DOCSLIB.ORG

Molecular Phylogeny of a Potentially Parasitic Dinoflagellate Isolated from the Solitary Radiolarian, Thalassicolla Nucleata

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Phylogeny of a Potentially Parasitic Dinoflagellate Isolated from the Solitary Radiolarian, Thalassicolla Nucleata J. Eukaryot. Microbiol., 53(1), 2006 pp. 43–45 r 2006 The Author(s) Journal compilation r 2006 by the International Society of Protistologists DOI: 10.1111/j.1550-7408.2005.00071.x Molecular Phylogeny of a Potentially Parasitic Dinoflagellate Isolated from the Solitary Radiolarian, Thalassicolla nucleata REBECCA J. GAST ABSTRACT. Thalassicolla nucleata, a solitary radiolarian, has been described as being parasitized by two dinoflagellates, Solenodinium (Syndiniales) and Caryotoma (Blastodiniales). Several T. nucleata were stripped of their extracapsular material and allowed to regenerate their rhizopodial structures without symbionts. Within a week, two were observed to disintegrate, leaving behind non-pigmented swimming dinoflagellate cells. Identical full-length ribosomal sequences were recovered from both samples. Upon alignment and phylogenetic analysis, it was determined that these putative parasite sequences were distinct from Scrippsiella nutricula (the dinoflagellate symbiont of the host), and also from all other dinoflagellate parasites sequenced to date. Key Words: Blastodiniales, dinoflagellate parasite, molecular phylogeny, Syndiniales. EVERAL dinoflagellate genera have been reported as internal in a well of a six-well Costar dish with 5 ml of filtered sterile S and external parasites of a wide range of organisms, including seawater. The extracapsular material was allowed to regenerate invertebrates, ciliates, sarcodines, and other dinoflagellates (Coats and the cells were maintained at 25 1C with a 12-h photoperiod for 1999). These parasitic interactions often result in negative effects several days. on the host, including reproductive impairment and death. In this DNA extraction, amplification, and sequencing. Dinoflagel- manner, parasitic dinoflagellates can influence the composition of late-like cells that appeared from two disintegrated central cap- the microbial food web with either positive (destruction of harm- sules were collected using a sterile 1-ml pipet into sterile 1.5-ml ful algal blooms) or negative (removal of prey items from the microcentrifuge tubes. Cells were pelleted at approximately planktonic food web) outcomes. 15,000 g for 5 min. The seawater was removed and replaced with The diversity of parasitic dinoflagellates was first recognized 25 ml of 5% Chelex (Walsh, Metzger, and Higuchi 1991). The and described by Chatton (see Cachon and Cachon 1987). Jean cells were lysed by heating to 95 1C for 10 min and 1 ml was used and Monique Cachon continued the study of these parasites, for PCR amplification. Primers A (50 AACCTGGTTGATCCT resulting in significant information regarding the structure and GCCAGT 30) and B (50 GATCCTTCTGCAGGTTCACCTAC 30) function of the dinoflagellate cells themselves (Cachon and were used to amplify the full-length small subunit ribosomal gene Cachon 1987). Regarding the sarcodines, radiolaria in particular in a 50-ml reaction (Gast and Caron 1996). The cycling parameters have been described as being parasitized by several genera of were 3 min at 95 1C, 35 cycles of 1 min at 94 1C, 1 min at 52 1C, dinoflagellates. Species of Syndinium occur intracapsularly in 2 min at 72 1C with a final extension of 10 min at 72 1C. PCR both colonial and solitary radiolaria, whereas Solenodinium and products were cleaned using Wizards PCR Prep DNA Purifica- Caryotoma are only found in members of the solitary radiolaria, tion System (Promega, Madison, Wisconsin) and pooled products Thalassicollidae (Hollande 1974; Hollande and Corbel 1982; were sequenced directly using infrared dye-labeled primers Theodorides 1989). (LI-COR, Lincoln, Nebraska) and Sequitherm (Epicentre Tech- Thalassicolla nucleata is a solitary radiolarian that has photo- nologies, Madison, Wisconsin; Gast and Caron 1996). The full- synthetic dinoflagellate symbionts (Gast and Caron 1996). We length sequences for the dinoflagellate parasite were deposited in employed Thalassicolla as a system to examine symbiont re- GenBank under Accession numbers DQ116021 and DQ116022. establishment because the extracapsular material containing the Phylogenetic reconstruction. An alignment of 47 dinoflagel- photosynthetic symbionts can be stripped away from the central late small subunit ribosomal gene (srDNA) sequences was gen- capsule that contains most of the host cell. While conducting erated using GCG Wisconsin PackageTM SeqLabs (alignment symbiont re-establishment experiments, two central capsules in available from the author upon request). There were a total of the process of ‘‘re-growth’’ without symbionts were observed to 1,577 sites used for the phylogenetic analysis, with 493 informa- drop to the bottom of their culture dishes and release non- tive for parsimony. Modeltest 3.5 (Posada and Crandall 1998) was pigmented dinoflagellate cells. Considered to be putative para- used to establish the best model of evolution for the dataset, and sites, these cells were collected for microscopy, enriched by maximum likelihood parameters (TrN1I1G) were used culturing, and identified using small subunit ribosomal gene to generate the tree in PAUPÃ (base frequencies A 5 0.2741, sequence analysis. C 5 0.1830, G 5 0.2528, T 5 0.2901; A À C 5 1, A À G 5 3.1549, A À T 5 1, C À G 5 1, C À T 5 6.4002, G À T 5 1; pro- portion of invariable sites 5 0.3311; g 5 0.6507; Swofford 1999). MATERIALS AND METHODS One hundred bootstrap replicates of maximum parsimony were Radiolaria collection. Thalassicolla nucleata were collected used to estimate the confidence of the reconstructed branch points. several miles offshore of Bermuda in July of 1996. Cells were The trees are unrooted, but Amoebophrya was used as the out- brought back to the laboratory and their extracapsular material group in both analyses. was stripped away by repeated pipetting using a 1-ml pipettor tip to disrupt the matrix. Additional removal of extracapsular materi- RESULTS AND DISCUSSION al was accomplished with pulled glass micropipets. The central capsules were washed three separate times in 0.2-mm filtered After re-growing their extracapsular material in the absence of sterile seawater, examined by microscopy to confirm that all symbionts, two individual Thalassicolla central capsules disinte- symbionts were removed, and then each individual was placed grated and released several hundred non-pigmented dinoflagel- late-like cells. The enrichment culture of these dinoflagellates and Corresponding Author: R. Gast, Woods Hole Oceanographic Institu- their preservation were unsuccessful, but full-length small subunit tion, Woods Hole, MA 02543—Telephone number: 508 –289 3209; ribosomal gene sequences were amplified and sequenced for FAX number: 508 –457 2169; e-mail: [email protected] each of the two samples. Molecular phylogenetic reconstructions 43 44 J. EUKARYOT. MICROBIOL., VOL. 53, NO. 1, JANUARY– FEBRUARY 2006 confirmed that the cells were dinoflagellates, that the two samples todinium (Fig. 1), which form a well-supported group. The were identical to each other, and that they were unrelated to the Blastodiniales currently do not form a monophyletic group host symbionts (Scrippsiella nutricula) or any of the dinoflagel- in srDNA phylogenetic analyses (Saldarriaga et al. 2004), but late parasites currently available in the sequence database (Fig. 1). the Thalassicolla dinoflagellate also does not show an affinity The general topology of the reconstruction is congruent with other with either of the two members of this group, Haplozoon and recent phylogenies (Saldarriaga et al. 2001, 2004), although many Amyloodinium. In fact, there is no support for grouping this new of the internal branch points are not well resolved. This has been sequence with any of the other published dinoflagellates. This noted in the previous publications as well. does not rule out the possibility that the putative parasite is Two dinoflagellates, Solenodinium and Caryotoma, have been Caryotoma, but it also does not provide strong support. Further described as intracapsular parasites of Thalassicolla. Solenodi- studies on the location of the infection are likely necessary to nium is considered a member of the Syndiniales, and parasitizes resolve the genus identification. the nucleus of the host (Coats 1999; Hollande 1974; Theodorides Despite the inability to provide a name for this parasite, the 1989). Caryotoma is a member of the Blastodiniales, and is genetic information obtained is valuable. It has shown that these described as being within the central capsule, but not within the putative Thallassicola parasites are not members of the Syndi- nucleus (Coats 1999; Hollande and Corbel 1982; Theodorides niales, and might represent a group of dinoflagellate parasites that 1989). The lack of ultrastuctural information on the location of is unrelated to any of the ones currently