathogens .

A PCR detection system was also developed for the discrimination between the 10 Basidiomycete taxa found in South African vineyards as well as other Basidiomycetes associated with esca and esca-related diseases from around the world.

This document is confidential and any unauthorised disclosure is prohibited. Final report 3

This was the first in-depth study of the grapevine disease esca in South Africa. Problem identification and objectives State the problem being addressed and the ultimate aim of the project. Esca is a grapevine disease caused by a complex of fungal pathogens, namely Phaeomoniella chlamydospora , Pheaoacremonium spp. and Basidiomycete spp. (wood rot fungi) (Mugnai et al ., 1999). Previously it was believed that Stereum hirsitum and Phellinus igniarius were responsible for this disease in local vineyards (Marais, 1981), although no studies have ever been conducted to confirm this. Leaf symptoms are not common in South African vineyards. Consequently, the wrong assumption was made that esca does not occur very frequently and that it is not of great economic importance. Different wood rotting fungi produce different toxins and therefore it is possible that it could influence symptom expression (Sparapano et al ., 2000; Tabacchi et al ., 2000). It is therefore of cardinal importance to determine to what extent esca occurs in the various grape growing areas of South Africa and to identify the different fungi associated with the disease. The toxins produced by the Basidiomycete spp. must be identified and their role in symptom expression needs to be clarified. Wood rot fungi can have a huge impact on production and can reduce the productive lifespan of a grapevine significantly. The disease also has a direct effect on the quality of wine made from affected vines. Knowledge of the causal organisms and their infection pathways will also help to implement effective management strategies to control the disease.

The aim of this project is therefore to identify the Basidiomycete fungi associated with Esca disease in local vineyards and to study their biology. Other fungal species directly associated with wood rot symptoms will also be identified (ie. Phomopsis , Phaeoacremonium and Botryosphaeriaceae). The pathogen status of the Basidiomycetes must be determined as well as the factors that contribute to pathogenesis, ie the production of secondary metabolites and hydrolytic enzymes involved in wood degradation. A molecular identification technique must also be developed for quick and accurate detection of the Basidiomycetes involved with esca.

Workplan (materials and methods) List trial sites, treatments, experimental layout and statistical detail, sampling detail, cold storage and examination stages and parameters. Milestone 1: Symptoms and fungi associated with esca in South African vineyards

Sampling of esca diseased vines Vineyards showing foliar symptoms of esca, esca proper or general decline were identified in all the major wine, raisin and table grape production areas of South Africa between 2001 and 2008. The presence of external symptoms was not always recorded, since several vines were collected during winter when farmers traditionally remove old or unproductive vines. Vines showing typical tiger stripe foliar symptoms and also declining vines were cut open and those showing the whole range of internal symptoms (white rot and different types of discolourations) were removed and immediately taken to the laboratory where fungal isolations were made.

Fungal isolations from diseased vines Cross and longitudinal sections were made at various places in the cordons and trunk of each plant to investigate internal necrosis. For fungal isolations, wood sections with internal necrosis were selected and cut into two smaller sections adjacent to each other, in order to obtain two mirror images of the same symptom type. This was also done to facilitate the use of two sterilisation techniques to ensure fungal isolation from soft, spongy material. A photograph of each wood section showing the various symptom types was taken. One section was flame sterilized by holding the wood with sterile forceps, lightly spraying it with 70% ethanol and passing it through a flame. The other piece was triple sterilized as follows: 30 s in 70% ethanol, 2 min in 3.5% NaOCl and 30 s in 70% ethanol. Twelve small sections of wood (1×1×2 mm) from

This document is confidential and any unauthorised disclosure is prohibited. Final report 4

each of the different symptom types were then aseptically removed with a scalpel and placed onto Potato Dextrose Agar (PDA, Biolab, South Africa) plates containing 250 mg chloramphenicol (four pieces per plate). Plates were incubated at 24(±1) °C for approximately 4 weeks. Fungal growth from tissue pieces was monitored daily.

Selection and storage of cultures Fungi isolated from the various symptom types and suspected of being involved in the complex of fungi associated with esca were recorded, identified (where possible) and subcultured (hyphal tip or single spore) for later identification. Isolates were also selected to represent the various geographical regions. Pure cultures were stored in sterile distilled water in 14 ml McCartney bottles kept at 4 °C. Representative isolates are stored in a fungal culture collection at ARC Infruitec-Nietvoorbij, Stellenbosch and the STE-U culture collection of the Department of Plant Pathology, Stellenbosch University, South Africa.

Identification of fungi Fungal isolates obtained from the various symptom types were identified to genus level with phenotypic characteristics, including cultural growth and micromorphology. For a selected number of isolates, species identification was completed with PCR and sequence comparisons (White et al., 2011).

Internal wood symptoms Photographs of the wood section were used to identify and compare the different internal symptom types. Fungi that were isolated were linked to the specific symptom type and recorded on the different photographs. From this, the total number of fungi isolated from each symptom type from each section of wood was calculated.

Milestone 2: Characterisation of the fungi associated with esca diseased grapevines in South Africa

Morphological characterization Isolates obtained from above mentioned surveys were identified according to morphological and cultural characteristics as species of basidiomycetes (Fischer 2002), Botryosphaeriaceae (Van Niekerk et al ., 2004; Crous et al ., 2006; Damm et al ., 2007; Phillips et al ., 2008), Eutypa (Glawe and Rogers, 1982), Phaeoacremonium (Essakhi et al ., 2008; Mostert et al ., 2006b), Phomopsis (Mostert et al ., 2001; Van Niekerk et al . 2005) and Phaeomoniella chlamydospora (Crous and Gams, 2000). The cultures were purified through hyphal tipping or single sporing, if possible. All of the basidiomycete isolates and a selection of isolates of the other genera were deposited in the fungal culture collection at the ARC Infruitec-Nietvoorbij in Stellenbosch and the Department of Plant Pathology, University of Stellenbosch (Table 1). The total number of isolates obtained for each fungal taxon is reported in White et al . (2011a). This paper reports the characterization of selected number of isolates within each taxon.

This document is confidential and any unauthorised disclosure is prohibited. Final report 5

Table 1. Isolation details of Phaeoacremonium, Phomopsis, Botryosphaeriaceae, Eutypa and basidiomycete isolates obtained from esca diseased grapevines ( Vitis vinifera ) in South Africa.

STE-U Age of vine Collection GenBank accession Species Origin Cultivar Number (years) date 1 numbers

Phaeoacremonium TUB, ACT

6986 P. aleophilum Hermanus Chardonnay 21 2008/02/13 XXX, XXX

6991 Vredendal Colombar ± 35 2008/01/30 XXX, XXX Cabernet 6996 Wellington 13 2008/02/18 Sauvignon 6997 Calitzdorp Hanepoot 37 2008/02

7002 Calitzdorp Hanepoot 37 2008/02

6988 P. alvesii Klawer Chenin blanc 41 2008/01/31 XXX, XXX

6989 Klawer Chenin blanc 41 2008/01/31 XXX, XXX

7000 De Rust Chenin blanc 38 2008/02/06

7001 De Rust Chenin blanc 38 2008/02/06

6998 P. iranianum Calitzdorp Chenin blanc 44 2008/02/06 XXX, XXX

6999 Calitzdorp Chenin blanc 44 2008/02/06 XXX, XXX

6987 P. mortoniae Hermanus Chardonnay 21 2008/02/13 XXX, XXX

6990 P. parasiticum Klawer Chenin blanc 41 2008/01/31 XXX, XXX

6993 De Rust Fransdruif 33 2008/02/07 XXX, XXX

6992 P. sicilianum Oudtshoorn Colombar 31 2008/02/07 XXX, XXX

6994 Calitzdorp Hanepoot 37 2008/02 XXX, XXX

6995 Calitzdorp Hanepoot 37 2008/02 Phomopsis/ ITS Diaporthe 7003 Diaporthe ambigua Porterville Colombar 15 2005/03/01 XXX Cabernet 7010 Phomopsis theicola Stellenbosch 15 2005/05/17 XXX Sauvignon 7016 Stellenbosch Sauvignon blanc 25 2005/06/02 XXX Cabernet 7004 P. viticola Stellenbosch Unknown 2005/05/05 XXX Sauvignon Cabernet 7005 Stellenbosch Unknown 2005/05/05 XXX Sauvignon Cabernet 7006 Stellenbosch Unknown 2005/02/17 Sauvignon Cabernet 7007 Stellenbosch Unknown 2005/05/05 Sauvignon Cabernet 7008 Stellenbosch 15 2005/05/17 Sauvignon Cabernet 7009 Stellenbosch 15 2005/05/17 Sauvignon Cabernet 7011 Stellenbosch 19 2005/05/24 Sauvignon 7012 Stellenbosch Cabernet 19 2005/05/24

This document is confidential and any unauthorised disclosure is prohibited. Final report 6

Sauvignon

Cabernet 7013 Stellenbosch 19 2005/05/24 Sauvignon Cabernet 7014 Stellenbosch 19 2005/05/24 Sauvignon 7015 Stellenbosch Sauvignon blanc 25 2005/06/02

7017 Lutzville Colombar 22 2008/01/30 Somerset Cabernet 7018 31 2008/02/20 West Sauvignon 7019 Ashton Sauvignon blanc 20 2008/02/29

Botryosphaericeae ITS, EF

7020 Diplodia seriata Paarl Chenin blanc 18 2005/02/03 XXX, XXX

7026 Porterville Colombar 15 2005/03/01 XXX, XXX

7031 Stellenbosch Sauvignon blanc 25 2005/06/02

7032 Stellenbosch Sauvignon blanc 25 2005/06/21

7033 Klawer Fransdruif 35 2008/01/30

7034 Tulbagh Chenin blanc 24 2007/11/06

7035 Rawsonville Chenin blanc 20 2007/11/28 Neofusicoccum 7024 Paarl Hanepoot 22 2005/02/14 XXX, XXX australe 7025 Porterville Colombar 15 2005/03/01 XXX, XXX Cabernet 7028 Stellenbosch 15 2005/05/17 Sauvignon Cabernet 7029 Stellenbosch 19 2005/05/24 Sauvignon 7030 Stellenbosch Pinotage 28 2005/05/25

7021 Paarl Chenin blanc 18 2005/02/14

7022 Paarl Chenin blanc 18 2005/02/14

7023 Paarl Chenin blanc 18 2005/02/14

7027 Porterville Colombar 15 2005/03/02 Neofusicoccum 7036 Darling Chenin blanc 21 2007/10/22 XXX, XXX parvum 7037 Constantia Sauvignon blanc 25 2007/10/16 XXX, XXX

Eutypa lata ITS

5699 Eutypa lata Stellenbosch Sauvignon blanc 23 2003/03/13 XXX

5700 Stellenbosch Sauvignon blanc 23 2003/03/13 XXX

5692 Stellenbosch Chenin blanc 26 2002/11/25

5693 Stellenbosch Chenin blanc 26 2002/11/25

5694 Stellenbosch Chenin blanc 26 2002/11/25

5695 Stellenbosch Chenin blanc 26 2002/11/25

5696 Stellenbosch Chenin blanc 26 2002/11/25

This document is confidential and any unauthorised disclosure is prohibited. Final report 7

5697 Stellenbosch Chenin blanc 26 2002/11/25

5698 Stellenbosch Chenin blanc 26 2002/11/25

Basidiomycetes ITS

7038 Taxon 1 Stellenbosch Sauvignon blanc 23 2003/01/29 XXX

7039 Stellenbosch Sauvignon blanc 23 2003/01/29 XXX

7045 Stellenbosch Sauvignon blanc 23 2003/03/13

7046 Porterville Colombar 15 2004/11/15

7047 Porterville Colombar 15 2004/11/15

7048 Paarl Chenin blanc 18 2005/02/03

7051 Paarl Chenin blanc 18 2005/02/14

7054 Porterville Dan Ben Hanna 19 2003/11/27

7058 Porterville Colombar 15 2005/03/02

7059 Porterville Colombar 15 2005/03/02

7060 Porterville Colombar 15 2005/03/02

7061 Porterville Colombar 15 2005/03/02

7062 Porterville Colombar 15 2005/03/02

7063 Porterville Colombar 15 2005/03/02

7064 Porterville Colombar 15 2005/03/02

7065 Porterville Colombar 15 2005/03/01

7066 Porterville Colombar 15 2005/03/01

7067 Slanghoek Hanepoot 40 2005/03/02 Cabernet 7070 Stellenbosch 15 2005/05/17 Sauvignon Cabernet 7071 Stellenbosch 15 2005/05/17 Sauvignon Cabernet 7073 Stellenbosch 15 2005/05/17 Sauvignon Cabernet 7074 Stellenbosch 19 2005/05/24 Sauvignon Cabernet 7075 Stellenbosch 19 2005/05/24 Sauvignon 7078 Stellenbosch Sauvignon blanc 25 2005/06/02

7079 Stellenbosch Sauvignon blanc 25 2005/06/07

7080 Stellenbosch Sauvignon blanc 25 2005/06/07 Cabernet 7083 Stellenbosch 19 2005/06/23 Sauvignon 7084 Slanghoek Hanepoot 40 2005/07/08

7088 Rawsonville Chenin blanc 11 2005/11/03

7092 De Doorns Sultana 18 2007/07/07

7107 Constantia Sauvignon blanc 25 2007/10/16

7110 Constantia Sauvignon blanc 18 2007/10/16

7112 Bonnievale Sauvignon blanc 20 2007/10/07

This document is confidential and any unauthorised disclosure is prohibited. Final report 8

7113 Bonnievale Sauvignon blanc 20 2007/10/07

7117 Durbanville Shiraz 21 2007/09/27

7118 Durbanville Shiraz 21 2007/09/27

7120 Durbanville Sauvignon blanc 23 2007/09/27

7123 Durbanville Sauvignon blanc 23 2007/09/27

7130 Malmesbury Chenin blanc 36 2007/10/22 Riebeeck 7141 Chenin blanc 20 2007/11/06 Kasteel 7142 Tulbagh Chenin blanc 24 2007/11/06

7144 Tulbagh Chenin blanc 28 2007/11/06

7145 Rawsonville Chenin blanc 20 2007/11/28

7146 Rawsonville Chenin blanc 20 2007/11/28

7148 De Rust Chenin blanc 38 2008/02/06

7149 De Rust Chenin blanc 38 2008/02/06

7150 De Rust Red muskadel 31 2008/02/06

7151 De Rust Red muskadel 31 2008/02/06

7152 De Rust Fransdruif 33 2008/02/07

7156 Lutzville Colombar 22 2008/01/30

7157 Klawer Fransdruif 35 2008/01/30

7158 Klawer Chenin blanc 41 2008/01/31

7159 Klawer Chenin blanc 41 2008/01/31

7160 Klawer Chenin blanc 41 2008/01/31

7161 Klawer Chenin blanc 41 2008/01/31

7162 Klawer Chenin blanc 41 2008/01/31 Somerset Cabernet 7172 32 2008/02/19 West Sauvignon 7175 Ashton Shiraz 30 2008/02/29

7176 Montagu Colombar 27 2008/02/29

7147 Taxon 2 Oudtshoorn Pinotage 29 2008/02/06 XXX

7154 Calitzdorp Hannepoot 37 Feb-08 XXX

7155 Calitzdorp Hannepoot 37 Feb-08

7109 Taxon 3 Constantia Sauvignon blanc 18 2007/10/16 XXX

7136 Grabouw Sauvignon blanc 15 2007/11/08 XXX

7174 Ashton Sauvignon blanc 20 2008/02/29

7178 Montagu Colombar 27 2008/02/29

7042 Taxon 4 Stellenbosch Chenin blanc 26 2002/11/25 XXX

7043 Stellenbosch Chenin blanc 26 2002/11/25 XXX

7125 Taxon 5 Darling Chenin blanc 23 2007/10/22 XXX

This document is confidential and any unauthorised disclosure is prohibited. Final report 9

7126 Darling Chenin blanc 23 2007/10/22 XXX

7127 Darling Chenin blanc 21 2007/10/22

7128 Darling Chenin blanc 21 2007/10/22

7129 Darling Chenin blanc 21 2007/10/22

7131 Malmesbury Pinotage 36 2007/10/22

7132 Malmesbury Pinotage 36 2007/10/22

7143 Tulbagh Chenin blanc 24 2007/11/06

7153 Ladismith Chenin blanc 28 2008/02/06

7177 Montagu Colombar 27 2008/02/29

7133 Taxon 6 Malmesbury Pinotage 36 2007/10/22 XXX

7134 Malmesbury Pinotage 36 2007/10/22 XXX

7076 Taxon 7 Stellenbosch Pinotage 28 2005/05/25 XXX

7090 Stellenbosch Ruby Cabernet 22 2007/08/02 XXX

7106 Constantia Sauvignon blanc 25 2007/10/16

7165 Franschhoek Chenin blanc 25 2008/02/13 Somerset Cabernet 7173 31 2008/02/20 West Sauvignon 7138 Taxon 8 Botrivier Chenin blanc 20 2007/11/08 XXX

7139 Botrivier Chenin blanc 20 2007/11/08 XXX

7040 Fomitiporia sp. Stellenbosch Sauvignon blanc 23 2003/01/29 XXX

7041 Stellenbosch Sauvignon blanc 23 2003/01/29 XXX

7050 Paarl Hanepoot 22 2005/02/14 XXX

7052 Paarl Chenin blanc 18 2005/02/14 XXX

7053 Paarl Chenin blanc 18 2005/02/14

7056 Stellenbosch Hanepoot 12 2005/02/25

7057 Stellenbosch Malbec 12 2005/02/25 Cabernet 7069 Stellenbosch 15 2005/05/17 Sauvignon Cabernet 7072 Stellenbosch 15 2005/05/17 Sauvignon 7077 Stellenbosch Sauvignon blanc 25 2005/06/02

7081 Stellenbosch Sauvignon blanc 25 2005/06/20

7082 Stellenbosch Sauvignon blanc 25 2005/06/21

7086 Klaas voogds Red Globe 10 2005/09/12

7093 Wellington Chenin blanc 20 2007/09/07

7094 Wellington Chenin blanc 20 2007/09/07

7095 Wellington Chenin blanc 20 2007/09/07

7096 Franschhoek Chenin blanc 40 2007/09/19 Somerset 7097 Sauvignon blanc 16 2007/09/26 West

This document is confidential and any unauthorised disclosure is prohibited. Final report 10

7108 Constantia Sauvignon blanc 18 2007/10/16

7115 Durbanville Chenin blanc 26 2007/09/27

7119 Durbanville Sauvignon blanc 23 2007/09/27

7121 Durbanville Sauvignon blanc 23 2007/09/27

7122 Durbanville Sauvignon blanc 23 2007/09/27

7124 Darling Chenin blanc 23 2007/10/22

7135 Grabouw Chardonnay 15 2007/11/08

7137 Botrivier Chenin blanc 20 2007/11/08

7140 Riebeeck Wes Chenin blanc 19 2007/11/06 Cabernet 7163 Franschhoek 14 2008/02/12 Sauvignon Cabernet 7164 Franschhoek 14 2008/02/12 Sauvignon 7166 Hermanus Chardonnay 21 2008/02/13

7167 Hermanus Chardonnay 21 2008/02/13

7168 Hermanus Chardonnay 21 2008/02/13 Cabernet 7169 Wellington 13 2008/02/18 Sauvignon Cabernet 7170 Wellington 13 2008/02/18 Sauvignon Somerset 7171 Tinta Barroca 28 2008/02/19 West 7055 Phellinus sp. Marken Prime seedless 5 2003/11/27 XXX

7098 Kanon Eiland Sultana Unknown 2007/09/15 XXX

7099 Kanon Eiland Sultana Unknown 2007/09/15

7100 Keimoes Chenin blanc 18 2007/09/15

7101 Keimoes Colomino 18 2007/09/15

7102 Keimoes Colomino 18 2007/09/15

7103 Marchand Sultana 40 2007/09/15

7104 Marchand Sultana 40 2007/09/15

7105 Marchand Sultana 40 2007/09/15

7179 Keboes Sultana Unknown 2008/02/27

7180 Prieska Sultana Unknown 2008/04/17 1Isolates were collected by Francois Halleen and Chana-Lee White.

This document is confidential and any unauthorised disclosure is prohibited. Final report 11

Morphological characterization (continue) The cultural growth patterns were determined for 38 isolates of Phaeoacremonium on PDA, Malt extract agar (MEA; 2 % malt extract, Oxoid Ltd, England; 1.5 % agar (Difco, Le Pont de Claix, France) and on Oatmeal Agar (OA; Difco, Le Pont de Claix, France) at 25 oC. After eight days the radial growth of the colonies was measured on MEA. After 16 days, the colour of the colonies was determined on all the media (Rayner, 1970). From these results, 17 Phaeoacremonium isolates were selected for further identification of morphological structures formed on MEA.

The Botryosphaeriaceae and Phomopsis isolates were plated onto PDA and incubated at 25 oC. After two weeks a selection 18 from 137 isolates of Botryosphaeriaceae and 17 Phomopsis isolates were made on the basis of different cultural growth patterns. Botryosphaeriaceae isolates were grown on sterile pine needles on water agar (WA, Biolab, South Africa) to induce the formation of pycnidia (Crous et al ., 2006). The Phomopsis isolates formed pycnidia on PDA.

Microscopic slides of the selected Botryosphaeriaceae, Phaeomoniella chlamydospora , Phomopsis and Phaeoacremonium isolates were made in lactic acid. Conidial dimensions were measured under a light microscope (Axioskop, Zeiss, Germany). Twenty-four spores were measured from each isolate and 95 % confidence intervals were calculated.

The basidiomycetes were plated onto PDA and incubated at 25 oC. After four weeks, a selection of 134 of the 350 basidiomycete isolates was made. The isolates represented all of the sampled geographical regions and included all of the different cultural growth patterns. A selection of 31 basidiomycete isolates, representative of the different phylogenetic clades was made. A growth study was done with these isolates with mycelial plugs (2 mm diam.) taken from the margin of the colonies, plated onto PDA and incubated at 25 oC. After 14 days, the colony diameters were measured.

DNA isolation and amplification Genomic DNA was extracted from fresh fungal mycelia obtained from PDA plates not older than 14 days from 134 basidiomycete, 18 Botryosphaeriaceae, 17 Phomopsis and 17 Phaeoacremonium isolates. The CTAB based DNA extraction method was used as described by Damm et al . (2008).

The partial beta-tubulin region (TUB) was amplified for the Phaeoacremonium isolates with the primers T1 (O’Donnell and Cigelnik, 1997) and Bt2b (Glass and Donaldson, 1995). The actin gene (ACT) was amplified using primers ACT-512F and ACT-783R (Carbone and Kohn, 1999). PCR conditions as stated in Mostert et al . (2006) were used for these two gene areas.

For the Botryosphaeriaceae isolates the elongation factor-1α was amplified with the primers EF1-728F and EF1-986R (Carbone and Kohn, 1999). The internal transcribed spacers 1 and 2 and the 5.8S rRNA gene was amplified with the ITS1 and ITS4 primers (White et al ., 1990) for the Botryosphaeriaceae and Phomopsis isolates. The PCR reaction contained 1 µl of undiluted DNA, 1 × PCR buffer, 4 pmol of each primer, 0.2 mM of each dNTP, 1.5 U of Taq Polymerase,

2.5 mM MgCl 2 and the reaction was made up to a total volume of 25 µl with sterile water. The PCR amplification cycles included a denaturing step at 95 oC for eight minutes followed by 35 cycles of 95 oC for 15 s, 55 oC for 30 s and 72 oC for 60 s followed by a final extension step at 72 oC for five minutes.

The ITS region was also amplified for the basidiomycetes with the primers ITS1 and ITS4. Due to the presence of heterokaryotic mycelium of basidiomycete fungi (Clark and Anderson, 2004) the PCR products were cloned to ensure sequencing of a single copy. A PCR reaction for each

This document is confidential and any unauthorised disclosure is prohibited. Final report 12

isolate was performed to amplify the ITS region using two µl undiluted DNA, 0.5 mM of each primer, 0.2 mM of each dNTP, 1 × PCR buffer without MgSO 4 (Fermentas Life Sciences, St. Leon-Rot, Germany), 0.5 U of Pfu Taq Polymerase (Fermentas Life Sciences) 4 mM MgSO 4 (Fermentas Life Sciences), and the reaction was made up to a total volume of 25 µl with sterile water. The parameters used were a denaturing step at 95 oC for three minutes, followed by 40 cycles of 95 oC for one minute, 45 oC for one minute and 72 oC for two minutes, followed by a final extension step at 72 oC for five minutes.

