Coon Thesis 2010.Pdf

A search for KCNRG mutations in multiple myeloma cell lines

A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science at George Mason University

Stephanie Coon Bachelor of Science George Mason University, 2002

Director: Dr. Ancha Baranova, Associate Professor Department of Molecular and Microbiology

Fall Semester 2010 George Mason University Fairfax, VA

DEDICATION

I would like to express a sincere thanks to my advisors, professors, family, friends and co-workers. I appreciate all of your patience, support and guidance.

iii

ACKNOWLEDGEMENTS

I would like to thank Aybike Birerdinc who collaborated on cell line DNA preparation and sequence analysis, Masoomeh Sikaroodi, who performed automated sequencing, and all of my colleagues who have gracefully shared their time and experiences. I would like to thank my committee members for their contributions, and Dr. Baranova, my dissertation adviser, who challenges her students in a way that inspires understanding and innovative ideas.

TABLE OF CONTENTS

Page List of Tables ...... vi List of Figures ...... vii Abstract ...... viii Chapter 1: Background and Significance ...... 1 1.1. Genetic abnormalities seen in MM ...... 3 1.2. Potassium channels ...... 6 1.3. The genomic structure and function of candidate tumor suppressor gene KCNRG……………………………………………………………………..11 1.4. Happloinsufficiency ...... 14 1.5 Specific aims ...... 17 Chapter 2: Materials and Methods ...... 18 2.1. Sample cell lines ...... 18 2.2. DNA Extraction ...... 19 2.3. PCR ...... 19 2.4. Gene sequencing ...... 22 2.5. Computer programs and statistical analysis ...... 22 Chapter 3: Results and Discussion ...... 24 3.1. Evaluation of PCR amplification of KCNRG exons with different primer pairs ...... 24 3.2. Evaluation of PCR amplification of KCNRG exons with varied concentrations ...... 27 3.3. Evaluation of DNA extraction from varied numbers of cells ...... 28 3.4. Evaluation of nested PCR ...... 29 3.5. Direct sequencing of KCNRG exons 1 and 3 in multiple myeloma cell lines RPMI-8226, NCI-H929 and U266B1 ...... 31 3.6 An analysis of the array chromosome genomic hybridization (aCGH) of NCI-60 cell lines with KCNRG probe ...... 37 3.7 Analysis of GEO datasets ...... 40 Chapter 4: Conclusion...... 43 Appendix 1: Screenshot of chromatograms for cell lines showing insC in RPMI-8226 and U266B2……………………………………………………………………………..44 Appendix 2: KCNRG expression profile of vincristine-sensitive and vincristine-resistant SKOV-3 cells ………………………………………………………………………45 References ...... 46

LIST OF TABLES

Table Page Table 1: Primer sequences………………..…...……………………………….….....….21 Table 2: Concentration of extracted DNA from various numbers of live cells..….…….29 Table 3. Known human SNPs from NCBI database…………………………………….36 Table 4. Results from MatInspector software matching KCNRG INR sequence with and without mutation…………………..…………………………………………...36 Table 5. Results of aCGH with probe for KCNRG from CellMiner web application….39

LIST OF FIGURES

Figure Page Figure 1: Positions of genes in the minimal CDR and regions of deletions determined by various independent researchers ...... 5 Figure 2: Kv Shaker type channel with α, β and T1 domain ...... 8 Figure 3: KCNRG gene locus and mRNA isoforms ...... 14 Figure 4: KCNRG exon 1 (5’-3’) nucleotide sequence...... 20 Figure 5: KCNRG exon 3 (5’-3’) nucleotide sequence ...... 21 Figure 6: Amplification of KCNRG exons 1 and 3 with various primer pairs ...... 25 Figure 7: Output from NetPrimer software of KCNRG primer dimers ...... 27 Figure 8: Amplification of KCNRG exon 1 with varied concentrations ...... 28 Figure 9: Amplification of KCNRG exon 1 by nested PCR ...... 30 Figure 10: Amplification of KCNRG exons 1 and 3 in three different MM cell lines: NCI-H929, RPMI-8226, U266B2 ...... 33 Figure 11: Sequence alignment of product of L1R1 for cell lines NCI-H929, RPMI-8226, U266B2 and the reference sequence from the GenBank database ...... 34 Figure 12: Screenshot of chromatograms for cell lines showing delT in RPMI-8226 .... 35 Figure 13: Screenshot example of a chromatogram from a gene sequencing reaction with L4 ...... 37 Figure 14. KCNRG expression profile of normal and benzene exposed peripheral blood mononuclear cells…………………………………………………………………...42

vii

ABSTRACT

A SEARCH FOR KCNRG MUTATIONS IN MULTIPLE MYELOMA CELL LINES

Stephanie Coon, MS

George Mason University, 2010

Thesis Director: Dr. Ancha Baranova

Deletions and/or rearrangements on chromosome 13q14.3 are observed in more than half

of multiple myeloma (MM) and chronic lymphocytic leukemia (CLL) cases and are also

frequently seen in other hematopoietic malignancies. The minimal common deleted

region (CDR) in MM cells contains candidate tumor suppressor gene KCNRG (potassium

channel regulating gene), the product of which suppresses assembly of the Kv channels

and Kv currents. KCNRG exerts growth suppressive and pro-apoptotic effects in HL-60,

LNCaP and RPMI-8226 cells. In this study, the KCNRG gene was sequenced in three multiple myeloma cell lines, NCI-H929, RPMI-8226 and U266B2. The RPMI-8226 cell line was found to contain a delT mutation in the core promoter initiator element. Deletion of T decreases matrix similarity of this DNA element from 0.945 to 0.941, and, therefore, might negatively influence expression of KCNRG in RPMI-8226 cells. The haploinsufficiency of KCNRG might be relevant to the progression of CLL and MM at least in a subset of patients.