sequenced. An alternative this parasite makes it impossible to designate it as either genus conclusion could be that this organism is not a parasite at all, but a based upon cellular location. heterotroph that was not removed during the washes of the central Observations of the released cells showed them to be gymno- capsules and grew to an observable number over a period of dinoid in shape, about 20 mm in size, and highly refractile under several days. This seems unlikely considering the regrowing dark-field illumination on a dissecting microscope (data not central capsules were monitored microscopically twice a day, available). These morphological characters suggest the potential and no dinoflagellates were observed in the culture dishes prior affiliation with either genus, but
Load more

Recommended publications
  • This Article Appeared in a Journal Published by Elsevier. the Attached
    This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research and education use, including for instruction at the authors institution and sharing with colleagues. Other uses, including reproduction and distribution, or selling or licensing copies, or posting to personal, institutional or third party websites are prohibited. In most cases authors are permitted to post their version of the article (e.g. in Word or Tex form) to their personal website or institutional repository. Authors requiring further information regarding Elsevier’s archiving and manuscript policies are encouraged to visit: http://www.elsevier.com/copyright Author's personal copy ARTICLE IN PRESS European Journal of PROTISTOLOGY European Journal of Protistology 44 (2008) 299–307 www.elsevier.de/ejop Morphology and molecular phylogeny of Haplozoon praxillellae n. sp. (Dinoflagellata): A novel intestinal parasite of the maldanid polychaete Praxillella pacifica Berkeley Sonja RueckertÃ, Brian S. Leander Canadian Institute for Advanced Research, Program in Integrated Microbial Biodiversity, Departments of Botany and Zoology, University of British Columbia, Vancouver, BC, Canada V6T 1Z4 Received 11 December 2007; received in revised form 3 April 2008; accepted 5 April 2008 Abstract The genus Haplozoon comprises a group of endoparasites infecting the intestines of polychaete worms. Comparative studies using light microscopy, scanning and transmission electron microscopy, and small subunit rDNA have shown that these organisms are very unusual dinoflagellates. To date, there is only one species known from the Pacific Ocean, namely Haplozoon axiothellae Siebert. In this study, we describe Haplozoon praxillellae n. sp. from the intestine of the Pacific maldanid polychaete Praxillella pacifica Berkeley.
    [Show full text]
  • Molecular Data and the Evolutionary History of Dinoflagellates by Juan Fernando Saldarriaga Echavarria Diplom, Ruprecht-Karls-Un
    Molecular data and the evolutionary history of dinoflagellates by Juan Fernando Saldarriaga Echavarria Diplom, Ruprecht-Karls-Universitat Heidelberg, 1993 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES Department of Botany We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA November 2003 © Juan Fernando Saldarriaga Echavarria, 2003 ABSTRACT New sequences of ribosomal and protein genes were combined with available morphological and paleontological data to produce a phylogenetic framework for dinoflagellates. The evolutionary history of some of the major morphological features of the group was then investigated in the light of that framework. Phylogenetic trees of dinoflagellates based on the small subunit ribosomal RNA gene (SSU) are generally poorly resolved but include many well- supported clades, and while combined analyses of SSU and LSU (large subunit ribosomal RNA) improve the support for several nodes, they are still generally unsatisfactory. Protein-gene based trees lack the degree of species representation necessary for meaningful in-group phylogenetic analyses, but do provide important insights to the phylogenetic position of dinoflagellates as a whole and on the identity of their close relatives. Molecular data agree with paleontology in suggesting an early evolutionary radiation of the group, but whereas paleontological data include only taxa with fossilizable cysts, the new data examined here establish that this radiation event included all dinokaryotic lineages, including athecate forms. Plastids were lost and replaced many times in dinoflagellates, a situation entirely unique for this group. Histones could well have been lost earlier in the lineage than previously assumed.