The PCR reactions were run on a GeneAmp PCR System 9700. All PCR products were visualized under UV light on a 1 % agarose gel stained with ethidium bromide. The PCR products were cleaned using the MSB Spin PCRapase kit (Invitek, Berlin, Germany). The ITS products of the basidiomycetes were cloned using the CloneJET TM PCR cloning kit (Fermentas Life Sciences) according to manufacturer’s instructions. Colonies were selected and a PCR reaction performed to obtain a product which was then cleaned using the MSB Spin PCRapase kit.

The cleaned products were sequenced in both directions using an ABI PRISM Big Dye Terminator v3.1 Cycle Sequencing Ready Reaction Kit (PE Biosystems, Foster City, CA) with the primers used in the initial PCR reactions. The products were then analyzed on an ABI Prism 3130XL DNA sequencer (Perkin-Elmer, Norwalk, CN).

Phylogenetic analyses Consensus sequences made using Geneious Pro v3.6.2 (Biomatters Ltd.). Reference sequences representing the relevant species for Botryosphaeriaceae (van Niekerk et al ., 2004), Phaeoacremonium (Essakhi et al ., 2008; Mostert et al ., 2006b), Phomopsis (van Niekerk et al ., 2005) and the basidiomycetes (Fischer, 2006) were obtained from GenBank (http://www.ncbi.nlm.gov) and included in the different gene alignments. The sequences were automatically aligned using MAFFT v6 (Katoh et al ., 2002) and further manual alignment was performed using Sequence alignment editor v2.0a11 (Rambaut, 2002).

The congruency of the TUB and ACT dataset for Phaeoacremonium and the EF and ITS dataset for the Botryosphaeriaceae was tested with partition homogeneity using PAUP (Phylogenetic Analysis Using Parsimony) v4.0b10 (Swofford, 2003). Maximum parsimony analyses were performed with PAUP, using the heuristic search option, with 10 random taxon additions for all the datasets. Tree bisection and reconstruction was used as the branch swapping algorithm. All characters were unordered and of equal weight. Gaps were treated as missing data. Bootstrap support values were calculated from 1000 heuristic search replicates. Measures calculated for parsimony included tree length (TL), consistency index (CI), retention index (RI) and the rescaled consistency index (RC) values.

Milestone 3: Taxonomic descriptions of the new Basidiomycete species In the following section taxonomic descriptions / identification of five of the ten new Basidiomycete Taxa will be discussed, namely new Fomitiporia , Phellinus and Fomitiporella species, as well as identifying two of our unknown taxa as identical to Inonotus setulosocroceus (Taxon 7) and Taxon 8 as representing the anamorph stage of Inonotus rickii , Ptychogaster cubensis .

A novel Fomitiporia species associated with esca on grapevine in South Africa:

Fungal material and culturing

This document is confidential and any unauthorised disclosure is prohibited. Final report 13

Thirty-six mycelial isolates, all from Vitis vinifera , were identified during vineyard surveys conducted during the initial phase of this study (White et al. 2011b) as a putative novel Fomitiporia species. Fungal strains are maintained by the culture collection of the Department of Plant Pathology at the University of Stellenbosch (STE-U) and are stored on PDA (Potato Dextrose Agar, Biolab, Midrand, SA) slants in sterile water at 15 °C and in tubes filled with 70% glycerol at -85 °C. Prior to DNA extraction, cultures were grown on PDA at 25 °C under daylight conditions. Growth studies were conducted with three isolates on MEA (Malt extract agar) at intervals of 5 °C between 5 °C and 45 °C. Growth was measured after a period of seven days and cardinal temperatures for colony growth were obtained.

Comparative microscopy of fruit bodies Sections of fruit bodies were mounted in water or Melzer´s reagent, and were studied at 500x or 1250x under phase contrast optics. A maximum of 25 observations was recorded for measurements of basidiospores. Pictures of sections mounted in Melzer’s reagent were taken at 400x and 1000x magnification using a Nikon Eclipse E600 compound microscope with a Nikon DMX1200C digital camera attachment.

DNA isolation, PCR amplification, Sequencing DNA was isolated from cultured mycelium grown for 21 days on PDA plates using CTAB buffer (Damm et al . 2008). Approximately 700 bp of the ITS region was amplified using the primer pair ITS1 and ITS4 (White et al . 1990). PCR and cloning were done according to the protocol in White et al. (2011b). Cloning was necessary to allow the sequencing of a single copy of the gene region (Clark and Anderson 2004). The LSU region was amplified using the primer pair LR0R and LR5 (http://www.biology.duke.edu/fungi/mycolab/primers.htm) and PCR products were cloned using an insTAclone PCR cloning kit (Fermentas Life Sciences) according to the manufacturer’s instructions. Products were cleaned using an MSB Spin PCRapase kit (Invitek, Germany) and cleaned products were sequenced using ABI PRISM Big Dye Terminator v3.1 Cycle Sequencing Ready Reaction Kit (PE Biosystems, Foster City, CA). The products were then analyzed on an ABI Prism 3130XL DNA sequencer (Perkin-Elmer, Norwalk, CN).

Phylogenetic analysis Sequences were edited using Geneious Pro 3.5.6 (2007, Biomatters Ltd., Auckland, New Zealand) and consensus sequences were run through the Basic Local Alignment Search Tool (BLAST, http://blast.ncbi.nlm.nih.gov/Blast.cgi) to obtain a preliminary identification. Reference sequences were obtained from GenBank (http://www.ncbi.nlm.nih.gov/Genbank) to build representative combined ITS and LSU alignments for phylogenetic analyses. Selection of reference sequences was based on several publications, including Dai et al. (2001), Fischer (2002), Decock et al. (2005), Fischer et al. (2005), Fischer (2006), Decock et al. (2007), Dai et al. (2008) and Amalfi et al. (2010, 2012), and included all relevant and available taxa, ie., with main emphasis on species occurring on grapevine and/or in Africa. Phellinus uncisetus Robledo Urcelay & Rajchenb. MUCL46231 and MUCL47061 was selected as outgroup. The sequences were automatically aligned using MAFFT v6 (Katoh et al. 2002) and further manual alignment was performed using Sequence alignment editor v2.0a11 (Rambaut 2002). Maximum parsimony analyses were performed using PAUP (Phylogenetic Analysis Using Parsimony) v4.0b10 (Swofford 2003), using the heuristic search option, with 10 random taxon additions for all the datasets. Tree bisection and reconstruction were used as the branch swapping algorithms. All characters were unordered and of equal weight. Gaps were treated as missing data. Bootstrap support values were calculated from 1000 heuristic search replicates. Measures calculated for parsimony included tree length (TL), consistency index (CI), retention index (RI) and the rescaled consistency index (RC) values. Bayesian analyses were conducted for the ITS and LSU partitions of the alignment using MrBayes 3.1.2 (Ronquist and Huelsenbeck 2003). Modeltest 3.6 was used for selecting the optimal model of sequence evolution for each clade alignment. The likelihood and prior settings for each partition were changed accordingly in MrBayes. Markov chains were initiated from a random tree and run 2.000.000 generations,

This document is confidential and any unauthorised disclosure is prohibited. Final report 14

keeping one out of every 100 generations. Convergence among chains was monitored by examining plots of log-likelihood values and observing when the values of the four chains reached a plateau. The average deviation of split frequencies was 0.003292 and the potential scale reduction factors (PSRF) were 1.00 for each parameter. The first 1250 generations (burn- in) were discarded and the remaining generations were used to calculate the 50% majority-rule tree and the posterior probability for the individual branches.

A new species of Phellinus sensu stricto associated with esca on grapevine in South Africa: This study will describe a novel Phellinus s.s species from grapevine in the Northern Cape and Limpopo provinces of South Africa and Namibia. The species was isolated from grapevines showing severe symptoms of the grapevine trunk disease complex, esca, and a number of related fruit bodies were found on the trunks of affected vines, both dead and alive. The species was not assignable to any known taxon of Phellinus s.s. and was described by morphological means as well as by comparing the sequences of the nuclear large subunit and the internal transcribed spacer region to those from other species of Phellinus s.s ., originating from different regions worldwide.

Fungal material and culturing Eleven mycelial isolates, all from Vitis vinifera , were identified during a previous study (White et al. 2011) as a putative novel Phellinus species. Two further strains were collected from the Limpopo province of South Africa and a single strain from southern Namibia. Fungal strains are maintained by the culture collection of the Department of Plant Pathology at the University of Stellenbosch (STE-U) and are stored on PDA (Potato Dextrose Agar, Biolab, Midrand, SA) slants and in sterile water at 15 °C and in tubes filled with 70% glycerol at -85 °C. Prior to DNA extraction, cultures were grown on PDA at 25 °C under daylight conditions. Growth studies were conducted with three isolates on MEA (Malt extract agar) at intervals of 5 °C between 5 °C and 45 °C. Growth was measured after a period of seven days and cardinal temperatures for colony growth was obtained.

DNA isolation, PCR amplification, Sequencing DNA was isolated from cultured mycelium grown for 21 days on PDA plates using CTAB buffer (Damm et al . 2008). The LSU region was amplified using the primer pair LR0R and LR5 (http://www.biology.duke.edu/fungi/mycolab/primers.htm) and PCR products were cloned using an insTAclone PCR cloning kit (Fermentas Life Sciences) according to the manufacturer’s instructions. Products were cleaned using an MSB Spin PCRapase kit (Invitek, Germany) and cleaned products were sequenced using ABI PRISM Big Dye Terminator v3.1 Cycle Sequencing Ready Reaction Kit (PE Biosystems, Foster City, CA). The products were then analyzed on an ABI Prism 3130XL DNA sequencer (Perkin-Elmer, Norwalk, CN).

This document is confidential and any unauthorised disclosure is prohibited. Final report 15

representative LSU alignment for phylogenetic analyses. Selection of reference sequences were based on several publications, including De Cock et al. (2006), Wagner and Fischer (2002) and Yombiyeni et al. (2008). The sequences were automatically aligned using MAFFT v6 (Katoh et al. 2002) and further manual alignment was performed using Sequence alignment editor v2.0a11 (Rambaut 2002). Maximum parsimony analyses were performed using PAUP (Phylogenetic Analysis Using Parsimony) v4.0b10 (Swofford 2003), using the heuristic search option, with 10 random taxon additions for all the datasets. Tree bisection and reconstruction was used as the branch swapping algorithm. All characters were unordered and of equal weight. Gaps were treated as missing data. Bootstrap support values were calculated from 1000 heuristic search replicates. Measures calculated for parsimony included tree length (TL), consistency index (CI), retention index (RI) and the rescaled consistency index (RC) values. Bayesian analyses were conducted for the LSU alignment using MrBayes 3.1.2 (Ronquist and Huelsenbeck 2003). Modeltest 3.6 was used for selecting the optimal model of sequence evolution for each clade alignment. The likelihood and prior settings for each partition were changed accordingly in MrBayes. Markov chains were initiated from a random tree and run 2.000.000 generations, keeping one out of every 100 generations. Convergence among chains was monitored by examining plots of log-likelihood values and observing when the values of the four chains reached a plateau. The average deviation of split frequencies was and the potential scale reduction factors (PSRF) were for each parameter. The first generations (burn-in) were discarded and the remaining generations were used to calculate the 50% majority-rule tree and the posterior probability for the individual branches.

Milestone 4(a): Toxic secondary metabolite production by Basidiomycete fungi which are involved with pathogenesis. Representative isolates of the ten “unknown Basidiomycetes” were tested for the production of the phytotoxins 4-hydroxy-benzaldehyde, sterehirsutinal, sterehirsutinol and frustulosine. Liquid suspensions of the fungi were grown up. The liquid phase was extracted with ethyl acetate and the different compounds were cleaned by column chromatography according to the methods of Tabacchi et al. (2000). Toxins was confirmed with LCMS by using standards of the toxins.

Milestone 4(b): Hydrolytic enzyme production by Basidiomycete fungi which are involved with wood degradation. Extra-cellular enzyme production of representative isolates of the ten “unknown Basidiomycetes” was determined. These enzymes included pectate lyase (degrades pectin), cellulase, xylanase (cell wall degrading enzymes), peroxidase, manganese peroxidase and laccase (involved with lignin degradation). The fungi were grown on solid media containing either pectin or cellulose or lignin. Enzymatic activities were measured by the area of transparent or colored halos produced (Santos et al., 2006).

Milestone 5: Pathogenicity trials Inoculations with representative isolates of all 10 unknown Basidiomycete taxa were carried out in September 2010 in a Shiraz (Groenhof) and Mouvedre (Tokara) vineyard in Stellenbosch. Three isolates of Taxa 1, 2, 3, 5, 7, Fomitiporia capensis and Phellinus resupinatus , two isolates each of Taxa 4, 6 and 8, as well as a negative control (potato dextrose agar plug) and non- pathogen ( Acremonium strictum , isolate STEU6296) were selected for the trial (Table 2). Agar plugs, 4mm in diameter, were obtained from the outer margin of 4-week-old cultures and individually placed in holes drilled in the distal ends of cordons. Only one inoculation was made on a plant. The plants were examined for foliar symptoms at regular intervals and inoculated arms were removed after 2 years. None of the plants displayed any foliar symptoms after

This document is confidential and any unauthorised disclosure is prohibited. Final report 16

inoculation. Inoculated arms were removed during the period between October and December 2012. Internal symptoms, namely discoloured lesions and rot, were measured and isolations were made from symptomatic tissue.

Table 2. Isolates selected for pathogenicity trial. Isolate (STE - Isolates Taxon U) (FH) Origin Taxon 1 7038 1 Stellenbosch 7141 270 De Rust 7148 288 Riebeeck Kasteel Taxon 2 7147 285 Oudtshoorn 7154 300 Oudtshoorn 7155 301 Calitzdorp Taxon 3 7109 216 Constantia 7136 261 Grabouw 7174 327 Ashton Taxon 4 7042 7 Stellenbosch 7043 8 Stellenbosch Taxon 5 7126 244 Darling 7143 275 Tulbagh 7153 295 Ladismith Taxon 6 7133 256 Malmesbury 7134 258 Malmesbury Taxon 7 7090 175 Stellenbosch 7106 211 Constantia 7165 315 Franschhoek Taxon 8 7138 265 Botrivier 7139 266 Botrivier Fomitiporia capensis 7096 189 Franschhoek 7135 259 Grabouw 7168 319 Hermanus Phellinus resupinatus 7055 62 Marken 7098 194 Kanon Eiland 7105 210 Marchand Acremonium strictum 6296 Agar control NUL

Milestone 6: Spore trapping studies Spore trapping studies were conducted in two vineyards at Nietvoorbij, blocks P2 (Pinotage) and B3 (mixed cultivars). Twenty basidiocarps were identified in P2 and 12 in B3 in the first season (2010) and 13 and 9 in the second season (2011). Petroleum jelly covered slides were placed directly beneath the basidiocarps and replaced weekly from mid-June to the end of November 2010 and again from mid-May to the end of November 2011. Evaluation of the slides was carried out by screening the slide for spores and then identifying a zone of abundant spores within a single field of view under x200 magnification. The number of spores in this specific field was then recorded and regarded as a qualitative indication of the availability of spores. Climatic parameters compared to spore release were total rainfall in a trapping period (mm/week), relative humidity (%) and average temperature (˚C) over a trapping period.

This document is confidential and any unauthorised disclosure is prohibited. Final report 17

Milestone 7: Development of a PCR detection system for the discrimination between Basidiomycetous isolates (Hymenochaetales) associated with esca of grapevine In this section we describe the development of a PCR assay for the specific and robust detection of isolates from any of the 10 “unknown” taxa found in South African grapevines as tested against Basidiomycete species associated with esca and related diseases from around the world.

Strains and isolates used in this study Strains and isolates used in this study are listed in Table 3.

Sequence alignment Sequences corresponding to the 5.8 S rRNA genomic region including the two flanking internal transcribed spacers (ITS) of all Basidiomycetous isolates (White et al ., 2011) were aligned using the program Clustal X (2.0) (Larkin et al ., 2007) whereupon the alignment was viewed using BioEdit (7.0.9.0) (Hall, 1999).

Primer design Unique forward primers were designed to specifically recognise each taxon. Primers bind either in the ITS1 or ITS2 region, are between 17 to 22 base pairs long, have a melting temperature of 52 °C to 54 °C, and have a GC content of between 40 to 59 % and are listed in Table 4. Each taxon specific forward primer was paired with ITS4 (White et al ., 1990) that binds in the 25S region homologous between all taxa to give amplicon sizes as listed in Table 5.

Genomic DNA extraction and PCR conditions Genomic DNA was extracted from cultures as described previously (Damm et al ., 2008). All PCR reactions were run using the BIOTAQ enzyme system (Bioline) and individual nucleotides and MgCl 2 were added to a final concentration of 200µM and 1,5mM respectively. The various PCR cycling conditions used are indicated in Table 6. PCR amplicons was run in 1.5 % agarose gels and stained with ethidium bromide for DNA visualisation under UV light. The DNA molecular marker “GeneRuler™ DNA ladder mix” was run in parallel with samples for relative fragment size determination.

Image processing software Paint.NET (v3.5.10) was used for image processing and all vector graphics manipulations were performed using Inkscape (v.48).

Table 3. Strains and Basidiomycetous isolates used in this study Strain or Basidiomycetous Isolate name STE -U collecti on ID or taxon Reference Phaemoniella clamydospora PMC 88 This laboratory Phaeoacremonium aleophilum PMC 229 This laboratory Neofusicoccum parvum1 PMC 190 This laboratory Diplodia seriata PMC 212 This laboratory Eutypa lata PMC 123 This laboratory Phomopsis viticola PMC 173 This laboratory Fomitiporia mediterranea MF 1 Dr Michael Fischer Fomitiporia australiensis MF 2 Dr Michael Fischer Fomitiporia australiensis MF 3 Dr Michael Fischer Phellinus alni MF 4 Dr Michael Fischer

This document is confidential and any unauthorised disclosure is prohibited. Final report 18

Strain or Basidiomycetous Isolate name STE -U collecti on ID or taxon Reference Fomitiporia vitis MF 5 Dr Michael Fischer Fomitiporia polymorpha MF 6 Dr Michael Fischer Inocutis jamaicensis MF 7 Dr Michael Fischer Phellinus ignarius MF 8 Dr Michael Fischer Inonotus hispidus MF 9 Dr Michael Fischer Taxon 1 FH 329 7157 Taxon 1 FH 222 7112 Taxon 1 FH 224 7113 Taxon 1 FH 213 7107 Taxon 1 FH 217 7110 Taxon 1 FH 179 7092 Taxon 1 FH 288 7148 Taxon 1 FH 289 7149 Taxon 1 FH 290 7150 Taxon 1 FH 292 7151 Taxon 1 FH 294 7152 Taxon 1 FH 232 7117 Taxon 1 FH 234 7118 Taxon 1 FH 237 7120 Taxon 1 FH 240 7123 Taxon 1 FH 305 7157 Taxon 1 FH 306 7158 Taxon 1 FH 307 7159 Taxon 1 FH 309 7160 Taxon 1 FH 310 7161 Taxon 1 FH 311 7162 Taxon 1 FH 302 7156 Taxon 1 FH 251 7130 Taxon 1 FH 330 7176 Taxon 1 FH 39 7048 Taxon 1 FH 52 7051 Taxon 1 FH 61 7054 Taxon 1 FH 34 7046 Taxon 1 FH 35 7047 Taxon 1 FH 79 7058 Taxon 1 FH 80 7059 Taxon 1 FH 81 7060 Taxon 1 FH 84 7061 Taxon 1 FH 85 7062 Taxon 1 FH 86 7063 Taxon 1 FH 90 7064 Taxon 1 FH 96 7065 Taxon 1 FH 98 7066 Taxon 1 FH 170 7088 Taxon 1 FH 280 7145 Taxon 1 FH 282 7146 Taxon 1 FH 270 7141 Taxon 1 FH 100 7067 Taxon 1 FH 161 7084 Taxon 1 FH 325 7172 Taxon 1 FH 1 7038 Taxon 1 FH 2 7039

This document is confidential and any unauthorised disclosure is prohibited. Final report 19

Strain or Basidiomycetous Isolate name STE -U collecti on ID or taxon Reference Taxon 1 FH 26 7045 Taxon 1 FH 119 7070 Taxon 1 FH 120 7071 Taxon 1 FH 122 7073 Taxon 1 FH 125 7074 Taxon 1 FH 127 7075 Taxon 1 FH 143 7078 Taxon 1 FH 147 7079 Taxon 1 FH 149 7080 Taxon 1 FH 157 7083 Taxon 1 FH 273 7142 Taxon 1 FH 276 7144 Taxon 2 FH 300 7154 Taxon 2 FH 301 7155 Taxon 2 FH 285 7147 Taxon 3 FH 327 7174 Taxon 3 FH 216 7109 Taxon 3 FH 261 7136 Taxon 3 FH 333 7178 Taxon 4 FH 7 7042 Taxon 4 FH 8 7043 Taxon 5 FH 243 7125 Taxon 5 FH 244 7126 Taxon 5 FH 246 7127 Taxon 5 FH 247 7128 Taxon 5 FH 248 7129 Taxon 5 FH 295 7153 Taxon 5 FH 253 7131 Taxon 5 FH 254 7132 Taxon 5 FH 332 7177 Taxon 5 FH 275 7143 Taxon 6 FH 256 7133 Taxon 6 FH 258 7134 Taxon 7 FH 211 7106 Taxon 7 FH 315 7165 Taxon 7 FH 326 7173 Taxon 7 FH 131 7076 Taxon 7 FH 175 7090 Taxon 8 FH 265 7138 Taxon 8 FH 266 7139 Taxon 9 FH 214 7108 Taxon 9 FH 239 7122 Taxon 9 FH 313 7163 Taxon 9 FH 316 7166 Taxon 9 FH 317 7167 Taxon 9 FH 167 7086 Taxon 9 FH 43 7049 Taxon 9 FH 268 7140 Taxon 9 FH 324 7171 Taxon 9 FH 66 7056 Taxon 9 FH 139 7077 Taxon 9 FH 263 7137

This document is confidential and any unauthorised disclosure is prohibited. Final report 20

Strain or Basidiomycetous Isolate name STE -U collecti on ID or taxon Reference Taxon 9 FH 241 7124 Taxon 9 FH 227 7115 Taxon 9 FH 236 7119 Taxon 9 FH 238 7121 Taxon 9 FH 189 7096 Taxon 9 FH 314 7164 Taxon 9 FH 259 7135 Taxon 9 FH 319 7168 Taxon 9 FH 46 7050 Taxon 9 FH 56 7052 Taxon 9 FH 59 7053 Taxon 9 FH 192 7097 Taxon 9 FH 4 7040 Taxon 9 FH 5 7041 Taxon 9 FH 78 7057 Taxon 9 FH 118 7069 Taxon 9 FH 121 7072 Taxon 9 FH 151 7081 Taxon 9 FH 155 7082 Taxon 9 FH 183 7093 Taxon 9 FH 184 7094 Taxon 9 FH 187 7095 Taxon 9 FH 320 7169 Taxon 9 FH 323 7170 Taxon 10 FH 196 7099 Taxon 10 FH 334 7179 Taxon 10 FH 197 7100 Taxon 10 FH 200 7101 Taxon 10 FH 203 7102 Taxon 10 FH 207 7103 Taxon 10 FH 209 7104 Taxon 10 FH 210 7105 Taxon 10 FH 62 7055 Taxon 10 FH 194 7098 Taxon 10 FH 337 7180

This document is confidential and any unauthorised disclosure is prohibited. Final report 21

Table 4. Primers used in this study Primer name Primer sequence 5’ →3’ Reference BT1 GTCTGCTCCGTATCCTC This study BT2 TCCCTTTGGCTGTATGTG This study BT3 TTGTATTCTTCGGCCGTG This study BT4 TCCGTTTTATCTGGTTGTATGG This study BT5 TACAACATTTGCGTGTTACC This study BT6 CACGACCTTCATCGGAG This study BT7 CTTGAAGTAACGTCGGCT This study BT8 GCTTGTAGTGAGCGACTC This study BT9 GTATGTACATGTGCTTGCC This study BT10 GGAGGCATGTAGTCTTACTTA This study ITS4 TCCTCCGCTTATTGATATGC White et al ., 1990 ITS1-F CTTGGTCATTTAGAGGAAGTAA Gardes & Bruns, 1993

Table 5. Taxon specificity and expected amplicon sizes for primer pairs Primer pair Taxon specificity Approximate amplicon size in base pairs (bp) ITS1-F & ITS4 All taxa 700-800 bp BT1 & ITS4 Taxon 1 620 bp BT2 & ITS4 Taxon 2 600 bp BT3 & ITS4 Taxon 3 590 bp BT4 & ITS4 Taxon 4 590 bp BT5 & ITS4 Taxon 5 240 bp BT6 & ITS4 Taxon 6 680 bp BT7 & ITS4 Taxon 7 610 bp BT8 & ITS4 Taxon 8 570 bp BT9 & ITS4 Taxon 9 700 bp BT10 & ITS4 Taxon 10 550 bp

Table 6. PCR programmes used in this study “Touchdown 1” “Touchdown 2”

This document is confidential and any unauthorised disclosure is prohibited. Final report 22

Results and discussion State results obtained and list any industry benefits. If applicable, include a short discussion covering ALL accumulated results from the start of the project. Limit it to essential information only.