CHAPTER 1: Background and Significance

Multiple myeloma (MM) is the most common type of the plasma cell tumors and

accounts for 10% of all blood cancers (Collins C, 2005). The National Cancer Institute

reported over 20,580 new cases in the United States in 2009, with the majority of

diagnoses occurring after the age of 65. The elderly, African Americans and men have

the highest risk for developing the disease. Over 10,000 deaths due to MM occurred in

the US in 2009.

MM is a hematological malignancy that develops from post-germinal center B-

lymphocytes, which differentiate into plasma cells and accumulate in the bone marrow.

These cells produce various cytokines that stimulate osteoclasts, which break down bone

tissue. The resultant lytic bone lesions are large enough to be seen on radiographs and

leave the bones weak and susceptible to fractures. In MM patients, spinal cord

compressions are commonly observed leading to back pain, loss of bowel and bladder

control, decreased sensation, and even paralysis. The process of bone resorption releases

calcium into the bloodstream and it is deposited throughout the body. This hypercalcemia

is responsible for fatigue, confusion and renal failure. Additionally, anemia may develop as the replacement of normal bone marrow by infiltrating tumor cells interferes with the normal red blood cell production. The majority of myeloma tumor cells are secretory active, meaning they produce abnormal immunoglobulin light chains, known as

1 paraproteins, that can be detected in the blood and urine. The paraproteins accumulate in

the blood, tissues and organs and may cause polyneuropathy (the simultaneous malfunction of many peripheral nerves), a decrease in the level of normal immunoglobulins and are also a contributing factor to kidney failure.

The outcome for patients with multiple myeloma is highly variable, ranging from as little as 6 months to more than 10 years (Greipp PR et al. 2005). Conventional

chemotherapy relies on alkylating agents and anthracyclines, as well as nonspecific anti-

inflammatory agents that can prolong a patient’s survival to 3-4 years on average

(Gregory WM et al. 1992; Myeloma Trialists’ Collaborative Group 1998). High dose

chemotherapy in conjunction with autologous stem cell transplantation can extend patient

survival up to 5 years, but few-to-none are cured (Attal M. et al. 2001; Fermand JP et al.

1998; Lenhoff S et al. 2000). Two avenues for improving the outcome of autografting are

the repeated use of high-dose chemotherapy and the introduction of cancer vaccine-based

strategies to overcome minimal residual disease after a transplant. While high-dose

chemotherapy followed by allografting has been associated with high transplant related

mortality, continued efforts in using this approach are ongoing (Gahrton G et al. 1991).

Recent advancements include attempts to avoid graft-versus-host disease by T-cell depletion from allografts and using non-myeloablative therapies to reduce toxicity while

allowing for donor hematopoiesis and an alloimmune graft-versus-MM effect (Alyea E et

al. 2001; Badros A et al. 2001; Kroger N et al. 2002). Despite these efforts, the

development of tumor-cell resistance to all available therapies has yet to be overcome

(Salmon SE et al. 1991; Sonneveld P et al. 1994; Grogan T et al. 1993). MM remains

2 largely incurable highlighting the need for novel biologically based treatment strategies.

These may be better achieved by gaining a greater understanding of the disease on a

genetic level.

1.1 Genetic abnormalities seen in MM

The uncontrolled growth, invasion and metastasis of cancer are caused by genetic

abnormalities and these aberrations most often affect two general classes of genes.

Oncogenes encode a large number of proteins that are cancer-promoting. Their

overexpression or mutational activation results in new properties such as hyperactive

growth and division, protection against apoptosis, disruption of tissue boundaries, and the

gain of ability to establish tumor clones (metastasis) in a variety of tissue environments.

In contrast, tumor suppressor genes (TSG), as their name suggests, protect the cell from the development into the tumor. The inactivation of these genes results in a loss of the normal function of the cell leading to cancer progression. Cell cycle control, accurate

DNA replication, apoptosis, orientation and adhesion within tissues, and immune cell interactions are all TSG functions that can be negatively affected upon gene silencing.

Abnormal karyotypes showing the presence or absence of specific DNA sequences on human chromosomes can be detected using fluorescence in situ hybridization (FISH). This cytogenetic technique revealed that deletions on chromosome

13q14.3 are observed in 54% of MM cases and a TSG is believed to be located in this area (Harrison CJ et al. 2003; Elnenaei MO et al. 2003). A deletion of 13q14.3 is an adverse prognostic indicator as MM patients with this deletion experience a statistically

3 significant higher relapse rate after dose-reduced allogeneic stem cell transplantation with

the risk of death being nearly twice as high (Kroger N et al. 2006).

A loss of genetic material from chromosomal band13q14.3 is also frequently seen in other malignancies including 50% of the cases of B-cell Chronic Lymphocytic

Leukemia (B-CLL), 70% of mantle cell lymphomas (MCL), as well as some solid tumors

such as prostate cancer (Liu Y et al. 1997; Dohner H et al. 1999; Stilgenbauer S et al.

1998; Rosenwald A et al. 1999; Lu W et al. 2006). This is not surprising, since many

previously described TSGs have been implicated in more than one type of human

malignancy.

An attempt to delineate the minimal common deleted region (CDR) in MM cells

identified a region of 350 kb and prompted an interest in a section adjacent to marker

D13S319 (Elnenaei MO et al. 2003). This region encompasses an area containing tumor

suppressor gene (TSG) candidates DLEU1, DLEU2, RFP2, KCNRG and additionally,

two microRNAs, miR-15a, and miR-16-1 (Fig. 1) (Liu Y et al. 1997; Kapanadze B et al.

1998; Calin GA et al. 2002; Tyybakinoja A et al. 2007; Baranova AV et al. 2003).