    [Show full text]
  • A Parasite of Marine Rotifers: a New Lineage of Dinokaryotic Dinoflagellates (Dinophyceae)
    Hindawi Publishing Corporation Journal of Marine Biology Volume 2015, Article ID 614609, 5 pages http://dx.doi.org/10.1155/2015/614609 Research Article A Parasite of Marine Rotifers: A New Lineage of Dinokaryotic Dinoflagellates (Dinophyceae) Fernando Gómez1 and Alf Skovgaard2 1 Laboratory of Plankton Systems, Oceanographic Institute, University of Sao˜ Paulo, Prac¸a do Oceanografico´ 191, Cidade Universitaria,´ 05508-900 Butanta,˜ SP, Brazil 2Department of Veterinary Disease Biology, University of Copenhagen, Stigbøjlen 7, 1870 Frederiksberg C, Denmark Correspondence should be addressed to Fernando Gomez;´ [email protected] Received 11 July 2015; Accepted 27 August 2015 Academic Editor: Gerardo R. Vasta Copyright © 2015 F. Gomez´ and A. Skovgaard. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Dinoflagellate infections have been reported for different protistan and animal hosts. We report, for the first time, the association between a dinoflagellate parasite and a rotifer host, tentatively Synchaeta sp. (Rotifera), collected from the port of Valencia, NW Mediterranean Sea. The rotifer contained a sporangium with 100–200 thecate dinospores that develop synchronically through palintomic sporogenesis. This undescribed dinoflagellate forms a new and divergent fast-evolved lineage that branches amongthe dinokaryotic dinoflagellates. 1. Introduction form independent lineages with no evident relation to other dinoflagellates [12]. In this study, we describe a new lineage of The alveolates (or Alveolata) are a major lineage of protists an undescribed parasitic dinoflagellate that largely diverged divided into three main phyla: ciliates, apicomplexans, and from other known dinoflagellates.
    [Show full text]
  • Supplementary Material Parameter Unit Average ± Std NO3 + NO2 Nm
    Supplementary Material Table S1. Chemical and biological properties of the NRS water used in the experiment (before amendments). Parameter Unit Average ± std NO3 + NO2 nM 140 ± 13 PO4 nM 8 ± 1 DOC μM 74 ± 1 Fe nM 8.5 ± 1.8 Zn nM 8.7 ± 2.1 Cu nM 1.4 ± 0.9 Bacterial abundance Cells × 104/mL 350 ± 15 Bacterial production μg C L−1 h−1 1.41 ± 0.08 Primary production μg C L−1 h−1 0.60 ± 0.01 β-Gl nM L−1 h−1 1.42 ± 0.07 APA nM L−1 h−1 5.58 ± 0.17 AMA nM L−1·h−1 2.60 ± 0.09 Chl-a μg/L 0.28 ± 0.01 Prochlorococcus cells × 104/mL 1.49 ± 02 Synechococcus cells × 104/mL 5.14 ± 1.04 pico-eukaryot cells × 103/mL 1.58 × 0.1 Table S2. Nutrients and trace metals concentrations added from the aerosols to each mesocosm. Variable Unit Average ± std NO3 + NO2 nM 48 ± 2 PO4 nM 2.4 ± 1 DOC μM 165 ± 2 Fe nM 2.6 ± 1.5 Zn nM 6.7 ± 2.5 Cu nM 0.6 ± 0.2 Atmosphere 2019, 10, 358; doi:10.3390/atmos10070358 www.mdpi.com/journal/atmosphere Atmosphere 2019, 10, 358 2 of 6 Table S3. ANOVA test results between control, ‘UV-treated’ and ‘live-dust’ treatments at 20 h or 44 h, with significantly different values shown in bold. ANOVA df Sum Sq Mean Sq F Value p-value Chl-a 20 H 2, 6 0.03, 0.02 0.02, 0 4.52 0.0634 44 H 2, 6 0.02, 0 0.01, 0 23.13 0.002 Synechococcus Abundance 20 H 2, 7 8.23 × 107, 4.11 × 107 4.11 × 107, 4.51 × 107 0.91 0.4509 44 H 2, 7 5.31 × 108, 6.97 × 107 2.65 × 108, 1.16 × 107 22.84 0.0016 Prochlorococcus Abundance 20 H 2, 8 4.22 × 107, 2.11 × 107 2.11 × 107, 2.71 × 106 7.77 0.0216 44 H 2, 8 9.02 × 107, 1.47 × 107 4.51 × 107, 2.45 × 106 18.38 0.0028 Pico-eukaryote
    [Show full text]
  • Ellobiopsids of the Genus Thalassomyces Are Alveolates