Milestone 1: Symptoms and fungi associated with esca in South African vineyards

Distribution of esca Diseased vines representative of the search criteria were found in 31, five and one production areas, Western Cape, Northern Cape and Limpopo Provinces, respectively (Table 7), and in all the regions investigated. In total, 212 vines were collected from vineyards covering an area of 207 ha. Of these vines, fungi were isolated from 181 vines, representing 18 cultivars.

The majority of diseased vines were found in older vineyards. A total of 3% of the vines sampled were between 3 and 10 years of age, 39% were between 11 and 20 years, 56% were older than 21 years and the age of the remaining 3% of vines sampled was unknown.

This document is confidential and any unauthorised disclosure is prohibited. Industry allocated project

number

Table 7. The geographic distribution of esca diseased vines in South Africa, the cultivars sampled and their age. Province District a Town Affected cultivars b

Western Cape Botriver Botrivier Chenin blanc (20, 23)

Calitzdorp, De Rust, Ladismith, Montagu, Chenin blanc (28, 38), Colombar (27), Fransdruif (33), Hanepoot (37), Merlot (3), Pinotage (29), Calitzdorp Oudtshoorn, Prins Albert Red Muscadel (31)

Cape Point Constantia Sauvignon blanc (18, 25)

Darling Darling Chenin blanc (21, 23)

Lutzville Valley Klawer, Lutzville Chenin blanc (41), Colombar (20), Fransdruif (35)

Overberg Grabouw Chardonnay (15), Sauvignon blanc (15)

Paarl Franschoek, Paarl, Wellington Cabernet sauvignon (13, 14), Chenin blanc (18, 20, 25, 40) Hanepoot (22)

Robertson Ashton, Bonnievale, Klaas Voogds Red Globe (10) c, Sauvignon blanc (20), Shiraz (30)

Cabernet sauvignon (15, 19, 31, 32), Chenin blanc (26), Hanepoot (12), Malbec (12), Pinotage (28), Stellenbosch Somerset West, Stellenbosch Ruby cabernet (22), Tinta barocca (28), Sauvignon blanc (16, 23, 25)

Piketberg, Porterville, Malmesbury, Riebeek Swartland Dan Ben Hannah (19), Chenin blanc (19, 20, 36), Colombar (15), Pinotage (36) Kasteel, Riebeeck Wes

Tulbagh Tulbagh Chenin blanc (24, 28)

Tygerberg Durbanville Chenin blanc (26, 34), Sauvignon blanc (23), Shiraz (21) Walker Bay Hermanus Chardonnay (21) c Worcester De Doorns, Rawsonville, Slanghoek Chenin blanc (11, 20), Hanepoot (40), Sultana (18) , Red Globe (9) Keboes, Keimoes, Kanon Eiland, Marchand, Northern Cape Chenin blanc (18), Colomino (18), Sultana (26, 40) * c Prieska

Limpopo Marken Prime seedless (5) c a Districts as described by South African Wine Industry Information and Systems (SAWIS) (Anonymous, 2010). b Cultivars affected by esca with the age of the sampled vines indicated in brackets. c Table grape cultivars. * Raisin cultivars; those which are not indicated are wine grapes. This document is confidential and any unauthorised disclosure is prohibited.

Industry allocated project

number

Esca foliar symptoms observed in the field Although extensive surveys of the same number of vineyards of the same age in each of the regions could not be conducted, symptoms typical to those described for esca were observed in several vineyards. External symptoms included foliar and berry symptoms, as well as apoplexy.

The first symptom observed in the beginning of each growing season was typical dieback, consisting of vine arms not producing any green shoots. Apoplexy, i.e. the sudden die-back and wilt in the hot summer months, was observed occasionally in vineyards 13 years of age and older.

Foliar symptoms, when present, appeared mainly in a short window period between the end of January and the end of March each year. Foliar symptoms (Fig. 1) observed in some vineyards included; 1) typical tiger stripe symptoms, as found in European vineyards, 2) general scorching on the leaves where eventual necrosis occurred, 3) and general vine decline symptoms which included smaller leaves, shoots with shortened internodes and stunted shoots. The tiger stripe symptoms included scorching on the edges of the leaf laminae and chlorosis along the leaf veins, with red grape cultivars showing reddish scorching along the edges of the leaves. White grape cultivars did not have this red tinge and leaf scorching appeared whitish in colour.

Examples of berry symptoms were also observed. Symptoms on red berries appeared as a pale discoloration and some shriveled berries. Symptoms on white berries appeared as black spots on the berries. This was only observed on one occasion on berries of a Hanepoot vine located in Stellenbosch.

A B

C D Figure 1. Tiger stripe foliar symptoms as observed in South Afica on red grapevine cultivars (A and B), a white grape cultivar (C) and leaf scorching (D).

This document is confidential and any unauthorised disclosure is prohibited.

Final report 25

Internal wood symptoms Five predominant symptom types were identified, and these included white rot, black and brown wood streaking, brown necrosis within the white rot, sectorial brown necrosis, and a brown/red margin next to decay often including black lines at the borders of decayed wood (Fig. 2). The white rot included areas which appeared white, yellow or yellow-orange, and ranged from spongy to hard in texture. Black and brown wood streaking took the form of brown to black dots in transverse sections that were either separate or clustered. These were assumed to be the same wood symptoms as recorded in Petri disease, the decline form described in new vineyards. The brown necrosis within the white rot was identified as brown to dark brown necrotic wood of a hard consistency where the necrotic areas were surrounded by white rot on all sides. The sectorial brown necrosis started from the below the bark and then progressed inwards sometimes taking on V-shapes. This sectorial necrosis appeared brown to dark brown. The brown, red or black margins next to decay appeared darker in colour than neighboring symptoms (especially when surrounding the sectorial necrosis).

Figure 2. Cross sections showing the internal symptoms and symptom types found in diseased vines: 1. White rot, usually central; 2. Black and brown wood streaking; 3. Brown necrosis within white rot; 4. Sectorial brown necrosis; 5. Brown, red or black margin next to decay.

Fungi associated with specific symptom types A stem section representative of all wood symptoms detected in each sampled vine was selected. A total of 24,715 isolations were made and 13,669 fungal isolates were obtained from the five symptom types associated with esca diseased vines in South Africa (Table 8). Basidiomycetes (4,695 isolates), Pa. chlamydospora (4,595) and Pm . aleophilum (2,386) were

This document is confidential and any unauthorised disclosure is prohibited. Final report 26

by far the most frequently isolated pathogens associated with these symptoms and represent 34.3, 33.6 and 17.5% of the total isolates obtained, respectively. Ten unknown basidiomycete species were identified (White et al ., 2011), four within the Inocutis group, four within Inonotus , one Phellinus and one new Fomitiporia sp. closely related to F. mediterranea . Other pathogens included Botryosphaeriaceae, other Phaeoacremonium spp., Eutypa lata , Phomopsis viticola , other Phomopsis spp. as well as Pleurostomophora richardsiae (Nannf.) L. Mostert, W. Gams & Crous. Most of the isolates were retrieved from the central brown/red margins of stem decay with or without black lines (5,257 isolates), white rot (4,554) and sectorial brown necrosis (2,405), followed by black and brown wood streaking (914) and brown necrosis within white rot (539). The number of isolates obtained for each taxon per symptom type is presented in Table 2.

The basidiomycetes, as expected, were the primary cause of the white rot (30.4%; Table 8). Phaeoacremonium aleophilum , Pa. chlamydospora and Phaeoacremonium spp. were also found in the white rot, but at much lower incidences (7.4%, 4.8% and 2.1%, respectively). It appeared that the first stage of the white rot was often orange in colour and hard in texture, which then progressed to become whiter and semi-spongy to spongy and soft. The development of symptom types could be seen in the differences between trunks of younger vines compared with older vines and sometimes within the same vine. In younger vines, the areas of the brown discoloured wood were often larger than the area of white rot, indicating that there could be a succession of infection and symptom development in the wood. White rot dominated over the other symptom types as wood degradation advanced.

Black and brown wood streaking was primarily caused by Pa. chlamydospora (45.4%). No Phomopsis species, Pl. richardsiae or Eutypa lata were found in this symptom and the other species occurred at a relatively low frequency (1.1% to 1.8 %).

From the brown necrosis within white rot, six taxa were isolated in the following frequencies: basidiomycetes (20.4%), Pm . aleophilum (15.9%), Pa. chlamydospora (13.6%), Botryosphaeriaceae (1.5%), Pl. richardsiae (1.1%) and E. lata (0.4%). Phomopsis spp. were not isolated from this symptom type.

The most predominant species isolated from the sectorial brown necrosis were Pa. chlamydospora (20.8%). Botryosphaeriaceae (10.7%), Pm . aleophilum (9.4%), E. lata (7.5%), basidiomycetes spp. (5.5%), Phomopsis viticola (6.3%). Phaeoacremonium spp. (1.2%), Phomopsis spp. (0.1%) and Pleurostomophora richardsiae (0.026%) comprised the rest of the species isolated from this type of symptom.

Phaeomoniella chlamydospora (29.1%) was the primary fungus that was isolated from the brown/red margins of decay with or without black lines next to decay, which appeared as the remains of brown discoloured necrotic wood observed in younger vines. The basidiomycetes (15.1%), Pm . aleophilum (13.6%), Phaeoacremonium spp. (2.5%), Botryosphaeriaceae (2.1%), Phomopsis viticola (1.5%), E. lata (1.1%) and Pleurostomophora richardsiae (0.01%) comprised the rest of the species isolated from this this symptom.

This document is confidential and any unauthorised disclosure is prohibited. Industry allocated project

number

Table 8. The total number of isolations and fungi isolated from each of the five symptom types associated with esca diseased vines collected in South Africa.

Isolated fungi a Total Total Symptom number number of type Basidiomycetes Phaeoacremonium Phaeoacremonium Phaeomoniella Phomopsis Phomopsis Eutypa Pleurostomophora of Botryosphaeriaceae b isolations species aleophilum spp. chlamydospora viticola spp. lata richardsiae isolates

4554 White rot 30.4 7.4 2.1 4.8 0.1 0 0.4 0.4 0.1 9944 (33.3) Brown, red or black 5257 15.1 13.6 2.5 29.1 1.5 0 2.1 1.1 0.01 8072 margin next (38.5) to decay Brown necrosis 539 20.4 15.9 1.4 13.6 0 0 1.5 0.4 1.1 992 within white (3.9) rot

Sectorial 2405 brown 5.5 9.4 1.2 20.8 6.3 0.1 10.7 7.5 0.03 3904 (17.6) necrosis

Black and 914 brown wood 1.8 1.4 1.1 45.4 0 0 1.1 0 0 1803 (6.7) streaking

Number of 430 4695 (19) 2386 (9.7) 491 (2) 4595 (18.6) 380 (1.5) 3 (0.1) 662 (2.7) 27 (0.1) 13669 24715 isolates b (1.7)

a The numbers represent the percentage of isolates of a specific fungus from the total number of isolations that was made from that symptom type. b The number in brackets represents the percentage of isolates retrieved from that symptom type.

This document is confidential and any unauthorised disclosure is prohibited.

Industry allocated project

number

Discussion Esca, as a complex of wood diseases that may also show typical foliar symptoms (Surico, 2009), occurs over a wide range of grapevine producing areas in South Africa. Esca was found in 31 production areas in the Western Cape, five production areas in the Northern Cape and in one production area in the Limpopo province on a range of cultivars of wine, table and raisin grapes. This illustrates the prominence of the disease in the country. Esca proper, where vine decay coexists with vascular disease showing typical leaf stripe symptoms (Surico, 2009), was only observed in a small number of vineyards.

In the present study, 95% of the esca diseased vines were from vineyards older than 10 years. This correlates with other studies, which have shown that higher incidences of disease were common in vines aged 10 years and older, very often in the more complex form of “esca proper”, where decay coexists with the vascular disease (Mugnai et al ., 1999; Reisenzein et al ., 2000; Surico et al ., 2006; Péros et al ., 2008; Romanazzi et al ., 2009).

External symptoms observed in a few South African vineyards were very similar to those found in Europe and other countries, including foliar, berry and apoplexy symptoms traditionally associated with the esca complex. Symptoms associated with “hoja de malvón”, where the leaves are smaller than normal, chlorotic and with the edges rolled downwards (Gatica et al ., 2000) were not observed . The recent observations made in South African vineyards were also consistent with external symptoms reported by Marais (1981) resembling tiger-stripes, apoplexy, dieback and decline of the vines. Apoplexy was rarely found in the present study, while general decline symptoms were much more prevalent. Measle-like berry symptoms were only found on one occasion. This observation differs with results from Europe, where tiger stripe symptoms are common (Mugnai et al ., 1999), but is similar to the situation in Australian vineyards, where foliar symptoms are also not common (Pascoe and Cottral, 2000). The typical tiger stripe symptoms, which as stated above were rarely found, were observed mainly in the same period as in the Northern Hemisphere, during full summer. These symptoms can sometimes be missed because of natural deterioration of the leaves due to unfavourable weather conditions like strong winds and high temperatures which are common during that particular time of the year. However, given the nature of this study where all the vineyards were not visited during the same time period, conclusions regarding the occurrence of various symptoms cannot be made.

The combination of fungal species in affected grapevine wood, their contribution to wood degradation, their interactions amongst each other and the toxins produced by the different species are all thought to play roles in symptom expression. This interaction, however, is not fully understood (Mugnai et al ., 1999; Stefanini et al ., 2000; Surico et al ., 2000a, 2000b; Surico et al ., 2006; Calzarano and Di Marco, 2007). External symptoms can also be influenced by vine age, farming practices, soil type, the slope of the land and the cultivar type (Surico et al ., 2000a), as well as environmental and seasonal factors (Mugnai et al., 1999). Expression of external symptoms have been found to be erratic or inconsistent since vines showing symptoms in one season might not show them the following season (Surico et al ., 2000b; Redondo et al ., 2001; Sofia et al ., 2006).

Species of the basidiomycetes, Botryosphaeriaceae, E. lata , Pm . aleophilum, other Phaeoacremonium spp., Pa. chlamydospora , Phomopsis viticola , other Phomopsis spp. as well as Pl. richardsiae were found in this study. Five symptom types were found including; white rot, black and brown wood streaking, brown necrosis within the white rot, sectorial brown necrosis, and brown/red margins with or without black lines next to decay. Internal symptoms observed, and the fungi isolated from each type, were similar to those observed in Europe and Argentina (Larignon and Dubos, 1997; Mugnai et al ., 1999; Gatica et al ., 2000; Pollastro et al ., 2000; Sofia et al ., 2006; Calzarano and Di Marco, 2007; Péros et al ., 2008; Sánchez-Torres et al ., 2008). Marais (1981) only reported internal symptoms of yellow rot surrounded by a black zone.

This document is confidential and any unauthorised disclosure is prohibited.

Final report 29

From the white rot symptom, basidiomycete species were, as expected, the most predominant species with low numbers of Pm . aleophilum and Pa. chlamydospora isolated in this study. Many other studies have shown that F. mediterranea was the main casual agent in the white rot of grapevine in Europe (Larignon and Dubos, 1997; Mugnai et al ., 1999; Pollastro et al ., 2000; Sofia et al ., 2006; Calzarano and Di Marco, 2007; Péros et al ., 2008; Sánchez-Torres et al ., 2008), while other basidyomycetes species are found in different grape growing areas (Fischer, 2006). Another basidiomycete species, Inocutis jamaicensis , was the most dominant species found in the soft decay associated with“hoja de malvón”-affected vines (Gatica et al ., 2000; Lupo et al ., 2006).

The role of Stereum hirsutum in esca is still unclear (Reisenzein et al ., 2000). This fungus was isolated from only 5% of the esca-affected vines investigated in France (Larignon and Dubos, 1997). The pathogen was believed to be the casual agent in South African esca diseased vines (Marais, 1981), probably following suggestions from early French literature reports. Stereum hirsutum was not isolated in the present study and therefore cannot be considered as a main esca-associated pathogen in South Africa.

The black and brown wood streaking observed was primarily caused by Pa. chlamydospora . This is consistent with other studies (Larignon and Dubos, 1997; Mugnai et al ., 1999; Pollastro et al ., 2000; Sofia et al., 2006; Calzarano and Di Marco, 2007; Péros et al ., 2008; Sánchez- Torres et al ., 2008). In the present study, basidiomycetes, Pm . aleophilum and species of Botryosphaeriaceae were also isolated from black and brown wood streaking, but below 2% for each species found. Gatica et al . (2000) mostly found Botryosphaeriaceae, followed by Pa. chlamydospora and Phaeoacremonium spp.

From the brown necrosis within the white rot, basidiomycetes, Pm . aleophilum and Pa. chlamydospora were isolated. The greatest number of fungal isolates from this symptom were the basidiomycetes (20%). Serra et al . (2000) isolated mostly sterile mycelium and Fomitiporia sp. from this symptom type. Even though basidiomycetes are more commonly associated with white rot, pathogenicity studies showed that basidiomycetes can also cause brown discolouration of grapevine wood during the first stages of colonisation (Sparapano et al ., 2001).

Phaeomoniella chlamydospora was the primary fungus isolated from the brown/red margins next to wood decay. Other studies have also found Phaeoacremonium spp., Pa. chlamydospora and the Botryosphaeriaceae in the black lines and within the brown discoloured wood (Larignon and Dubos, 1997; Mugnai et al ., 1999; Pollastro et al ., 2000; Serra et al ., 2000; Sofia et al ., 2006; Calzarano and Di Marco, 2007; Péros et al ., 2008; Sánchez-Torres et al ., 2008).

Phaeomoniella chlamydospora and species of Botryosphaeriaceae were the most numerous fungi isolated from the sectorial brown necrosis symptoms. This symptom type is likely to be the first to develop. Gatica et al . (2000) also found Pa. chlamydospora /Phaeoacremonium spp. and Botryosphaeriaceae, as well as I. jamaicensis from the corresponding zones in “hoja de malvón”-affected vines. Serra et al . (2000) isolated sterile mycelium, Sphaeropsis sp. (Botryosphaeriaceae), Phomopsis sp. and E. lata from the brown necrosis. In the present study, E. lata was rarely isolated (only 1.7 % of the total isolates) and predominantly from the sectorial brown necrosis. Eutypa lata was reported as a pioneer fungus pre-disposing the wood for colonization by the decay agent F. mediterranea (Larignon and Dubos, 1997). However, E. lata is likely to be the agent causing Eutypa dieback, a disease which has its own symptomology (Mugnai et al ., 1999). This fungus may simply be coincidental in vines infected by esca pathogens.

Members of the Botryosphaeriaceae are known to be associated with esca diseased vines (Mugnai et al ., 1999), but their role is unclear (Calzarano and Di Marco, 2007). In general, these fungi can be isolated from most of the symptom types associated with the esca complex

This document is confidential and any unauthorised disclosure is prohibited. Final report 30

(Larignon and Dubos, 1997; Mugnai et al ., 1999), although they are more frequently associated with sectorial necrosis (Van Niekerk et al ., 2006). As in the case of E. lata , they may be coincidentally present in affected vines, even if, when present, they could have an influence on foliar symptoms.

Phomopsis species, particularly Phomopsis viticola , have also been associated with grapevine trunk diseases (van Niekerk et al ., 2005). However, their role needs to be determined in esca diseased vines (Péros et al ., 2008). The majority of the Phomopsis isolates were isolated from sectorial brown necrosis, but they appeared to play a minor role due to low frequencies found in comparison with the other fungi. The Phomopsis spp. were only found in the sectorial brown necrosis. The Phomopsis spp. and Phomopsis viticola were not isolated in the black and brown wood streaking or in the brown wood streaking within white rot.

Pleurostomophora richardsiae was rarely found in the present study. This is a lesser known grapevine trunk disease pathogen that has been associated with vascular streaking (Halleen et al ., 2007), although its involvement in esca is unknown. The fungus has frequently been isolated from young diseased vines, specifically from around the pith areas in graft unions (Halleen and Groenewald, 2005).

Esca is more prominent and widespread in South Africa than previously recognized, and occurs in the three provinces where grapevine production dominates. External symptoms associated with the esca complex were observed in the field, and five internal symptom types in grapevine wood were identified. The external symptoms and the predominant fungi isolated were similar to those observed in Europe and the USA. The isolated fungi included basidiomycete species, Pa. chlamydospora and Phaeoacremonium spp. (mostly Pm . aleophilum ), confirming these taxa as the main causal organisms of esca diseased vines. Additionally, Phomopsis species, Botryosphaeriaceae and E. lata were also found, but to a lesser extent. It must be emphasized that this study was carried out with the aim of completing a wide survey of fungal pathogens, selecting vines showing the full range of internal symptoms (white rot and different types of discolouration), and therefore did not record the presence of symptomatic vines showing only the vascular disease. This aspect will be developed in future studies.

Literature cited Anonymous, 2010. Wine of Origin Production Areas . South African Wine Industry Information and Systems (SAWIS): http://www.sawis.co.za/cert/productionareas.php; Date Accessed: 20/10/2010. Armengol J., A. Vicent, L. Torné, F. García-Figueres and J. García-Jiménez, 2001. Fungi associated with esca and grapevine decline in Spain: a three-year survey. Phytopathologia Mediterranea 40, 325 ‒329. Bruno G. and L. Sparapano, 2006. Effects of three esca-associated fungi on Vitis vinifera L.: II. Characterization of biomolecules in xylem sap and leaves of healthy and diseased vines. Physiological and Molecular Plant Pathology 69, 195 ‒208. Bruno G., L. Sparapano and A. Graniti, 2007. Effects of three esca-associated fungi on Vitis vinifera L.: IV. Diffusion through the xylem of metabolites produced by two tracheiphilous fungi in the woody tissue of grapevine leads to esca-like symptoms on leaves and berries. Physiological and Molecular Plant Pathology 71, 106 ‒124. Calzarano F. and S. Di Marco, 2007. Wood discoloration and decay in grapevines with esca proper and their relationship with foliar symptoms. Phytopathologia Mediterranea 46, 96 ‒101. Chiarappa L., 1959. Wood decay of the grapevine and its relationship with black measles disease. Phytopathology 49, 510 ‒519. Crous P.W., W. Gams, M.J. Wingfield and P.S. Van Wyk, 1996. Phaeoacremonium gen. nov. associated with wilt and decline diseases of woody hosts and human infections. Mycologia 88, 786 ‒796.