DLEU1 and DLEU2 candidates encode a number of non-coding RNAs that so far have

not been conclusively shown to be involved in the development of MM (Rowntree C et al. 2002; Wolf S et al. 2001). No mutations were found in RFP2, a gene that encodes

ubiquitin ligase, when direct sequencing was conducted in six patients and four MM cell

lines (Elnenaei MO et al. 2003). Single-strand conformation polymorphism (SSCP)

screening in CLL patients sharing the same deleted region also revealed no mutations

(Baranova AV et al. 2003; van Everdink WJ et al. 2003).

Figure 1. Positions of genes in the minimal CDR and regions of deletions determined by various independent researchers

Candidate TSG KCNRG (potassium channel regulating gene) encodes a soluble protein with high homology to the cytoplasmic T1 tetramerization domain of voltage- gated K+ channels (Kv channels) (Ivanov et al. 2003). Normal assembly of the K+ channel proteins may be disrupted by the binding of KCNRG leading to the suppression of Kv currents. In 2003 Ivanov et al. performed an extensive study of KCNRG in various normal and tumor cell lines. KCNRG expression was found in all six studied normal cell lines of lung, lymphocyte, prostate, brain, kidney and stomach but was decreased in human epidermal carcinoma cell line A431 and absent in tumor cell lines of metastatic prostate carcinoma (LNCaP), ovarian epithelial carcinoma (SKOV-3) and osteocarcinoma (T1-13). Using the patch-clamp technique, Ivanov et al. demonstrated that

5 KCNRG suppresses Kv channel activity in the human androgen-sensitive prostate cell line LNCaP.

1.2 Potassium channels

The movement of ions across cell membranes is essential to many of life's processes. Ion pumps build gradients across the membrane, which are then used as an energy source by ion channels and other transport proteins to pump nutrients into cells, generate electrical signals, regulate cell volume, and secrete electrolytes across epithelial layers. Ion channels are a class of integral membrane proteins that span the cell membrane forming an aqueous pore which catalyzes the passage of ions across an otherwise ion-impermeable lipid bilayer. This process is highly specific and highly regulated. Most ion channels are gated, with the ability to switch between both open and closed conformations.

The voltage-dependent K+ channels are the prototypical and the most widely distributed type of the ion channel family. Their major function is to establish the resting membrane potential at the termination of each action potential in excitable membranes.

These multi-subunit complexes span the cell membrane forming potassium selective pores. The voltage gated (Kv) class in eukaryotes are tetrameric proteins and are made up of α-subunits, which through their T1 domains are bound to β-subunits (Fig 2). The α portion is composed of four identical subunits arranged in the membrane around a central pore. Each of these four subunits consists of six hydrophobic trans-membrane alpha helices: S1, S2, S3, S4, S5, and S6 with both N and C termini on the intracellular side of

6 the membrane. A P-domain is present between subunits S5 and S6 (Sansom MS, 2000).

Helix S4, which is not exposed to the lipid bilayer, contains many positively charged

lysine and arginine residues and is thought to act as a voltage sensor responsible for

voltage-dependent gating, while the other 5 helices are thought to function in the opening

and closing of the pore (Miller C, 2000). The highly conserved T1 domain shares

homology with a BTB/POZ domain often found in transcription factors and links the α- subunits, via the S1 helices, to the cytoplasmic β-subunits (Bixby KA, et al. 1999; Gulbis

JM et al. 2000; Sewing S et al. 1996; Yu W et al. 1996). The T1 domain is thought to be involved in determining the subfamily specific assembly of the α-subunits and is also suspected to be involved in the operation of the channel (Bixby KA et al. 1999; Wang G et al. 2006; Cushman SJ et al. 2000; Minor DL et al. 2000).

The β-subunits are also arranged tetramerically are thought to be related to aldo- keto reductase enzymes (Rehm H et al. 1988; Parcej DN et al. 1992; Scott VE et al. 1994;

McCormack T et al. 1994; Choinard, SW et al. 1995; Gulbis JM et al. 1999). The crystallization of the Kv β2-subunit showed the tetramer to be composed of four triose-

phosphate isomerase barrels. The central core of each barrel is made up of eight parallel

β-strands with intervening α-helices encircling the perimeter of the barrel (Gulbis JM, et

al. 1999). The crystal structure of the Kv1.2-β2 complex reveals that the T1 domain

seems to serve as a docking platform for the β2 subunit. Indeed the crystallization of β2

revealed that the active site contains an NADP+ cofactor molecule and catalytic residues

for the hydride transfer (Long SB et al. 2005). Behaving as redox sensors, β2-subunits

can allow direct coupling of membrane electrical activity to the redox state of the cell

7 (Bahring R et al. 2001; Tipparaju SM et al. 2005; Weng J et al. 2006). The β subunits both modulate the channel activity at the cell surface and control the surface expression of the α subunits. While free (unbound to the β subunits) Kv1.2 have the ability to function normally, interaction with the β subunits increase the stability of Kv1.2 α subunits and can dramatically decrease the rate of Kv1.2 degradation (Shi G et al. 1996).

Figure 2. Kv Shaker type channel with α, β and T1 domains. Reprinted from “Role of KCNRG in B-cell Chronic Lymphocytic Leukemia,” by A. Birerdinc, 2008, p. 15. Copyright 2008 by Aybike Birerdinc. Reprinted with permission.