    J. Eukaryot. Microbiol., 51(2), 2004 pp. 246±252 q 2004 by the Society of Protozoologists Ellobiopsids of the Genus Thalassomyces are Alveolates JEFFREY D. SILBERMAN,a,b1 ALLEN G. COLLINS,c,2 LISA-ANN GERSHWIN,d,3 PATRICIA J. JOHNSONa and ANDREW J. ROGERe aDepartment of Microbiology, Immunology, and Molecular Genetics, University of California at Los Angeles, California, USA, and bInstitute of Geophysics and Planetary Physics, University of California at Los Angeles, California, USA, and cEcology, Behavior and Evolution Section, Division of Biology, University of California, La Jolla, California, USA, and dDepartment of Integrative Biology and Museum of Paleontology, University of California, Berkeley, California, USA, and eCanadian Institute for Advanced Research, Program in Evolutionary Biology, Genome Atlantic, Department of Biochemistry and Molecular Biology, Dalhousie University, Halifax, Nova Scotia, Canada ABSTRACT. Ellobiopsids are multinucleate protist parasites of aquatic crustaceans that possess a nutrient absorbing `root' inside the host and reproductive structures that protrude through the carapace. Ellobiopsids have variously been af®liated with fungi, `colorless algae', and dino¯agellates, although no morphological character has been identi®ed that de®nitively allies them with any particular eukaryotic lineage. The arrangement of the trailing and circumferential ¯agella of the rarely observed bi-¯agellated `zoospore' is reminiscent of dino¯agellate ¯agellation, but a well-organized `dinokaryotic nucleus' has never been observed. Using small subunit ribosomal RNA gene sequences from two species of Thalassomyces, phylogenetic analyses robustly place these ellobiopsid species among the alveolates (ciliates, apicomplexans, dino¯agellates and relatives) though without a clear af®liation to any established alveolate lineage. Our trees demonstrate that Thalassomyces fall within a dino¯agellate 1 apicomplexa 1 Perkinsidae 1 ``marine alveolate group 1'' clade, clustering most closely with dino¯agellates.
    [Show full text]
  • Dinoflagellate Nuclear SSU Rrna Phylogeny Suggests Multiple Plastid Losses and Replacements
    J Mol Evol (2001) 53:204–213 DOI: 10.1007/s002390010210 © Springer-Verlag New York Inc. 2001 Dinoflagellate Nuclear SSU rRNA Phylogeny Suggests Multiple Plastid Losses and Replacements Juan F. Saldarriaga,1 F.J.R. Taylor,1,2 Patrick J. Keeling,1 Thomas Cavalier-Smith3 1 Department of Botany, University of British Columbia, 6270 University Boulevard, Vancouver, British Columbia, V6T 1Z4, Canada 2 Department of Earth and Ocean Sciences, University of British Columbia, 6270 University Boulevard, Vancouver, British Columbia, V6T 1Z4, Canada 3 Department of Zoology, Oxford University, South Parks Road, Oxford, OX1 3PS, UK Received: 25 September 2000 / Accepted: 24 April 2001 Abstract. Dinoflagellates are a trophically diverse Introduction group of protists with photosynthetic and non- photosynthetic members that appears to incorporate and There is now no serious doubt that mitochondria and lose endosymbionts relatively easily. To trace the gain plastids are descendants of free-living prokaryotic cells and loss of plastids in dinoflagellates, we have sequenced (Gray and Spencer 1996). The primary endosymbioses the nuclear small subunit rRNA gene of 28 photosyn- that incorporated these cells into eukaryotic organisms thetic and four non-photosynthetic species, and produced are, however, exceedingly rare events: mitochondria phylogenetic trees with a total of 81 dinoflagellate se- were probably incorporated only once in the history of quences. Patterns of plastid gain, loss, and replacement life (Roger 1999), and the same is probably true for were plotted onto this phylogeny. With the exception of plastids (Delwiche 1999; Cavalier-Smith 2000). Vertical the apparently early-diverging Syndiniales and Noctilu- descendants of plastids obtained through primary endo- cales, all non-photosynthetic dinoflagellates are very symbiosis are now found in many photosynthetic organ- likely to have had photosynthetic ancestors with peridi- isms (glaucophytes, red and green algae, and land nin-containing plastids.