This document is confidential and any unauthorised disclosure is prohibited. Final report 31

Crous P.W., B. Slippers, M.J. Wingfield, J. Rheeder, W.F.O. Marasas, A.J.L. Phillips, A. Alves, T. Burgess, P. Barber and J.Z. Groenewald, 2006. Phylogenetic lineages in the Botryosphaeriaceae . Studies in Mycology 55, 235 ‒253. Du Plessis S.J., 1947. Wingerdsiektes in Suid-Afrika . Pro Ecclesia-Drukkery, Stellenbosch, South Africa. Edwards J., G. Marchi and I. Pascoe, 2001. Young esca in Australia. Phytopathologia Mediterranea 40, S303 −S310. Fischer M., 2002. A new wood-decaying basidiomycete species associated with esca of grapevine: Fomitiporia mediterranea (Hymenochaetales). Mycological Progress 1 (3), 315 ‒324. Fischer M., 2006. Biodiversity and geographic distribution of basidiomycetes causing esca- associated white rot in grapevine: a worldwide perspective. Phytopathologia Mediterranea 45, S30 ‒S42. Fischer M. and M. Binder, 2004. Species recognition, geographic distribution and host-pathogen relationships: a case study in a group of lignicolous basidiomycetes, Phellinus s.l. Mycologia 96 (4), 799 ‒811. Fischer M. and H-M. Kassemeyer, 2003. Fungi associated with esca disease of grapevine in Germany. Vitis 42 (3), 109 ‒116. Galet P., 1977. Apoplexie. In: Les Maladies et les Parasites de la Vigne , Vol I. Imp. Paysan du Midi, Montpellier, France, 409 ‒430. Gatica M., B. Dubos and P. Larignon, 2000. The “hoja de malvón” grape disease in Argentina. Phytopathologia Mediterranea 39, 41‒45. Graniti A., G. Surico and L. Mugnai, 2000. Esca of grapevine: a disease complex or a complex of diseases. Phytopathologia Mediterranea 39, 16 ‒20. Gubler W.D., T.S. Thind, A.J. Feliciano and A. Eskalen, 2004. Pathogenicity of Phaeoacremonium aleophilum and Phaeomoniella chlamydospora on grape berries in California. Phytopathologia Mediterranea 43, 70 ‒74. Halleen F. and M. Groenewald, 2005. Grapevine diagnostic observations with special reference to trunk diseases. 15th Australasian Plant Pathology Society Conference, 26 ‒29 September 2005, Geelong, Australia, (abstract). Halleen F., L. Mostert and P.W. Crous, 2007. Pathogenicity testing of lesser known vascular fungi of grapevines. Australasian Plant Pathology 36, 277 ‒285. Larignon P. and B. Dubos, 1987. Les séquences parasitaires impliquées dans le syndrome de l’esca. Symposium sur la Lutte Intégrée en Viticulture. Logrono, Portugal, 3 ‒5 mars, 1987. Larignon P. and B. Dubos, 1997. Fungi associated with esca disease in grapevine. European Journal of Plant Pathology 103, 147 ‒157. Lupo S., L. Bettucci, A. Pérez, S. Martínez, C. Césari, G. Escoriaza and M. Gatica, 2006. Characterization and identification of the basidiomycetous fungus associated with ‘hoja de malvón’ grapevine disease in Argentina. Phytopathologia Mediterranea 45, S110 ‒S116. Marais P.G., 1981. Grapevine diseases and abnormalities. In: Wingerdbou in Suid Afrika . (J. Burger, J. Deist, ed.). Trio-Rand/S.A. Litho, Old Millweg, N’dabeni, South Africa, 404 ‒405. Martin M.T. and R. Cobos, 2007. Identification of fungi associated with grapevine decline in Castilla y León (Spain). Phytopathologia Mediterranea 46, 18 ‒25. Mugnai L., A. Graniti and G. Surico, 1999. Esca (black measles) and brown wood-streaking: two old and elusive diseases of grapevines. Plant Disease 83 (5), 404 ‒418. Pascoe I. and E. Cottral, 2000. Developments in grapevine trunk disease research in Australia. Phytopathologia Mediterranea 39, 68 ‒75. Perold A.I., 1926. Handboek Oor Wynbou . Pro Ecclesia-Drukkery, Stellenbosch, South Africa. Péros J.-P., G. Berger and I. Jamaux-Despréaux, 2008. Symptoms, wood lesions and fungi associated with esca in organic vineyards in Languedoc-Roussillon (France). Journal of Phytopathology 156, 297 ‒303.

This document is confidential and any unauthorised disclosure is prohibited. Final report 32

Petit A.-N., N. Vaillant, M. Boulay, C. Clément and F. Fontaine, 2006. Alteration of photosynthesis in grapevines affected by esca. Phytopathology 96, 1060 ‒1066. Pollastro S., C. Dongiovanni, A. Abbatecola and F. Faretra, 2000. Observations on the fungi associated with esca and on a spatial distribution of esca-symptomatic plants in Apulian (Italy) vineyards. Phytopathologia Mediterranea 39, 206 ‒210. Redondo C., M.L. Tello, A. Avila and E. Mateo-Sagasta, 2001. Spatial distribution of symptomatic grapevines with esca disease in Madrid region (Spain). Phytopathologia Mediterranea 40, S439 ‒S442. Reisenzein H., N. Berger and G. Nieder, 2000. Esca in Austria. Phytopathologia Mediterranea 39, 26 ‒34. Romanazzi G., S. Murolo, L. Pizzichini and S. Nardi, 2009. Esca in young and mature vineyards, and molecular diagnosis of the associated fungi. European Journal of Plant Pathology 125, 277 ‒290. Rumbos I. and A. Rumbou, 2001. Fungi associated with esca and young grapevine decline in Greece. Phytopathologia Mediterranea 40, S330 ‒S335. Sánchez-Torres P., R. Hinarejos, V. González and J.J. Tuset, 2008. Identification and characterization of fungi associated with esca in vineyards of the Comunidada Valencia (Spain). Spanish Journal of Agricultural Research 6 (4), 650 ‒660. Serra S., M. Borgo and A. Zanzotto, 2000. Investigation into the presence of fungi associated with esca of young vines. Phytopathologia Mediterranea 39, 21 ‒25. Sofia J., T. Gonçalves and H. Oliveira, 2006. Spatial distribution of esca symptomatic plants in Dão vineyards (Centre Portugal) and isolation of associated fungi. Phytopathologia Mediterranea 45, S87 ‒S92. Sparapano L., G. Bruno and A.Graniti, 2001. Three-year observation of grapevines cross- inoculated with esca-associated fungi. Phytopathologia Mediterranea 40, S375 ‒S386. Stefanini F.M., G. Surico and G. Marchi, 2000. Longitudinal analysis of symptom expression in grapevines affected by esca. Phytopathologia Mediterranea 39, 225 ‒231. Surico G., 2001. Towards commonly agreed answers to some basic questions on esca. Phytopathologia Mediterranea 40, S487 ‒S490. Surico G., 2009. Towards a redefinition of the diseases within the esca complex of grapevine. Phytopathologia Mediterranea 48, 5 ‒10. Surico G., G. Marchi, P. Braccini and L. Mugnai, 2000a. Epidemiology of esca in some vineyards in Tuscany (Italy). Phytopathologia Mediterranea 39, 190 ‒205. Surico G., G. Marchi, F.J. Ferrandino, P. Bracchine and L. Mugnai, 2000b. Analysis of the spatial spread of esca in some Tuscan Vineyards (Italy). Phytopathologia Mediterranea 39, 211 ‒224. Surico G., L. Mugnai and G. Marchi, 2006. Older and more recent observations on esca: a critical overview. Phytopathologia Mediterranea 45, S68 ‒S86. Tabacchi R., A. Fkyerat, C. Poliart and G-M. Dubin, 2000. Phytotoxins from fungi of esca of grapevine. Phytopathologia Mediterranea 39, 156 ‒161. Van Niekerk J.M., J.Z. Groenewald, D.F. Farr, P.H. Fourie, F. Halleen and P.W. Crous, 2005. Reassessment of Phomopsis species on grapevines. Australasian Plant Pathology 34, 27 ‒39. Van Niekerk J.M., P.H. Fourie, F. Halleen and P.W. Crous, 2006. Botryosphaeria spp. as grapevine trunk disease pathogens. Phytopathologia Mediterranea 45, S43 ‒S54. Viala P., 1926. Recherches sur les maladies de la vigne. Esca. Annales des Epiphyties Fasc . 12, 1 ‒108. White C., F. Halleen, M. Fischer and L. Mostert, 2011. Characterisation of the fungi associated with esca diseased grapevines in South Africa. Phytopathologia Mediterranea 50, Supplement, 204 ‒223.

This document is confidential and any unauthorised disclosure is prohibited. Final report 33

Milestone 2: Characterisation of the fungi associated with esca diseased grapevines in South Africa

Phenotypic characterization The growth patterns of the Phaeoacremonium isolates are reported in Table 9. The colony textures were in most cases felty on MEA and PDA, and woolly on OA. Some variation in colony color were observed among the isolates of P. aleophilum , P. alvesii L. Mostert, Summerb. & Crous , P. iranianum L. Mostert, Gräfenhan, W. Gams & Crous and P. parasiticum (Ajello, Georg & C.J.K. Wang) W. Gams, Crous & M.J. Wingf, but in general were similar to the respective species. Conidial dimensions were measured for 17 isolates representing the different cultural growth patterns. The shape of the aerial conidia was similar to that reported for the respective species (Mostert et al . 2006; Essakhi et al . 2008). The conidia of P. aleophilum isolates were mostly oblong-ellipsoidal or cylindrical, occasionally reniform; for P. alvesii conidia were mainly ovoid or oblong-ellipsoidal and sometimes reniform to allantoid; conidia of P. iranianum and P. mortoniae Crous & W. Gams were oblong-ellipsoidal but P. mortoniae were sometimes reniform; the conidia of P. parasiticum were mostly oblong-ellipsoidal and sometimes allantoid to broadly oblong and conidia of P. sicilianum Essakhi, Mugnai, Surico & Crous were mainly allantoid, with some being subcylindrical. The conidial sizes were not a distinguishing feature due to the overlap among the different Phaeoacremonium species.

Only seven isolates of Phomopsis formed pycnidia. The alpha conidial size and shape were similar to that of Phomopsis viticola (Mostert et al . 2001). Identification of the other isolates was done with the phylogenetic analysis.

The colony growth of the 18 Botryosphaeriaceae isolates varied from pale grey to dark grey or olivaceous coloured and the colony textures were mostly woolly. The colony colour of Diplodia seriata De Not isolates included pale mouse grey (15'''''d) to mouse grey (13'''''i), olivaceous grey (21'''''i) or pale olivaceous grey (21'''''d). Neofusicoccum parvum (Pennycook & Samuels) Crous, Slippers & A.J.L. Phillips isolates had pale olivaceous grey colonies. Four isolates of D. seriata and one of N. parvum formed pycnidia. Conidia of N. parvum were hyaline, aseptate and measured (13 −)15 −18( −19) × 6−8 µm, while those of D. seriata were brown and aseptate with the inner walls appearing rough in texture and measured (20 −)22 −25 x (8 −)9 −10( −12) µm.

The basidiomycete isolates were grouped into 15 cultural growth patterns reported in Table 10. Variable colony characters occurred within several of the taxa. Colony colour did not always remain the same after subculturing. The different taxa, as determined by the phylogenetic analysis, comprised of various cultural growth patterns. However, Taxa 7 and 8 were distinctly only orange-brown in colour with fluffy mycelial growth. Colony diameters were measured for selected isolates of each taxon (Table 11). Taxon 4 was the slowest growing taxon with a colony diameter ranging from 29 to 41 mm after 14 days. Taxon 7 was also slow growing (45 to 57 mm in diameter), but overlapped with the growth ranges of Taxon 1, Taxon 5 and Fomitiporia sp.

Phaeomoniella chlamydospora isolates were identified on the basis of their distinct olive green to white yeast-like growth on PDA, pigmented conidiophores and small oblong-ellipsoidal conidia (Crous and Gams, 2000). The cultures of Ph . chlamydospora were not characterized further since previous studies have shown that only one species, which has very little variation, occurs on grapevine (Mostert et al., 2006a; Pottinger et al ., 2002).

Isolates of Eutypa was identified by the typical white to cream, cottony slow-growing colonies on PDA lacking fruit bodies.

This document is confidential and any unauthorised disclosure is prohibited. Final report 34

Table 9. Cultural growth characteristics of Phaeoacremonium isolates grown on malt extract agar (MEA), potato dextrose agar (PDA) and oatmeal agar (OA). Radial growth Colony colour 1 after 8 days Number of Species (mm) isolates MEA PDA OA MEA

Greyish Sepia Smoke grey Vinaceous P. aleophilum 14 5 - 10 (15'''i) (21''''f) buff (17'''d)

Pale mouse P. aleophilum 1 Isabelline (17''i) Greyish sepia 5 grey (15'''''d)

Dark mouse grey Isabelline P. aleophilum 1 (13'''''K) with Smoke grey 13 (17''i) yellow pigment

Venacious purple Pale Fawn (13'''); P. alvesii 4 (65'''b); Pale venacious; Venacious 10 - 14.5 venacious (5'''f) buff (19''f) purple (65'''b)

P. alvesii 1 Buff Buff Greyish sepia 10

P. iranianum 1 Buff Buff Buff 8.5

P. iranianum 1 Venacious buff Greyish sepia Smoke grey 13

Buff yeast P. mortoniae 1 Buff Buff 12 like growth

Pale purplish grey Pale mouse P. parasiticum 3 Greyish sepia 12 (1''''d) grey

Venacious buff Mouse grey P. parasiticum 3 Greyish sepia 12 mixed with buff (13''''')

Venacious buff Pale mouse P. sicilianum 6 mixed with Pale Greyish sepia 12 - 14 grey mouse grey

Pale mouse P. sicilianum 2 Pale mouse grey Greyish sepia 13.5 grey

1Colony colour descriptions according to Rayner (1970).

This document is confidential and any unauthorised disclosure is prohibited. Industry allocated project

number

Table 10 . Description of the cultural growth patterns of the basidiomycete isolates after 4 weeks on PDA.

Taxa STE-U number Origin Cultural growth patterns

7038; 7039; 7045; 7046; 7047; 7048; 7051; 7058; 7059; Ashton; Bonnievale; Constantia; De Cotton white/ pale yellow; Flat brown; Flat orange-yellow; Flat 7060; 7061; 7062; 7063; 7064; 7065; 7066; 7067; 7070; Doorns; De Rust; Durbanville; Klawer; white/ pale yellow (cream); Fluffy cream with dark mycelial 7071; 7073; 7074; 7075; 7078; 7079; 7080; 7083; 7084; Lutzville; Malmesbury; Montagu; Paarl; strands; Slow growing clear shades of brown with sparse 1 7088; 7092; 7107; 7110; 7112; 7113; 7117; 7118; 7120; Piketburg; Porterville; Rawsonville; mycelium; Sparse white; Speckled white/ yellow/ brown; Tufty 7120; 7123; 7130; 7141; 7142; 7144; 7145; 7146; 7148; Riebeeck Kasteel; Slanghoek; Somerset orange/ brown; Tufty white; White brown/ radiating growth 7149; 7150; 7151; 7152; 7156; 7157; 7158; 7159; 7160; West; Stellenbosch; Tulbagh streaky growth; Woolly light brown; Woolly sparse white 7161; 7162; 7172; 7175; 7176

2 7147; 7154; 7155 Oudtshoorn; Calitzdorp Flat orange-yellow; Speckled white/yellow/ brown

Flat white/ pale yellow (cream); Slow growing shades of brown 3 7109; 7136; 7174; 7178 Ashton; Constantia; Grabouw; Montagu with sparse mycelium; Wooly light brown; Woolly sparse white

Flat various yellow/ brown/ white tones; Slow growing clear 4 7042; 7043 Stellenbosch shades of brown with sparse mycelium

7125; 7126; 7127; 7128; 7129; 7131; 7132; 7143; 7153; Darling; Ladismith; Malmesbury; Cotton white/ pale yellow; Flat brown; Flat orange-yellow; Flat 5 7177 Montagu; Tulbagh white/ pale yellow (cream); Speckled white/ yellow/ brown

6 7133; 7134 Malmesbury Flat brown; Speckled white/ yellow/ brown Constantia; Franschhoek; Somerset 7 7076; 7090; 7106; 7165; 7173 Fluffy orange-brown West; Stellenbosch 8 7138; 7139 Botrivier Fluffy orange-brown

Botrivier; Constantia; Darling; 7040; 7041; 7049; 7050; 7052; 7053; 7056; 7057; 7069; Durbanville; Franschhoek; Grabouw; Flat brown; Flat various yellow/ brown white tones; Flat white/ 7072; 7077; 7081; 7082; 7086; 7093; 7094; 7095; 7096; Fomitiporia Hermanus; Klaas voogds; Paarl; Riebeek pale yellow (cream); Speckled white/ yellow/ brown; Tufty 7097; 7108; 7115; 7119; 7121; 7122; 7124; 7135; 7137; Wes; Somerset West; Stellenbosch; orange/ brown; Woolly light brown 7140; 7163; 7164; 7166; 7167; 7168; 7169; 7170; 7171 Wellington

7055; 7098; 7099; 7100; 7101; 7102; 7103; 7104; 7105; Kanon Eiland; Keboes; Keimoes; Flat brown; Speckled white/ yellow/ brown; Tufty orange/ Phellinus 7179; 7180 Marchand; Marken; Prieska brown

This document is confidential and any unauthorised disclosure is prohibited.

Industry allocated project

number

Table 11 . Colony diameter of the basidiomycete isolates grown on PDA at 25 oC after 14 days.

STE-U number Taxa Average diameter (mm)

7038 1 75 ± 2 7058 52 ± 7 7084 60 ± 15 7141 63 ± 17 7148 70 ± 15 7147 2 85 ± 0 7154 83 ± 3 7155 85 ± 0 7109 3 80 ± 1 7136 72 ± 10 7174 63 ± 1 7042 4 41 ± 2 7043 29 ± 22 7126 5 43 ± 6 7143 51 ± 4 7153 70 ± 6 7133 6 85 ± 0 7134 78 ± 2 7090 7 45 ± 2 7106 51 ± 4 7165 57 ± 3 7138 8 85 ± 0 7139 71 ± 7 7069 Fomitiporia sp. 46 ± 14 7096 65 ± 23 7122 85 ± 0 7135 77 ± 2 7168 83 ± 2 7055 Phellinus sp. 79 ± 2 7098 85 ± 0 7105 85 ± 0

This document is confidential and any unauthorised disclosure is prohibited.

Final report 37

Phylogenetic analyses The combined TUB and ACT alignment of the Phaeoacremonium isolates included 1042 nucleotides of which 508 nucleotides were parsimony-informative. A maximum parsimony analysis was conducted and isolates were grouped in well supported clades with known Phaeoacremonium species (Fig. 3). Five of the isolates grouped with P. aleophilum sequences, three isolates with P. sicilianum sequences, two isolates with P. iranianum sequences , two isolates with P. parasiticum sequences and one isolate with P. mortoniae sequences all with a bootstrap support of 100 %. Four isolates grouped in the P. alvesii clade with a bootstrap support of 75 %.

The parsimony analysis for the Phomopsis isolates included 494 nucleotides of which 111 were parsimony-informative. Fourteen of these isolates were identified as Phomopsis viticola , as they grouped with the reference sequences with a bootstrap support of 100 % (Fig. 4). Two isolates grouped with Phomopsis theicola with a bootstrap support of 71 %. One isolate grouped with Diaporthe ambigua Nitschke with a bootstrap support of 100 %.

The EF and ITS alignment of the Botryosphaeriaceae included 559 nucleotides of which 391 were parsimony-informative. Diplodia seriata was the most predominant species found and seven isolates grouped with the reference sequences with a bootstrap support of 63 % (Fig. 5). Five isolates grouped with reference sequences of Neofusicoccum australe (Slippers, Crous & M.J. Wingf.) Crous, Slippers & A.J.L. Phillips with a bootstrap support of 99 %. Six isolates grouped with isolates of N. parvum with a bootstrap support of 100 %.

The ITS alignment of the 134 basidiomycete isolates included 931 nucleotides of which 548 were parsimony-informative. The sequences grouped into eight well supported monophyletic clades (Taxa 1 to 8) of which the genus identity is uncertain (Fig. 6). Two clades clustered with the genera Phellinus and Fomitiporia . Taxa 1, 2, 3, 4, 5, 7, 8, Phellinus sp. and Fomitiporia sp. each had a bootstrap support of 100 %. Taxon 6 had a bootstrap support of 82 %. Taxa 1 to 4 grouped with Fomitiporella cf. and Inocutis cf. and Taxa 5 to 8 grouped with Inonotus . Taxon 1 represented 42 % of the basidiomycete isolates, followed by Fomitiporia, which comprised 25 % of the isolates. Phellinus was the next largest taxon (8 %) followed by taxon 5 (7 %), taxon 7 (4 %), taxon 3 (3 %) and taxon 2 (2 %). Taxa 4, 6 and 8 occurred the least and each comprised 1 % of the isolates. The majority of basidiomycete taxa included isolates from different regions and was not restricted to a specific location. Four taxa were restricted to a specific locality. Taxon 4 came only from Stellenbosch, taxon 6 from Malmesbury and taxon 8 from Botrivier, however, only two isolates of each were found. Phellinus sp. isolates were all obtained from Keimoes, Kanon Eiland, Prieska, Marchand and Upington (Northern Cape) and Marken in Limpopo. In a few cases up to three basidiomycete taxa were found within one plant.

The identity of the nine Eutypa isolates was determined by Safodien (2007) as E. lata with ITS phylogenic analysis.

This document is confidential and any unauthorised disclosure is prohibited. Final report 38

This document is confidential and any unauthorised disclosure is prohibited. Final report 39

This document is confidential and any unauthorised disclosure is prohibited. Final report 40

This document is confidential and any unauthorised disclosure is prohibited. Final report 41

This document is confidential and any unauthorised disclosure is prohibited. Final report 42

This document is confidential and any unauthorised disclosure is prohibited. Final report 43

Discussion Different fungi are associated with esca diseased vines in South Africa. These fungi include species of basidiomycetes and Botryosphaeriaceae , Eutypa lata, Phaeoacremonium spp. , Phaeomoniella chlamydospora and Phomopsis spp.

Six species of Phaeoacremonium were isolated and include P. aleophilum, P . alvesii, P . iranianum, P . mortoniae , P. parasiticum and P. sicilianum . There are 25 species of Phaeoacremonium world-wide that have been isolated from either Petri diseased or esca grapevines (Crous et al ., 1996; Mostert et al ., 2006b; Essakhi et al ., 2008; Graham et al ., 2009; Gramaje et al ., 2009). Phaeoacremonium aleophilum is the most common species on grapevines (Crous et al ., 1996; Mostert et al ., 2006b), followed by P. parasiticum (Mostert et al ., 2006b), which has also been confirmed in this study. In South Africa, P. aleophilum , P. austroafricanum , P. krajdenii , P. parasiticum , P. scolyti , P. subulatum , P. viticola and P. venezuelense have previously been isolated from grapevines (Mostert et al ., 2006b). This is the first report of P. mortoniae , P. iranianum and P. sicilianum in South Africa.

In the current study, Phomopsis viticola , Phomopsis theicola , and Diaporthe ambigua were found to be associated with esca. Van Niekerk et al . (2005) showed that 15 Phomopsis species occur on grapevines in South Africa. Of these, Phomopsis viticola is commonly found on grapevines and is associated with Phomopsis cane and leaf blight (Mostert et al ., 2001; van Niekerk et al ., 2005). Phomopsis theicola , previously known as Phomopsis sp. 1 (Santos and Phillips, 2009), has a wider host range, including Protea sp., Pyrus sp. and Prunus sp. (Mostert et al ., 2001; van Niekerk et al ., 2005). Diaporthe ambigua rarely occurs on grapevine and is more commonly associated with cankers on Malus sp., Prunus sp. and Pyrus sp. (Smit et al ., 1996; Crous et al ., 2000; van Niekerk et al . 2005).

Three species of the Botryosphaeriaceae, namely D. seriata , N. parvum and N. australe , were found associated with esca symptoms. However, twelve species of the Botryosphaeriaceae have previously been isolated from grapevines in South Africa (van Niekerk et al ., 2004, 2006, 2010). Of these, D. seriata, Neofusicoccum parvum (Crous et al ., 2006) and Lasiodiplodia theobromae were the most common (van Niekerk et al ., 2003, 2004). Neofussiccocum australe (Crous et al ., 2006) was also commonly found and was the most pathogenic species on South African grapevines (van Niekerk et al ., 2004). Lasiodiplodia crassispora was recently identified from grapevines and found to be highly pathogenic (van Niekerk et al., 2010). Several species of the Botryosphaeriaceae, including Diplodia seriata , N. parvum and N. austral , are associated with grapevines in other countries, such as Australia, USA (California), Portugal and Spain (Phillips, 2002; Taylor et al ., 2005; Sánchez-Torres et al ., 2008; Úrbez-Torrez et al ., 2006).

The phylogeny of the EF and ITS region gave low bootstrap support for D. seriata (63 %). Other analyses have also shown low bootstrap support for Diplodia species. In a study using only the ITS region no support was found for the D. pinea clade, which grouped basal to D. seriata and D. scrobiculata (Phillips et al ., 2007). The combined EF and ITS analysis of Damm et al . (2007) also gave low bootstrap support for the D. seriata (67 %) and D. pinea clades (62 %). Diplodia pinea , D. scrobiculata and D. seriata are phylogenetically closely related and also share morphological features namely, aseptate conidia that become pigmented within the pycnidium (Phillips et al ., 2007).

