The Role of Autophagy in Chemical Proteasome Inhibition Model of Retinal Degeneration

International Journal of Molecular Sciences

Article The Role of Autophagy in Chemical Proteasome Inhibition Model of Retinal Degeneration

Merry Gunawan 1, Choonbing Low 1, Kurt Neo 1, Siawey Yeo 2, Candice Ho 3, Veluchamy A. Barathi 2,4,5, Anita Sookyee Chan 3, Najam A. Sharif 6 and Masaaki Kageyama 1,*

1 Santen-SERI Open Innovation Centre, 20 College Road, The Academia, Singapore 169856, Singapore; [email protected] (M.G.); [email protected] (C.L.); [email protected] (K.N.) 2 Translational Pre-Clinical Model Platform, Singapore Eye Research Institute, 20 College Road, The Academia, Singapore 169856, Singapore; [email protected] (S.Y.); [email protected] (V.A.B.) 3 Singapore Eye Research Institute, 20 College Road, The Academia, Singapore 169856, Singapore; [email protected] (C.H.); [email protected] (A.S.C.) 4 Department of Ophthalmology, Yong Loo Lin School of Medicine, National University of Singapore, 21 Lower Kent Ridge Road, Singapore 119077, Singapore 5 Academic Clinical Program in Ophthalmology, Duke-NUS Medical School, 8 College Road, Singapore 169857, Singapore 6 Global Alliance and External Research, Santen Inc., Emeryville, CA 94608, USA; [email protected] * Correspondence: [email protected]

Abstract: We recently demonstrated that chemical proteasome inhibition induced inner retinal degeneration, supporting the pivotal roles of the ubiquitin–proteasome system in retinal structural integrity maintenance. In this study, using beclin1-heterozygous (Becn1-Het) mice with autophagic dysfunction, we tested our hypothesis that autophagy could be a compensatory retinal protective mechanism for proteasomal impairment. Despite the reduced number of autophagosome, the Citation: Gunawan, M.; Low, C.; ocular tissue morphology and intraocular pressure were normal. Surprisingly, Becn1-Het mice Neo, K.; Yeo, S.; Ho, C.; Barathi, V.A.; experienced the same extent of retinal degeneration as was observed in wild-type mice, following an Chan, A.S.; Sharif, N.A.; Kageyama, M. The Role of Autophagy in intravitreal injection of a chemical proteasome inhibitor. Similarly, these mice equally responded to Chemical Proteasome Inhibition other chemical insults, including endoplasmic reticulum stress inducer, N-methyl-D-aspartate, and Model of Retinal Degeneration. Int. J. lipopolysaccharide. Interestingly, in cultured neuroblastoma cells, we found that the mammalian Mol. Sci. 2021, 22, 7271. https:// target of rapamycin-independent autophagy activators, lithium chloride and rilmenidine, rescued doi.org/10.3390/ijms22147271 these cells against proteasome inhibition-induced death. These results suggest that Becn1-mediated autophagy is not an effective intrinsic protective mechanism for retinal damage induced by insults, Academic Editor: Tomoaki Ishigami including impaired proteasomal activity; furthermore, autophagic activation beyond normal levels is required to alleviate the cytotoxic effect of proteasomal inhibition. Further studies are underway Received: 31 May 2021 to delineate the precise roles of different forms of autophagy, and investigate the effects of their Accepted: 30 June 2021 activation in rescuing retinal neurons under various pathological conditions. Published: 6 July 2021

Keywords: proteasome inhibition; autophagy; retinal degeneration; neuroprotection Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional afﬁl- iations. 1. Introduction The accumulation of toxic protein aggregates is a hallmark feature of many neurodegenerative conditions, such as Alzheimer’s disease, Parkinson’s disease, Huntington’s disease, and amyotrophic lateral sclerosis [1]. The evidence points to a dysfunctional Copyright: © 2021 by the authors. Licensee MDPI, Basel, Switzerland. ubiquitin–proteasome system (UPS) to be implicated in the pathogenesis of these dis- This article is an open access article eases [2]. UPS promotes the degradation of most soluble proteins via ubiquitination of distributed under the terms and target proteins, as well as misfolded and damaged proteins via ubiquitin-independent conditions of the Creative Commons pathway, preventing the formation of protein aggregates [3,4]. Proteasome activity is Attribution (CC BY) license (https:// decreased in aged neurons and in a plethora of neurodegenerative conditions, leading to creativecommons.org/licenses/by/ the accumulation of aggregated proteins and the formation of ubiquitin-positive inclusion 4.0/). bodies [5]. Proteasome inhibition in animal models, by genetic or pharmacological means,

Int. J. Mol. Sci. 2021, 22, 7271. https://doi.org/10.3390/ijms22147271 https://www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2021, 22, 7271 2 of 15

closely mimics the pathology and symptoms of neurodegenerative diseases, such as the aggregation of ubiquitinated proteins, formation of inclusion bodies, and neuronal cell death [6–10]. Another major intracellular pathway regulating the clearance of aberrant protein is autophagy, which operates in a closely interlinked manner to the UPS [11]. Autophagy targets large protein complexes and aggregates, and even damaged cellular organelles [12]. The essential role of autophagy in the clearance of neurotoxic protein aggregates in neurodegenerative diseases has been reported in many studies. The genetic deletion of autophagy-related genes in neuronal cells led to neurodegeneration [13,14], whereas activation of autophagy via chemical or genetic means, was shown to enhance the clearance of disease-associated protein aggregates [11]. Thus, these two major protein degradation control systems, the UPS and autophagy, are effective cellular defense mechanisms in neurons and may be potential therapeutic targets for neurodegenerative diseases that are caused by neurotoxic protein accumulation and aggregation. As seen in the central nervous system, multiple studies have demonstrated that UPS and autophagy may play signiﬁcant roles in protein homeostasis in the retina. Retinal proteasome and autophagic activities decline with age, and an increased protein aggregation is found in the aging retina [15–18]. Impaired proteasome function was reported to induce photoreceptor degeneration [19,20]; conversely, proteasome activation increased photoreceptor survival in an inherited retinal degeneration model [21]. Similarly, autophagy has been implicated in photoreceptor cell death and survival [22–24], as well as in retinal pigmented epithelial cell dysfunction in the pathogenesis of age-related macular degeneration [25–27]. Recent studies have also linked autophagy to retinal ganglion cell (RGC) death in glaucoma [28]. Despite these efforts, the interplay between UPS and autophagy in the regulation of protein degradation in retinal health and disease is not fully understood at present. To address this key question, we hypothesized that autophagy could be an innate defense mechanism against retinal degeneration while proteasome function is impaired. We previously reported that the pharmacological inhibition of proteasome in the retina induced an accumulation of poly-ubiquitinated proteins, leading to cell loss in the ganglion cell layer (GCL) [29], which is resistant to an array of pharmacological agents, such as antioxidants and endoplasmic reticulum (ER) stress inhibitors. In this study, we used this chemical proteasome inhibition model in genetically engineered mice with a defect in beclin1 (Becn1) gene, a key signaling molecule in the autophagic pathway [30]. They were Becn1-heterozygous (Becn1-Het) with autophagic dysfunction, which have been used in many earlier studies [31–35]. To our surprise, despite autophagic dysfunction in the retina of these mice, Becn1-Het mice and normal wild-type (WT) mice displayed equal vulnerability to retinal degeneration, induced by chemical proteasome inhibition as well as other pharmacological insults. Furthermore, we demonstrated that only the mammalian target of rapamycin (mTOR)-independent autophagy activators could protect against proteasome impairment-induced cytotoxicity in human neuroblastoma cells.

2. Results 2.1. Intravitreal (IVT) Injection of a Proteasome Inhibitor Induced Inner Retinal Degeneration in Mice To extend our previous finding that in rats intravitreal (IVT) injection of the proteasome inhibitor MG-262 induces inner retinal degeneration [29], we first aimed to reproduce this observation in normal WT mice. Consistent with our previous study, MG-262 (0.01 and 0.04 nmol/eye) induced a severe loss of cells in the GCL, accompanied by inner plexiform layer (IPL) thinning in a dose-dependent manner, while the inner and outer nuclear layers (INL and ONL, respectively) appeared relatively normal 7 days following IVT injection of this agent (Figure1a,b). Upon MG-262 injection, these retinal morphological changes were associated with the presence of vacuoles in the optic nerve, indicating optic neuropathy (Figure1c). These findings further increase the value and robustness of chemical proteasome inhibition as a model for inner retinal degeneration in rodents. Int. J. Mol. Sci. 2021, 22, 7271 3 of 15

outer nuclear layers (INL and ONL, respectively) appeared relatively normal 7 days following IVT injection of this agent (Figure 1a,b). Upon MG-262 injection, these retinal morphological changes were associated with the presence of vacuoles in the optic nerve, indicating optic neuropathy (Figure 1c). These findings further increase the value and robust- Int. J. Mol. Sci. 2021, 22, 7271 3 of 15 ness of chemical proteasome inhibition as a model for inner retinal degeneration in rodents.