    [Show full text]
  • Revisions to the Classification, Nomenclature, and Diversity of Eukaryotes
    University of Rhode Island DigitalCommons@URI Biological Sciences Faculty Publications Biological Sciences 9-26-2018 Revisions to the Classification, Nomenclature, and Diversity of Eukaryotes Christopher E. Lane Et Al Follow this and additional works at: https://digitalcommons.uri.edu/bio_facpubs Journal of Eukaryotic Microbiology ISSN 1066-5234 ORIGINAL ARTICLE Revisions to the Classification, Nomenclature, and Diversity of Eukaryotes Sina M. Adla,* , David Bassb,c , Christopher E. Laned, Julius Lukese,f , Conrad L. Schochg, Alexey Smirnovh, Sabine Agathai, Cedric Berneyj , Matthew W. Brownk,l, Fabien Burkim,PacoCardenas n , Ivan Cepi cka o, Lyudmila Chistyakovap, Javier del Campoq, Micah Dunthornr,s , Bente Edvardsent , Yana Eglitu, Laure Guillouv, Vladimır Hamplw, Aaron A. Heissx, Mona Hoppenrathy, Timothy Y. Jamesz, Anna Karn- kowskaaa, Sergey Karpovh,ab, Eunsoo Kimx, Martin Koliskoe, Alexander Kudryavtsevh,ab, Daniel J.G. Lahrac, Enrique Laraad,ae , Line Le Gallaf , Denis H. Lynnag,ah , David G. Mannai,aj, Ramon Massanaq, Edward A.D. Mitchellad,ak , Christine Morrowal, Jong Soo Parkam , Jan W. Pawlowskian, Martha J. Powellao, Daniel J. Richterap, Sonja Rueckertaq, Lora Shadwickar, Satoshi Shimanoas, Frederick W. Spiegelar, Guifre Torruellaat , Noha Youssefau, Vasily Zlatogurskyh,av & Qianqian Zhangaw a Department of Soil Sciences, College of Agriculture and Bioresources, University of Saskatchewan, Saskatoon, S7N 5A8, SK, Canada b Department of Life Sciences, The Natural History Museum, Cromwell Road, London, SW7 5BD, United Kingdom
    [Show full text]
  • Hematodinium-Australis N-Sp, a Parasitic Dinoflagellate of the Sand Crab Portunus-Pelagicus from Moreton Bay, Australia
    W&M ScholarWorks VIMS Articles Virginia Institute of Marine Science 7-1994 Hematodinium-Australis N-Sp, a parasitic dinoflagellate of the sand crab Portunus-pelagicus from Moreton Bay, Australia DA Hudson Jeffrey D. Shields Virginia Institute of Marine Science Follow this and additional works at: https://scholarworks.wm.edu/vimsarticles Part of the Aquaculture and Fisheries Commons Recommended Citation Hudson, DA and Shields, Jeffrey D., "Hematodinium-Australis N-Sp, a parasitic dinoflagellate of the sand crab Portunus-pelagicus from Moreton Bay, Australia" (1994). VIMS Articles. 1572. https://scholarworks.wm.edu/vimsarticles/1572 This Article is brought to you for free and open access by the Virginia Institute of Marine Science at W&M ScholarWorks. It has been accepted for inclusion in VIMS Articles by an authorized administrator of W&M ScholarWorks. For more information, please contact [email protected]. DISEASES OF AQUATIC ORGANISMS Published July 28 Dis. aquat. Org. Hematodinium australis n. sp., a parasitic dinoflagellate of the sand crab Portunus pelagicus from Moreton Bay, Australia Darryl A. ~udsonl,Jeffery D. Shields 'Department of Parasitology, The University of Queensland, Brisbane, Queensland 4072, Australia 'Chesapeake Bay National Estuarine Research Reserve in Virginia, Virginia Institute of Marine Science, College of William & Mary, Gloucester Point, Virginia 23062, USA ABSTRACT. A new species of parasitic dinoflagellate is described from the portunid crab Portunus pelagicus. The dinoflagellate is a member of the genus Hematodinium which formerly consisted of a single species, H. perezi. Members of the genus have been reported in crabs and lobsters from Europe and North America, where in some circumstances they cause significant mortalities to host populations.