Phaeomoniella chlamydospora is frequently associated with esca-diseased vines or declining grapevines worldwide (Mostert et al ., 2006a). In the current study, Ph . chlamydospora was commonly associated with esca diseased vines. Even though Ph . chlamydospora has recently been isolated from a weed that can be found in vineyards, Convolvulus arvensis (Agustí-Brisach et al. 2011), has it not yet been isolated from other woody host. Six additional species of Phaeomoniella have been found on other hosts. Phaeomoniella zymoides and Ph . pinifoliorum

This document is confidential and any unauthorised disclosure is prohibited. Final report 44

have been found on pine needles (Lee et al ., 2006). Phaeomoniella dura , P. effusa , P. prunicola , P. tardicola and Ph . zymoides have been found on Prunus spp. trees in South Africa (Damm et al ., 2010).

Genera of the Diatrypaceae that occur on grapevines include Cryptosphaeria , Cryptovalsa , Diatrype , Diatrypella , Eutypa and Eutypella (Trouillas et al ., 2010). In South Africa Cryptovalsa ampelina , Eutypa lata , Eutypa leptoplaca and Eutypella vitis have been found on grapevines (Mostert et al ., 2004; Safodien, 2007). In the present study, only Eutypa lata was found to be associated with esca symptoms (Safodien, 2007). Eutypa lata has also been found on esca diseased vines in Italy, Germany, Spain and France (Mugnai et al ., 1999; Fischer and Kassemeyer, 2003; Martin and Cobos, 2007; Péros et al ., 2008).

Ten different basidiomycete taxa, not corresponding with known species, were found in the current study. Two taxa could be linked to the genera of Fomitiporia and Phellinus . The other taxa could possibly be species of Inonotus or Inocutis . Two of the taxa, Fomitiporia sp. and taxon 1, contained the majority of the basidiomycete isolates. Phylogenetic species recognition using the ITS region was used to identify the different taxa (Fischer and Binder, 2004; Sánchez- Torres et al ., 2008). For formal description of these phylogenetic taxa, the basidiocarps need to be linked to the sequence identity. Only a few basidiocarps were found in the current study (not reported) and will be used in further work to establish the identity of these 10 taxa.

A diversity of basidiomycete fungi causing white rot have been found from grapevines and include, Armillaria mellea , Flammulina velutipes , Pleurotus pulmonarius , Inonotus hispidus , Stereum hirsutum , Trametes hirsuta , Trametes versicolor (Fischer and Kassemeyer, 2003). Peniophora incarnata and Hirneola aruculae-judae have also been found on grapevines, but their association with white rot is uncertain (Fischer and Kassemeyer, 2003). However, the diversity of basidiomycete taxa found from esca diseased vines is generally less and taxa are often restricted to a specific area. Fomitiporia mediterranea is the most common species in Europe (Fischer, 2006). Fomitiporia australiensis together with two unknown taxa is restricted to Australia and F. polymorpha to North America (Fischer, 2005; 2006). Inocutis jamaicensis (Murrill) Gottlieb, J.E. Wright & Moncalvo and Fomitiporella vitis Auger, Aguilera & Esterio (no formal description of this species have been published), associated with ‘hoja de malvon’ and chlorotic leaf roll, respectively, occur on grapevines in South America (Fischer, 2006; Lupo et al ., 2006). Stereum hirsutum (Willd.: Fr.) Pers. has sometimes been isolated from esca diseased vines in Europe (Larignon and Dubos, 1997; Martin and Cobos, 2007; Sánchez-Torres et al ., 2008), however, its role within the esca complex is uncertain. The perception that basidiomycetes are not a threat to grapevines has limited the research on basidiomycetes associated with esca (Fischer, 2006).

In the present study, ten basidiomycete taxa were found, possibly due to the wide area of investigation which consisted of different climatic regions. Most of the taxa were found in the Western Cape Province. Stellenbosch had the highest diversity, with four taxa present (taxa 1, 4, 7 and Fomitiporia sp.). However, this could be due to the bias in number of samples analyzed from this location. Some of the taxa were restricted to a specific area. In the Northern Cape or Limpopo provinces, which are known for their warmer climate, only Phellinus sp. (11 isolates) was found. These areas were also geographically isolated from the other grapevine production areas in the Western Cape. Taxon 2 (three isolates) was only found in Oudtshoorn and Calitzdorp, which is about 400 km from the Cape Peninsula.

In South Africa esca of grapevines is associated with different fungi, including 10 basidiomycete taxa, Phaeomoniella chlamydospora and Phaeoacremonium spp. Additionally Eutypa lata , three species of Phomopsis spp. and three species of the Botryosphaeriaceae were also found. Pathogenicity studies on field grapevines are underway to assess the relevance of the different basidiomycete taxa. Knowledge regarding the fungi associated with esca diseased vines will aid

This document is confidential and any unauthorised disclosure is prohibited. Final report 45

in further research to understand the co-occurrence and the role of the different trunk disease fungi in grapevines.

Literature cited Armengol J., A. Vicent, L. Torné, F. García-Figueres and J. García-Jiménez, 2001. Fungi associated with esca and grapevine decline in Spain: a three-year survey. Phytopathologia Mediterranea 40, 325-329. Agustí-Brisach C., Gramaje D., León M., García-Jiménez J. and J. Armengol, 2011. Evaluation of vineyard weeds as potential hosts of black foot and Petri disease pathogens. Plant Disease 95: 803-810. Calzarano F. and S. Di Marco, 2007. Wood discoloration and decay in grapevines with esca proper and their relationship with foliar symptoms. Phytopathologia Mediterranea 46, 96- 101. Carbone I. and L.M. Kohn, 1999. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 91, 553-556. Chiarappa L., 1959. Wood decay of the grapevine and its relationship with black measles disease. Phytopathology 49, 510-519. Clark T.A. and J.B. Anderson, 2004. Dikaryons of the basidiomycete fungus Schizophyllum commune evolution in long-term culture. Genetics 167, 1663-1675. Crous P.W. and W. Gams, 2000. Phaeomoniella chlamydospora gen. et comb. nov., a casual organism of Petri grapevine decline and esca. Phytopathologia Mediterranea 39, 112- 118. Crous P.W., W. Gams, M.J. Wingfield and P.S. van Wyk, 1996. Phaeoacremonium gen. nov. associated with wilt and decline diseases of woody hosts and human infections. Mycologia 88, 786-796. Crous P.W., A.J.L. Phillips and A.P. Baxter, 2000. Phytopathogenic fungi from South Africa. University of Stellenbosch Printers, Stellenbosch, 358 pp. Crous P.W., B. Slippers, M.J. Wingfield, J. Rheeder, W.F.O. Marasas, A.J.L. Phillips, A. Alves, T.Burgess, P. Barber and J.Z. Groenewald, 2006. Phylogenetic lineages in the Botryosphaeriaceae. Studies in Mycology 55, 235-253. Damm U., P.W. Crous and P. Fourie, 2007. Botryosphaeriaceae as potential pathogens of Prunus species in South Africa, with descriptions of Diplodia africana and Lasiodiplodia plurivora sp. nov. Mycologia 99, 664-680. Damm U., P.H. Fourie and P.W. Crous, 2010. Coniochaeta (Lecythophora ), Collophora gen nov. and Phaeomoniella species associated with wood necroses of Prunus trees. Persoonia 24, 60-80. Damm U., L. Mostert, P.W. Crous and P.H. Fourie, 2008. Novel Phaeoacremonium species associated with necrotic wood of Prunus trees. Persoonia 20, 97-102. Essakhi S., L. Mugnai, P.W. Crous, J.Z. Groenewald and G. Surico, 2008. Molecular and phenotypic characterization of novel Phaeoacremonium species associated with Petri disease and esca of grapevine. Persoonia 21, 119-134. Fischer M., 2002. A new wood-decaying basidiomycete species associated with esca of grapevine: Fomitiporia mediterranea (Hymenochaetales). Mycological Progress 1, 315- 324. Fischer M., 2006. Biodiversity and geographic distribution of basidiomycetes causing esca- associated white rot in grapevine: a worldwide perspective. Phytopathologia Mediterranea 45, S30-S42. Fischer M. and M. Binder, 2004. Species recognition, geographic distribution and host-pathogen relationships: a case study in a group of lignicolous basidiomycetes, Phellinus s.l. Mycologia 96, 799-811. Fischer M., J. Edwards, J.H. Cunnington and I.G. Pascoe, 2005. Basidiomycetous pathogens on grapevine: a new species from Australia – Fomitiporia australiensis . Mycotaxon 92, 85-96.

This document is confidential and any unauthorised disclosure is prohibited. Final report 46

Fischer M. and H-H. Kassemeyer, 2003. Fungi associated with esca disease of grapevine in Germany. Vitis 42, 109-116. Glass N. and G. Donaldson, 1995. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Applied and Environmental Biology 61, 1323-1330. Glawe D. A., and J. D. Rodgers, 1982. Observations on the anamorphs of six species of Eutypa and Eutypella . Mycotaxon 14, 334-346. Graham A.B., P.R. Johnston and B.S. Weir, 2009. Three new Phaeoacremonium species on grapevine in New Zealand. Australasian Plant Pathology 38, 505-513. Gramaje D., J. Armengol, H. Mohammadi, Z. Banihashemi and L. Mostert, 2009. Novel Phaeoacremonium species associated with Petri disease and esca of grapevine in Iran and Spain. Mycologia 101, 920-929. Groenewald M., J. Kang, P.W. Crous and W. Gams, 2001. ITS and β-tubulin phylogeny of Phaeoacremonium and Phaeomoniella species. Mycological Research 105, 651-657. Katoh K., K. Misawa, K. Kuma and T. Miyata, 2002. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Research 30, 3059- 3066. Larignon P. and B. Dubos, 1997. Fungi associated with esca disease in grapevine. European Journal of Plant Pathology 103, 147-157. Lee H.B., J.Y. Park, H.S. Jung and R.C. Summerbell, 2006. Two new Phaeomoniella species: Phaeomoniella zymoides and Phaeomoniella pinifoliorum spp. nov., new acid-tolerant epiphytic fungi isolated from pine needles in Korea. Mycologia 98, 598-611. Lupo S., L. Bettucci, A. Pérez, S. Martínez, C. Césari, G. Escoriaza and M. Gatica, 2006. Characterization and identification of the basidiomycetous fungus associated with ‘hoja de malvón’ grapevine disease in Argentina. Phytopathologia Mediterranea 45, S110- S116. Martin M.T. and R. Cobos, 2007. Identification of fungi associated with grapevine decline in Castilla y León (Spain). Phytopathologia Mediterranea 46, 18-25. Marais P.G., 1981. Grapevine diseases and abnormalities. pp. 404-405. In: “Wingerdbou in Suid Afrika”. Ed. J. Burger and J. Deist. Mostert L., E.C.A. Abeln, F. Halleen and P.W. Crous, 2006a. Genetic diversity among isolates of Phaeomoniella chlamydospora on grapevines. Australasian Journal of Plant Pathology 35, 453-460. Mostert L., P.W. Crous, J-C. Kang and A.J.L. Phillips, 2001. Species of Phomopsis and a Libertella sp. occurring on grapevines with specific reference to South Africa: morphological, cultural, molecular and pathological characterization. Mycologia 93, 146- 167. Mostert L., F. Halleen, P.W. Crous and M.L. Creaser, 2004. Cryptovalsa ampelina , a forgotten shoot and cane pathogen of grapevines. Australasian Journal of Plant Pathology 33, 295-299. Mostert L., J.Z. Groenewald, W. Gams, R.C. Summerbell and P.W. Crous, 2006b. Taxonomy and pathology of Togninia (Diaporthales ) and its Phaeoacremonium anamorphs. Studies in Mycology 54, 1-115. Mugnai L., A. Graniti and G. Surico, 1999. Esca (Black measles) and brown wood-streaking: Two old and elusive diseases of grapevines. Plant Disease 83, 404-418. Munkvold G.P., J.A. Duthie and J.J. Marois, 1994. Reductions in yield and vegetative growth of grapevines due to Eutypa dieback. Phytopathology 84, 186–192. O’Donnell K. and E. Cigelnik, 1997. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Molecular Phylogenetics and Evolution 7, 103-116. Pascoe I. and E. Cottral, 2000. Developments in grapevine trunk disease research in Australia. Phytopathologia Mediterranea 39, 68-75.

This document is confidential and any unauthorised disclosure is prohibited. Final report 47

Péros J.-P., G. Berger and I. Jamaux-Despréaux, 2008. Symptoms, wood lesions and fungi associated with esca in organic vineyards in Languedoc-Roussillon (France). Journal of Phytopathology 156, 297-303. Phillips A.J.L., 2002. Botryosphaeria species associated with diseases of grapevines in Portugal. Phytopathologia Mediterranea 41, 3-18. Phillips A.J.L., A. Alves, S.R. Pennycook, P.R. Johnston, A. Ramaley, A. Akulov and P.W. Crous, 2008. Resolving the phylogenetic and taxonomic status of dark-spored teleomorph genera in the Botryosphaeriaceae. Persoonia 21, 29-55. Phillips A.J.L., P.W. Crous, and A. Alves, 2007. Diplodia seriata , the anamorph of “Botryosphaeria ” obtusa . Fungal Diversity 25, 141-155 Rambaut A., 2002. Sequence Alignment Editor. Version 2.0. Department of Zoology, University of Oxford, Oxford. Reisenzein H., N. Berger and G. Nieder, 2000. Esca in Austria. Phytopathologia Mediterranea 39, 26-34. Rumbos I. and A. Rumbou, 2001. Fungi associated with esca and young grapevine decline in Greece. Phytopathologia Mediterranea 40, S330-S335. Safodien S., 2007. The molecular identification and characterization of Eutypa dieback and a PCR-based assay for the detection of Eutypa and Botryosphaeriaceae species from grapevine in South Africa. M.Sc. Thesis, University of Stellenbosch. Sánchez-Torres P., R. Hinarejos, V. González and J.J. Tuset, 2008. Identification and characterization of fungi associated with esca in vineyards of the Comunidada Valencia (Spain). Spanish Journal of Agricultural Research 6, 650-660. Santos J.M. and A.J.L. Phillips, 2009. Resolving the complex of Diaporthe (Phomopsis ) species occurring on Foeniculum vulgare in Portugal. Fungal Diversity 34, 111-125. Smit W.A., C.D. Viljoen, B.D. Wingfield, M.J. Wingfield and F.J. Calitz, 1996. A new canker disease of apple, pear, and plum rootstocks caused by Diaporthe ambigua in South Africa. Plant Disease 80, 1331-1335. Sofia J., T. Gonçalves and H. Oliveira, 2006. Spatial distribution of esca symptomatic plants in Dão vineyards (Centre Portugal) and isolation of associated fungi. Phytopathologia Mediterranea 45, S87-S92. Swofford D.L., 2003. Phylogenetic analysis using parsimony. Version 4.0b10. Sinauer Associates: Sunderland, M.A., USA. Taylor A., G.E.St.J. Hardy, P. Wood and T. Burgess, 2005. Identification and pathogenicity of Botryosphaeria species associated with grapevine decline in Western Australia . Australasian Plant Pathology 34, 187-195. Trouillas F.P., J.R. Úrbez-Torrez and W.D. Gubler, 2010. Diversity of diatrypaceous fungi associated with grapevine canker diseases in California. Mycologia 102, 319-336. Úrbez-Torrez J.R., G.M. Leavitt, T.M. Voegel and W.D. Gubler, 2006. Identification and distribution of Botryosphaeria spp. associated with grapevine cankers in California. Plant Disease 90, 1490- 1503. van Niekerk J.M., P.W. Crous, J.Z. Groenewald, P.H. Fourie and F. Halleen, 2004. DNA phylogeny, morphology and pathogenicity of Botryosphaeria species on grapevines. Mycologia 96, 781-798. van Niekerk J.M., P.H. Fourie, F. Halleen and P.W. Crous, 2006. Botryosphaeria spp. as grapevine trunk disease pathogens. Phytopathologia Mediterranea 45: S43-S54. van Niekerk J.M., J.Z. Groenewald, D.F. Farr, P.H. Fourie, F. Halleen and P.W. Crous, 2005. Reassessment of Phomopsis species on grapevines. Australasian Plant Pathology 34, 27-39. van Niekerk J.M., W. Bester, F. Halleen, P.W. Crous and P.H. Fourie, 2010. First record of Lasiodiplodia crassispora as a pathogen of grapevine trunks in South Africa. Plant Disease 94, 1063. White T.J., T. Bruns, S. Lee and J. Taylor, 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogentics. In: Innis, M.A., Gelfand, D.H., Sninsky, J.J., eds.

This document is confidential and any unauthorised disclosure is prohibited. Final report 48

PCR protocols, a guide to methods and applications. New York: Academic Press Inc. pp. 315-322. White C., F. Halleen and L. Mostert, 2011. The symptoms and fungi associated with esca in South African vineyards. Phytopathologia Mediterranea 50, S236-246.

Milestone 3: Taxonomic descriptions of the new Basidiomycete species

A novel Fomitiporia species associated with esca on grapevine in South Africa Thirty-six isolates belonging to the new species, described as Fomitiporia capensis , were found in vineyards across the Western Cape and two isolates in a vineyard in Limpopo. Fomitiporia capensis is clearly separated by molecular means from all the other species of Fomitiporia included in our analyses (Fig. 8).

Formal description Fomitiporia capensis M. Fisch., M. Cloete, L. Mostert, F. Halleen sp. nov. MycoBank MB800998 (Figs. 7 a-f) Basidiomata perennia, resupinata; superficies pororum luteobrunnea ad brunnea, pori circulares, 4-6 in quoque millimetro; systema hypharum dimiticum, omnia septa fibulis egentia; hyphae skeletales luteobrunneae, 3.0 – 4.0 µm latae, hyphae generativae hyalinae, septatae, 2.5 – 4.0 µm latae; sporae ellipsoideae ad subglobosae, hyalinae, crassitunicatae, amyloideae, 6.5-7.5 x 5.5-7 µm; setae hymeniales minimae.

Holotypus FH 183, in Pretoria (PREM60818), collectus a F. Halleen, in Vitis vinifera , cv. Chenin blanc in Wellington (Western Cape), July 2007.

Etymology: capensis refers to the geographic origin of the first isolations of the species, the Cape region in South Africa.

Specimens examined: FH 43 (corresponds to sequences STEU-7049 and 7050), FH 183 (STEU-7093, PREM60818), FH 184 (STEU-7094), MP 5 (STEU-7489).

Habitat. Fruit bodies usually occur on living, but more or less declining vines in the uppermost part of trunk where the trunk and cordons meet on cordon-trained vines, on the underside of the cordon. On untrained vines, fruit bodies often occur just above soil level, but also on the underside of arms.

Fruit bodies are resupinate, inseparable, woody hard, perennial; in the holotype (FH 183) with blackish crust in upper part, but crust inconsistently present in other specimens; up to 5 mm thick; margin inconspicuous in some specimens, more obvious in others, yellowish-brown. Pore surface yellowish brown – rusty brown; pores more or less circular, in the holotype (FH 183) somewhat irregularly arranged, 4-6 per mm, dissepiments thick, entire. Tube layer not stratified in most fruit bodies, indistinctly stratified in MP5, up to 5 mm thick; darker than pore surface, dark reddish brown. Context grayish - yellowish, up to 2 mm thick; darkening with KOH. Hyphal system dimitic; hyphae parallel in hymenophoral trama; septa without clamp connections; skeletal hyphae golden brown, very rarely branched, 3 – 4 µm wide; generative hyphae hyaline, thin-walled, regularly branched, simple septate, 2.5 – 3.5 (4) µm wide. Setae essentially absent; one single seta found in the hymenium of specimen FH 43, straight and subulate, 25 x 7 µm. Spores ovoid – subglobose, appearing slightly thick-walled, some with distinct apiculus, hyaline, smooth, mostly dextrinoid, (6) 6.5 – 7.5 (8) x (5) 5.5 – 7 (7.5). Crystals common in the hymenial layer of some specimens, rhomboid, up to > 20 µ long.The optimal temperature for growth of mycelial colonies was 25 °C.

This document is confidential and any unauthorised disclosure is prohibited. Final report 49

Remarks: Morphologically F. capensis is very similar to F. punctata (boreal species occurring on many genera of deciduous host plants) and F. aethiopica Decock, Bitew & G. Castillo (species of Eastern Africa, occurring on deciduous trees; Decock et al . 2005). These three taxa are characterized by large spores and absence of setae; pores are slightly smaller in F. punctata . So far, no cushion-shaped fruit bodies have been found for F. capensis .

Figure 7. Leaf streaking symptoms (a) and internal wood rot (b) on Vitis vinifera cv. Chenin blanc associated with a fruit body of Fomitiporia capensis FH 183 located on the trunk of the vine (c). Blackish crust forming on the margin of FH 183 (d). Dissepiment showing basidiospores and basidia of STEU- 7489. Hyaline, ovoid-globose basidiospores of FH 183. Scale bar indicates 7µm (e). Basidiospore of FH 183 showing dextrinoid reaction characteristic of genus. Scale bar indicates 7µm (f).

Phylogeny During analysis of the combined ITS and LSU dataset, 29 characters were excluded as missing or ambiguous and 1619 characters were included, of which 1251 were constant, 119 were parsimony-uninformative and 249 were parsimony informative. The heuristic search on the dataset resulted in 60 most parsimonious trees with the same topology (length 621, CI=0.692, RI=0.861, RC=0.596). Fomitiporia capensis formed a well supported clade with 100% bootstrap support and a probability of 1 (Fig. 8). Immediately basal to F. capensis, F. tenuis and F. hippophaeicola formed equally well supported clades.

This document is confidential and any unauthorised disclosure is prohibited. Final report 50

100 (*) Fomitiporia gabonensis MUCL47576 Fomitiporia gabonensis MUCL51302

100 (*) Fomitiporia nobilissima MUCL47580 100 (*) Fomitiporia nobilissima MUCL51289

100 (*) Fomitiporia ivindoensis MUCL51311 Fomitiporia ivindoensis MUCL51312

100 (*) Fomitiporia apiahyna MUCL51451 Fomitiporia apiahyna MUCL51474

100 (*) Fomitiporia tabaquilio MUCL46230 Fomitiporia tabaquilio MUCL47754

99 (*) Fomitiporia langloisii 01-77 96 (*) Fomitiporia langloisii CFMR-FP-94347-R

99 (*) Fomitiporia maxonii CRGF182 96 (9.1) 100 (*) Fomitiporia maxonii CRGF183 Fomitiporia dryophila CFMR-TJV-93-232 Fomitiporia dryophila CFMR-TJV-93-259 Fomitiporia sp. CBS386.66 Fomitiporia australiensis VPRI22859 Fomitiporia capensis STE-U7050 Fomitiporia capensis STE-U7095 Fomitiporia capensis STE-U7097 Fomitiporia capensis STE-U7096 Fomitiporia capensis STE-U7094 Fomitiporia capensis STE-U7093 Fomitiporia capensis STE-U7489 Fomitiporia capensis STE-U7082

100 (*) Fomitiporia capensis STE-U7168 Fomitiporia capensis STE-U7049 99 (*) Fomitiporia capensis STE-U7108 Fomitiporia capensis STE-U7171 Fomitiporia tenuis MUCL44802 100 (*) Fomitiporia tenuis MUCL49971 Fomitiporia tenuis MUCL49948 Fomitiporia punctata MUCL34101 100 (*) 94 (*) Fomitiporia punctata MUCL47629 Fomitiporia robusta MUCL51327 Fomitiporia mediterranea K9/9 99 (*) Fomitiporia mediterranea 99-105 Fomitiporia pseudopunctata MUCL51325

100 (*) Fomitiporia aethiopica MUCL44777 Fomitiporia aethiopica MUCL44806 98 (*) Fomitiporia erecta MUCL49871

95 (*) Fomitiporia punicata Cui23 Fomitiporia punicata Cui26 Fomitiporia polymorpha 91-42/3 100 (*) Fomitiporia polymorpha 91-42/1 Fomitiporia bannaensis MUCL45926 100 (*) Fomitiporia bannaensis MUCL46950 Fomitiporia hippophaeicola MUCL31746 100 (*) Fomitiporia hippophaeicola MUCL31747 Phellinus uncisetus MUCL46231 Phellinus uncisetus MUCL47061

10 changes

Figure 8. A combined ITS and LSU phylogeny of Fomitiporia capensis. Fomitiporia capensis formed a well-supported clade with a bootstrap support value of 100%.

This document is confidential and any unauthorised disclosure is prohibited. Final report 51

Discussion Within the last decade, the number of taxa within Fomitiporia has increased significantly. This formerly small genus now forms the largest group within Phellinus s.l. Clearly, emphasis of new descriptions is on non-European locations such as Africa and Asia (www.mycobank.org). There have been several descriptions of novel Fomitiporia species in Africa recently (Decock et al. 2005; Amalfi et al. 2010), greatly expanding knowledge of the genus and its occurrence on the continent. The novel South African species, Fomitiporia capensis , is one of several basidiomycetes within the Hymenochaetales associated with esca symptoms on Vitis vinifera in South Africa (White et al. 2011b).