FigureFigure 1.1. ProteasomeProteasome inhibitor inhibitor (MG-262) (MG-262) induced induced inner inner retinal retinal degeneration degeneration in mice. in mice. (a) Representative (a) Representative images images of hema- of hematoxylintoxylin and eosin and eosin staining staining of mouse of mouse retinae retinae 7 days 7 days following following intr intravitrealavitreal injection injection of 0.01 of 0.01 and and 0.04 0.04 nmol/eye nmol/eye of ofMG-262, MG-262, or orits its vehicle vehicle (10% (10% dimethyl dimethyl sulfoxide sulfoxide in in Dulbecco’s Dulbecco’s phosphate phosphate buffered buffered solution solution or or D-PBS). Retinae were cross-sectioned,cross-sectioned, andand theirtheir imagesimages werewere takentaken approximatelyapproximately 300300µ µmm awayaway fromfrom the the optic optic nerve nerve head. head. GCL:GCL: ganglionganglion cellcell layer;layer; IPL:IPL: innerinner plexiform layer; INL: inner nuclear layer; OPL: outer plexiform layer; ONL: outer nuclear layer; IS/OS: photoreceptor inner plexiform layer; INL: inner nuclear layer; OPL: outer plexiform layer; ONL: outer nuclear layer; IS/OS: photoreceptor and outer segments. The scale bar shows 50 µm. (b) Quantification of number of cells in the GCL and IPL thickness meas- inner and outer segments. The scale bar shows 50 µm. (b) Quantification of number of cells in the GCL and IPL thickness urement. Cell counting and thickness measurement were performed on ImageJ. N = 6 eyes from 3 mice per each treatment measurement.group. Each value Cell represents counting and the thicknessmean ± standard measurement deviation were with performed the mean on valu ImageJ.e indicated N = 6 eyesat the from bottom 3 mice of pereach each bar. treatmentStatistical group. analysis Each was value performed represents with the one-way mean ± analysisstandard of deviationvariance, withfollowed the mean by Dunnett’s value indicated post hoc at test. thebottom ** p < 0.01 of each *** p bar.< 0.001, Statistical vs. vehicle analysis (Veh). was ( performedc) Representative with one-way images analysisof the optic of variance, nerve of followed eyes, injected by Dunnett’s with 0.01 post nmol/eye hoc test. of ** MG-262.p < 0.01 ***Vacuolationp < 0.001, vs.(red vehicle arrow (Veh).heads) ( cwas) Representative observed througho imagesut of the the optic optic nerve nerve in of eyes eyes, injected injected with with MG-262. 0.01 nmol/eye The scale of bar MG-262. shows Vacuolation200 µm. (red arrow heads) was observed throughout the optic nerve in eyes injected with MG-262. The scale bar shows 200 µm. 2.2. Characterization of Ocular Phenotypes of Beclin1-Heterozygous (Becn1-Het) Mice with 2.2.Reduced Characterization Level of Retinal of Ocular Autophagy Phenotypes of Beclin1-Heterozygous (Becn1-Het) Mice with Reduced Level of Retinal Autophagy To test our hypothesis that autophagy could confer retinal protection against im- To test our hypothesis that autophagy could confer retinal protection against impaired paired proteasome, we characterized retinal phenotypes of Becn1-Het mice, being genet- proteasome, we characterized retinal phenotypes of Becn1-Het mice, being genetically ically modified mice, with autophagic dysfunction [31–34] under normal conditions. First, modified mice, with autophagic dysfunction [31–34] under normal conditions. First, we we confirmed a reduced level of autophagy in the retina of these mice using an im- confirmed a reduced level of autophagy in the retina of these mice using an immunostaining munostaining for LC3, a component of the autophagosome (Figure 2a,b). In accordance for LC3, a component of the autophagosome (Figure2a,b). In accordance with previous with previous reports that detected LC3 immunostaining in highly metabolic retinal cell reports that detected LC3 immunostaining in highly metabolic retinal cell layers [25], we layers [25], we observed LC3 punctae in retinal cell layers, including the GCL, INL, and observed LC3 punctae in retinal cell layers, including the GCL, INL, and ONL (Figure2b) . ONL (Figure 2b). In the Becn1-Het mice, LC3 punctae were markedly reduced in all three In the Becn1-Het mice, LC3 punctae were markedly reduced in all three layers (Figure2b ), layers (Figure 2b), confirming the reduced number of autophagosome in these cells. This confirming the reduced number of autophagosome in these cells. This result further supportsresult further the use supports of Becn1 the-Het use mice of Becn1 as an-Het animal mice model as an animal of defective model autophagy. of defective autophagy. We then determined if any ocular abnormality may be present in Becn1-Het mice. As shownWe in then Figure determined2c,d, a series if any of clinicalocular abnormality imaging, namely, may be slit present lamp photography, in Becn1-Het mice. fundus As photography,shown in Figure and 2c,d, fundus a series fluorescent of clinical angiography, imaging, namely, failed to slit detect lamp noticeable photography, differences fundus in thephotography, morphology and of fundus the cornea, fluorescent the lens, angiograph and the retinay, failed between to detect WT noticeable and Becn1 differences-Het mice. Opticalin the morphology coherence tomography of the cornea, further the lens, confirmed and the that retina the between structure WT of the and optic Becn1 nerve-Het head,mice. asOptical well ascoherence the inner tomography and total retinal further thickness confirmed (Figure that2 c,d)the ofstructure these mice of the were optic normal. nerve Additionally, intraocular pressure (IOP) was maintained in the normal range in both groups of mice (Figure2e). Overall, despite autophagic dysfunction found in the retina of these mice, the eyes of Becn1-Het did not display any abnormality in their morphology and structure or IOP under normal conditions. Int. J. Mol. Sci. 2021, 22, 7271 4 of 15

head, as well as the inner and total retinal thickness (Figure 2c,d) of these mice were normal. Additionally, intraocular pressure (IOP) was maintained in the normal range in both groups of mice (Figure 2e). Overall, despite autophagic dysfunction found in the retina of Int. J. Mol. Sci. 2021, 22, 7271 4 of 15 these mice, the eyes of Becn1-Het did not display any abnormality in their morphology and structure or IOP under normal conditions.

FigureFigure 2.2. RetinalRetinal autophagicautophagic dysfunctiondysfunction and and ocular ocular phenotypes phenotypes of of beclin1-heterozygous beclin1-heterozygous mice mice (Becn1 (Becn1-Het).-Het). (a )( Immunoflu-a) Immuno- orescencefluorescence staining staining of LC3of LC3 in in the th retinae retina of of wild-type wild-type (WT) (WT) and andBecn1 Becn1-Het-Het mice mice (each (each image image isis representativerepresentative ofof 22 eyes). ImmunofluorescenceImmunofluorescence stainingstaining waswas performedperformed on 5 µµmm thickthick retinalretinal cryosectionscryosections ofof WTWT andand Becn1Becn1-Het-Het mice,mice, andand imagesimages werewere acquiredacquired withwith confocalconfocal microscopy.microscopy. RepresentativeRepresentative mergedmerged z-stackz-stack images are shown. The scale bar shows 50 µm.µm. ((bb)) EnlargedEnlarged imagesimages ofof LC3LC3 immunostainingimmunostaining inin thethe ganglionganglion cellcell layerlayer (GCL),(GCL), innerinner nuclearnuclear layerlayer (INL),(INL), andand outerouter nuclearnuclear layer (ONL). Red, yellow, and blue colors correspond to the respective area of the images shown in (a). White arrow heads layer (ONL). Red, yellow, and blue colors correspond to the respective area of the images shown in (a). White arrow indicate visible LC3 punctae. The scale bar shows 10 µm. (c) Representative clinical imaging of the eyes of WT and Becn1- heads indicate visible LC3 punctae. The scale bar shows 10 µm. (c) Representative clinical imaging of the eyes of WT and Het mice, including (from left to right), slit lamp photography, fundus fluorescein angiography, fundus photography, and Becn1spectral-Het domain mice, including ocular cohe (fromrence left tomography to right), slit (OCT). lamp photography, (d) Inner and fundus total fluoresceinretina thicknes angiography,s was quantified fundus photography,based on the andOCT spectral images domainobtained. ocular Image coherence quantification tomography was performed (OCT). on (d) ImageJ. Inner and The total inner retina retina thickness is defined was to include quantified the basedGCL, IPL on the(inner OCT plexiform images obtained.layer), and Image INL, quantificationwhereas the total was retina performed includes on all ImageJ. retinal The layers. inner N retina= 10–12 is eyes defined from to 5–6 include mice theper GCL, each IPLgroup. (inner (e) plexiformIntraocular layer), pression and (IOP) INL, measured whereas the with total rebound retina includestonometer all in retinal WT and layers. Becn1 N-Het = 10–12 mice. eyes The from same 5–6 mice mice shown per eachin (d group.) were used (e) Intraocular for IOP measurements. pression (IOP) Each measured value withrepresents rebound the tonometermean ± standard in WT anddeviationBecn1 -Hetwith mice.the mean The samevalue miceindi- showncated at in the (d) bottom were used of each for IOPbar. measurements.Statistical analysis Each was value performed represents with the an mean unpaired± standard t-test. deviation with the mean value indicated at the bottom of each bar. Statistical analysis was performed with an unpaired t-test. 2.3. Becn1-Het and Wild-Type (WT) Mice Possess Equal Vulnerability to Proteasome Inhibition 2.3.and Becn1-HetEndoplasmic and Reticulum Wild-Type (ER) (WT) Stress Mice Possess Equal Vulnerability to Proteasome Inhibition and Endoplasmic Reticulum (ER) Stress We further examined if autophagic dysfunction in Becn1-Het mice could render them moreWe sensitive further to examined inner retinal if autophagic degeneration dysfunction caused in byBecn1 proteasome-Het mice inhibition. could render As themseen moreabove, sensitive an IVT injection to inner of retinal MG-262 degeneration (0.01 nmol/eye) caused induced by proteasome moderate inhibition.cell loss in the As seenGCL above,and IPL an thinning IVT injection in both of WT MG-262 and Becn1 (0.01 nmol/eye)-Het mice (Figure induced 3a). moderate Qualitatively, cell loss a insimilar the GCL de- andgree IPLof inner thinning retinal in degeneration both WT and uponBecn1 MG-Het-262 mice treatment (Figure was3a). observed Qualitatively, between a similarWT and degreeBecn1-Het of inner mice. retinal To quantify degeneration these changes upon MG-262 more precisely, treatment we was used observed the expression between level WT andof geneticBecn1 -Hetcell markers, mice. To neurofilament quantify these light changes chain more (Nefl precisely,), and rhodopsin we used the(Rho expression) genes, to levelreflect of the genetic number cell of markers, RGCs [36] neurofilament and photorecep lighttors chain [37] (Nefl in the), and whole rhodopsin retina, respectively. (Rho) genes, toConsistent reflect the with number our ofprevious RGCs [ 36study] and [29], photoreceptors MG-262 (0.01 [37 and] in the0.04 whole nmol/eye) retina, reduced respectively. Nefl Nefl Consistentexpression within a dose-dependent our previous study manner [29], in MG-262 both mouse (0.01 andgroups, 0.04 and nmol/eye) the maximum reduced reduc- expression in a dose-dependent manner in both mouse groups, and the maximum reduction tion from the respective control level in the vehicle group was approximately 70% (Figure from the respective control level in the vehicle group was approximately 70% (Figure3b ). 3b). In contrast, MG-262 reduced the Rho expression level by only 30% at the higher dose, In contrast, MG-262 reduced the Rho expression level by only 30% at the higher dose, compared with the vehicle group. Again, we observed no statistically significant difference in the level of expression of Nefl or Rho upon MG-262 injection between WT and Becn1-Het mice (Figure3b).