    [Show full text]
  • Khristianthesisresubmit.Pdf (7.238Mb)
    A Parasitic Dinoflagellate of the Ctenophore Mnemiopsis sp. by Khristian Deane Smith A thesis submitted to the Graduate Faculty of Auburn University in Partial fulfillment of the Requirements of the Degree of Masters of Science Auburn, Alabama December 12, 2011 Keywords: dinoflagellate, parasite, marine ctenophore, Mnemiopsis, Pentapharsodinium Copyright 2011 by Khristian Deane Smith Approved by Anthony Moss, Chair, Associate Professor of Biological Sciences Mark Liles, Assistant Professor of Biological Sciences Scott Santos, Associate Professor of Biological Sciences Abstract In this study I have sought to characterize a previously unknown parasitic dinoflagellate, which is associated with the costal ctenophore Mnemiopsis sp. Here, I describe its general morphology, based on an identification system created by Charles Kofoid used specifically for dinoflagellates. The identification system, Kofoid plate tabulation, allows for identification of genera or possibly species. The plate tabulation is used to interpret the gross morphological characters, number of thecal plates, and their arrangement. The study will also present on an overview of its parasitic relationship with the host and its reproductive capacity. Lastly, the study finishs with the phylogenetic placement based on rDNA, ITS, and cyt b molecular analysis. I conclude that the dinoflagellate’s phylogeny is placed tentatively into the genus Pentapharsodinium due to the inconsistencies within the monophyletic E/Pe clade. The life cycle of the dinoflagellate is characteristic of
    [Show full text]
  • The Revised Classification of Eukaryotes
    Published in Journal of Eukaryotic Microbiology 59, issue 5, 429-514, 2012 which should be used for any reference to this work 1 The Revised Classification of Eukaryotes SINA M. ADL,a,b ALASTAIR G. B. SIMPSON,b CHRISTOPHER E. LANE,c JULIUS LUKESˇ,d DAVID BASS,e SAMUEL S. BOWSER,f MATTHEW W. BROWN,g FABIEN BURKI,h MICAH DUNTHORN,i VLADIMIR HAMPL,j AARON HEISS,b MONA HOPPENRATH,k ENRIQUE LARA,l LINE LE GALL,m DENIS H. LYNN,n,1 HILARY MCMANUS,o EDWARD A. D. MITCHELL,l SHARON E. MOZLEY-STANRIDGE,p LAURA W. PARFREY,q JAN PAWLOWSKI,r SONJA RUECKERT,s LAURA SHADWICK,t CONRAD L. SCHOCH,u ALEXEY SMIRNOVv and FREDERICK W. SPIEGELt aDepartment of Soil Science, University of Saskatchewan, Saskatoon, SK, S7N 5A8, Canada, and bDepartment of Biology, Dalhousie University, Halifax, NS, B3H 4R2, Canada, and cDepartment of Biological Sciences, University of Rhode Island, Kingston, Rhode Island, 02881, USA, and dBiology Center and Faculty of Sciences, Institute of Parasitology, University of South Bohemia, Cˇeske´ Budeˇjovice, Czech Republic, and eZoology Department, Natural History Museum, London, SW7 5BD, United Kingdom, and fWadsworth Center, New York State Department of Health, Albany, New York, 12201, USA, and gDepartment of Biochemistry, Dalhousie University, Halifax, NS, B3H 4R2, Canada, and hDepartment of Botany, University of British Columbia, Vancouver, BC, V6T 1Z4, Canada, and iDepartment of Ecology, University of Kaiserslautern, 67663, Kaiserslautern, Germany, and jDepartment of Parasitology, Charles University, Prague, 128 43, Praha 2, Czech
    [Show full text]
  • Adl S.M., Simpson A.G.B., Lane C.E., Lukeš J., Bass D., Bowser S.S