As mentioned above, F. capensis is morphologically most similar to F. aethiopica since both species essentially lack setae and both pores and basidiospores are within the same size range. In the holotype specimen of F. capensis (FH 183), a contrast between colouration of the pore surface and tube layer was observed, a phenomenon which was also described for F. aethiopica by Decock et al. (2005). The differences between the former and latter species are the thin shape of the fruit body of F. capensis and the fact that it seems to be perennial whereas the fruit body of F. aethiopica may be annual sometimes. As for the host range of the two species, data are limited: at present, F. aethiopica is known only from non-defined “deciduous trees”, whereas F. capensis has been found on Vitis vinifera only. Fomitiporia mediterranea and F. punctata are also morphologically similar but differ in their distinctly smaller pore size than that observed in F. capensis (Ryvarden and Gilbertson 1994; Fischer 2002).

Fomitiporia capensis forms a well-supported and clearly delineated clade in a combined ITS and LSU phylogeny based on bootstrap support and Bayesian probability (Fig. 3). It is phylogenetically closest to another African species, F. tenuis Decock, Bitew & Castillo, however the morphological differences between the two species are dramatic. Fomitiporia tenuis is characterised by having very small pores and much smaller basidiospores than those of F. capensis . Another genetically related taxon is F. hippophaeicola (H. Jahn) Fiasson & Niemelä, forming pileate or effused-reflexed fruit bodies on Hippophaë rhamnoides and Eleagnus in Europe and Asia (Jahn, 1976; Ryvarden and Gilbertson, 1994). Based on phylogeny, F. capensis is not closely related to other species occurring on grapevine, namely F. mediterranea , F. australiensis and F. polymorpha . Although all the other individual species formed separate clades, the combined ITS and LSU phylogeny failed to distinguish between F. mediterranea and F. pseudopunctata . These two species are closely related by molecular analysis using the ITS, LSU and tef1 regions (Amalfi et al . 2010), but can be separated by sequences of the rpb2-gene (Amalfi, pers. comm.). Morphologically, F. pseudopunctata has abundant setae and can thus be easily distinguished from F. mediterranea (David et al . 1982). Fomitiporia capensis has only been isolated from grapevines diagnosed with esca. Its potential virulence as a primary wood rotting agent is currently being tested on Vitis vinifera . Other fungi isolated from esca affected vines in South Africa can include Phaeoacremonium spp., Phaeomoniella chlamydospora , Phomopsis spp., Botryosphaeriaceae spp. and Eutypa spp. (Van Niekerk et al . 2011; White et al . 2011b). The full host range of F. capensis is unknown, as only grapevines were sampled in the present study. During sampling of a wider geographical range of South African vineyards, its distribution was limited to the main wine-growing region of the Western Cape Province and a single vineyard in Limpopo province in the North of the country. Its common occurrence in a geographically small area of the Western Cape may be due to the fact that this area is the oldest wine producing area in South Africa. It could also be that F. capensis originates from the natural vegetation of the Western Cape and also finds the climatic conditions ideal in this region. Investigation of the occurrence of F. capensis on other hosts may shed more light on the host range and ecology of F. capensis .

This document is confidential and any unauthorised disclosure is prohibited. Final report 52

There is a large discrepancy between the number of mycelial cultures found through isolations on vines showing symptoms of esca and the number of fruit bodies of F. capensis collected during surveys. Fruit bodies seem to occur rarely under South African conditions; however, the frequent presence of the species in many vineyards would appear to suggest that fruit bodies are formed often enough to effectively spread infection via basidiospores (Fischer 2000). Little is known about the exact infection process of vines with the esca related basidiomycetes, though it has been assumed to be by basidiospores entering the plant through wound sites such as pruning wounds (Cortesi et al. 2000; Lupo et al. 2006). If it is the case that infection occurs through basidiospores, it follows that fruit bodies would have to be present to release such spores.

The apparent scarcity of fruit bodies may be due to several factors. Fruit bodies of F. capensis have been found to occur underneath the grapevine cordon, in the shade and sometimes underneath the bark, making them difficult to spot especially if vines are trained close to the ground. It may also be likely that fruit bodies simply don’t form often on Vitis , which in fact might represent a secondary host for F. capensis . While this idea is in some contrast with the high number of mycelia recovered from affected vines, further studies should include sampling from woody hosts close to vineyards to establish if fruit bodies might be present on them. This study demonstrated the existence of a distinct new Fomitiporia species associated with the grapevine disease esca in South Africa based on morphological and phylogenetic data.

Literature cited Amalfi M, Yombiyeni P, Decock C (2010) Fomitiporia in sub-Saharan Africa: morphology and multigene phylogenetic analysis support three new species from the Guineo-Congolian rainforest. Mycologia 102: 1808 – 1817.

Amalfi M, Raymundo T, Valenzuela R, Decock C (2012) Fomitiporia cupressicola sp. nov., a parasite on Cupressus arizonica , and additional unnamed clades in the southern USA and northern Mexico, determined by multilocus phylogenetic analyses. Mycologia 104: 880-893.

Auger J, Aguilera N, Esterio M (2005) Identification of basidiomycete species associated with wood decay symptoms of chlorotic leaf roll in Chile. Phytopathologia Mediterranea 44: 86.

Chiarappa L (1959) Wood decay of the grapevine and its relationship with black measles disease. Phytopathology 49: 510-519.

Clark TA, Anderson JB (2004) Dikaryons of the basidiomycete fungus Schizophyllum commune : Evolution in Long-Term Culture. Genetics 167: 1663-1675.

Cortesi P, Fischer M, Milgroom MG (2000) Identification and spread of Fomitiporia punctata associated with wood decay of grapevine showing symptoms of esca. Phytopathology 90: 967- 972.

Dai YC, Zhang M, Zhou T-S (2001) New and noteworthy species of Hymenochaetaceae from China. Mycosystema 20: 16–21.

Dai YC, Cui BK, Decock C (2008) A new species of Fomitiporia (Hymenochaetaceae, Basidiomycota) from China. Mycological Research 112: 375–380.

Damm U, Mostert L, Crous PW, Fourie PH (2008) Novel Phaeoacremonium species associated with necrotic wood of Prunus trees. Persoonia 20: 97-102.

This document is confidential and any unauthorised disclosure is prohibited. Final report 53

David A, Dequatre B, Fiasson JL (1982) Two new Phellinus with globose, cyanophilous spores. Mycotaxon 14: 160– 174.

Decock C, Bitew A, Castillo G (2005) Fomitiporia tenuis and Fomitiporia aethiopica (Basidiomycetes, Hymenochaetales), two undescribed species from the Ethiopian Highlands: taxonomy and phylogeny. Mycologia 97: 124–132.

Decock C, Figueroa S, Robledo G, Castillo G (2007) Fomitiporia punctata (Basidiomycota, Hymenochaetales) and its presumed taxonomic synonyms in America: taxonomy and phylogeny of some species from tropical/subtropical areas. Mycologia 99: 733-752.

Fiasson JL, Niemelä T (1984) The Hymenochaetales : a revision of the European poroid taxa. Karstenia 24: 14-28.

Fischer M. (1996) On the species complexes within Phellinus : Fomitiporia revisited. Mycological Research 100: 1459-1467.

Fischer, M. (2000) Grapevine wood decay and lignicolous basidiomycetes. Phytopathologia Mediterranea 39: 100-106.

Fischer M (2002) A new wood-decaying basidiomycete species associated with esca of grapevine: Fomitiporia mediterranea (Hymenochaetales). Mycological Progress 1: 315-324.

Fischer M (2006) Biodiversity and geographic distribution of basidiomycetes causing esca- associated white rot in grapevine: a worldwide perspective. Phytopathologia Mediterranea 45: S30-S42.

Fischer M, Binder M (2004) Species recognition, geographic distribution and host-pathogen relationships: a case study in a group of lignicolous basidiomycetes, Phellinus s .l. Mycologia 96: 799-811.

Fischer M, Edwards J, Cunnington JH, Pascoe IG (2005) Basidiomycetous pathogens on grapevine: a new species from Australia – Fomitiporia australiensis . Mycotaxon 92: 85-96.

Gatica M, Césari C, Escoriaza G (2004) Phellinus species inducing hoja de malvón symptoms on leaves and wood decay in mature field-grown grapevines. Phytopathologia Mediterranea 43: 59-65.

Graniti A, Surico G, Mugnai L (2000) Esca of grapevine: a disease complex or a complex of diseases? Phytopathologia Mediterranea 39: 16-20.

Jahn H. (1976) Phellinus hippophaecola H. Jahn nov. sp. Memoirs of the New York Botanical Garden 28: 105-108.

Katoh K, Misawa K, Kuma K, Miyata T (2002) MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Research 30: 3059-3066.

Larignon P, Dubos B (1997) Fungi associated with esca disease in grapevine. European Journal of Plant Pathology 103: 147-157.

Lupo S, Bettucci L, Pérez A, Martínez S, Césari C, Escoriaza G, Gatica M (2006) Characterization and identification of the basidiomycetous fungus associated with ‘hoja de malvón’ grapevine disease in Argentina. Phytopathologia Mediterranea 45: S110-S116.

This document is confidential and any unauthorised disclosure is prohibited. Final report 54

Marais PG (1981) Wingerdsiektes en Abnormaliteite. In: Burger J and Deist J (eds) Wingerdbou in Suid-Afrika. pp.404-405.

Mostert L, Groenewald JZ, Gams W, Summerbell R, Crous PW (2006) Taxonomy and pathology of Togninia (Diaporthales ) and its Phaeoacremonium anamorphs. Studies in Mycology 54: 1-115.

Mugnai L, Graniti A, Surico G (1999) Esca (Black measles) and Brown Wood-Streaking: Two old and elusive diseases of grapevines. Plant Disease 83: 404-418.

Rambaut A (2002) Sequence Alignment Editor. Version 2.0. Department of Zoology, University of Oxford, Oxford, U.K.

Ravaz L (1909) Sur l’apoplexie de la vigne. Progrès Agricole et Viticole 30: 547-579.

Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572–1574.

Ryvarden L, Gilbertson RL (1994) European Polypores 2. Meripilus - Tyromyces . Synopsis Fungorum 7. FungiFlora, Oslo, Norway: p 392–743.

Swofford DL (2003) Phylogenetic analysis using parsimony. Version 4.0b10. Sinauer Associates: Sunderland, M.A., USA.

Van Niekerk, Bester W, Halleen F, Crous PW, Fourie PH (2011) The distribution and symptomatology of grapevine trunk disease pathogens are influenced by climate. Phytopathologia Mediterranea 50: 98-111.

Viala P (1926) Recherches sur les maladies de la vigne. Esca. Annales des Epiphyties, Fasc. 1 et 2: 1-108.

Vinet E (1909) L’apoplexie de la vigne en Anjou. Revue de viticulture 32: 676-681.

White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ (eds) PCR protocols, a guide to methods and applications. Academic Press Inc, New York, pp. 315-322.

White C, Halleen F, Fischer M, Mostert L (2011a) Symptoms and fungi associated with esca diseased grapevines in South Africa. Phytopathologia Mediterranea 50: 236-246.

White C, Halleen F, Mostert L (2011b) Characterization of the fungi associated with esca diseased grapevines in South Africa. Phytopathologia Mediterranea 50: 204-223.

A new species of Phellinus sensu stricto associated with esca on grapevine in South Africa: Eleven isolates of the putative novel Phellinus species were found in vineyards in the Orange River area of the Northern Cape, 2 in Limpopo province and 1 in Namibia. The 14 isolates formed a well-supported group separated from other Phellinus species based on the ITS phylogeny (Fig. 9).

Morphology Phellinus resupinatus M. Fisch., M. Cloete, L. Mostert, F. Halleen sp. nov. Fig. 10

This document is confidential and any unauthorised disclosure is prohibited. Final report 55

Etymology: resupinatus refers to the attachment of the fruit bodies to the substrate, which is resupinate to cushion-shaped.

Specimens examined: “Keboes” (somewhat irregular appearance), MP 1, Keboes plant 1, Kanon Eiland P1

Habitat: thick trunk, apparently in the uppermost part, distinct white rot.

Fruit bodies are resupinate to cushion-shaped (MP1), firmly attached to the host surface, woody hard, perennial; up to 6 mm thick in total; with distinct sterile yellowish margin, up to 5 mm wide, in MP1; no margin in other specimens. Pore surface dark yellowish – pale brownish; bright reddish brown in active specimens; cracked in dry specimens (for instance, “Keboes”); pores more or less circular to angular, very small, (6) 7-8 (9)/mm; dissepiments thin, entire. Tube layer stratified, with up to three layers (in MP1); 2-4 mm thick, of the same color or slightly darker than pore surface. Subiculum very thin, up to 1 mm, grayish brown; darkening with KOH. Hyphal system dimitic; hyphae subparallel in hymenophoral trama; septa without clamp connections; skeletal hyphae golden brown, essentially aseptate, very rarely branched, slightly thick-walled, 2-4 µm wide; generative hyphae hyaline, most evident in subiculum, thin-walled to slightly thick-walled, rarely septate, rarely branched, 2-3.5 µm wide.

Setae: hymenial, scattered, not evident in all sections; most apparent in Keboes 1 and Kanon Eiland, in one single section of MP 1, straight and more or less ventricose, 12 - 25 x 5-8 µm.

Spores: broadly ellipsoid, hyaline, non-dextrinoid; (4) 4.5 – 5 (5.5) x 3 -3.5 (4) µm; very rare in MP 1.

Optimal temperature for growth of mycelia colonies: 35˚C

Remarks: Phellinus resupinatus is restricted to the northern grapevine-growing areas of SA and one isolate was found in southern Namibia.

This document is confidential and any unauthorised disclosure is prohibited. Final report 56

gi|46810569|gb|AY558638.1| Phellinus populicola gi|288986769|gb|GQ383705.1| Phellinus populicola gi|288986782|gb|GQ383718.1| Phellinus igniarius gi|288986776|gb|GQ383712.1| Phellinus igniarius gi|48995524|gb|AY340042.1| Phellinus alni gi|288986820|gb|GQ383756.1| Phellinus alni gi|48995531|gb|AY340049.1| Phellinus cinereus gi| 48995543|gb|AY340061.1| Phellinus lundellii gi|46810561|gb|AY558630.1| Phellinus lundellii CBS gi|6470317|gb|AF200241.1| Phellinus tremulae gi|288986846|gb|GQ383782.1| Phellinus tremulae gi|46810581|gb|AY558652.1 | Phellinus tuberculosus gi|288986848|gb|GQ383784.1| Phellinus tuberculosus gi|48995535|gb|AY340053.1| Phellinus laevigatus gi|48995537|gb|AY340055.1| Phellinus laevigatus gi|290783886|gb|GU594159.1| Phellinus car ibaeo - gi|290783885|gb|GU594158.1| Phellinus caribaeo -quercicola gi|342154979|gb|HM635697.1| Phellinus caribaeo -quercicolus gi|342154981|gb|HM635699.1| Phellinus caribaeo -quercicolus gi|342155003|gb|HM635721 .1| Phellinus gabonensis gi|342155004|gb|HM635722.1| Phellinus gabonensis gi|342154998|gb|HM635716.1| Phellinus gabonensis Phellinus resupinatus Phellinus resupinatus Phellinus resupinatus Phellinu s resupinatus Phellinus resupinatus Phellinus resupinatus Phellinus resupinatus Phellinus resupinatus Phellinus resupinatus gi|28396164|gb|AY189699.1| Phellinus gi|46810541|gb|AY558610.1| Phellinus bicuspi datus gi|46810578|gb|AY558648.1| Phellinus spiculosus gi|46810565|gb|AY558634.1| Phellinus occidentalis gi|301128667|emb|FN539063.1| Stereum gi|213159523|gb|EU851114.1| Stereum hirsutum 1

Figure 9. An ITS phylogeny of Phellinus resupinatus sp. nov. Phellinus resupinatus formed a well-supported clade with a bootstrap support value of 100%.

This document is confidential and any unauthorised disclosure is prohibited. Final report 57

Figure 10. White rot symptoms (a) on a vine with a Phellinus resupinatus fruitbody (b). Basidia and cystidia (c), non-dextrinoid basidiospores (d) of Phellinus resupinatus . Hymenial setae of Phellinus resupinatus (e).

Phylogeny During an analysis of the ITS region, the novel Phellinus sp. formed a well-supported clade with a bootstrap support value of 99% and a posterior probability of 1 (Fig. 9). P. bicuspidatus , P. caribaeo-quercicolus and P. gabonensis formed well-supported clades immediately basal to Phellinus sp. These clades were seperated from the group Phellinus s.s.

Discussion Systematics Phellinus sensu lato had traditionally been distinguished from Inonotus s.l. , the other large genus in Hymenochaetales, by means of comparing the hyphal mitism and fruit body consistency of species. This approach has been demonstrated as inconsistent due to a high level of morphological overlap and the existence of intermediate morphological forms (Fiasson & Niemelä 1984, Corner 1991, Wagner & Fischer 2001, 2002). Several other genera have since been found to accommodate species within Phellinus s.l. such as Fomitiporia , Fomitiporella Murr., Phellinidium (Kotl.), Fuscoporia , Fulvifomes Murr. (Fiasson & Niemelä 1984) and Porodaedalea (M. Lars., Lomb. & Aho); for an overview see Wagner & Fischer 2001, 2002.

Based on a phylogenetic study of the nuclear large subunit (LSU), Wagner and Fischer (2002) found the composition of Phellinus s.s. to be inconclusive. While nine European species

This document is confidential and any unauthorised disclosure is prohibited. Final report 58

including P. igniarius and P. alni and a tenth non-European species, P. arctostaphyli , formed a highly supported clade, the non-European taxa Phellinus bicuspidatus and P. spiculosus had only low support for inclusion in Phellinus s.s. . Decock et al. (2006) described a novel species, P. caribaeo-quercicolus Decock & S. Herrera, closely related to P. bicuspidatus , as belonging to Phellinus s.s. and Yombiyeni et al. (2011) found P. gabonensis , another close relative to P. bicuspidatus . In our study, Phellinus resupinatus grouped together with P. bicuspidatus , P. gabonensis , P. castanopsidis B.K. Cui & Decock (Cui & Decock 2013) and P. caribaeo- quercicolus both in LSU and ITS phylogenies. The new species was most closely related to P. bicuspidatus. P. bicuspidatus and P. resupinatus form a subclade basal to P. gabonensis, P. castanopsidis and P. caribaeo-quercicolus , which form a separate subclade also basal to Phellinus s.s. based on both the LSU and ITS phylogenies.

Phellinus resupinatus and P. bicuspidatus differ morphologically in that the former has smaller pores and straight, ventricose hymenial setae compared to the latter´s short, bicuspid setae. Phellinus bicuspidatus also has a monomitic hyphal system which sets it apart from the other four species (Lombard & Larsen 1985). Although the group comprising of P. caribaeo- quercicolus , P. castanopsidis, P. gabonensis , P. bicuspidatus and P. resupinatus is clearly delineated from Phellinus s.s. based on ITS and LSU phylogeny, previous publications have classified these species as part of Phellinus s.s (Wagner and Fischer 2002, Decock et al. 2006, Yombiyeni et al. 2010) and there is still no compelling morphological evidence that suggests otherwise. Taking this into consideration, it is interesting to note that the non-European species mentioned above, i.e P. biscuspidatus, P. gabonensis, P. caribeo-quercicolus , and P. castanopsidis are considered Phellinus s.l. in Cui & Decock (2013).

Ecology During an exploratory study on Hymenochaetales associated with esca in South Africa, White et al. (2011a) found ten different species occurring on grapevine in the Western Cape area of South Africa, but only one single species occurring in the Northern Cape. In the Northern Cape Orange River area, one of South Africa’s biggest table grape production areas, exclusively Phellinus resupinatus was found on diseased grapevines.

The species was isolated as mycelial cultures from severe white rot symptoms and fruit bodies were also found in vineyards. In the Limpopo table grape growing region fruit bodies of P. resupinatus have since been found on diseased vines where fruit bodies of another species, Fomitiporia capensis , were also found (Cloete et al. 2013). A single isolate of P. resupinatus was found coincidentally in southern Namibia on grapevine by a visiting colleague.

The disparity between the species found in the different areas of South Africa in White et al. (2011a) may be explained by differences in climate and ecosystem. The Western Cape has a famously diverse natural ecosystem and a Mediterranean climate, whereas the Northern Cape and Limpopo have higher average temperatures, summer rainfall and a less diverse natural ecosystem. The occurrence of P. resupinatus in the Northern Cape coincides with the higher optimum growth temperature of 35 ˚C in comparison with the optimum of 25 ˚C for F. capensis (Cloete et al . 2013), the species more commonly found in the Western Cape. Ryvarden (1998) lists differences in climate as well as a different set of potential hosts for wood inhabiting fungi as reasons why there were only a small number of polypores in common between Africa and Europe. The same example may possibly apply to these areas in South Africa. Ryvarden (1998) also mentions dimitic hyphal construction as a possible reason why his review found a higher number of diverse Phellinus s.l species reported in Africa compared to Inonotus s.l. species, as the soft annual fruit bodies traditionally associated with the latter might be better adapted to temperate-boreal climates. Once again, this idea may be applied to the South African esca situation as several genera belonging to Inonotus s.l. ( unpublished data ) are found only in the Western Cape. While the Western Cape has a harsh, dry summer, winters are mild and damp. In the Northern Cape and Limpopo areas, as well as in southern Namibia, conditions in winter

This document is confidential and any unauthorised disclosure is prohibited. Final report 59

are dry. The morphology of the fruit body, amongst other factors, may assist this species further in surviving under these circumstances where the Western Cape Inonotus s.l. species might not have thrived. The exact host range for P. resupinatus is presently unknown as no specimens have yet been found on indigenous flora or other trees, but it is a distinct possibility that the species may occur on other hosts than Vitis .

Literature Cited Chiarappa L (1959) Wood decay of the grapevine and its relationship with black measles disease. Phytopathology 49:510-519

Chiarappa L (1997) Phellinus igniarius : the cause of spongy wood decay of black measles (" esca") disease of grapevines. Phytopathologia Mediterranea 36:109-111

Cloete M, Fischer M, Mostert L, Halleen F (2014) A novel Fomitiporia species associated with esca on grapevine in South Africa. Mycological Progress 13:303-311

Corner EJH (1991) Ad Polyporaceas VII. Beihefte Nova Hedwigia 101:1-175

Cortesi P, Fischer M, Milgroom MG (2000) Identification and spread of Fomitiporia punctata associated with wood decay of grapevine showing symptoms of esca disease. Phytopathology 90:967-972

Crous, P. W., Gams, W., Wingfield, M. J., & Van Wyk, P. S. (1996). Phaeoacremonium gen. nov. associated with wilt and decline diseases of woody hosts and human infections. Mycologia volume number? 786-796.

Crous PW, Phillips A. J, Baxter A P (2000) Phytopathogenic fungi from South Africa. University of Stellenbosch, Dept. of Plant Pathology Press. 358 p.

Crous, P. W., & Gams, W. (2006). Phaeomoniella chlamydospora gen. et comb. nov., a causal organism of Petri rapevine Decline and Esca. Phytopathologia Mediterranea 39(1):112-118.

Cui BK, Decock C (2013) Phellinus castanopsidis sp. nov. (Hymenochaetaceae) from southern China, with preliminary phylogeny based on rDNA sequences. Mycological Progress 12:341- 351

Dai Y-C (1999) Phellinus sensu lato (Aphyllophorales, Hymenochaetaceae) in East Asia. Acta Botanica Fennica 166:1-115

Damm U, Mostert L, Crous PW, Fourie PH (2008) Novel Phaeoacremonium species associated with necrotic wood of Prunus trees. Persoonia 20:97-102

Decock C, Figueroa SH, Robledo G, Castillo G (2006) Phellinus caribaeo-quercicolus sp. nov., parasitic on Quercus cubana : taxonomy and preliminary phylogenetic relationships. Mycologia 98: 265-274

Fiasson JL, Niemelä T, (1984) The Hymenochaetales: a revision of the European poroid taxa. Karstenia 24:14-28

Fischer M (1995) Phellinus igniarius and its closest relatives in Europe. Mycological Research 99: 735–744

Fischer M (2000) Grapevine wood decay and lignicolous basidiomycetes. Phytopathologia Mediterranea, 39:100-106

This document is confidential and any unauthorised disclosure is prohibited. Final report 60

Fischer M, Binder M (2004) Species recognition, geographic distribution and host-pathogen relationships: a case study in a group of lignicolous basidiomycetes, Phellinus s.l . Mycologia 96:799-811

Fischer, M., Edwards, J., Cunnington, J. H., & Pascoe, I. G. (2005). Basidiomycetous pathogens on grapevine: a new species from Australia-Fomitiporia australiensis. Mycotaxon, 92, 85-96.

