J. Eukaryot. Microbiol., 53(1), 2006 pp. 43–45 r 2006 The Author(s) Journal compilation r 2006 by the International Society of Protistologists DOI: 10.1111/j.1550-7408.2005.00071.x Molecular Phylogeny of a Potentially Parasitic Dinoflagellate Isolated from the Solitary Radiolarian, Thalassicolla nucleata

REBECCA J. GAST

ABSTRACT. Thalassicolla nucleata, a solitary radiolarian, has been described as being parasitized by two dinoflagellates, Solenodinium (Syndiniales) and Caryotoma (Blastodiniales). Several T. nucleata were stripped of their extracapsular material and allowed to regenerate their rhizopodial structures without symbionts. Within a week, two were observed to disintegrate, leaving behind non-pigmented swimming dinoflagellate cells. Identical full-length ribosomal sequences were recovered from both samples. Upon alignment and phylogenetic analysis, it was determined that these putative parasite sequences were distinct from Scrippsiella nutricula (the dinoflagellate symbiont of the host), and also from all other dinoflagellate parasites sequenced to date. Key Words: Blastodiniales, dinoflagellate parasite, molecular phylogeny, Syndiniales.

EVERAL dinoflagellate genera have been reported as internal in a well of a six-well Costar dish with 5 ml of filtered sterile S and external parasites of a wide range of organisms, including seawater. The extracapsular material was allowed to regenerate invertebrates, ciliates, sarcodines, and other dinoflagellates (Coats and the cells were maintained at 25 1C with a 12-h photoperiod for 1999). These parasitic interactions often result in negative effects several days. on the host, including reproductive impairment and death. In this DNA extraction, amplification, and sequencing. Dinoflagel- manner, parasitic dinoflagellates can influence the composition of late-like cells that appeared from two disintegrated central cap- the microbial food web with either positive (destruction of harm- sules were collected using a sterile 1-ml pipet into sterile 1.5-ml ful algal blooms) or negative (removal of prey items from the microcentrifuge tubes. Cells were pelleted at approximately planktonic food web) outcomes. 15,000 g for 5 min. The seawater was removed and replaced with The diversity of parasitic dinoflagellates was first recognized 25 ml of 5% Chelex (Walsh, Metzger, and Higuchi 1991). The and described by Chatton (see Cachon and Cachon 1987). Jean cells were lysed by heating to 95 1C for 10 min and 1 ml was used and Monique Cachon continued the study of these parasites, for PCR amplification. Primers A (50 AACCTGGTTGATCCT resulting in significant information regarding the structure and GCCAGT 30) and B (50 GATCCTTCTGCAGGTTCACCTAC 30) function of the dinoflagellate cells themselves (Cachon and were used to amplify the full-length small subunit ribosomal gene Cachon 1987). Regarding the sarcodines, radiolaria in particular in a 50-ml reaction (Gast and Caron 1996). The cycling parameters have been described as being parasitized by several genera of were 3 min at 95 1C, 35 cycles of 1 min at 94 1C, 1 min at 52 1C, dinoflagellates. Species of Syndinium occur intracapsularly in 2 min at 72 1C with a final extension of 10 min at 72 1C. PCR both colonial and solitary radiolaria, whereas Solenodinium and products were cleaned using Wizards PCR Prep DNA Purifica- Caryotoma are only found in members of the solitary radiolaria, tion System (Promega, Madison, Wisconsin) and pooled products Thalassicollidae (Hollande 1974; Hollande and Corbel 1982; were sequenced directly using infrared dye-labeled primers Theodorides 1989). (LI-COR, Lincoln, Nebraska) and Sequitherm (Epicentre Tech- Thalassicolla nucleata is a solitary radiolarian that has photo- nologies, Madison, Wisconsin; Gast and Caron 1996). The full- synthetic dinoflagellate symbionts (Gast and Caron 1996). We length sequences for the dinoflagellate parasite were deposited in employed Thalassicolla as a system to examine symbiont re- GenBank under Accession numbers DQ116021 and DQ116022. establishment because the extracapsular material containing the Phylogenetic reconstruction. An alignment of 47 dinoflagel- photosynthetic