    The Journal of Published by the International Society of Eukaryotic Microbiology Protistologists J. Eukaryot. Microbiol., 59(5), 2012 pp. 429–493 © 2012 The Author(s) Journal of Eukaryotic Microbiology © 2012 International Society of Protistologists DOI: 10.1111/j.1550-7408.2012.00644.x The Revised Classification of Eukaryotes SINA M. ADL,a,b ALASTAIR G. B. SIMPSON,b CHRISTOPHER E. LANE,c JULIUS LUKESˇ,d DAVID BASS,e SAMUEL S. BOWSER,f MATTHEW W. BROWN,g FABIEN BURKI,h MICAH DUNTHORN,i VLADIMIR HAMPL,j AARON HEISS,b MONA HOPPENRATH,k ENRIQUE LARA,l LINE LE GALL,m DENIS H. LYNN,n,1 HILARY MCMANUS,o EDWARD A. D. MITCHELL,l SHARON E. MOZLEY-STANRIDGE,p LAURA W. PARFREY,q JAN PAWLOWSKI,r SONJA RUECKERT,s LAURA SHADWICK,t CONRAD L. SCHOCH,u ALEXEY SMIRNOVv and FREDERICK W. SPIEGELt aDepartment of Soil Science, University of Saskatchewan, Saskatoon, SK, S7N 5A8, Canada, and bDepartment of Biology, Dalhousie University, Halifax, NS, B3H 4R2, Canada, and cDepartment of Biological Sciences, University of Rhode Island, Kingston, Rhode Island, 02881, USA, and dBiology Center and Faculty of Sciences, Institute of Parasitology, University of South Bohemia, Cˇeske´ Budeˇjovice, Czech Republic, and eZoology Department, Natural History Museum, London, SW7 5BD, United Kingdom, and fWadsworth Center, New York State Department of Health, Albany, New York, 12201, USA, and gDepartment of Biochemistry, Dalhousie University, Halifax, NS, B3H 4R2, Canada, and hDepartment of Botany, University of British Columbia, Vancouver, BC, V6T 1Z4, Canada, and iDepartment
    [Show full text]
  • Molecular Phylogeny of Noctilucoid Dinoflagellates (Noctilucales
    ARTICLE IN PRESS Protist, Vol. 161, 466–478, July 2010 http://www.elsevier.de/protis Published online date 26 February 2010 ORIGINAL PAPER Molecular Phylogeny of Noctilucoid Dinoflagellates (Noctilucales, Dinophyceae) Fernando Go´ meza,1, David Moreirab, and Purificacio´ nLo´ pez-Garcı´ab aMarine Microbial Ecology Group, Universite´ Pierre et Marie Curie, CNRS UMR 7093, Laboratoire d’Oce´ anographie de Villefranche, Station Zoologique, BP 28, 06230 Villefranche-sur-Mer, France bUnite´ d’Ecologie, Syste´ matique et Evolution, CNRS UMR 8079, Universite´ Paris-Sud, Batimentˆ 360, 91405 Orsay Cedex, France Submitted September 2, 2009; Accepted December 13, 2009 Monitoring Editor: Michael Melkonian The order Noctilucales or class Noctiluciphyceae encompasses three families of aberrant dinoflagellates (Noctilucaceae, Leptodiscaceae and Kofoidiniaceae) that, at least in some life stages, lack typical dinoflagellate characters such as the ribbon-like transversal flagellum or condensed chromosomes. Noctiluca scintillans, the first dinoflagellate to be described, has been intensively investigated. However, its phylogenetic position based on the small subunit ribosomal DNA (SSU rDNA) sequence is unstable and controversial. Noctiluca has been placed either as an early diverging lineage that diverged after Oxyrrhis and before the dinokaryotes -core dinoflagellates- or as a recent lineage branching from unarmoured dinoflagellates in the order Gymnodiniales. So far, the lack of other noctilucoid sequences has hampered the elucidation of their phylogenetic relationships to other dinoflagellates. Furthermore, even the monophyly of the noctilucoids remained uncertain. We have determined SSU rRNA gene sequences for Kofoidiniaceae, those of the type Spatulodinium (=Gymnodinium) pseudonoctiluca and another Spatulodinium species, as well as of two species of Kofoidinium, and the first gene sequence of Leptodiscaceae, that of Abedinium (=Leptophyllus) dasypus.
    [Show full text]