Fischer M (2006) Biodiversity and geographic distribution of basidiomycetes causing esca- associated white rot in grapevine: a worldwide perspective. Phytopathologia Mediterranea 45:30-42

Gilbertson RL, Ryvarden L (1987) North American Polypores . Vol. 2, Fungiflora, Oslo, Norway. 430-885 Jahn H (1963) Mitteleuropäische Porlinge (Polyporaceae s.l.) und ihr Vorkommen in Westfalen (unter Ausschluß der resupinaten Arten). Westfälische Pilzbriefe 4:1-143

Jahn H (1981) Die resupinaten Phellinus -Arten in Mitteleuropa mit Hinweisen auf die resupinaten Inonotus -Arten und Poria expansa (Desm.) [= Polyporus megaloporus Pers.]. Bibliotheca Mycologica 81: 37-151

Katoh K, Misawa K, Kuma K, Miyata T (2002) MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Research 30:3059-3066

Larignon P, Dubos B (1997) Fungi associated with esca disease in grapevine. European Journal of Plant Pathology 103:147-157

Larsen MJ, Cobb-Poulle LA (1990) The genus Phellinus (Hymenochaetaceae): A survey of the world taxa. Oslo, Norway: Fungiflora. 206 p.

Larsson KH, Parmasto E, Fischer M, Langer E, Nakasone KK, Redhead SA (2006) Hymenochaetales: a molecular phylogeny for the hymenochaetoid clade. Mycologia 98:926-936

Lombard FF, Larsen MJ (1985) Phellinus bicuspidatus (Hymenochaetales, Hymenochaetaceae), a new species associated with a white sap rot of oak in Louisiana. Mycologia: 55-61

Martinez, S. (2005). Inocutis jamaicensis, the causal agent of eucalypt stem rot in Uruguay. Mycotaxon 91: 165–171.

Mostert L, Groenewald JZ, Summerbell RC, Gams W, Crous PW (2006) Taxonomy and pathology of Togninia (Diaporthales) and its Phaeoacremonium anamorphs. Studies in Mycology 54: 1-101

Mugnai L, Graniti A, Surico G (1999) Esca (black measles) and brown wood-streaking: two old and elusive diseases of grapevines. Plant disease, 83:404-418

Murrill WA (1907) (Agaricales) Polyporaceae. North American Flora 9:1-131

Niemelä T (1972) On Fennoscandian polypores. II. Phellinus laevigatus (Fr.) Bourd. & Galz. and Phellinus lundellii Niemelä, n. sp . Annales Botanici Fennici 9:41-59

This document is confidential and any unauthorised disclosure is prohibited. Final report 61

Niemelä T (1975) On Fennoscandian Polypores. IV. Phellinus igniarius , P. nigricans and P. populicola , n. sp . Annales Botanici Fennici 12:93-122

Niemelä T (1977) On Fennoscandian polypores. V. Phellinus pomaceus . Karstenia 17:77-86

Oberwinkler F (1977) Das neue System der Basidiomyceten. In: Frey W, Hurka H, Oberwinkler F, eds. Beiträge zur Biologie der niederen Pflanzen. Gustav Fischer, Stuttgart, Germany: 59- 105

Parmasto E (1976) Studies on Yakutian fungi 2. Ganodermataceae, Hymenochaetaceae, Polyporaceae s.str. Eesti NSV Teaduste Akadeemia toimetised, Bioloogia 25:316–321

Parmasto E. (1985) The species concept in Hymenochaetaceae (Fungi, Hymenomycetes). Proceedings of the Indian Academy of Sciences (Plant Sciences) 94:369-380

Rambaut A (2002) Sequence Alignment Editor. Version 2.0. Department of Zoology, University of Oxford, Oxford, U.K.

Roberts P, Ryvarden L (2006) Poroid fungi from Korup National Park, Cameroon. Kew Bulletin 61:55-78 Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19:1572–1574

Ryvarden L (1991) Genera of polypores.Nomenclature and taxonomy. Oslo, Norway: Fungiflora. 363 p.

Ryvarden L (1998) African polypores - a review. Belgian Journal of Botany 131:150-155 Ryvarden L, Gilbertson RL (1994) European Polypores 2. Meripilus - Tyromyces. Synopsis Fungorum 7. FungiFlora, Oslo, Norway: 392–743

Ryvarden L, Johansen I (1980) A preliminary polypore flora of East Africa. Fungiflora, Oslo, Norway. 636 p.

Sell I (2008) Taxonomy of the species in the Phellinus igniarius group. Mycotaxon 104:337–347

Tomšovský M, Vampola P, Sedlák P, Byrtosová Z, Jankowský L (2010) Delimitation of central and northern European species of the Phellinus igniarius group (Basidiomycota, Hymenochaetales) based on analysis of ITS and translation elongation factor 1 alpha DNA sequences. Mycological Progress 9: 431-445

Wagner T, Fischer M (2001) Natural groups and a revised system for the European poroid Hymenochaetales (Basidiomycota) supported by nLSU rDNA sequence data. Mycological Research 105:773-782

Wagner T, Fischer M (2002) Proceedings towards a natural classification of the worldwide taxa Phellinus s.l. and Inonotus s.l. and phylogenetic relationships of allied genera. Mycologia 94:998-1016

White, T. J., Bruns, T., Lee, S. J. W. T., & Taylor, J. W. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: a guide to methods and applications 18: 315-322.

White CL, Halleen F, Fischer M, Mostert L (2011 a). Characterisation of the fungi associated with esca diseased grapevines in South Africa. Phytopathologia Mediterranea, 50: S204-S223

This document is confidential and any unauthorised disclosure is prohibited. Final report 62

White C L, Halleen F, Mostert L (2011 b). Symptoms and fungi associated with esca in South African vineyards. Phytopathologia Mediterranea 50:S236-S246

Wright JE, Blumenfeld SN (1984) New South American species of Phellinus (Hymenochaetaceae). Mycotaxon 21:413-425

Yombiyeni P, Douanla-Meli C, Amalfi M, Decock C (2011) Poroid Hymenochaetaceae from Guineo–Congolian rainforest: Phellinus gabonensis sp. nov. from Gabon–taxonomy and phylogenetic relationships. Mycological Progress 10:351-362

Description of Taxon 1 and identification of Taxa 7 and 8 The novel Fomitiporella species (Taxon1; Fig. 11 a-b) is characterised by an irregularly shaped fruiting body which may be resupinate to effuse-reflexed with no setae occurring and brown coloured, ellipsoid-ovoid basidiospores between 5-6 x 3.5-4 µm in size. Based on 28s large subunit phylogeny, it is most closely related to the species Fomitiporella caryophylli , a species occurring on south-eastern Asian hardwood trees (Fig. 12).

During a collection trip, a fruit body was collected from a willow tree. A mycelial culture was sequenced and the sample corresponded to Taxon 7 from grapevine originally from the Stellenbosch and Constantia areas. During morphological examination, the sample was identified as Inonotus setulosocroceus , an Inonotus species originally described from hardwood trees in South Australia and Japan. The species is characterised by resupinate, irregularly shaped, monomitic fruit bodies which are found primarily in fissures in tree bark, sparse ventricose hymenial setae with thickened brown walls and hyaline, broadly ellipsoid basidiospores between 7-8.5 x 5-6 µm in size. No sequences of I. setulosocroceus are available for comparison (Fig. 13), but the morphological identification is convincing when compared to morphological descriptions of related species, especially in light of the specimen’s unusual basidiocarp formation on the host (Fig. 11 c-d).

Sequences of Taxon 8 were found to group with American specimens of Ptychogaster cubensis , the anamorph of the American population of Inonotus rickii , a species of Inonotus found on wax myrtle trees in the south-eastern U.S and on ornamental perennials in Portugal and Italy (Fig. 13). Ptychogaster cubensis is characterised by a cushion-shaped fruitbody similar to that of Inonotus rickii but with no pores and chlamydospore formation when the fruit body matures. Taxon 8 forms copious chlamydospores as well as primordial basidiocarps with thick- walled, dark-coloured basidiospores and dark-walled, ventricose hymenial setae in vitro (Fig. 11 e-g). No fruit bodies have been observed in the field.

Fruit bodies, which are essential for taxonomic descriptions, have only been linked to the new Fomitiporia, Fomitiporella and Phellinus species. In addition to this, fruit bodies from willow trees have been linked to Taxon 7, Inonotus setulosocroceus . This opens up the possibility that further fruit bodies may be found on alternative hosts, and goes some way towards explaining the lack of fruit bodies from Taxa 2, 3, 4, 5, 6 and 8, which have not been found on grapevine despite numerous targeted searches in areas where these taxa were isolated from. Searches on alternative hosts have turned up several specimens belonging to Fomitiporia capensis on oak and guava trees, further supporting the alternative host hypothesis, i.e that fruit bodies on alternative woody hosts may be responsible for the spread of inoculum in the form of basidiospores to grapevines.

This document is confidential and any unauthorised disclosure is prohibited. Final report 63

gi|24459243|gb|AY059052.1| Fomitiporella

gi|390176188|gb|JQ910910.1| Fomitiporella sp. 98 gi|24459227|gb|AY059036.1| Fomitiporella

gi|390176186|gb|JQ910908.1| Fomitiporella sp.

gi|92911672|gb|DQ459301.1| Fomitipore lla sp. Fv.Ch -7

FH270 TAXON 10 0 FH288 TAXON 80 gi|24459212|gb|AY059021.1| Fomitiporella

gi|15216461|gb|AF311012.1| Inocutis dryophilus strain 87- 74

71 gi|15216468|gb|AF311019.1| Inocutis rheades strain TW

99 gi|24459235|gb|AY059044.1| Inocutis ludo -

gi|24459239|gb|AY059048.1| Inocutis

gi|24459240|gb|AY059049.1 | Inonotus 68 gi|22652935|gb|AF518623.1 | Inonotus hispidus strain FPL -

gi|24459223|gb|AY059032.1| Inonotus 69 gi|24459209|gb|AY059018.1| Inonotus 99 gi|24459247|gb|AY059056.1| I nonotus

gi|10717089|gb|AF287884.1|AF287884 Phellinus 1 change

Figure 12. An LSU phylogeny Fomitiporella sp. “Taxon 1”. “Taxon 1” formed a well- supported clade with a 100% bootstrap support value and was closely related to Fomitiporella caryophylli .

This document is confidential and any unauthorised disclosure is prohibited. Final report 64

Taxon 7 Taxon 7 Taxon 7 Taxon 7 Taxon 7 Cave Fungus Taxon 8 Taxon 8 gi|299772163|gb|GU111923.1| Inonotus rickii CBS gi|46810524|gb|AY558593.1| Inonotus obliquus IFO gi|70985880|gb|DQ103883.1| Inonotus obliquus gi|331092850|gb|JF692194.1| Inonotus micantissimus gi|21304230|gb|AY072024.1| Inonotus patouillardii isolate gi|255709695|gb|GQ253461.1| Inonotus rickii HAI gi|21304232|gb|AY072026.1| Inonotus quercustris gi|158934570|emb|AM269781.1| Inonotus andersonii L(61)11-14- gi|50659111|gb|AY624993.1| Inonotus hispidus 86- gi|46810533|gb|AY558602.1| Inonotus hispidus CBS gi|7341286|gb|AF237730.1| Inonotus cuticularis gi|378792931|gb|JN642594.1| Inonotus sp. SHW-2012c WD- gi|407756998|gb|JQ860317.1| Inonotus weigelae gi|353261199|gb|JN169786.1| Inonotus tenuicontextus IFP:Yuan gi|407756995|gb|JQ860314.1| Inonotus weigelae gi|407756994|gb|JQ860313.1| Inonotus alpinus gi|378792912|gb|JN642575.1| Inonotus sp. SHW-2012a gi|46810539|gb|AY558608.1| Inonotus baumii SFCC gi|33330076|gb|AF534069.1| Inonotus baumii Dai gi|39547231|gb|AY436626.1| Inonotus linteus KFDA gi|378792913|gb|JN642576.1| Inonotus sp. SHW-2012b WD- gi|3415136|gb|AF082101.1| Inonotus linteus gi|46810583|gb|AY558654.1| Inonotus weirianus CBS gi|4416087|gb|AF110989.1| Inonotus weirianus gi|378792927|gb|JN642590.1| Inonotus vaninii gi|336185140|gb|HQ845050.1| Inonotus vaninii gi|407756987|gb|JQ860306.1| Inonotus zonatus gi|357184617|gb|JF895464.2| Inonotus sp. gi|357184618|gb|JF895465.2| Inonotus sp. gi|49339456|gb|AY641432.1| Inonotus tropicalis UTHSC 02- gi|353261200|gb|JN169787.1| Inonotus tricolor Wei gi|485963924|gb|KC505570.1| Stereum hirsutum gi|213159519|gb|EU851110.1| Stereum hirsutum 1

Figure 13. An ITS phylogeny of Inonotus spp. “Taxon 7” and “Taxon 8”. Inonotus sp. “Taxon 8” formed a well-supported clade (100%) with an American isolate of Inonotus rickii . “Taxon 7” formed a well-supported clade with a bootstrap support value of 100%.

This document is confidential and any unauthorised disclosure is prohibited. Final report 65

Figure 11. Fruit body (a) and pigmented basidiospores (b) of Fomitiporella sp. “Taxon 1”. Fruit body (c), basidium with immature basidiospores and hymenial setae (d) of Inonotus sp. “Taxon 7”. Primordial fruit body formed in vitro featuring visible setae (e), hymenium and setae (f) and chlamydospores (g) of Inonotus sp. “Taxon 8”.

This document is confidential and any unauthorised disclosure is prohibited. Final report 66

Milestone 4(a): Toxic secondary metabolite production by Basidiomycete fungi which are involved with pathogenesis. Representative isolates of all ten Basidiomycete taxa were able to produce 4-hydroxybenzaldehyde, a toxin thought to be involved in pathogenicity (Fig. 12; White et al). To investigate the significance of this, cultures of Fomitiporia mediterranea , F. australiensis , F. polymorpha , Fomitiporella vitis , Phellinus alni , P. igniarius and Inocutis jamaicensis , as well as four F. mediterranea isolates with a known history of 4-hydroxy-benzaldehyde were obtained from international collaborators to be used in comparison studies; Fomitiporia mediterranea (45/23, the type culture; Fischer 2002), F. australiensis (22485, 22486; Fischer et al ., 2005), F. polymorpha (91-42/2; Fischer & Binder 2004), Fomitiporella vitis (Fischer 2006), Phellinus alni (TW162; Fischer & Binder 2004), P. igniarius (83-1022; Fischer 2006) and Inocutis jamaicensis (Arg10; Fischer 2006) were obtained from Dr. Michael Fischer in Germany. F. mediterranea isolates FP1, Fp2, 1413 and 474 with a known history of 4-hydroxy-benzaldehyde (4-HB) production were obtained from Dr. Abou-Mansour (University of Fribourg, Switzerland). The idea was to compare 4-hydroxybenzaldehyde production of South African isolates with isolates associated with esca and related pathogens from Europe, Australia, North and South America.

In this second round of trials, the uninoculated control (Potato Dextrose Broth) and negative Trichoderma controls had much higher levels 4-HB present than the South African basidiomycete isolates. Cultures of Fomitiporia mediterranea obtained from Dr. Eliane Abou- Mansour as references were used for extractions and detection of 4-HB (Fig. 13). The first attempt had higher levels of 4-HB in the Trichoderma isolate and the uninoculated control (PDB) and very low levels in the reference isolates. These results were completely unexpected since Trichoderma is a biological control agent and there should definitely not be any toxins in the control. The second extraction was made from isolates grown on Czapek broth, an anorganic growth medium. Once again, the uninoculated broth control had higher levels of 4-HB than the reference isolates. A round of extractions was done on six uninoculated controls, namely Malt Extract Broth (MEB), Cabernet cane extract (CE), carrot broth (CB), PDB (pH adjusted to 3), PDB (pH not adjusted) and sterile water. Similar low levels of 4-HB were found for the carrot broth, both PDBs and the sterile water, suggesting that even filtered, double-autoclaved water is contaminated. However, since lower levels of 4-HB were found in basidiomycetes than in uninoculated controls in all trials, it may be surmised that basidiomycetes have some kind of interaction with the molecule. The low levels obtained in all trials compared to levels found in literature suggest that 4-HB plays no credible role in the pathogenecity of these organisms.

Milestone 4(b): Hydrolytic enzyme production by Basidiomycete fungi which are involved with wood degradation . Enzyme tests conducted with representative isolates of the ten “unknown” Basidiomycetes showed that all these taxa produce enzymes which are able to degrade cellulose and lignin both of which are structural components of wood. Some of the Basidiomycete isolates were able to produce lignin peroxidase, and the majority of the isolates were able to produce manganese peroxidase and laccase. All the basidiomycete isolates were able to produce cellulase and none were able to produce xylanase (White et al). Cultures of Fomitiporia mediterranea , F. australiensis , F. polymorpha , Fomitiporella vitis , Phellinus alni , P. igniarius and Inocutis jamaicensis were then tested in a second round of in vitro assays (Table 12) to compare these reference isolats with South African isolates . In vitro assays for cellulase, laccase, lignin peroxidase and manganese peroxidase were performed and results analysed. All isolates, including the reference isolates, were able to produce cellulase, with isolates representing South African taxon 1 and 3 producing the most (Fig 14). Likewise all isolates were able to produce laccase (Table 13). White et al. found that single isolates of SA taxa 1, 3 and both isolates of taxon 8 did not produce laccase. Manganese

This document is confidential and any unauthorised disclosure is prohibited. Final report 67

peroxidase was produced by all the reference isolates (Table 13). SA taxon 4 produced no manganese peroxidase, in line with White et al., and taxon 3 and the Phellinus sp. were less likely to produce it (Table 13). White found variation within taxon 3, in line with the later findings, but didn’t find any variation in the Phellinus sp.’s ability to produce it. Taxon 3 and taxon 4 were unable to produce lignin peroxidase (Table 13). White et al. found that taxa 3, 4, 5, 6, 7 and 8 were unable to produce lignin peroxidase. Among the reference isolates, Phellinus alni , P. igniarius and Inonotus hispidus were unable to produce lignin peroxidase (Table 13). South African taxa therefore compared well with other well known Basidiomycete pathogens that are associated with esca or other well known diseases.

Figure 12. A summary of 4-hydroxybenzaldehyde concentrations found in South African basidiomycete liquid cultures compared to the biological control agent Trichoderma T6514, T6515, Eco77 and an uninoculated Potato dextrose broth as control (White, MSc Thesis).

This document is confidential and any unauthorised disclosure is prohibited. Final report 68

Figure 13. A summary of results obtained during the current report year (PhD student M. Cloete); 4-hydroxybenzaldehyde concentrations in Dr. Abou-Mansour’s reference F. mediterranea isolates FP1, Fp2, 1413 and 474, as well as several controls, namely T1 Trichoderma , uninoculated PD broth and uninoculated Czapek broth. A final test was performed on six different uninoculated “controls”, namely Malt Extract Broth (MEB), Cabernet cane extract (CE), carrot broth (CB), PDB (pH adjusted to 3), PDB (pH not adjusted) and sterile water. These results, based on several repeats and various controls lead us to believe that this compound is not involved with pathogenicity

This document is confidential and any unauthorised disclosure is prohibited. Final report 69

Table 12. Isolates used during in vitro enzyme assays. Isolate Taxon MF1 Fomitiporia mediterranea 45/23 MF2 Fomitiporia australiensis 22485 MF3 Fomitiporia australiensis 22486 MF4 Phellinus alni TW 162 MF5 cf. Fomitiporella vitis, "Chile.I" MF6 Fomitiporia polymorpha 91-42/2 MF7 Inocutis jamaicensis "ARG 10" MF8 Phellinus igniarius 83-1022 MF9 Inonotus hispidus 1 Taxon 1 270 Taxon 1 288 Taxon 1 300 Taxon 2 301 Taxon 2 285 Taxon 2 216 Taxon 3 261 Taxon 3 327 Taxon 3 7 Taxon 4 8 Taxon 4 244 Taxon 5 275 Taxon 5 295 Taxon 5 256 Taxon 6 258 Taxon 6 175 Taxon 7 315 Taxon 7 211 Taxon 7 319 Fomitiporia capensis 189 Fomitiporia capensis 259 Fomitiporia capensis 62 Phellinus resupinatus 210 Phellinus resupinatus 194 Phellinus resupinatus

This document is confidential and any unauthorised disclosure is prohibited. Final report 70

Table 13. The production 1 of manganese peroxidase, lignin peroxidase and laccase by the selected basidiomycete isolates. Manganese peroxidase 80 Lignin Isolate ppm 100ppm peroxidase Laccase MF1 1 1 1 1 MF2 1 1 1 1 MF3 0/1 0/1 1 1 MF4 1 1 0 1 MF5 1 1 1 1 MF6 1 1 1 1 MF7 0/1 0/1 1 1 MF8 0/1 0/1 0 1 MF9 1 0/1 0 1 1 0/1 1 1 1 270 0/1 1 1 1 288 1 1 1 1 285 1 1 1 1 300 1 1 1 1 301 1 1 1 1 216 0 0/1 0 1 261 0/1 0/1 0 1 327 1 0/1 0 1 7 0 0 0 1 8 0 0 0 1 244 0 0 0/1 1 275 0/1 0/1 1 1 295 0/1 1 1 1 256 0 0 1 1 258 1 1 1 1 175 1 1 1 1 211 1 1 1 1 315 0/1 0/1 1 1 266 1 1 0/1 1 189 0/1 1 1 1 259 1 1 1 1 319 1 1 1 1 62 1 1 1 1 210 0/1 0/1 1 1 194 0/1 0/1 1 1 1 If all six plates produced a positive result, 1 was denoted. If five or less plates were positive, 1/0 was denoted and 0 if no enzymes were produced.

This document is confidential and any unauthorised disclosure is prohibited. Final report 71

Figure 14. The ratio of the colony diameter to the size of the halo produced by cellulase in vitro .

Milestone 5: Pathogenicity trials The lesion lengths on all inoculated plants did not differ significantly from the control lesions in Shiraz (Table 14) and there was no significant difference between taxa (p=0.6340) or isolates (p=0.3978). In Mourvedre, only Taxon 3 was able to form lesions which differed significantly from the control (p<0.0001) (Table 15) and there was no significant difference between isolates (p=0.795). Between the two grapevine cultivars, no statistically significant variation could be observed between lesion lengths (p=0.407). This might be an indication of a plant response to the wounding process prior to inoculation.

The extent of rot observed on Shiraz (LSD=3.3167) was significantly less than that observed in Mourvedre (LSD=11.563). In Shiraz, there was a difference between taxa (p=0.0083) and taxon 6, Phellinus and taxon 7 proved virulent (Table 16). Single isolates of taxa 6, 7 and Phellinus proved virulent, with average rot lengths statistically differing from the controls. There was a difference between isolates within a taxon (p=0.03), with some isolates not differing significantly from the controls (Fig. 15).

In Mourvedre, there was less variation between isolates (p=0.1838) than in Shiraz. All three isolates of taxon 3 proved virulent, with average rot lengths statistically differing from the controls. A single isolate of taxon 5 was also virulent (Fig. 16). There was variation between taxa (p<0.0001) and taxon 3 and taxon 2 proved virulent in comparison to controls (Table 17).

This document is confidential and any unauthorised disclosure is prohibited. Final report 72

During reisolation, differences were observed between the cultivars. A relatively low reisolation percentage was seen in Shiraz with 27% of isolates recovered from the field. This was slightly higher than the percentage of samples in which rot was observed (19.6%). In Mourvedre, 65% of isolates were recovered from the field and rot was observed in 48.6% of samples. The ratio of percentage samples in which rot were seen to the percentage of reisolation was similar in both cultivars, suggesting a link between establishment of the fungus and the development of symptoms. The higher rate of reisolation in Mourvedre seems to indicate that the Hymenochaetales taxa which were inoculated during the trial will favour establishment in the cultivar. This may be due to several factors or combinations of factors, including, but not limited to, differences in wood physiology, host response and the condition of the inoculation block.