Int. J. Mol. Sci. 2021, 22, 7271 5 of 15

compared with the vehicle group. Again, we observed no statistically significant difference in the level of expression of Nefl or Rho upon MG-262 injection between WT and Becn1-Het mice (Figure 3b). We also tested both animal groups for the retinal effect of tunicamycin, an ER stress inducer that causes dramatic loss of the photoreceptor cells [29,38]. Consistently, IVT injection of tunicamycin induced a dramatic reduction in the expression level of Rho, but not Nefl gene (Figure 3c). As seen by the effect of MG-262 on the inner retinal degenerative, we did not observe any significant difference in the Nefl or Rho level between WT and Becn1-Het mice upon injection of tunicamycin (Figure 3c). Thus, these results suggest that the basal level of autophagic activity does not contribute to the maintenance of the retinal structural integrity under the normal condition, Int. J. Mol. Sci. 2021, 22, 7271 5 of 15 or when protein degradation or folding is impaired following chemical proteasome inhibition or ER stress induction.

FigureFigure 3.3.Beclin1-heterozygous Beclin1-heterozygous micemice ((Becn1Becn1-Het)-Het) andand wild-typewild-type (WT)(WT) micemice areare equallyequally sensitivesensitive toto retinalretinal degeneration,degeneration, inducedinduced by by proteasome proteasome inhibition inhibition and and endoplasmic endoplasmic reticulum reticulum (ER) (ER) stress. stress.Chemicals, Chemicals, oror theirtheir vehicle,vehicle, werewere intravitreally intravitreally injectedinjected into into the the eyes eyes of of WT WT and andBecn1 Becn1-Het-Het mice, mice, and and eyes eyes were were isolated isolated 7 and 7 4and days 4 days post-injection post-injection for histological for histological evaluation eval- (auation) and gene(a) and expression gene expression analysis (analysisb,c), respectively. (b,c), respectively. Quantitative Quantitative PCR was performedPCR was performed for neurofilament for neurofilament light chain light (Nefl )chain and (Nefl) and rhodopsin (Rho) genes. Each expression value was normalized to glyceraldehyde-3-phosphate dehydrogenase rhodopsin (Rho) genes. Each expression value was normalized to glyceraldehyde-3-phosphate dehydrogenase (Gapdh), the (Gapdh), the housekeeping gene, in individual samples and is shown relative to that obtained in the WT vehicle group. (a) housekeeping gene, in individual samples and is shown relative to that obtained in the WT vehicle group. (a) Representative Representative images of hematoxylin and eosin-stained retinae, following intravitreal injection of 0.01 nmol/eye MG-262 imagesor its vehicle of hematoxylin (10% dimethyl and eosin-stained sulfoxide or retinae, DMSO followingin Dulbecco intravitreal’s phosphate injection buffered of 0.01 solution nmol/eye or D-PBS). MG-262 The or itsscale vehicle bar shows (10% dimethyl50 µm. (b sulfoxide) Effects orof DMSOMG-262 in (0.01 Dulbecco’s and 0.04 phosphate nmol/eye) buffered or its vehicle solution (Veh, or D-PBS). 10% DMSO The scale in D-PBS) bar shows on Nefl 50 µ m.and(b Rho) Effects gene ofexpression MG-262 (0.01levels and in the 0.04 retina. nmol/eye) N = 8 to or 16 its eyes vehicle from (Veh, 4 to 10%8 mice DMSO per each in D-PBS) group. onBlackNefl andand whileRho genebars show expression WT and levels Becn1 in- theHet, retina. respectively. N = 8 to ( 16c) Effects eyes from of tunicamycin 4 to 8 mice per(Tunc, each 2.5 group. µg/eye) Black or its and vehicle while (Veh, bars show25% DMSO WT and inBecn1 D-PBS)-Het, on respectively.Nefl and Rho (cgene) Effects expressionof tunicamycin levels in the (Tunc, retina. 2.5 Nµg/eye) = 5 to 8 oreyes its from vehicle 4 mi (Veh,ce per 25% each DMSO group. in Each D-PBS) value on representsNefl and Rho thegene mean expression ± standard levelsdeviation in the with retina. the Nmean = 5 tovalue 8 eyes indicated from 4 miceat the per top each of each group. bar. EachFor statistical value represents analysis, the a two- meanway± standardanalysis of deviation variance with was theperformed, mean value followed indicated by Sidak’s at the toppost of hoc each test. bar. * p For< 0.05, statistical ** p < 0.01, analysis, *** p < a0.001, two-way **** p analysis < 0.0001 offor variance each pair was of comparison. performed, followed by Sidak’s post hoc test. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 for each pair of comparison. 2.4. Retinal Degenerative Effects of Other Pharmacological Insults in Becn1-Het Mice WeTo alsoextend tested our bothfindings animal to groupsother types for the of retinalretinal effectdegeneration of tunicamycin, models,an we ER asked stress if inducerexcitotoxicity- that causes and neuroinflammation-induced dramatic loss of the photoreceptor RGC death cells could [29,38 be]. modified Consistently, in Becn1 IVT- injectionHet mice. of IVT tunicamycin injection inducedof N-methyl-D-aspar a dramatic reductiontate (NMDA, in the expression20 nmol/eye), level an of authenticRho, but notNMDANefl genereceptor-coupled (Figure3c). As channel seen by agonist the effect [38,39], of MG-262 led to oncell the loss inner in the retinal GCL degenerative, and IPL thin- wening, did accompanied not observe by any a remarkable significant differencereduction in in Nefl the geneNefl orexpression Rho level levels between (Figure WT 4a,b). and Becn1Similarly,-Het micelipopolysaccharide upon injection (LPS, of tunicamycin 2 µg/eye), (Figurea pro-inflammatory3c). substance [40], caused a mildThus, but thesestatistically results significant suggest that reduction the basal in levelNefl gene of autophagic expression. activity Similar does to the not retinal con- tributedegeneration to the maintenance induced by MG-262 of the retinal and tunicamy structuralcin integrity IVT injection, under the we normal did not condition, observe any or whenstatistically protein significant degradation difference or folding in isthe impaired retinal followingstructuralchemical changes proteasomeand reduction inhibition in Nefl or ER stress induction.

2.4. Retinal Degenerative Effects of Other Pharmacological Insults in Becn1-Het Mice To extend our findings to other types of retinal degeneration models, we asked if excitotoxicity- and neuroinflammation-induced RGC death could be modified in Becn1-Het mice. IVT injection of N-methyl-D-aspartate (NMDA, 20 nmol/eye), an authentic NMDA receptor-coupled channel agonist [38,39], led to cell loss in the GCL and IPL thinning, accompanied by a remarkable reduction in Nefl gene expression levels (Figure4a,b ). Sim- ilarly, lipopolysaccharide (LPS, 2 µg/eye), a pro-inflammatory substance [40], caused a mild but statistically significant reduction in Nefl gene expression. Similar to the retinal degeneration induced by MG-262 and tunicamycin IVT injection, we did not observe any statistically significant difference in the retinal structural changes and reduction in Nefl gene expression upon IVT injection of NMDA or LPS between WT and Becn1-Het mice (Figure4b,c). Int. J. Mol. Sci. 2021, 22, 7271 6 of 15

gene expression upon IVT injection of NMDA or LPS between WT and Becn1-Het mice (Figure 4b,c). Altogether, it is likely that Becn1-mediated autophagy may not compensate for retinal Int. J. Mol. Sci. 2021, 22, 7271 damage induced by an array of deleterious insults, including chemical proteasome6 inhi- of 15 bition, ER stress, excitotoxicity, and inflammation in mice.

(a)