Potassium channels are found in most of the cell types and are involved in many important cellular functions such as the neural signaling, the generation and regulation of cardiac rhythm and the signal transduction pathways. In recent years, K+ channels have 8 been implicated in a wide variety of diseases and have become of particular interest to the

field of oncology since they are now thought be involved in cell cycle control and

apoptosis. For example, these channels were found in non-excitable eukaryotic cells,

particularly, in lymphocytes. In human lymphocytes, Kv channels are proposed to play an

important role in mitogenic growth control and an increase in K+ channel activity or K+ channel gene expression has been found to be involved in cell division in many cell types

(Smith GA et al. 2002; Rane, S 1999). Additionally, Kv channels are up-regulated in neoplastic hematopoietic cells (Smith GA et al. 2002). In particular, Kv channels are thought to play a role in the regulation of proliferation by maintaining the driving force for calcium influx and consequently affecting calcium-dependent cell cycle control

(Cahalan MD and Lewis RS, 1990).

Selective blockers of Kv channels have been demonstrated to suppress proliferation in normal lymphocytes and the same is also true for malignant cells including transformed immune cells such as those found in leukemia and myeloma

(Smith GA et al. 2002). In the androgen-sensitive prostate cancer cell line LNCaP the rate of mitosis was shown to decrease in response to blockage of Kv channels implying that

Kv channels are involved in proliferation (Rybalchenko V et al. 2001). In a later study, the blocking of Kv channels in hepatocarcinoma cells was seen to prevent both adhesion and proliferation (Zhou Q et al. 2003). Recently, Kv channel proteins are upregulated in various types of lymphomas and leukemias. Nonselective Kv channel blocking in the human myeloid leukemia cell line ML-1 reduces proliferation (Lu L et al. 1993). In these cells the Kv inhibition prevents phosphorylation of the retinoblastoma protein and the

9 G1/S transition of the cell cycle (Xu B et al. 1996). In multiple myeloma cell experiments

the nonselective Kv channel blocker 4-aminopyridine demonstrated that Kv inhibition

produces G1 arrest and in other studies two additional Kv channel blockers had similar

effects on MM cells (Xu B et al. 1996; Shen AY et al. 1999; Wu SN et al. 1998).

Kv channels are also associated with apoptosis since the Kv channel blocking ability of proteins and apoptotic activity have been positively correlated and in certain types of breast tumors a definite connection between Kv channels and deregulation in apoptosis was observed (Avdonin V et al. 1998; Brevet M et al. 2008). Programmed cell death typically involves the activation of capases and capase-activated DNase action

(Schwartz L et al. 1996; Enari M et al. 1998). Ion channels in several cell types have been suggested to be involved in this process through cell depolarization (Avdonin V et al.

1998). For example, when K+ channels are blocked, there is a decrease in K+ efflux which depolarizes the cell. This may facilitate the opening of other voltage activated channels such as those for calcium. Activation of the capase-dependent apoptotic cascade has been shown to be a result of increases in free intracellular Ca2+ (Orrenius S et al.

1996; Ares M et al. 1997).

Mitochondria may have an important role in apoptotic signaling and Kv1.3 channels, the most predominant type of potassium channel found the plasma membrane of human lymphocytes, are also expressed in the inner mitochondrial membrane. A critical role for mitochondrial Kv1.3 (mitKv1.3) in the regulation apoptosis has been identified. Inhibiting the influx of positive charge through mitKv1.3 results in early hyperpolarization, production of reactive oxygen species (ROS), and a later

10 depolarization and release of cytochrome c - all events known to take place in

mitochondria in many apoptotic models. Kv1.3 are present in the mitochondria of human

prostate cancer cell line PC3 and human breast adenocarcinoma cell line MCF-7 and

could play a role in apoptotic signaling in these cells (Gulbins, E et al 2009).

1.3 The genomic structure and function of candidate tumor suppressor gene

KCNRG

KCNRG lies within the 3’ end of the largest transcript of RFP2, and the promoter

for KCNRG is located in the RFP2 3’-untranslated region. Human KCNRG encodes two

protein isoforms, KCNRG-S and KCNRG-L, which have the first 191 amino acids in

common. Amino acid positions 7 to 98 code for a T1 tetramerization domain. An out-of- frame insertion of the alternatively spliced exon 2, derived from an AluSp short interspersed element (SINE) repeat, is responsible for the C-terminus variation pertaining to KCNRG-S (Fig 3). While both mRNA isoforms are co-expressed in the same set of tissues, Alu-containing KCNRG-S transcript levels are significantly lower in comparison with those of KCNRG-L (Birerdinc A, 2008). Cho et al. studied the expression of the

KCNRG gene in several samples of non-cancerous tissue. Of the 68 tissues, six expressed only KCNRG-S, while 35 cases showed KCNRG-L alone, and in 27 cases both variants were observed. Functional analysis demonstrated that there is no considerable difference

in potassium regulation activity between these protein isoforms (Cho et al. 2006). In

another study overexpression of any KCNRG isoform in three tumor cell lines RPMI-

11 8226, LNCaP and HL-60 revealed significant decreases in growth and migration

accompanied by a significant increase in apoptotic events (Birerdinc A, 2008).

An analysis of KCNRG-overexpressing mammalian cells led researchers to

conclude that KCNRG is an endoplasmic reticulum (ER)-associated protein (Usman H.

and Matthew MK, 2009). Immunoprecipitation studies strongly support an interaction

between KCNRG and hKv1.1 or hKv1.4. Functional expression analysis showed that

KCNRG has no effect on hKv1.4 channels that lacks the T1 domain suggesting that the

presence of the T1 domain is required for whole cell current reductions by KCNRG

(Usman H and Matthew MK, 2009). As the Kv1 α and β subunits interact via the T1 domain in the ER during Kv1 biosynthesis, it is likely that KCNRG indeed interferes with Kv1 assembly in the ER (Shi G et al 1996; Nagaya N and Papazian DM, 1997).

Heterologous expression of KCNRG in Xenopus laevis oocytes reduces whole cell currents through human shaker-related Kv1 channels by 40-50% (Usman H and

Matthew MK, 2009). This level of current reduction may have physiological relevance since a 50% reduction in K+ currents in non-excitable MCF-7 breast cancer cells is correlated with a 20% reduction in proliferation (Ouadid-Ahidouch H et al. 2000).