Discussion It is important to mention that these results must be seen in context of other similar trials with Basidiomycete fungi where it took up to seven years of inoculation before symptoms appeared. We were therefore extremely lucky to get some indication within a two-year period. Although these results are limited to some extent, our trial demonstrated considerable variation between the two cultivars, as well as differences between isolates of the same species. We can also conclude that all ten Basidiomycete taxa are pathogenic due to their ability to produce rot, but acknowledge that considerable variation might occur within each taxon.

Table 14. Lesion lengths between taxa on Shiraz (LSD= 8.3261). T-grouping Mean N Taxon a 44.002 10 NEG a 41.497 30 Taxon 2 ab 40.104 10 NUL ab 38.635 29 Taxon 1 ab 38.11 29 Taxon 5 ab 38.057 19 Taxon 6 ab 37.899 30 Taxon 3 ab 37.813 30 Taxon 7 ab 36.506 30 F. capensis ab 36.023 19 Taxon 8 ab 35.933 30 P. resupinatus b 32.506 19 Taxon 4

This document is confidential and any unauthorised disclosure is prohibited. Final report 73

15. Lesion lengths between taxa on Mourvedre (LSD=12.202). T-grouping Mean N Taxon a 65.668 30 Taxon 3 b 37.511 10 NEG bc 36.575 20 Taxon 4 bc 33.552 30 Taxon 7 bc 32.646 30 Taxon 1 bc 31.549 30 Taxon 5 bcd 29.346 30 F. capensis bcd 28.682 18 Taxon 8 bcd 28.146 30 Taxon 2 bcd 26.315 30 P. resupinatus cd 24.465 20 Taxon 6 d 18.303 10 NUL

Table 16. Rot lengths between taxa on Shiraz (LSD=3.217).

T-grouping Mean N Taxon a 5.817 19 Taxon 6 ab 3.7 30 P. resupinatus abc 3.384 30 Taxon 7 bcd 2.431 29 Taxon 5 bcd 2.031 30 Taxon 3 bcd 1.945 19 Taxon 8 bcd 1.871 29 Taxon 1 cd 0.322 29 F. capensis cd 0.231 30 Taxon 2 cd 0.206 19 Taxon 4 d 0 9 NUL d 0 10 NEG

Table 17. Rot lengths between taxa on Mourvedre (LSD=11.563).

T-grouping Mean N Taxon a 40.869 30 Taxon 3 b 12.009 30 Taxon 2 bc 11.069 30 Taxon 1 bc 10.138 29 Taxon 5 bc 7.278 29 P. resupinatus bc 7.171 29 Taxon 7 bc 6.216 20 Taxon 4 bc 5.397 26 F. capensis bc 3.571 19 Taxon 6 bc 1.428 18 Taxon 8 c 0 7 NUL c 0 8 NEG

This document is confidential and any unauthorised disclosure is prohibited. Final report 74

Figure 15. Rot lengths between isolates on Shiraz.

Figure 16. Rot lengths between isolates on Mourvedre.

This document is confidential and any unauthorised disclosure is prohibited. Final report 75

Milestone 6: Spore trapping Identification of the basidiocarps being monitored in the spore trap studies proved to be very difficult. Identification was made by isolating mycelium from the basidiocarps and by cloning and sequencing the ITS-region from those isolates. Although 28 basidiocarps could be identified, 10 could not be identified since DNA isolation from these basidiocarps proved to be problematic. This has necessitated optimization of the DNA isolation protocol. Identifications were also made based on fruiting body and spore morphology. Basidiocarp isolates that have been identified include 27 specimens of “Taxon 1”, one Fomitiporia sp. identified by means of morphology and one isolate that seems closely related to Fomitiporia mediterranea and may possibly be F. pseudopunctata , an isolate found in Southern Europe and Africa which cannot be distinguished from F. mediterranea using the ITS region.

Weather data for the seasons 2010 and 2011 were compared with each other in order to find possible differences between the two years (Fig. 17 - 19). The two seasons were very similar in terms of weather though 2010 was slightly drier than 2011 and much hotter after September. Although drier on average, 2010 had bigger rainfall “spikes” throughout the trapping period.

Spore counts were bulked together for Taxon 1 and Fomitiporia, respectively, since the Fomitiporia fruit bodies released much larger numbers of spores in general. Spore counts may be seen in Fig. 20 - 23. During 2010, Taxon 1 had available spores throughout the trapping season with peaks in the first week of July and third week of September (Fig.20). In 2011, Taxon 1’s spore availability declined from higher levels in winter to very low levels in spring and early summer (Fig. 21). Fomitiporia had high levels of spores availability for the first 13 weeks in 2010 after which it flattened out (Fig. 22), but in 2011 spore levels peaked twice (at week 3 of June and week 2 of September) and stayed mostly low throughout the rest of the season (Fig. 23). In the case of the Fomitiporia , this phenomenon may be explained by manual trauma to the basidiocarp during the off-season since only two structures were used for trapping.

When viewing the results of the spore counts on both taxa over both seasons (Fig. 20 - 23), it is clear that sporulation occurs at a high rate from the fourth week of May to the end of September and that sporulation tapers off towards summer. This latter result was in accordance with expectations, as the physical drying out of fruiting bodies may be observed in the field from mid to late summer (December to February). The high rate of available spores observed from May to September means that basidiospores are available for infection of wounds left by pruning (July-August) and suckering (September-October).

Figure 17. Average temperature at Nietvoorbij between May and Nov 2010 and 2011. 2010 was considerably warmer than 2011 after Sept .

This document is confidential and any unauthorised disclosure is prohibited. Final report 76

Figure 18. Total rainfall at Nietvoorbij between May and Nov 2010 and 2011. No significant difference was observed between seasons, though 2010 was slightly drier.

Figure 19. RH at Nietvoorbij between May and Nov 2010 and 2011. No significant difference between seasons, though the RH in 2010 was slightly lower which is expected due to the slight difference in total rainfall between the two seasons.

This document is confidential and any unauthorised disclosure is prohibited. Final report 77

Taxon 1 (2010)

140 80

120 70 60 100 50 80 40 C), RH (%) RH C), Total Rain (mm) 60 30 Total Spores 40

Spores observed Spores 20 Temp ( Temp Average RH (%) 20 10 Average Temp (°C) 0 0

Week

Figure 20. Total spores observed for all fruiting bodies identified as Taxon 1 during the trapping season of 2010.

Figure 21. Total spores observed for all fruiting bodies identified as Taxon 1 during the trapping season of 2011.

This document is confidential and any unauthorised disclosure is prohibited. Final report 78

Figure 22. Total spores observed for all fruiting bodies identified as Fomitiporia sp. during the trapping season of 2010.

Figure 23. Total spores observed for all fruiting bodies identified as Fomitiporia sp. during the trapping season of 2011.

This document is confidential and any unauthorised disclosure is prohibited. Final report 79

Milestone 7: Development of a PCR detection system for the discrimination between Basidiomycetous isolates (Hymenochaetales) associated with esca of grapevine In order to design a PCR based detection system for discrimination between the 10 different taxa previously identified (White et al ., 2011), an alignment was constructed using DNA sequences corresponding to the 5.8 S rRNA genomic region including the two flanking internal transcribed spacers (ITS1 and ITS2) (collectively referred to as the ITS region) from all the isolates (Table 3) analysed by White et al ., (2011) (see Materials and Methods). The aim was to develop a primer pair consisting of a unique forward primer for each taxon that exclusively recognise members of such a specific taxon, combined with the universal reverse primer ITS4 (White et al ., 1990). By visual inspection areas within ITS1 and ITS2 were identified that (1) displayed maximum variability between taxa but (2) did not contain any sequence differences between all members of a specific taxon. Primers were designed to all have similar properties with regards to percentage GC content and melting temperature increasing the potential for the use of universal PCR cycling conditions (Table 4). Due to the distribution of sequence diversity within the alignment the taxon specific forward primers bind in different areas with ITS1 and ITS2 resulting in different expected amplicon sizes using the various taxon specific primer pairs (Table 5). In order to test specificity, each primer set was tested using genomic DNA from one member of each taxon as well as a selection of other Ascomycetous and Basidiomycetous fungi associated with grapevine trunk disease (Table 3). A control PCR was performed using the universal primers ITS1-F (Gardes & Bruns, 1993) and ITS4 (White et al ., 1990) as well as cycling conditions with stepwise decreasing annealing temperatures (referred to as “touchdown 1”, see Table 6) in order to amplify the whole ITS region from all these samples. As shown in Figure 24 amplification was obtained for all samples demonstrating that in all cases the DNA was of sufficient quality for ITS amplification. Using the same sample set and cycling conditions all the different taxon specific primer pairs were tested. With exception of primers designed for taxa 5 and 6, each primer pair exclusively amplified the corresponding taxon specific isolate it was designed for, with no other amplification for other Ascomycetous or Basidiomycetous isolates (Fig. 25 and 26). To address this inability to differentiate between taxa 5 and 6 we modified the PCR cycling conditions (referred to as “touchdown 2”, see Table 6) which enabled the specific detection of taxon 6 but not taxon 5 (Figure 27). Taxon 5 specific detection could not be obtained through any further modifications of PCR cycling conditions (data not shown). Finally we tested for the detection of all taxon members using the corresponding taxon specific primer set and PCR programme “touchdown 1”. As shown in Figure 28 all isolates from each of the 10 taxa were successfully detected.

Discussion In this study we develop a PCR detection system of primers and PCR cycling conditions for the specific detection of Basidiomycetous isolates from diseased grapevine on taxon (as described by White et al (2011)) level. We demonstrate the exclusive detection of all tested taxon members using the corresponding designed primer sets with the exception of taxon 5 and 6. Isolates from taxa 5 and 6 are very similar as shown by phylogenetic analysis (White et al ., 2011). However with the use of modified PCR cycling conditions and a process of elimination efficient detection and discrimination between isolates belonging to these taxa is demonstrated.

This document is confidential and any unauthorised disclosure is prohibited. Final report 80

Figure 24. ITS amplification of all isolates representing a member of each of the ten Hymenochaetales taxa, as well as other Ascomycetous and Basidiomycetous fungi associated with grapevine trunk diseases.

This document is confidential and any unauthorised disclosure is prohibited. Final report 81

Figure 25. Taxon-specific primer pairs amplify specific taxon members. Each primer pair was tested against a panel of isolates the same as shown in Figure 1. Shown here are the results for primer pairs specific for taxon 1-5 using PCR programme “touchdown 1”.

This document is confidential and any unauthorised disclosure is prohibited. Final report 82

Figure 26. Taxon-specific primer pairs amplify specific taxon members. Each primer pair was tested against a panel of isolates the same as shown in Figure 1. Shown here are the results for primer pairs specific for taxon 6-10 using PCR programme “touchdown 1”.

This document is confidential and any unauthorised disclosure is prohibited. Final report 83

Figure 27. PCR amplification of taxon 5 and 6 isolates using either taxon 5 or 6 specific primer pairs with the PCR programme “touchdown 2”. Only taxon specific amplification for taxon was obtained.

This document is confidential and any unauthorised disclosure is prohibited. Final report 84

Figure 28. All members of each taxon are amplified with its corresponding taxon-specific primer pair. PCR cycling conditions: “touchdown 1”.

Literature cited Damm U., L. Mostert, P.W. Crous and P.H. Fourie, 2008. Novel Phaeoacremonium species associated with necrotic wood of Prunus trees. Persoonia 20: 97–102.

Gardes M. and T.D. Bruns, 1993. ITS primers with enhanced specificity for Basidiomycetes: application to identification of mycorrhizae and rusts. Mol Ecol 2: 113-118.

Hall T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser 41:95-98.

Larkin M.A., G. Blackshields, N.P. Brown, R. Chenna, P.A. McGettigan, H. McWilliam, F. Valentin, I.M. Wallace, A. Wilm, R. Lopez, J.D. Thompson, T.J. Gibson and D.G. Higgins, 2007. Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947-2948.

This document is confidential and any unauthorised disclosure is prohibited. Final report 85

White T.J., T. Bruns, S. Lee and J. Taylor, 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols, a Guide to Methods and Applications (Innis M.A., Gelfand D.H., Sninsky J.J., ed.), Academic Press Inc., New York, NY, USA, 315–322.

White C., F. Halleen, M. Fischer and L. Mostert, 2011. Characterisation of the fungi associated with esca diseased grapevines in South Africa. Phytopathologia Mediterranea 50 (Supplement), 204–223.

This document is confidential and any unauthorised disclosure is prohibited. Final report 86

Complete the following table

Milestone Target Date Extension Date Date Completed Achievement 1. Occurrence of esca Esca occurs in all the major grape 31/03/2013 disease in South Africa growing areas of South Africa. 377 Basidiomycete isolates were obtained, 140 of which were subjected to phylogenetic analysis. Ten unique groups (Taxa) among genera of the Hymenochaetales were identified. Other species associated with esca symptoms include (ranked from highest incidence) Phaeomoniella chlamydospora , Phaeoacremonium spp., Botryosphaeriaceae spp., Eutypa 2. Characterisation of lata , Phomopsis spp. and Basidiomycete and Pleurostomphora richardsiae . Six other wood invading 31/03/2013 Phaeoacremonium spp. were fungi associated with identified. This is the first report of the disease Phaeoacremonium iranianum , P. mortoniae and P. sicilianum in South Africa. Diplodia seriata (pathogenic) was the most common Botryosphaeriaceae spp., while the more pathogenic Neofusicoccum parvum and N. australe occurred less frequently. The virulent Phomopsis viticola was the most common of the three Phomopsis species identified. Fomitiporia capensis and Phellinus resupinatus were described as new species. Description of Fomitiporella sp. (Taxon1) is in an advanced stage. 3. Taxonomic A specimen appearing to be a descriptions of the new representative of Taxon 7 was 31/03/2013 Basidiomycete found on an alternative host and species. the species appears morphologically identical to Inonotus setulosocroceus . Taxon 8 was identified as representing the anamorph stage of Inonotus rickii , Ptychogaster cubensis . 4. Comparison of Extensive studies investigating toxins and enzymes the possible role of 4-hydroxy- produced by South 31/03/2013 benzaldehyde lead us to believe African isolates with that this toxin is not involved in those of other pathogenicity as earlier proposed

This document is confidential and any unauthorised disclosure is prohibited. Final report 87

countries. by literature. The role of enzymes is much more important. Enzyme activity of South African isolates was compared with overseas isolates associated with esca and related diseases in Europe, South- and North America and Australia. All isolates were able to produce cellulase and laccase. There was a difference in manganese peroxidase and lignin peroxidase production between the reference isolate and some South African isolates. Inoculations with representative isolates of 10 Basidiomycete taxa were carried out in a Shiraz and Mourvedre vineyard in Stellenbosch. Results revealed a significant difference between the pathogenicity status of the 5. Pathogenicity trials 31/03/2013 different taxa and between the susceptibility of the cultivars inoculated. However, all ten have the ability to survive within grapevine wood after inoculation and cause internal discolouration and rot. Spore trapping studies conducted in two vineyards in Stellenbosch showed that basidiospores were 6. Spore trapping 31/03/2013 released at a high rate from the studies end of May to the end of September whereafter it declined towards summer. A PCR detection system was developed for the discrimination between the 10 Basidiomycee 7. Development of a taxa found in South African 31/03/2013 PCR detection system vineyards as well as other Basidiomycetes associated with esca and esca-related diseases from around the world.

Accumulated outputs List ALL the outputs from the start of the project. The year of each output must also be indicated.

Conclusions Esca is one of the most underrated diseases in South Africa. It affects all grapevine cultivars and occurs in every production area of the country. Within the South African context it is clear that several Basidiomycete fungi are capable of fulfilling the role of esca pathogen. Spore trapping studies revealed that spores are released from fruiting bodies at large numbers from the end of May until the end of September which coincides with our traditional pruning periods.

This document is confidential and any unauthorised disclosure is prohibited. Final report 88

Farmers are therefore urged to apply pruning wound protection in order to prevent these infections. Furthermore, strict sanitation practices must be followed to remove inoculum sources from vineyards. Disease-affected arms or dead plants must be removed and wounds treated to prevent further infections.

Technology development, products and patents Indicate the commercial potential of this project, eg. Intellectual property rights or commercial product(s) A PCR detection system was developed for the discrimination between the 10 Basidiomycee taxa found in South African vineyards.

Suggestions for technology transfer List any suggestions you may have for technology transfer

Human resources development/training Indicate the number and level (eg. MSc, PhD, post doc) of students/support personnel that were trained as well as their cost to industry through this project. Add in more lines if necessary.

Student level (BSc, MSc, PhD, Post doc) Cost to Project 1. Chana-Lee White (MSc, 2010) R0 2. Mia Cloete (started 2010) R0 3.

Publications (popular, press releases, semi-scientific, scientific) Scientific Publications: Characterisation of the fungi associated with esca diseased grapevines in South Africa. C. White, F. Halleen M. Fischer & L. Mostert. Phytopathologea Mediterranea (2011) 50: 204-223.

Symptoms and fungi associated with esca in South African vineyards. C. White, F. Halleen & L. Mostert. Phytopathologia Mediterranea (2011) 50: 236-246

A novel Fomitiporia species associated with esca on grapevine in South Africa. M. Cloete, M. Fischer, L. Mostert and F. Halleen. Mycological Progress (2014) 13: 303-311

A novel Phellinus species associated with esca on grapevine in South Africa. M. Cloete, M. Fischer, L. Mostert & F. Halleen. Mycological Progress (submitted)

Taxonomic and ecological novelties in Inonotus s.l. species associated with white rot of grapevines in South Africa. M. Cloete, M. Fischer, L. Mostert & F. Halleen. Fungal Diversity (In prep)

Popular Publications: WineLand (August 2011, pp. 90). Wingerd stamsiekte navorsing bevoordeel deur Suid- Afrika/Duitsland samewerking. F. Halleen

Press Releases:

This document is confidential and any unauthorised disclosure is prohibited. Final report 89

LandbouBurger (15 April 2011). Duitse deskundige hier oor wingerd-stamsiekte. F. Halleen

LandbouBurger (12 October 2012). SA navorsers deel hul werk op oorsese verhoë. F. Halleen

Presentations/papers delivered Papers delivered at international conferences: 10 th International Mycological Congress (3-8 August 2014, Bangkok, Thailand) A PCR detection system for the discrimination between Basidiomycetous isolates (Hymenochaetales) associated with grapevine trunk disease. M. Bester, M. Cloete, L. Mostert & F. Halleen

XXth AETFAT Congress (13-17 January 2014, Stellenbosch) Diversity in basidiomycetes associated with esca disease of grapevines in South Africa. M. Cloete, M. Fischer, L. Mostert & F. Halleen

8th International Workshop on Grapevine Trunk Diseases. Valencia. Spain. 18 June 2012. Basidiomycetes associated with esca in South Africa. M. Cloete, M. Fischer, L. Mostert & F. Halleen.

7th International Workshop on Grapevine Trunk Diseases (17-21 January 2010, Santa Cruz, Chile). Basidiomycetes and other fungi associated with esca diseased grapevines in South Africa. C. White, F. Halleen, M. Fischer & L. Mostert

Papers delivered at national conferences: 36th SASEV Congress (12-14 November 2014, Somerset West). Determining the pathogenicity of Basidiomycetes causing white rot associated with esca on mature grapevines. M. Cloete, M. Bester, M. Fischer, L. Mostert and F. Halleen

34th SASEV Congress (14-16 November 2012, Simondium). Progress made on the identification and biology of Basidiomycete fungi associated with esca in South African vineyards. M. Cloete, M. Fischer, F. Halleen & L. Mostert

46 th Congress of the Southern African Society for Plant Pathology (25-28 January 2009, Gordon’s Bay). Characterization of fungi associated with ESCA of grapevines in South Africa. C. White, F. Halleen & L. Mostert

Poster presentations at international conferences: 8th International Workshop on Grapevine Trunk Diseases. Valencia. Spain. 18-21 June 2012. A novel Fomitiporia sp. associated with esca on grapevine in South African vineyards. M. Cloete, M. Fischer, L. Mostert, F. Halleen.

Poster presentations at national conferences: 48th Congress of the Southern African Society for Plant Pathology (20-24 Jan 2013, Bela Bela). Industrial X-ray computed tomography as an aid to the study of wood rot symptoms associated with esca disease in grapevines. M. Cloete, F. Halleen & L. Mostert

This document is confidential and any unauthorised disclosure is prohibited. Final report 90

4th International SASEV Conference on Enology and Viticulture – Beyond 2010 (28-30 July 2009, CTICC, Cape Town). Esca disease, a threat to the longevity of grapevines. C. White, F. Halleen, M. Fischer & L. Mostert

Other presentations (international invitations): Instituto Federal, Rio Grande do Sul, Brazil (28 October 2013) Grapevine Trunk Diseases: A South African perspective. F. Halleen

Julius-Kühn-Institut, Invited lecture (Geilweilerhof, Germany, 17 August 2010) Grapevine diseases and viticulture in South Africa. F. Halleen & L. Mostert

Universidad de Chile (Santiago, Chile, 28 January 2010) Esca: research approach at ARC Infruitec-Nietvoorbij. F. Halleen

Other presentations (national): University of Stellenbosch (Dep. Plant Pathology, 25 April 2014) Diversity in Basidiomycetes associated with esca disease of grapevines in South Africa. M. Cloete, M. Fischer, L. Mostert & F. Halleen

University of Stellenbosch (Dep. Plant Pathology, 27 Sept. 2013) A novel Phomitiporella sp. associated with esca in the Western Cape. M. Cloete, M. Fischer, L. Mostert & F. Halleen

VinPro Regional Information Day (6, 7, 8, 13 Aug en 4 Sept. 2013) Most important grapevine trunk disease pathogens in South Africa. F. Halleen

University of Stellenbosch (Dep. Plant Pathology, 31 May 2013) Pathogenicity studies on several South African Hymenochaetales associated with esca on grapevine. M. Cloete, L. Mostert & F. Halleen

University of Stellenbosch (Dep. Plant Pathology, 2 November 2012) Basidiospore release in two Stellenbosch vineyards 2010-2011. M. Cloete, M. Fischer, L. Mostert & F. Halleen

THRIP Audit (ARC Infruitec-Nietvoorbij, Stellenbosch, 28 August 2012) Epidemiology and etiology of esca on grapevine in South Africa. F. Halleen

ARC Infruitec-Nietvoorbij Information Day (Stellenbosch, 26 July 2012) Grapevine trunk disease research. F. Halleen

SASPP Western Cape PhD Research Day (Stellenbosch, 17 July 2012) A novel Fomitiporia sp. associated with esca in South African vineyards. M. Cloete, M. Fischer, L. Mostert, F. Halleen

This document is confidential and any unauthorised disclosure is prohibited. Final report 91

University of Stellenbosch (Friday Forum, Departement of Plant Pathology, 20 April 2012). Secondary metabolites associated with esca basidiomycetes: the 4-Hydroxybenzaldehyde dilemma. M. Cloete, L. Mostert, F. Halleen

University of Stellenbosch (Friday Forum, Departement of Plant Pathology, 23 September 2011). A novel Fomitiporia sp. associated with esca on grapevine in the Western Cape. M. Cloete, M. Fischer, L. Mostert, F. Halleen

ARC Infruitec-Nietvoorbij (15 March 2011) Field demonstration of grapevine trunk diseases to University of Stellenbosch, Dep. Plant Pathology, PP478 students. F. Halleen

VinPro Regional Information Days (4, 5, 6, 11 & 12 May 2010, Vredendal, Malmesbury, Worcester, Robertson, Stellenbosch) Root and trunk diseases (Robertson/Klein Karoo): Do we have all the answers? F. Halleen, P.H. Fourie, L. Mostert, A. McLeod, J.M. Van Niekerk, C. Spies, C. Kotze, C. Mutawila, C. White

Winetech – visit to Nietvoorbij (Stellenbosch, 18 November 2009) Grapevine trunk disease research. F. Halleen

University of Stellenbosch (Dep. Plant Pathology, Friday Forum, 9 September 2009) Secondary metabolite and enzyme characterization of the basidiomycetes involved in esca. C. White, L. Mostert & F. Halleen

Terason - Grapevine Training Course (Wellington, 12 Junie2009) Wood rotting fungi. F. Halleen

University of Stellenbosch (Friday Forum, Dep. Plant Pathology, 17 April 2009) Characterization of fungi associated with esca of grapevines in South Africa. C. White, L. Mostert & F. Halleen

Total cost summary of the project

TOTAL COST IN REAL COST CFPA DFTS Deciduous SATI Winetech THRIP OTHER TOTAL TERMS

YEAR 1 102959 107162 210122

YEAR 2 127954 133179 261133

YEAR 3 135631 141168 276799

YEAR 4 146481 152461 298942

TOTAL 513025 533970 1046996

This document is confidential and any unauthorised disclosure is prohibited.