FigureFigure 4. Beclin1-heterozygousBeclin1-heterozygous mice mice (Becn1 (Becn1-Het)-Het) and and wild-type wild-type (WT) (WT) mice mice are areequally equally sensitive sensitive to excitotoxicity to excitotoxicity and neu- and neuroinflammation.roinflammation. Chemicals Chemicals or their or theirvehicle vehicle (Dulbecco’s (Dulbecco’s phosphat phosphatee buffered buffered solution solution or D-PBS) or D-PBS)were intravitreally were intravitreally injected injectedinto the eyes into theof WT eyes and of Becn1 WT and-Het Becn1mice,-Het and eyes mice, were and isolated eyes were 7 and isolated 4 days 7 post-injection and 4 days post-injection for histological for evaluation histological (a) evaluationand gene expression (a) and gene analysis expression (b,c), respectively. analysis (b,c ),Quantitative respectively. PCR Quantitative was performed PCR for was the performed neurofilament for the light neurofilament chain (Nefl) lightgene. chain Each (Neflexpression) gene. Eachvalue expression was normalized value was to glyceraldehyde-3-phosphate normalized to glyceraldehyde-3-phosphate dehydrogenase dehydrogenase (Gapdh), the housekeeping (Gapdh), the housekeepinggene, in individual gene, insamples individual and samplesis shown and relative is shown to that relative obtained to that in obtainedthe WT vehicle in the WT group. vehicle (a) group.Representative (a) Representative images of hematoxylin and eosin-stained retinae following intravitreal injection of 20 nmol/eye N-methyl-D-aspartate (NMDA) or images of hematoxylin and eosin-stained retinae following intravitreal injection of 20 nmol/eye N-methyl-D-aspartate its vehicle. (b) Effects of 20 nmol/eye NMDA or its vehicle on Nefl gene expression in the retina. N = 4 to 9 eyes from 2 to (NMDA) or its vehicle. (b) Effects of 20 nmol/eye NMDA or its vehicle on Nefl gene expression in the retina. N = 4 to 9 eyes 5 mice for each group. (c) Effects of 2 µg/eye lipopolysaccharide (LPS) or its vehicle on Nefl gene expression in the retina. fromN = 6 2 to to 9 5 eyes mice from for each 4 to group.5 mice (forc) Effectseach group. of 2 µ g/eyeEach value lipopolysaccharide represents the (LPS)mean or ± standard its vehicle deviation on Nefl gene with expression the mean invalue the retina.indicated N = at 6 the to 9 top eyes of fromeach 4bar. to 5For mice statistical for each analysis, group. Each a two-way value representsanalysis of the variance mean ±wasstandard performed, deviation followed with by the Sidak’s mean valuepost hoc indicated test * p at< 0.05, the top ** p of < each0.01, bar.*** p For < 0.001, statistical **** p analysis, < 0.0001 afor two-way each pair analysis of comparison. of variance was performed, followed by Sidak’s post hoc test * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001 for each pair of comparison. 2.5. Specific Autophagy Activators Could Protect against MG-262-Induced Cytotoxicity Altogether, it is likely that Becn1-mediated autophagy may not compensate for reti- Finally, we tested the possibility that extrinsic activation of autophagy may offer ad- nal damage induced by an array of deleterious insults, including chemical proteasome ditional protection against cellular damage induced by proteasomal inhibition because inhibition, ER stress, excitotoxicity, and inflammation in mice. the normal level of autophagic activity may not be sufficient to protect neuronal cells. To 2.5.test Specificthis possibility, Autophagy we Activators chose human Could neuroblastoma Protect against MG-262-Inducedcells, SH-SY5Y, often Cytotoxicity used as surro- gate cells for primary brain neurons [41] because of the less complex and smaller data Finally, we tested the possibility that extrinsic activation of autophagy may offer variabilities, compared with in vivo experiments. We examined the effects of a series of additional protection against cellular damage induced by proteasomal inhibition because mTOR-dependent (rapamycin, Torin-1, RSVA314 and Tat-D11) [42–44] and independent the normal level of autophagic activity may not be sufficient to protect neuronal cells. autophagy activators (trehalose, carbamazepine, lithium chloride, and rilmenidine) [45] To test this possibility, we chose human neuroblastoma cells, SH-SY5Y, often used as surrogateon MG-262-induced cells for primary neuronal brain ce neuronsll death. [ 41As] becauseshown in of Figure the less 5, complex MG-262 and consistently smaller data in- variabilities,duced cell death compared in SH-SY5Y with in cells vivo throughoutexperiments. the We experiments. examined theAmong effects all of tested a series com- of mTOR-dependentpounds, only two mTOR-independent (rapamycin, Torin-1, autopha RSVA314gy andactivators, Tat-D11) lithium [42–44 chloride] and independent and rilmen- autophagyidine, were activators found to (trehalose,increase cell carbamazepine, viability when lithium treated chloride, prior to and MG-262 rilmenidine) exposure. [45 ]The on MG-262-inducedmaximum cytoprotective neuronal effects cell death. of lithium As shown chloride in Figure was 5greater, MG-262 than consistently that of rilmenidine, induced cellalthough death both in SH-SY5Y effects were cells statistically throughout signif the experiments.icant. Regardless Among of mTOR-dependent all tested compounds, or in- onlydependent two mTOR-independent activation, the other autophagy chemicals activators, (rapamycin, lithium Torin-1, chloride RSVA314, and rilmenidine, Tat-D11, were car- foundbamazepine to increase or trehalose) cell viability did not when rescue treated these priorcells. toInterestingly, MG-262 exposure. in our experimental The maximum set- cytoprotectiveting, the classic effects mTOR of inhibitors, lithium chloride rapamycin was and greater Torin-1, than thatexacerbated of rilmenidine, MG-262-induced although bothcytotoxicity effects werein a statisticallystatistically significant. significant Regardless manner. These of mTOR-dependent data support the or independent notion that activation,mTOR-independent the other chemicalsautophagic (rapamycin, activation Torin-1,may play RSVA314, a cytoprotective Tat-D11, carbamazepine role against cell or trehalose)death induced did notby chemical rescue these proteasome cells. Interestingly, inhibition in ourvitro. experimental setting, the classic mTOR inhibitors, rapamycin and Torin-1, exacerbated MG-262-induced cytotoxicity in a statistically significant manner. These data support the notion that mTOR-independent autophagic activation may play a cytoprotective role against cell death induced by chemical proteasome inhibition in vitro. Int. J. Mol. Sci. 2021, 22, 7271 7 of 15 Int. J. Mol. Sci. 2021, 22, 7271 7 of 15

FigureFigure 5. 5.Autophagy Autophagy activatorsactivators couldcould alleviatealleviate MG-262-inducedMG-262-induced cytotoxicity.cytotoxicity. Human Humanneuroblastoma neuroblastoma cells, cells, SH-SY5Y,SH-SY5Y, were were treatedtreated with with a a series series of of different different autophagy autophagy activators,activators, asas indicated,indicated, 11 hh priorprior toto treatmenttreatment withwith 0.20.2µ µMM MG-262 MG-262or orits its vehiclevehicle (0.1% (0.1% dimethyl dimethyl sulfoxide sulfoxide inin Dulbecco’s Dulbecco’s ModifiedModified Eagle’sEagle’s Medium)Medium) forfor 2424 h,h, andand cell cell viability viability waswas measured measured byby WST-1WST-1 assay. assay. All All experiments experiments were were performed performed in in triplicate triplicate and and each each value value is is shown shown as as a a percentage percentage of of that that obtained obtained in in thethe vehicle vehicle group. group. Statistical Statistical test test was was performed performed with with one-way one-way analysisanalysis ofof variance,variance, followedfollowed byby Dunnett’sDunnett’s postpost hochoc test.test. EachEach value value represents represents the the mean mean± ± standardstandard deviationdeviation withwith thethe meanmean valuevalueindicated indicatedat atthe thebottom bottom of of each each bar. bar.** **p p< <0.01 0.01,, ********p p< < 0.0001 0.0001,, statisticallystatistically significantsignificant increase in in cell cell viab viabilityility compared compared with with the the respective respective vehicle vehicle group; group; # p #< 0.05;p < 0.05; #### p < 0.0001, statistically significant reduction in cell viability compared with the respective vehicle group. #### p < 0.0001, statistically significant reduction in cell viability compared with the respective vehicle group.

3.3. DiscussionDiscussion TheThe keykey findingfinding ofof thisthis studystudy isis that that autophagic autophagicdysfunction dysfunction diddid notnotmodify modifyinner inner retinalretinal degeneration degeneration induced induced by by chemical chemical proteasome proteasome inhibition inhibition in Becn1 in Becn1-Het-Het mice. mice. To our To knowledge,our knowledge, this isthis the is first the report first report studying studying the potential the potential roles of roles autophagy of autophagy in the retinal in the structuralretinal structural integrity, integrity, while proteasome while proteasome function function is impaired. is impaired. Given the Given proposed the proposed retinal protectiveretinal protective roles of autophagyroles of autophagy in earlier in studies earlier [studies46–49], [46–49], we hypothesized we hypothesized that autophagy that au- couldtophagy also could be a compensatoryalso be a compensatory mechanism mech to overcomeanism to overcome toxic protein toxic accumulation protein accumula- in the eventtion in of the proteasome event of proteasome impairment impairment in the retina, in the and retina, that and autophagic that autophagic dysfunction dysfunction might exacerbatemight exacerbate the degree the ofdegree retinal of degenerationretinal degeneration induced induced by chemical by chemical proteasome proteasome inhibition. in- Unexpectedly,hibition. Unexpectedly, this hypothesis this hypothesis was not supported was not supported by the findings by thethat findingsBecn1 that-Het Becn1 and WT-Het miceand WT displayed mice displayed equal vulnerability equal vulnerability to retinal to damage retinal induceddamage induced by chemical by chemical proteasome pro- inhibitionteasome inhibition as well as as otherwell as pharmacological other pharmacological insults, insults, including including ER stress, ER stress, excitotoxicity, excitotox- andicity, neuroinflammation. and neuroinflammation. However, However, we found we thatfound mTOR-independent that mTOR-independent autophagy autophagy activators,activators, lithium lithium chloride chloride and rilmenidine, and rilmenidine, could significantly could significantly alleviate alleviate chemical chemical proteasome pro- inhibition-inducedteasome inhibition- cellinduced death cellin death vitro. in These vitro. results These suggestresults suggest that although that although the intrinsic the in- autophagictrinsic autophagic activity activity does not does play not a majorplay a rolemajor in role retinal in retinal cell survival, cell survival, the extrinsic the extrinsic stim- ulationstimulation of autophagy of autophagy promotes promotes cytoprotection cytoprotection against against cell death cell causeddeath bycaused proteasome by pro- impairmentteasome impairment in vitro. in vitro. WeWe previouslypreviously reported that that chemical chemical protea proteasomesome inhibition inhibition could could be used be used as a novel as a novelanimal animal model model for inner for inner retinal retinal degeneration degeneration in rats. in rats.IVT IVTadministration administration of MG-262 of MG-262 (0.1 (0.1nmol/eye), nmol/eye a potent), a potent and andselective selective proteasome proteasome inhibitor inhibitor [50], [ 50reduce], reducess retinal retinal proteasome protea- someactivity, activity, resulting resulting in the in accumulation the accumulation of ubiquitinated of ubiquitinated proteins proteins in the in the rat ratretina retina [29]. [29 In]. In this study, we chose two doses of MG-262 (0.01 and 0.04 nmol/eye), which correspond this study, we chose two doses of MG-262 (0.01 and 0.04 nmol/eye), which correspond to to the estimated vitreous concentration (1.7 µM) following MG-262 injection of the tested the estimated vitreous concentration (1.7 µM) following MG-262 injection of the tested dose in the rat eye, given the difference in the vitreous volume between the rat and mouse dose in the rat eye, given the difference in the vitreous volume between the rat and mouse eyes (60 vs. 10 µL). We consistently replicated the previous findings that IVT injection of eyes (60 vs. 10 µL). We consistently replicated the previous findings that IVT injection of the proteasome inhibitor MG-262 caused a severe loss of cells in the GCL and IPL thinning, the proteasome inhibitor MG-262 caused a severe loss of cells in the GCL and IPL thin- while leaving the photoreceptor layer relatively intact in normal mice. This further demon- ning, while leaving the photoreceptor layer relatively intact in normal mice. This further strates the robustness of this model. We combined this model with Becn1-Het knockout in demonstrates the robustness of this model. We combined this model with Becn1-Het mice. Becn1 is an evolutionary conserved protein, which plays a key role in autophagic knockout in mice. Becn1 is an evolutionary conserved protein, which plays a key role in vesicle nucleation, together with class III phosphatidylinositol 3-kinase (PI3K) complex [30]. autophagic vesicle nucleation, together with class III phosphatidylinositol 3-kinase (PI3K)