KCNRG does not affect the electrophysiology of the Kv channels or the total hKv protein level of the cell but is thought to reduce the number of functional channels in the plasma membrane by sequestering Kv channels in the interior of the cell and possibly in a form that has the ability to be subsequently released in a functional form to the plasma membrane in response to specific stimuli (Usman H and Matthew MK, 2009).

12 The role of KCNRG in disease may not be limited to cancer as a recent study

demonstrated its involvement in some cases of the autoimmune polyendocrene syndrome type 1 (APS-1). Some patients with the pulmonary symptoms of this disease have autoantibodies to KCNRG (Alimohammadi M et al 2008). Kv channel function in the lung is suspected to play a role in histamine-induced bronchoconstiction and plasma excretion.

In 2006 the mutation, allelic loss and expression patterns of KCNRG gene in hepatocellular carcinoma (HCC) in a Korean population were studied. An allelic loss of

KCNRG in HCC samples and more importantly its association with negative outcomes suggests a correlation between allelic loss and severity of disease. Allelic losses of

KCNRG were found at a lower frequency in 26.5% of the HCC cases. Moreover, a missense mutation in the T1 domain of KCNRG at codon 92 of CGT to CAT (Arg to His) was also found. This mutation was most likely a somatic event as repeated SSCP analysis showed no evidence of mutations in the corresponding normal sample. Furthermore, the

KCNRG mutated HCC case showed a loss of heterozygosity at D13S272 and only aberrant bands of the mutant allele as determined by SSCP. This suggests a hemizygous mutation in which one allele is mutated and the other is lost. Loss or alteration of

KCNRG gene may be involved in the development and/or progression in some cases of

HCCs as concluded by the authors (Cho YG et al. 2006).

Tumor suppressor genes are commonly known to be involved in the development of not just one but many human malignancies. TP53, PTEN and CDKN2A are a few examples of such multifunctional TSGs. In addition to multiple myeloma, many other

13 cancers including of B-cell chronic lymphocytic leukemia, mantle cell lymphomas, hepatocellular carcinoma are associated with chromosome 13q14.3 deletions. Moreover, these deletions are most often accompanied by a poor chemotherapy response profile.

Any roles that KCNRG plays in tumor development in MM may also be relevant to these and other malignancies.

Figure 3. KCNRG gene locus and mRNA isoforms

1.4 Haploinsufficiency

The unequivocal involvement of a candidate gene in tumor suppression is generally determined when a somatic point mutation is identified in the majority of samples representing a given type of tumor. In some cases, however, point mutations are 14 never or seldomly detected in DNA samples, yet the gene is undoubtedly shown to be

capable of tumor suppression in both in vivo and in vitro experimentation. Recently, this

phenomenon received a mechanical explanation when the term “haploinsufficiency” was

coined (Santarosa M & Ashwort A, 2004). Haploinsufficiency means that one copy of the gene is not enough to express the wild type condition. In other words, according to the haploinsufficiency model, when one allele is mutated, the single functional gene does not produce enough gene product, resulting in loss of function and tumorigenesis.

Haploinsufficiency plays a role in several diseases including many cancers and has become the focus of many studies in oncology. In the case of acute myeloid leukemia the haploinsufficiency of the AML1 gene was found to play a central role in the pathogenesis of the disease (Barton K and Nucifora G, 2000). Often a candidate TSG is

dramatically downregulated, but not entirely eliminated in tumor samples – exactly what

is expected in the case of haploinsufficiency, lending further support to the approach.

Evidence of non-imprinting monoallelic silencing of genes located in 13q14.3 has been observed in CLL indicating an epigenetic pathomechanism, possibly involving haploinsufficiency (Mertens, D, et al. 2006). In the normal case, only one copy of the gene is active, while the other is silenced via methylation and histone modifications without altering the primary DNA sequence. This implies that deletion or silencing of the one active copy of 13q14.3 is enough to produce a significant down-regulation of the candidate genes resulting in a loss of function. Indeed, evidence for a model of epigenetic regulation implying differential chromatin packaging of the two copies of 13q14.3 and resulting in monoallelic expression of the genes within has been demonstrated in non-

15 malignant B- and T-cells. Furthermore, a specific epigenetic code was found that is correlated with the transcriptional state of the genes in this region of interest and two candidate locus control regions (LCR) identified in 13q14.3 in healthy cells are epigenetically silenced in CLL cells (Ruppel M, 2009).

In many cancer cases tumor cells will harbor one copy of a chromosome with a large deletion of a tumor suppressor gene while the second copy remains intact with no point mutations. This may also be the case with MM, since deletions of 13q14.3 using comparative genomic hybridization (CGH) have been observed in various MM cell lines including U266 and RPMI 8226 (Avet-Loiseau H et al. 1997). Chromosome 13 deletion events were also detected using multiplex-ligation-dependent probe amplification

(MLPA) assays in MM cell lines U266 and RPMI 8226. Interestingly, in this study these

MM cell lines showed no KCNRG deletions nor were there any deletions found on 13q14 although the researchers caution that these cell lines are relatively unstable and sporadic genetic changes were observed regularly in culture (Spary L K et al. 2006).

16 1.5 Specific Aims

In order to investigate the involvement of KCNRG as a TSG in multiple myeloma

the mutational status of the candidate gene in different MM cell lines must be defined.

Cells for research can be obtained from MM patients’ bone marrow. Since it is often hard to obtain a large number of cells from the bone marrow biopsy of a multiple myeloma

patient, the ability to extract DNA from a small number of cells would prove to be useful.