symbionts can be stripped away from the central late small subunit ribosomal gene (srDNA) sequences was gen- capsule that contains most of the host cell. While conducting erated using GCG Wisconsin PackageTM SeqLabs (alignment symbiont re-establishment experiments, two central capsules in available from the author upon request). There were a total of the process of ‘‘re-growth’’ without symbionts were observed to 1,577 sites used for the phylogenetic analysis, with 493 informa- drop to the bottom of their culture dishes and release non- tive for parsimony. Modeltest 3.5 (Posada and Crandall 1998) was pigmented dinoflagellate cells. Considered to be putative para- used to establish the best model of evolution for the dataset, and sites, these cells were collected for microscopy, enriched by maximum likelihood parameters (TrN1I1G) were used culturing, and identified using small subunit ribosomal gene to generate the tree in PAUPÃ (base frequencies A 5 0.2741, sequence analysis. C 5 0.1830, G 5 0.2528, T 5 0.2901; A C 5 1, A G 5 3.1549, A T 5 1, C G 5 1, C T 5 6.4002, G T 5 1; pro- portion of invariable sites 5 0.3311; g 5 0.6507; Swofford 1999). MATERIALS AND METHODS One hundred bootstrap replicates of maximum parsimony were Radiolaria collection. Thalassicolla nucleata were collected used to estimate the confidence of the reconstructed branch points. several miles offshore of Bermuda in July of 1996. Cells were The trees are unrooted, but Amoebophrya was used as the out- brought back to the laboratory and their extracapsular material group in both analyses. was stripped away by repeated pipetting using a 1-ml pipettor tip to disrupt the matrix. Additional removal of extracapsular materi- RESULTS AND DISCUSSION al was accomplished with pulled glass micropipets. The central capsules were washed three separate times in 0.2-mm filtered After re-growing their extracapsular material in the absence of sterile seawater, examined by microscopy to confirm that all symbionts, two individual Thalassicolla central capsules disinte- symbionts were removed, and then each individual was placed grated and released several hundred non-pigmented dinoflagel- late-like cells. The enrichment culture of these dinoflagellates and Corresponding Author: R. Gast, Woods Hole Oceanographic Institu- their preservation were unsuccessful, but full-length small subunit tion, Woods Hole, MA 02543—Telephone number: 508 –289 3209; ribosomal gene sequences were amplified and sequenced for FAX number: 508 –457 2169; e-mail: [email protected] each of the two samples. Molecular phylogenetic reconstructions 43 44 J. EUKARYOT. MICROBIOL., VOL. 53, NO. 1, JANUARY– FEBRUARY 2006 confirmed that the cells were dinoflagellates, that the two samples todinium (Fig. 1), which form a well-supported group. The were identical to each other, and that they were unrelated to the Blastodiniales currently do not form a monophyletic group host symbionts (Scrippsiella nutricula) or any of the dinoflagel- in srDNA phylogenetic analyses (Saldarriaga et al. 2004), but late parasites currently available in the sequence database (Fig. 1). the Thalassicolla dinoflagellate also does not show an affinity The general topology of the reconstruction is congruent with other with either of the two members of this group, Haplozoon and recent phylogenies (Saldarriaga et al. 2001, 2004), although many Amyloodinium. In fact, there is no support for grouping this new of the internal branch points are not well resolved. This has been sequence with any of the other published dinoflagellates. This noted in the previous publications as well. does not rule out the possibility that the putative parasite is Two dinoflagellates, Solenodinium and Caryotoma, have been Caryotoma, but it also does not provide strong support. Further described as intracapsular parasites of Thalassicolla. Solenodi- studies on the location of the infection are likely necessary to nium is considered a member of the Syndiniales, and parasitizes resolve the genus identification. the nucleus of the host (Coats 1999; Hollande 1974; Theodorides Despite the inability to provide a name for this parasite, the 1989). Caryotoma is