Int. J. Mol. Sci. 2021, 22, 7271 8 of 15

Homozygous deletion of Becn1 is embryonically lethal, while Becn1 gene haploinsufficiency in the heterozygote mice was shown to promote tumorigenesis [31,32] and neurodegeneration [33], via impaired autophagy. Becn1-Het mice are one of the most popular animal models used to study the implications of autophagic dysfunction [31], which has been demonstrated in various tissues, including muscle, bronchial epithelial cells, germinal center B cells [31], heart aorta [34], and hippocampal neurons [33]. In contrast to these earlier studies and to our initial hypothesis, we found that Becn1-Het mice did not show any ocular abnormalities under normal conditions, as seen in an earlier study [35]. More importantly, Becn1-Het knockout did not affect the susceptibility of these mice to various pharmacological insults, including proteasome inhibition. Therefore, it is reasonable to conclude that autophagic dysfunction, due to Becn1 haploinsufficiency, may not contribute to the maintenance of the retinal structural integrity while proteasome function is impaired. However, we cannot exclude the possibility that the complete absence of autophagy in Becn1 homozygous knockout in the retina may enable RGCs to be more sensitive to these insults. In fact, such a scenario can be seen in an earlier study, demonstrating that conditional knockout of Atg5, another autophagy regulatory gene, in macrophages induced inflammasome activation and promoted atherosclerosis progression; however, the modest disruption of autophagy in Becn1-Het mice showed no phenotype [34]. Further studies using Becn1 conditional knockout in the retina are underway, to determine whether Becn1 homozygous deletion may have a different impact on inner retinal degeneration induced by chemical proteasome inhibition. Although the interplay between UPS and autophagy in the retina is largely unknown, an interesting concept has been proposed in recent studies using Rho mutant mice [51,52]. These investigators demonstrated that an activated autophagic function by a missense mutation in Rho gene and an mTOR inhibitor exacerbated retinal degeneration, whereas reduced autophagic activity by retinal specific deletion of Atg5 and the autophagy inhibitor hydroxychloroquine protected photoreceptors from Rho mutation-induced degeneration. Furthermore, they found that increased ER stress mediated overactivation of autophagy in response to Rho mutation, leading to a reduced UPS function and thereby photoreceptor degeneration. These findings suggest that a balance between UPS and autophagy activities is critical for photoreceptor survival, and either inhibition of autophagy or activation of UPS can be a potential therapeutic approach for retinal diseases, including photoreceptor degeneration. Their findings and concept contradict the proposed protective roles of autophagy in the retina in earlier studies [46–48,53]. However, a significant number of studies have also reported consistent results, where the inhibition of autophagy could be a retinal protective [49,54–56]. For example, the autophagy inhibitor 3-methyl adenine was reported to suppress RGC death in a retinal ischemia model [56]. In the current study, we found that reduced autophagy activity did not alter inner retinal degeneration indued by proteasome inhibition in Becn1-Het mice. Taking into account the above proposed concept of a balance between UPS and autophagy, one possible interpretation of our findings is that autophagy may not induce further cell death when UPS function is already eliminated, following chemical proteasome inhibition. However, this possibility is unlikely because autophagic dysfunction in Becn1-Het mice had no impact on inner retinal degeneration induced by ER stress, excitotoxicity, and neuroinflammation. Therefore, autophagy may not play significant retinal protective or detrimental roles against inner retinal degeneration induced by a wide variety of chemical insults. While autophagy may not be an intrinsic protective mechanism, it is possible that extrinsic activation of autophagy may provide neuroprotection while proteasome activity is reduced. To eliminate the complexities associated with in vivo studies, including the pharmacokinetic behavior of tested compounds, and minimized data variabilities among individual animals, we used cultured neuronal cells, SH-SY5Y, instead of whole animals. SH-SY5Y cells are well established as model neurons to study neuroprotection and neurodegenerative mechanisms [41,57,58], and are widely used to study autophagy and UPS [59–62]. Interestingly, we found that lithium chloride and rilmenidine promoted Int. J. Mol. Sci. 2021, 22, 7271 9 of 15

cell protection, whereas rapamycin and Torin-1 exacerbated cell death in SH-SY5Y neuroblastoma cells exposed to proteasome inhibition. Rapamycin and Torin-1 are inhibitors of mTOR [42], a sensor of nutrient availability and recipient of growth factor signaling [63]. mTOR negatively regulates the formation of the ULK complex via phosphorylation of ULK1/2 [64,65], which is the initial step of autophagic vesicle nucleation. Following this initial step, Becn1 regulates the formation of another complex called the PI3K complex. In addition to this, autophagy is regulated by mTOR-independent pathways that involve other intracellular signaling molecules, including inositol and cyclic adenosine monophosphate (cAMP) [66]. Rilmenidine reduces cAMP via stimulation of imidazoline-1 receptors [67], whereas lithium chloride lowers intracellular inositol levels via the inhibition of inositol monophosphatase 1 [68,69]. Reduced levels in both inositol and cAMP lead to autophagy activation in a mTOR-independent manner [68,69], although lithium chloride has also been reported to contribute to the mTOR-dependent pathway via the inhibition of glyco- gen synthase kinase 3 beta [70]. Although the exact molecular mechanisms are unclear, extrinsic activation of mTOR-independent autophagic pathways may overcome cellular stress caused by chemical proteasome inhibition, while that of mTOR-dependent pathways may enhance this stress, resulting in the opposite outcomes in cell survival and death in neuroblastoma cells. Given the signiﬁcance of autophagy in the pathogenesis of neurodegenerative diseases, in depth in vitro and in vivo analyses of the molecular mechanisms of action for autophagy activators and inhibitors is necessary to identify potential new drug candidates for the treatment of relevant diseases, as described elsewhere [71,72]. In conclusion, the present study demonstrates that Becn1-Het knockout does not rescue or sensitize inner retinal cells against degeneration induced by chemical proteasome inhibition in mice. Furthermore, we provide evidence demonstrating that mTOR- independent autophagy activators may be protective in neuroblastoma cells and thus can be regarded as neuroprotective agents. These results suggest that intrinsic autophagy activities are not sufﬁcient in operating to protect inner retinal cells as a compensatory mechanism for impaired proteasome function; furthermore, extrinsic autophagy activation via mTOR-independent pathways still promotes neuroprotection while proteasome function is compromised in vitro. Thus, our current study further supports the importance of UPS function in the maintenance of the retinal structural integrity, as demonstrated in our previous study [29], and provides some insights into the interplay between UPS and autophagy in the retina. A thorough study characterizing the effect of autophagy and proteasome modulators on their protein expression levels and activities may uncover novel crosstalk regulation between the two pathways in the retina. Such a study may also warrant further development of mTOR-independent autophagy activator as a therapeutic modality for retinal neurodegenerative diseases associated with proteasome dysfunction [73,74].

4. Materials and Methods 4.1. Chemicals MG-262, NMDA, and rapamycin were purchased from Enzo Life Sciences, Inc. (Farm- ingdale, NY, USA). LPS was purchased from Invitrogen (San Diego, CA, USA). Torin-1 and rilmenidine hemifumarate were purchased from Tocris Bioscience (Avonmouth, Bristol, UK). Tat-D11 (Tat- Becn1 D11) was purchased from Novus Biologicals (Littleton, CO, USA). All other chemicals were obtained from Sigma Aldrich (St Louis, MO, USA). All chemicals were dissolved in dimethyl sulfoxide (Thermo Fisher Scientiﬁc Inc., Waltham, MA, USA) or distilled water to prepare a stock solution, and diluted with Dulbecco’s phosphate buffered solution (D-PBS; from Life Technologies Corp, Carlsbad, CA, USA) to reach the ﬁnal indicated concentration.

4.2. Mice Becn1-Het mice (B6.129X1-Becn1tm1Blev/J) were purchased from The Jackson Labora- tory (Bar Harbor, ME, USA). They were bred and housed in the animal facility at SingHealth Experimental Medicine Centre, where they were maintained under a 12 h light (~10 lux)/ Int. J. Mol. Sci. 2021, 22, 7271 10 of 15

12 h dark cycle and provided food and water ad libitum. Genotyping was performed according to the protocol provided by The Jackson Laboratory. All animal experimental procedures were approved and performed in accordance with Institutional Animal Care and Use Committee (IACUC) guidelines of SingHealth Singapore and the Association for Research in Vision or Ophthalmology (ARVO) statement for the Use of Animals in Ophthalmic and Vision Research.

4.3. IVT Injection The procedure for IVT injection has been described previously [29,75,76]. Briefly, prior to injection animals were anesthetized with 150 mg/kg body weight (BW) ketamine hydrochloride (Parnell Laboratories, New South Wales, Australia) and 10 mg/kg BW xylazine hydrochloride (Troy Laboratories, New South Wales, Australia) and their pupils were dilated with a topical application of 1% tropicamide and 2.5% phenylephrine hydrochloride (Alcon Laboratories Inc., Fort Worth, TX, USA). For the injection, a 1 µL aliquot of solution containing each chemical was injected into the vitreous body of both eyes of each mouse using a Nanofil microsyringe with a 33G needle (World Precision Instruments Inc., Sarasota, FL, USA), under an ocular surgery microscope (Leica Microsystems GmbH, Wetzlar, Germany). A bilateral approach was taken to minimize the number of animals used in this study. All procedures were performed carefully to avoid injuring the lens or retina. Four or seven days following injections, the eyes were collected and subjected to further analysis as described below. Eyes with bleeding or inflammation caused by technical errors were excluded from analysis.