Therefore, the first Specific Aim of this project was to develop the protocol for extraction

of DNA from a very small amount of cells and optimize the conditions for amplification

of KCNRG-specific PCR products using miniscule amounts of DNA. As to the time of

completion of this project bone marrow samples of MM patients were not yet available,

thus a second Specific Aim was established – to examine KCNRG gene in three available

multiple myeloma cell lines NCI-H929, RPMI-8226 and U266B2.

CHAPTER 2: Materials and Methods

2.1 Sample cell lines

One leukemic cell line HL-60 and three different human myeloma cell lines

RPMI-8226, NCI-H929 and U266B1 were obtained from the American Type Culture

Collection (Manassas, VA). HL-60 (human promyelocytic leukemia) cell line is derived from peripheral blood and is morphologically myeloblastic. These cells proliferate continuously in suspension culture with the doubling time of about 36-48 hours. HL-60 cells predominantly have a neutrophilic promyelocyte (precursor) phenotype. RPMI-8226 is a MM cell line derived from peripheral blood of MM patient. These cells grow mostly as single cells in suspension, with some cells becoming slightly adherent. Similarly, MM

U266B1cells are derived from peripheral blood. They are described as round to polygonal, single or clustered cells in suspension, with some cells loosely adherent. The

MM NCI-H929 cell line is derived from bone marrow and in suspension can be seen as single, round to oval cells or clustered in small clumps. All three MM lines have cells with a lymphoblast-like morphology. Cells from all four lines were grown and maintained in RPMI1640 containing 2 mM glutamine, 10 mM HEPES and 10% fetal calf serum (Invitrogen, CA). The cells were regularly subjected to trypan blue staining and live cells were counted using a hemocytometer to determine cellular concentrations.

18 2.2 DNA extraction

Genomic DNA was purified using AllPrep DNA/RNA Micro kit (Qiagen, Hilden,

Germany) according to the manufacturer’s protocol. This kit is designed to extract DNA

from ≤ 50,000 cells. Additional genomic DNA preps were made using QIAamp DNA

Blood Mini Kit using an entire culture vial of cells (Qiagen, Hilden, Germany). In both

procedures, cells were first lysed and homogenized in a buffer containing the highly

denaturing guanidine-isothiocyanate to inactivate DNases and ensure isolation of intact

DNA. The lysate was next passed through a DNA spin column that selectively and

efficiently binds genomic DNA. The column was then washed and the purified DNA was

eluted. Extracted DNA concentrations were measured using a spectrophotometer.

2.3 PCR

Three forward and three reverse primers (Invitrogen, Carlsbad, CA) were

designed to amplify the majority of exon one of the KCNRG gene (GenBank accession

number NC_000013), including portions of the 5’ untranslated region (UTR) (Figure 4).

Similarly, two additional forward primers and two additional reverse primers were

designed to amplify exon three of the KCNRG gene (Figure 5). Table 1 lists all of the primers and their nucleotide sequences. All primers were designed using the computer software Primer3 (http://primer3.sourceforge.net/) and were further evaluated by the program NetPrimer (http://www.premierbiosoft.com/netprimer/index.html) to predict

secondary structures and melting temperatures. All amplifications were performed using

HotStar Taq Plus Master Mix Kit (Qiagen, Hilden, Germany). The reaction mixtures contained 10 uL of master mix, 1 uL of 4 nM forward primer, 1 uL of 4 nM reverse 19 primer and 8 uL of various concentrations of template DNA diluted in water for a total of

20 uL. Thermocycler parameters were as follows: Stage 1: 5 minutes at 95°C for one

cycle; Stage 2: 30 seconds at 94°C, 30 seconds at 59°C, and 60 seconds at 72°C for 35

cycles; Stage 3: 10 minutes at 72°C for one cycle. Amplicons were detected by gel

electrophoresis using a 1% agarose gel stained with ethidium bromide and viewed under

UV light.

gatatattgg cagttttcct taagctattt agttcctcat ctgttgcttT TTCATTTTGT atactgcaag ttcccaggca actcgaattt gcaaacacag ccatggatac actatttacc ttacagtagt ttcctgggaa tctaagtctg gtttttgtta ttcttccctc ccctccactg cataatcatg tataactagc aacatttatg gttataggtt gatttcctaa gtgtggctga tggtagcctc tagtttgaag tgagggaaga atgagtagtc aggaactggt cactttgaat gtgggaggga agatattcac gacaaggttt tctacgataa agcagtttcc tgcttctcgt ttggcacgca tgttagatgg cagagaccaa gaattcaaga tggttggtgg ccagattttt gtagacagag atggtgattt gtttagtttc atcttagatt ttttgagaac tcaccagctt ttattaccca ctgaattttc agactatctt aggcttcaga gagaggctct tttctatgaa cttcgttctc tagttgatct cttaaaccca tacctgctac agccaagacc tgctcttgtg gaggtacatt tcctaagccg gaacactcaa gcttttttca gggtgtttgg ctcttgcagc aaaacaattg agatgctaac agggaggatt acagtgttta cagaacaacc ttcagcgccg acctggaatg gtaacttttt ccctcctcag atgaccttac ttccactgcc tccacaaaga ccttcttacc atgacctggt tttccagtgt ggttctgaca gcactactga taaccaaact ggagtcaggt attttgtact ttgcagtatt tctcttgtat accagtttgt gatgttttct ctaaaaactt gaagttcctc aggcctgtaa cttctggaaa agatgattat tcaaaataat gttttggggt aaccagtgga gttgggtaga

Figure 4. KCNRG exon 1 (5’-3’) nucleotide sequence. The 5’ UTR is shown in red, the coding region of exon 1 is shown in blue, the forward and reverse primers (L1 and R1) are highlighted in yellow, the INR element is shown in purple capital letters, and intronic sequences are shown in black.