a member of the Blastodiniales, and is genetic information obtained is valuable. It has shown that these described as being within the central capsule, but not within the putative Thallassicola parasites are not members of the Syndi- nucleus (Coats 1999; Hollande and Corbel 1982; Theodorides niales, and might represent a group of dinoflagellate parasites that 1989). The lack of ultrastuctural information on the location of is unrelated to any of the ones currently sequenced. An alternative this parasite makes it impossible to designate it as either genus conclusion could be that this organism is not a parasite at all, but a based upon cellular location. heterotroph that was not removed during the washes of the central Observations of the released cells showed them to be gymno- capsules and grew to an observable number over a period of dinoid in shape, about 20 mm in size, and highly refractile under several days. This seems unlikely considering the regrowing dark-field illumination on a dissecting microscope (data not central capsules were monitored microscopically twice a day, available). These morphological characters suggest the potential and no dinoflagellates were observed in the culture dishes prior affiliation with either genus, but phylogenetic reconstructions to the destruction of the central capsule and the appearance placed them far from the Syndiniales, Amoebophrya and Hema- of several hundred flagellated cells. Parasitic dinoflagellate

Fig. 1. Phylogenetic reconstruction. The tree was generated using PAUPÃ algorithm for maximum parsimony. Bootstrap values at nodes were recovered from 100 replicats of maximum parsimony. GAST—DINOFLAGELLATE PARASITE OF THALASSICOLLA 45 ribosomal sequences are difficult to obtain, so future work on the e´volutif des Syndinides parasites de Radiolaires. Protistologica, confirmation of this organism as a parasite is warranted. 10:413–451. With the sequence information in hand, probes and primers Hollande, A. & Corbel, J. C. 1982. Utrastructure, cycle e´volutif et position can be developed to examine not only the intracellular location syste´matique de Caryotoma bernardi Holl.et Enj. (Dinoflagelle´s Oodi- of the organism to establish its identity, but also the environmental nides) parasite endocapsularie des Thalassicolles (Radiolaires). Protis- tologica, 18:123–133. distribution and prevalence of the organism. Posada, D. & Crandall, K. A. 1998. Modeltest: testing the model of DNA substitution. Bioinformatics, 14:817–818. ACKNOWLEDGMENTS Saldarriaga, J. F., Taylor, F. J. R., Keeling, P. J. & Cavalier Smith, T. 2001. Dinoflagellate nuclear SSU rRNA phylogeny suggests multiple I would like to thank Dave Caron and Linda Amaral-Zettler for plastid losses and replacements. J. Mol. Evol., 53:204–213. collecting radiolaria. This work was accomplished at the Bermuda Saldarriaga, J. F., Taylor, F. J. R., Cavalier-Smith, T., Menden-Deuer, S. & Biological Station for Research, and was supported in part, by Keeling, P. J. 2004. Molecular data and the evolutionary history of NSF Grant OCE-9314533. dinoflagellates. Eur. J. Protistol, 40:85–111. Swofford, D. 1999. PAUPÃ. Phylogenetic Analysis Using Parsimony (Ã and Other Methods). Sinauer Associates, Sunderland, MA. LITERATURE CITED Theodorides, J. 1989. Parasitology of Marine Zooplankton. Advances in Cachon, J. & Cachon, M. 1987. Parasitic dinoflagellates. In: Taylor, F. J. Marine Biology. Academic Press Ltd., New York. p. 117–177. R. (ed.), The Biology of Dinoflagellates. Blackwell Scientific Publica- Walsh, P. S., Metzger, D. A. & Higuchi, R. 1991. Chelex 100 as a medium tions, Oxford. p. 571–610. for simple extraction of DNA for PCR-based typing from forensic Coats, D. W. 1999. Parasitic life styles of marine dinoflagellates. material. Biotechniques, 10:506–513. J. Eukaryot. Microbiol., 46:402–409. Gast, R. J. & Caron, D. A. 1996. Molecular phylogeny of symbiotic dinoflagellates from Foraminifera and Radiolaria. Mol. Biol. Evol., 13:1192–1197. Hollande, A. 1974. Etude compare´e de la mitose syndinienne et de celle des Pe´ridiniens libres et des Hypermatigines. Infrastructure et cycle Received: 07/05/05, 09/15/05; accepted: 09/15/05