4.4. Intraocular Pressure (IOP) Measurement and Imaging Animals were anaesthetized with ketamine and xylazine in the same way as described in the above section. IOP was measured with an Icare TONOLAB rebound tonometer (Icare Finland Oy, Vantaa, Finland), approximately five minutes after animals were sedated. IOP was recorded between 9 AM and 11 AM in the room lighting at approximately 700 lux. The average of 5 consecutive measurements per eye was taken each time as the representative value. Digital color fundus photographs, spectral domain OCT images, and fundus fluorescent angiography (FFA) images were taken using the Micron IV retinal imaging microscope (Phoenix Research Laboratories, Pleasanton, CA, USA), centered on the optic nerve head and in all four quadrants. Fundus imaging and fluorescein angiography were performed following pupil dilation, as described above. FFA was performed after intraperitoneal injections of 1% sodium fluorescein dye (Akorn Inc., Lake Forest, IL, USA), diluted in sterile saline and given at a dose of 0.1 mL/10 g BW. FFA images were taken approximately 30 s after the fluorescein injection.

4.5. Histological Evaluation and Immunostaining Eyes for histology were fixed in 2.5% glutaraldehyde (Agar Scientific Ltd., Essex, UK) and 10% formaldehyde (Sigma Aldrich, St Louis, MO, USA) for 24 h at room temperature with gentle shaking. The fixed eyes were embedded in paraffin and the retinae were cross-sectioned with 3 µm thickness through the optic disk. Eight cross sections were automatically stained with hematoxylin and eosin (Leica Microsystems GmbH, Wetzlar, Germany) and three sections per an eye were randomly chosen for quantitative measurements. Images were recorded under a brightfield microscope (Axioplan2, Carl Zeiss GmbH, Oberkochen, Germany). Approximately 400 µm width of the retina, starting at 300 µm from the center of the optic disk, was analyzed and the number of cells in the GCL and IPL thickness were measured by ImageJ (version1.53; NIH, Bethesda, MD, USA). The values obtained in three sections were averaged as the representative value for each eye. For immunostaining, an antigen retrieval step was performed using a high pH target retrieval solution (Agilent Dako, Santa Clara, CA, USA). LC3 immunostaining was performed using a LC3 antibody (Sigma Aldrich, St Louis, MO, USA) in an antibody Int. J. Mol. Sci. 2021, 22, 7271 11 of 15

dilution buffer (2% BSA, 0.1% Triton in D- PBS) for overnight at 4 ◦C, followed by labelling with a secondary antibody conjugated to Alexa Fluor-488 (Thermo Fisher Scientiﬁc Inc., Waltham, MA, USA). Nuclei were labelled by incubating the sections in DAPI-containing D-PBS for 10 min at room temperature, before mounting with Prolong Diamond antifade (all from Life Technologies Corp, Carlsbad, CA, USA). Confocal images were taken with Leica SP8 microscopy (Leica Microsystems GmbH, Wetzlar, Germany) and analysed with Leica Application Suite X (LAS X) software (version 3.7.4; Leica Microsystems GmbH, Wetzlar, Germany).

4.6. Quantitative PCR According to the procedures described previously [29,75,76] and the manufacturer’s instructions, a quantitative PCR was performed. Briefly, total RNA was extracted using a RNeasy Lipid Tissue Mini kit (Qiagen, Hilden, Germany) and cDNA was synthesized using 0.4 µg of total RNA for each retina in a 20 µL mixture containing Superscipt Enzyme Mix, oligo-DT primers, and random hexamers (Life Technologies Corp, Carlsbad, CA, USA). The resultant cDNA was then diluted 20 times, and a 2 µL aliquot was added into a mixture containing SsoAdvanced Universal SYBR Green Supermix (Biorad, Hercules, CA, USA) and primer mix (Integrated DNA Technologies, Coralville, IA, USA). The sequences of forward and reverse primers used were listed in Table1. Quantitative PCR was performed using Quantstudio 7 Flex Real-Time Systems (Thermo Fisher Scientific Inc., Waltham, MA, USA) under the cycling condition at 50 ◦C for 2 min, 95 ◦C for 10 min, followed by 40 cycles at 94 ◦C for 1 min and 60 ◦C for 1 min. Threshold cycle time (Ct) values were determined using the Quantstudio software (Thermo Fisher Scientific Inc., Waltham, MA, USA). Gene expression levels of Nefl relative to that of glyceraldehyde-3-phosphate dehydrogenase (Gapdh) were determined by interpolating their Ct values to a standard curve (prepared with increasing amounts of cDNA derived from a 1:1 mixture of total RNA isolated from mouse brain and retina) and were further normalized to the respective control (vehicle group).

Table 1. Primer sequences used in the quantitative PCR study in 50 to 30 direction.

Gene Forward Reverse neuroﬁlament light chain (Neﬂ) CCGTACTTTTCGACCTCCTACA CTTGTGTGCGGATAGACTTGAG rhodopsin (Rho) CCCTTCTCCAACGTCACAGG TGAGGAAGTTGATGGGGAAGC glyceraldehyde-3-hosphate TGGCCTTCCGTGTTCCTAC GAGTTGCTGTTGAAGTCGCA dehydrogenase (Gapdh) 1 1 Housekeeping gene.

4.7. Cell Culture and Viability Assay SH-SY5Y human neuroblastoma cells were obtained from ATCC (Manassas, VA, USA) and cultured in accordance with the supplier’s instruction, in a culture media containing Dulbecco’s Modiﬁed Eagle’s Medium, F12 medium, 2 mM L-Glutamine, 10% fetal bovine serum, 0.1 mM non-essential amino acids, 1 mM sodium pyruvate, 1.5 mg/mL sodium bicarbonate, and 100 U/mL penicillin–streptomycin (all from Life Technologies Corp, Carlsbad, CA, USA). For viability assay, 10,000 cells were seeded onto a 96 well plate with collagen coating, and chemical treatments were performed 24 h after seeding as indicated. Autophagy activators were added 1 h prior to the addition of MG-262. Cell viability was then measured 24 h after treatment using a WST-1 assay kit (Abcam, Cambridge, UK) according to the manufacturer’s protocol. Absorbance value was measured with Inﬁnite M200 microplate reader (Tecan, Männedorf, Zürich, Switzerland).

4.8. Statistical Analysis Each value represents the mean ± standard deviation. For statistical analysis, an unpaired t-test, one-way, or two-way analysis of variance was performed and followed Int. J. Mol. Sci. 2021, 22, 7271 12 of 15

by post hoc analysis, as indicated in the ﬁgure legends. Differences were assumed to be statistically signiﬁcant when p < 0.05. All statistical analyses were performed with GraphPad Prism software version 9.0.2 (GraphPad, San Diego, CA, USA).

Author Contributions: Conceptualization, M.G., M.K. and N.A.S.; methodology, C.L., K.N., S.Y., C.H., V.A.B. and A.S.C.; formal analysis, M.G. and M.K.; investigation, M.G., C.L., K.N., S.Y., C.H., V.A.B., A.S.C., and M.K.; data curation, M.G.; writing—original draft preparation, M.G.; writing— review and editing, M.K. and N.A.S.; supervision, M.K. and N.A.S. All authors have read and agreed to the published version of the manuscript. Funding: This research received no external funding. Support was provided by Santen Pharmaceuti- cal Co. Ltd. in the form of salaries for its employees. Institutional Review Board Statement: The study was conducted according to the guidelines of the Institutional Animal Care and Use Committee (IACUC), Singapore. Informed Consent Statement: Not applicable. Data Availability Statement: The data presented in this study are available on request from the corresponding author. Conﬂicts of Interest: M.G., C.L., K.N., M.K., and N.A.S. are employees of Santen Pharmaceutical Co. Ltd. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.