20 ggccaac atggtgaaac tcaatcttta ctaaaaatac aaaaattagc cgggcatggt ggtgtgcgcc tgtaatccca cctgcttagg aggctgaggc aagagaatag cctaaacctg ggaggcagag gttgctgaga gccaagatca caccactaca caccagtctg ggtgacagag taagactcca tctcaaaaga aaaaaaaaaa aaatcactca tttggatttg taaagtaaat gaaatttcaa aaaaaaaatc tgtcttgaga aggtatgatg cctttgaggt tgtaagtcaa atttatgtgt atagttttgc tagttattaa agggatgctt tataattaag cttctttttg tgtgtcctag gtatgtttct ataaaacctg ataaccgaaa attggccaac ggaacaaatg tcctcggctt actgattgac actttattaa aggaaggctt tcatttggtc agcactagaa cagtatcttc tgaagacaaa actgaatgct atagctttga aaggataaaa agccctgaag tgctcatcac gaatgaaaca ccaaaaccag agactatcat cataccagag caatctcaga taaagaaatg aagttgtcta tcctctttta aagagaaatt gccatttttc ttgtttcatt acgtatttag ggcatacatg ttagccaaat ctacactcag cctaactctt ggc

Figure 5. KCNRG exon 3 (5’-3’) nucleotide sequence. The sequence of exon 3 is shown in blue, the forward and reverse primers (L4 and R5) are highlighted in yellow and the intronic region is shown in black.

Table 1. Primer sequences

Calculated Primer Name Primer Sequence Tm (°C) Exon 1 KCNRG-L1 TTC CTC ATC TGT TGC TTT TTC A 60 KCNRG-L2 TTT CCT AAG TGT GGC TGA TGG 60 KCNRG-L3 TTA GGC TTC AGA GAG AGG CTC 58 KCNRG-R1 CTC CAG TGG TTA CCC CAA AA 60 KCNRG-R2 ACA GGC CTG AGG AAC TTC AA 60 KCNRG-R3 GAG CCT CTC TCT GAA GCC TAA 58 Exon 3 KCNRG-L4 GGC CAA CAT GGT GAA ACT CA 61 KCNRG-L5 TCG ATT TTC AGC ACC TGA TT 58 KCNRG-R4 GAG AGC AGC AGG CAT TAT GG 62 KCNRG-R5 GCC AAG AGT TAG GCT GAG TG 58

2.4 Gene sequencing

After quantifying the purified PCR products on a 1% agarose gel, appropriate amounts of the products were used in sequencing reactions using specific primers. A standard sequencing reaction was performed using Big Dye Terminator V3.0 (Applied

BioSystems Inc.) and the reactions were run on ABI 9700 thermal cycler (Applied

BioSystems Inc.), programmed for an initial denaturation step at 96°C for 1 minute, then

45 cycles of denaturation at 96°C for 30 seconds, annealing at 50°C for 15 seconds, extension at 60°C for 4 minutes, and finally held at 4°C. The sequencing reactions were then purified using Sephadex G-50 (Sigma-Aldrich), dried in a SpeedVac and kept at -

20°C until ready to run on the sequencer. The reactions were reconstituted in a loading dye containing HiDi formamide, denatured for 3 minutes at 95°C and loaded on a

SCE9610 capillary sequencer (SpectruMedix LLC). The raw sequences were analyzed by

BaseSpectrum v2.0 software (SpectruMedix LLC) and imported to Sequencher software v4.1 (GeneCode) for further manual base calling. The resulting sequences were then used for identification through BLAST against GenBank sequences. The chromatogram files were analyzed using ChromasPro software.

2.5 Computer programs and statistic analysis

Comparative analysis in silico and an analysis of the structure of the KCNRG gene were performed using genomic, mRNA and EST databases available at http://www.ncbi.nlm.nih.gov and http://genome.ucsc.edu. The KCNRG promoter was

22 predicted by Core Promoter available at http://www.cshl.edu/OTT/html/corepromoter.html and NNPP available at http://www.fruitfly.org/seq_tools/promoter.html services and further analyzed by

MatInspector available at http://www.genomatix.de/online_help/help_matinspector/matinspector_help.html.

Analysis of NCI-60 cell lines was performed using array chromosome genomic hybridization data found in the CellMiner database available at http://discover.nci.nih.gov/cellminer/. Analysis of KCNRG expression was performed using genomic datasets found in the Gene Expression Omnibus database available at http://www.ncbi.nlm.nih.gov/geo/.

CHAPTER 3: Results and Discussion

3.1. Evaluation of PCR amplification of KCNRG exons with various primer pairs

Eight different combinations of the forward and reverse primers for exon 1 and the four combinations of forward and reverse primers for exon 3 were each evaluated for

success at amplifying a specific DNA target within the KCNRG gene. A single PCR

reaction was performed for each primer combination using 0.155 ug of a single pool of

purified total DNA extracted from cell line NCI H929. The products were detected by gel

electrophoresis to examine which primer pairs amplified a product with the expected

length (Figure 6). For exon 1 all of the combinations tested with one exception (L3R2)

showed amplification of PCR products with sizes that agreed with the expected sizes. For

exon 3 two of the combinations, L4R4 and L4R5, yielded products with the expected

sizes. Since it can be difficult sometimes to amplify large regions of DNA (>500 bp), it

was satisfying to show that the primer pairs L1R1 and L1R2 successfully amplified 949

and 896 bp regions, respectively, both of which encompass all of the coding region of

exon 1 and most of the 5’ UTR. Additionally, primer pairs L4R4 and L4R5 each

amplified regions with respective lengths of 782 and 710 bp and likewise both fragments

encompass the entire coding region of exon 3.

Figure 6. Amplification of KCNRG exons 1 and 3 with various primer pairs.