References 1. Taylor, J.P.; Hardy, J.; Fischbeck, K.H. Toxic Proteins in Neurodegenerative Disease. Science 2002, 296, 1991–1995. [CrossRef] 2. Dantuma, N.P.; Bott, L.C. The ubiquitin-proteasome system in neurodegenerative diseases: Precipitating factor, yet part of the solution. Front. Mol. Neurosci. 2014, 7, 70. [CrossRef][PubMed] 3. Bustamante, H.A.; Gonzalez, A.E.; Cerda-Troncoso, C.; Shaugnessy, R.; Otth, C.; Soza, A.; Burgos, P.V. Interplay between the autophagy-lysosomal pathway and the ubiquitin-proteasome system: A target for therapeutic development in Alzheimer’s disease. Front. Cell. Neurosci. 2018, 12, 126. [CrossRef][PubMed] 4. Raynes, R.; Pomatto, L.C.; Davies, K.J. Degradation of oxidized proteins by the proteasome: Distinguishing between the 20S, 26S, and immunoproteasome proteolytic pathways. Mol. Asp. Med. 2016, 50, 41–55. [CrossRef][PubMed] 5. Saez, I.; Vilchez, D. The Mechanistic Links Between Proteasome Activity, Aging and Age-related Diseases. Curr. Genom. 2014, 15, 38–51. [CrossRef][PubMed] 6. McNaught, K.S.P.; Björklund, L.M.; Belizaire, R.; Isacson, O.; Jenner, P.; Olanow, C.W. Proteasome inhibition causes nigral degeneration with inclusion bodies in rats. NeuroReport 2002, 13, 1437–1441. [CrossRef][PubMed] 7. McNaught, K.S.P.; Belizaire, R.; Jenner, P.; Olanow, C.; Isacson, O. Selective loss of 20S proteasome α-subunits in the substantia nigra pars compacta in Parkinson’s disease. Neurosci. Lett. 2002, 326, 155–158. [CrossRef] 8. Xie, W.; Li, X.; Li, C.; Zhu, W.; Jankovic, J.; Le, W. Proteasome inhibition modeling nigral neuron degeneration in Parkinson’s disease. J. Neurochem. 2010, 115, 188–199. [CrossRef] 9. Bedford, L.; Hay, D.; Devoy, A.; Paine, S.; Powe, D.G.; Seth, R.; Gray, T.; Topham, I.; Fone, K.; Rezvani, N.; et al. Depletion of 26S proteasomes in mouse brain neurons causes neurodegeneration and Lewy-like inclusions resembling human pale bodies. J. Neurosci. 2008, 28, 8189–8198. [CrossRef] 10. Li, Z.; Arnaud, L.; Rockwell, P.; Figueiredo-Pereira, M.E. A single amino acid substitution in a proteasome subunit triggers aggregation of ubiquitinated proteins in stressed neuronal cells. J. Neurochem. 2004, 90, 19–28. [CrossRef] 11. Lim, J.; Yue, Z. Neuronal Aggregates: Formation, Clearance, and Spreading. Dev. Cell 2015, 32, 491–501. [CrossRef] 12. Komatsu, M.; Ueno, T.; Waguri, S.; Uchiyama, Y.; Kominami, E.; Tanaka, K. Constitutive autophagy: Vital role in clearance of unfavorable proteins in neurons. Cell Death Differ. 2007, 14, 887–894. [CrossRef] 13. Hara, T.; Nakamura, K.; Matsui, M.; Yamamoto, A.; Nakahara, Y.; Suzuki-Migishima, R.; Yokoyama, M.; Mishima, K.; Saito, I.; Okano, H.; et al. Suppression of basal autophagy in neural cells causes neurodegenerative disease in mice. Nature 2006, 441, 885–889. [CrossRef] 14. Komatsu, M.; Waguri, S.; Chiba, T.; Murata, S.; Iwata, J.-I.; Tanida, I.; Ueno, T.; Koike, M.; Uchiyama, Y.; Kominami, E.; et al. Loss of autophagy in the central nervous system causes neurodegeneration in mice. Nature 2006, 441, 880–884. [CrossRef] 15. Leger, F.; Fernagut, P.-O.; Canron, M.-H.; Léoni, S.; Vital, C.; Tison, F.; Bezard, E.; Vital, A. Protein Aggregation in the Aging Retina. J. Neuropathol. Exp. Neurol. 2011, 70, 63–68. [CrossRef][PubMed] 16. Kapphahn, R.J.; Bigelow, E.J.; Ferrington, D.A. Age-dependent inhibition of proteasome chymotrypsin-like activity in the retina. Exp. Eye Res. 2007, 84, 646–654. [CrossRef][PubMed] 17. Louie, J.L.; Kapphahn, R.J.; Ferrington, D.A. Proteasome function and protein oxidation in the aged retina. Exp. Eye Res. 2002, 75, 271–284. [CrossRef][PubMed] Int. J. Mol. Sci. 2021, 22, 7271 13 of 15

18. Rodríguez-Muela, N.; Koga, H.; García-Ledo, L.; De La Villa, P.; De La Rosa, E.J.; Cuervo, A.M.; Boya, P. Balance between autophagic pathways preserves retinal homeostasis. Aging Cell 2013, 12, 478–4882. [CrossRef] 19. Lobanova, E.; Finkelstein, S.; Skiba, N.P.; Arshavsky, V.Y. Proteasome overload is a common stress factor in multiple forms of inherited retinal degeneration. Proc. Natl. Acad. Sci. USA 2013, 110, 9986–9991. [CrossRef] 20. Ando, R.; Noda, K.; Tomaru, U.; Kamoshita, M.; Ozawa, Y.; Notomi, S.; Hisatomi, T.; Noda, M.; Kanda, A.; Ishibashi, T.; et al. Decreased Proteasomal Activity Causes Photoreceptor Degeneration in Mice. Investig. Opthalmol. Vis. Sci. 2014, 55, 4682–4690. [CrossRef] 21. Lobanova, E.; Finkelstein, S.; Li, J.; Travis, A.M.; Hao, Y.; Klingeborn, M.; Skiba, N.P.; Deshaies, R.J.; Arshavsky, V.Y. Increased proteasomal activity supports photoreceptor survival in inherited retinal degeneration. Nat. Commun. 2018, 9, 1738. [CrossRef] 22. Besirli, C.; Chinskey, N.D.; Zheng, Q.-D.; Zacks, D.N. Autophagy Activation in the Injured Photoreceptor Inhibits Fas-Mediated Apoptosis. Investig. Opthalmol. Vis. Sci. 2011, 52, 4193–4199. [CrossRef] 23. Kunchithapautham, K.; Rohrer, B. Apoptosis and Autophagy in Photoreceptors Exposed to Oxidative Stress. Autophagy 2007, 3, 433–441. [CrossRef] 24. Rodríiguez-Muela, N.; Hernández-Pinto, A.M.; Serrano-Puebla, A.; Garcíaledo, L.; Latorre, S.; de la Rosa, E.J.; Boya, P. Lysosomal membrane permeabilization and autophagy blockade contribute to photoreceptor cell death in a mouse model of retinitis pigmentosa. Cell Death Differ. 2015, 22, 476–487. [CrossRef][PubMed] 25. Mitter, S.K.; Rao, H.V.; Qi, X.; Cai, J.; Sugrue, A.; Dunn, W.A.; Grant, M.B.; Boulton, M.E. Autophagy in the Retina: A Potential Role in Age-Related Macular Degeneration. Adv. Exp. Med. Biol. 2011, 83–90. [CrossRef] 26. Mitter, S.K.; Song, C.; Qi, X.; Mao, H.; Rao, H.; Akin, D.; Lewin, A.; Grant, M.; Dunn, W.; Ding, J.; et al. Dysregulated autophagy in the RPE is associated with increased susceptibility to oxidative stress and AMD. Autophagy 2014, 10, 1989–2005. [CrossRef] 27. Golestaneh, N.; Chu, Y.; Xiao, Y.-Y.; Stoleru, G.L.; Theos, A.C. Dysfunctional autophagy in RPE, a contributing factor in age-related macular degeneration. Cell Death Dis. 2018, 8, e2537. [CrossRef] 28. Fernández-Albarral, J.A. The Role of Autophagy in Eye Diseases. Life 2021, 11, 189. [CrossRef] 29. Kageyama, M.; Ota, T.; Sasaoka, M.; Katsuta, O.; Shinomiya, K. Chemical proteasome inhibition as a novel animal model of inner retinal degeneration in rats. PLoS ONE 2019, 14, e0217945. [CrossRef] 30. Kihara, A.; Kabeya, Y.; Ohsumi, Y.; Yoshimori, Y. Beclin–phosphatidylinositol 3-kinase complex functions at the trans-Golgi network. EMBO Rep. 2001, 2, 330–335. [CrossRef] 31. Qu, X.; Yu, J.; Bhagat, G.; Furuya, N.; Hibshoosh, H.; Troxel, A.; Rosen, J.; Eskelinen, E.-L.; Mizushima, N.; Ohsumi, Y.; et al. Promotion of tumorigenesis by heterozygous disruption of the beclin 1 autophagy gene. J. Clin. Investig. 2003, 112, 1809–1820. [CrossRef][PubMed] 32. Yue, Z.; Jin, S.; Yang, C.; Levine, A.J.; Heintz, N. Beclin 1, an autophagy gene essential for early embryonic development, is a haploinsufficient tumor suppressor. Proc. Natl. Acad. Sci. USA 2003, 100, 15077–15082. [CrossRef] 33. Pickford, F.; Masliah, E.; Britschgi, M.; Lucin, K.; Narasimnah, R.; Jaeger, P.A.; Small, S.; Spencer, B.; Rockenstein, B.; Levine, B.; et al. The autophagy-related protein beclin 1 shows reduced expression in early Alzheimer disease and regulates amyloid β accumulation in mice. J. Clin. Investig. 2008, 118, 2190–2199. [CrossRef] 34. Razani, B.; Feng, C.; Coleman, T.; Emanuel, R.; Wen, H.; Hwang, S.; Ting, J.P.; Virgin, H.; Kastan, M.B.; Semenkovich, C.F. Autophagy Links Inflammasomes to Atherosclerotic Progression. Cell Metab. 2012, 15, 534–544. [CrossRef][PubMed] 35. Chen, Y.; Sawada, O.; Kohno, H.; Le, Y.-Z.; Subauste, C.; Maeda, T.; Maeda, A. Autophagy Protects the Retina from Light-induced Degeneration. J. Biol. Chem. 2013, 288, 7506–7518. [CrossRef][PubMed] 36. Soto, I.; Oglesby, E.; Buckingham, B.P.; Son, J.L.; Roberson, E.D.O.; Steele, M.R.; Inman, D.M.; Vetter, M.L.; Horner, P.J.; Marsh- Armstrong, N. Retinal Ganglion Cells Downregulate Gene Expression and Lose Their Axons within the Optic Nerve Head in a Mouse Glaucoma Model. J. Neurosci. 2008, 28, 548–561. [CrossRef] 37. Pan, Y.; Luna, R.I.M.-D.; Lou, C.-H.; Nekkalapudi, S.; Kelly, L.E.; Sater, A.K.; El-Hodiri, H.M. Regulation of photoreceptor gene expression by the retinal homeobox (Rx) gene product. Dev. Biol. 2010, 339, 494–506. [CrossRef][PubMed] 38. Camacho, A.; Massieu, L. Role of glutamate transporters in the clearance and release of glutamate during ischemia and its relation to neuronal death. Arch. Med Res. 2006, 37, 11–18. [CrossRef][PubMed] 39. Manev, H.; Favaron, M.; Guidotti, A.; Costa, E. Delayed increase of Ca2+ influx elicited by glutamate: Role in neuronal death. Mol. Pharmacol. 1989, 36, 106–112. 40. Jang, S.; Lee, J.-H.; Choi, K.-R.; Kim, N.; Yoo, H.-S.; Oh, S. Cytochemical Alterations in the Rat Retina by LPS Administration. Neurochem. Res. 2006, 32, 1–10. [CrossRef] 41. Xicoy, H.; Wieringa, B.; Martens, G.J.M. The SH-SY5Y cell line in Parkinson’s disease research: A systematic review. Mol. Neurodegener. 2017, 12, 1–11. [CrossRef] 42. Kim, Y.C.; Guan, K.-L. mTOR: A pharmacologic target for autophagy regulation. J. Clin. Investig. 2015, 125, 25–32. [CrossRef] 43. Shoji-Kawata, S.; Sumpter, R.; Leveno, M.; Campbell, G.R.; Zou, Z.; Kinch, L.; Wilkins, A.D.; Sun, Q.; Pallauf, K.; MacDuff, D.; et al. Identification of a candidate therapeutic autophagy-inducing peptide. Nat. Cell Biol. 2013, 494, 201–206. [CrossRef] 44. Vingtdeux, V.; Chandakkar, P.; Zhao, H.; d’Abramo, C.; Davies, P.; Marambaud, P. Novel synthetic small-molecule activators of AMPK as enhancers of autophagy and amyloid-β peptide degradation. FASEB J. 2011, 25, 219–231. [CrossRef][PubMed] Int. J. Mol. Sci. 2021, 22, 7271 14 of 15

45. Sarkar, S.; Ravikumar, B.; Floto, R.A.; Rubinsztein, D.C. Rapamycin and mTOR-independent autophagy inducers ameliorate toxicity of polyglutamine-expanded huntingtin and related proteinopathies. Cell Death Differ. 2009, 16, 46–56. [CrossRef] [PubMed] 46. Bell, K.; Rosingol, I.; Sierra-Filardi, E.; Schmelter, C.; Grus, F.; Boya, P. Age related RGC vulnerability in an autophagy deficient mouse model. Investig. Ophthalmol. Vis. Sci. 2020, 61, 2360. 47. Rodríguez-Muela, N.; Germain, F.; Mariño, G.; Fitze, P.S.; Boya, P. Autophagy promotes survival of retinal ganglion cells after optic nerve axotomy in mice. Cell Death Differ. 2011, 19, 162–169. [CrossRef][PubMed] 48. Russo, R.; Varano, G.P.; Adornetto, A.; Nazio, F.; Tettamanti, G.; Girardello, R.; Cianfanelli, V.; Cavaliere, F.; Morrone, L.A.; Corasaniti, M.T.; et al. Rapamycin and fasting sustain autophagy response activated by ischemia/reperfusion injury and promote retinal ganglion cell survival. Cell Death Dis. 2018, 9, 1–18. [CrossRef][PubMed] 49. Park, K.K.; Liu, K.; Hu, Y.; Smith, P.D.; Wang, C.; Cai, B.; Xu, B.; Connolly, L.; Kramvis, I.; Sahin, M.; et al. Promoting Axon Regeneration in the Adult CNS by Modulation of the PTEN/mTOR Pathway. Science 2008, 322, 963–966. [CrossRef] 50. Kisselev, A.F.; Goldberg, A.L. Proteasome inhibitors: From research tools to drug candidates. Chem. Biol. 2001, 8, 739–758. [CrossRef] 51. Yao, J.; Qiu, Y.; Frontera, E.; Jia, L.; Khan, N.W.; Klionsky, D.J.; Ferguson, T.A.; Thompson, D.A.; Zacks, D.N. Inhibiting autophagy reduces retinal degeneration caused by protein misfolding. Autophagy 2018, 14, 1226–1238. [CrossRef][PubMed] 52. Qiu, Y.; Yao, J.; Jia, L.; Thompson, D.A.; Zacks, D.N. Shifting the balance of autophagy and proteasome activation reduces proteotoxic cell death: A novel therapeutic approach for restoring photoreceptor homeostasis. Cell Death Dis. 2019, 10, 1–14. [CrossRef][PubMed] 53. Su, W.; Li, Z.; Jia, Y.; Zhuo, Y. Rapamycin Is Neuroprotective in a Rat Chronic Hypertensive Glaucoma Model. PLoS ONE 2014, 9, e99719. [CrossRef] 54. Lim, J.-H.A.; Stafford, B.K.; Nguyen, B.K.S.P.L.; Lien, J.-H.A.L.B.V.; Wang, C.; Zukor, K.; He, C.W.Z.; Huberman, A.D. Neural activity promotes long-distance, target-specific regeneration of adult retinal axons. Nat. Neurosci. 2016, 19, 1073–1084. [CrossRef] [PubMed] 55. Chen, G.; Tang, L.; Wei, W.; Li, Z.; Li, Y.; Duan, X.; Chen, H. mTOR regulates neuroprotective effect of immunized CD4+Foxp3+ T cells in optic nerve ischemia. Sci. Rep. 2016, 6, 37805. [CrossRef][PubMed] 56. Piras, A.; Gianetto, D.; Conte, D.; Bosone, A.; Vercelli, A. Activation of Autophagy in a Rat Model of Retinal Ischemia following High Intraocular Pressure. PLoS ONE 2011, 6, e22514. [CrossRef] 57. Kovalevich, J.; Langford, D. Considerations for the Use of SH-SY5Y Neuroblastoma Cells in Neurobiology; Springer Science and Business Media LLC: New York, NY, USA, 2013; Volume 1078, pp. 9–21. 58. Bell, M.; Zempel, H. SH-SY5Y-derived neurons: A human neuronal model system for investigating TAU sorting and neuronal subtype-specific TAU vulnerability. Rev. Neurosci. 2021.[CrossRef] 59. Shamoto-Nagai, M.; Maruyama, W.; Kato, Y.; Isobe, K.-i.; Tanaka, M.; Naoi, M.; Osawa, T. An inhibitor of mitochondrial complex I, rotenone, inactivates proteasome by oxidative modification and induces aggregation of oxidized proteins in SH-SY5Y cells. J. Neurosci. Res. 2003, 74, 589–597. [CrossRef] 60. Cheng, B.; Maffi, S.K.; Martinez, A.A.; Acosta, Y.P.V.; Morales, L.D.; Roberts, J.L. Insulin-like growth factor-I mediates neuroprotection in proteasome inhibition-induced cytotoxicity in SH-SY5Y cells. Mol. Cell. Neurosci. 2011, 47, 181–190. [CrossRef] 61. Srinivasan, V.; Bruelle, C.; Scifo, E.; Pham, D.D.; Soliymani, R.; Lalowski, M.; Lindholm, D. Dynamic Interaction of USP14 with the Chaperone HSC70 Mediates Crosstalk between the Proteasome, ER Signaling, and Autophagy. iScience 2020, 23, 100790. [CrossRef] 62. Pantazopoulou, M.; Brembati, V.; Kanellidi, A.; Bousset, L.; Melki, R.; Stefanis, L. Distinct alpha-Synuclein species induced by seeding are selectively cleared by the Lysosome or the Proteasome in neuronally differentiated SH-SY5Y cells. J. Neurochem. 2021, 156, 880–896. [CrossRef][PubMed] 63. Sengupta, S.; Peterson, T.R.; Sabatini, D.M. Regulation of the mTOR Complex 1 Pathway by Nutrients, Growth Factors, and Stress. Mol. Cell 2010, 40, 310–322. [CrossRef][PubMed] 64. Kim, J.; Kundu, M.; Viollet, B.; Guan, K.-L. AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk. Nat. Cell Biol. 2011, 13, 132–141. [CrossRef][PubMed] 65. Alers, S.; Löffler, A.S.; Wesselborg, S.; Stork, B. Role of AMPK-mTOR-Ulk1/2 in the regulation of autophagy: Cross talk, shortcuts, and feedbacks. Mol. Cell. Biol. 2012, 32, 2–11. [CrossRef][PubMed] 66. Renna, M. Chemical inducers of autophagy that enhance the clearance of mutant proteins in neurodegenerative dis-eases. J. Biol. Chem. 2010, 285, 11061–11067. [CrossRef] 67. Williams, A. Novel targets for Huntington’s disease in an mTOR-independent autophagy pathway. Nat. Chem. Biol. 2008, 4, 295–305. [CrossRef] 68. Criollo, A.; Maiuri, M.C.; Tasdemir, E.; Vitale, I.; A Fiebig, A.; Andrews, D.; Molgó, J.; Díaz, J.; Lavandero, S.; Harper, F.; et al. Regulation of autophagy by the inositol trisphosphate receptor. Cell Death Differ. 2007, 14, 1029–1039. [CrossRef] 69. Sarkar, S.; Floto, R.A.; Berger, Z.; Imarisio, S.; Cordenier, A.; Pasco, M.; Cook, L.J.; Rubinsztein, D.C. Lithium induces autophagy by inhibiting inositol monophosphatase. J. Cell Biol. 2005, 170, 1101–1111. [CrossRef] 70. Motoi, Y.; Shimada, K.; Ishiguro, K.; Hattori, N. Lithium and Autophagy. ACS Chem. Neurosci. 2014, 5, 434–442. [CrossRef] Int. J. Mol. Sci. 2021, 22, 7271 15 of 15

71. Thellung, S.; Corsaro, A.; Nizzari, M.; Barbieri, F.; Florio, T. Autophagy Activator Drugs: A New Opportunity in Neuroprotection from Misfolded Protein Toxicity. Int. J. Mol. Sci. 2019, 20, 901. [CrossRef] 72. Vakifahmetoglu-Norberg, H.; Xia, H.-G.; Yuan, J. Pharmacologic agents targeting autophagy. J. Clin. Investig. 2015, 125, 5–13. [CrossRef][PubMed] 73. Sharif, N.A. iDrugs and iDevices Discovery Research: Preclinical Assays, Techniques, and Animal Model Studies for Ocular Hypotensives and Neuroprotectants. J. Ocul. Pharmacol. Ther. 2018, 34, 7–39. [CrossRef] 74. Sharif, N.A. Glaucomatous optic neuropathy treatment options: The promise of novel therapeutics, techniques and tools to help preserve vision. Neural Regen. Res. 2018, 13, 1145–1150. [CrossRef][PubMed] 75. Fuwa, M.; Kageyama, M.; Ohashi, K.; Sasaoka, M.; Sato, R.; Tanaka, M.; Tashiro, K. Nafamostat and sepimostat identiﬁed as novel neuroprotective agents via NR2B N-methyl-D-aspartate receptor antagonism using a rat retinal excitotoxicity model. Sci. Rep. 2019, 9, 20409–20412. [CrossRef][PubMed] 76. Sasaoka, M.; Ota, T.; Kageyama, M. Rotenone-induced inner retinal degeneration via presynaptic activation of voltage-dependent sodium and L-type calcium channels in rats. Sci. Rep. 2020, 10, 1–16.