The reaction with primer pair L5R4 showed two faint bands on the gel (~100 bp and ~200 bp) each with a length smaller than the length of the single band expected (904 bp). Although the specificities of the primers were analyzed using the NCBI tool Primer-

BLAST to avoid the possibility of the mishybridization to a similar sequence, it seems as though there was non-specific binding taking place in the reaction. This nonspecific binding can occur when the reaction’s annealing temperature is significantly lower than the Tm of the primer leading to the extension of the incorrect location along the DNA

sequence. The predicted Tm for primer R4, 61°C, is slightly higher than the annealing

temperature used in this reaction, 59°C. Primer L5 has only 40% GC content which is at

the low end of the suggested range for primer design of 40-60% for stable binding to

25 template. Contamination and DNA degradation are also possible reasons for the two

unexpected bands; however, reamplification of the DNA template with this pair yielded the same result, thus, making these two causes less probable.

Computational analysis with NetPrimer software of primer pair L3R2, in which no product was detected, showed that theses two primers are capable of forming 4 different cross-dimers between each other (Figure 7). In this case, primer dimers may have inhibited the PCR reaction from taking place. Similarly the PCR reaction with primer pair L5R5 did not show any evidence that amplification took place. These two primers have sequences that allow them to form two crosslinks that may be enough to prevent amplification (Figure 7). In addition the annealing temperature may have played a role in the luck of the success with these two pairs. Reactions involving annealing temperatures significantly higher than the primer Tm may lead to the primer failing to

anneal to the DNA template and extend. All of the primer pairs (except L5R4) were only tested once in PCR reactions that had an annealing temperature of 59°C and a concentration of 0.2 nM for each primer. The optimization of the magnesium concentrations and annealing temperatures may lead to successful amplification of these target regions, however the specific aims of this projects were the sequencing of KCNRG gene exons and adjacent sequences rather than optimization of each of these reactions. As the amplification of all intended KCNRG gene exons was achieved with other primers combinations, pairs of primers that did not yield correct PCR products after the first run were abandoned.

Figure 7. Output from NetPrimer software of KCNRG primer dimers A. L3R2 B. L5R5

3.2. Evaluation of PCR amplification with varied template DNA amounts

Using purified total DNA extracted from cell line NCI H929 and primer pair

L1R1, 12 different PCR reactions each with differing quantities of template DNA,

ranging from 7 ng to 312 ng, were performed. The amplicons were detected by gel

electrophoresis and all 12 of the varying amounts of template DNA showed bands of

expected length (Figure 8). The starting DNA concentration is expected to be

proportional to the final amplicon concentration until the point of saturation. Indeed, the

bands from reactions with starting DNA amounts of 10 ng and below were faintly

detected as seen by low intensity of fluorescence from the bands. This demonstrates that

PCR amplification with primer pair L1R1 is achievable with as little as 0.007 ug of template DNA. Although this experiment was only carried out with one set of primer 27 pairs, the experiment implied that the amplification of such a low amount of DNA could

be performed with other primer pairs for this gene as well as for other DNA sequences.

Figure 8. Amplification of KCNRG exon 1 with varied concentrations of DNA template as input.

3.3. Evaluation of DNA extraction from varied numbers of cells

Five separate DNA extractions were carried out, each starting with a different

amount of live NCI H929 cells ranging from 10,000 to 500,000. The concentration of

DNA was measured for each extract as seen in Table 2. An increase in starting number of live cells is positively correlated with an increase in DNA concentration of eluate as expected although it is not a linear relationship. This can be explained by the fact that

DNA from both live and dead cells were extracted but only live cells were counted. Dead

28 cells were not accounted for since their DNA is degrading and without further analysis it is difficult to know how much DNA is intact. The capacity of the column must also be taken into account as overloading it could lead to lower extraction efficiency. In addition, the column inherently will not be able to release all of the DNA and as the total amount of DNA is lowered, less of the total percent added will be eluted. When DNA purification was performed on 10,000 cells, the resultant DNA concentration was 13 ng/uL. Most

PCR reactions will allow the addition of several uL of DNA. For the protocol used in these studies, up to 8 uL of DNA could be added or in the case of the extract of 10,000 cells 104 ng. Previously DNA quantities as low as 7 ng were amplified (Figure 8). Thus, obtaining enough DNA from as few as 10,000 cells of any type for amplification should not represent a technical problem.

Table 2. Concentration of extracted DNA from various numbers of live cells

ID # of cells Concn (ug/uL) 260/280 260/230 Exp A 500,000 0.052 1.857 0.945 Exp B 100,000 0.024 2.000 0.393 Exp C 50,000 0.020 2.000 0.421 Exp D 30,000 0.016 2.000 0.444 Exp E 10,000 0.013 2.167 0.203

29 3.4. Evaluation of nested PCR of KCNRG exon 1

Nested PCR reactions were performed using purified total DNA extracted from

cell line NCI H929 as template, the first reaction with primer pair L1R1 and the second

reaction with primer pair L2R2. The final PCR product included the coding sequence of exon one in its entirety. The amount of template DNA in each primary reaction varied as indicated in Figure 9 while all secondary reactions contained 0.150 ug of DNA from the primary reaction. Amplicons from both runs were detected by gel electrophoresis as seen in Figure 9. Although the DNA concentrations of the final PCR products were not measured, the light intensity of the products detected by gel electrophoresis indicates that the DNA concentration of the amplicon is considerably higher after the second run. This is expected since the overwhelming majority of template DNA in the PCR mixture from run two is made up of short fragments barely larger than the second reaction’s target sequence, whereas the first mixture was composed of all of the DNA extracted from the cells. Nested PCR is thus the method of choice in studies where limited numbers of cells

(<10,000) are available or in cases where there is a low DNA extraction efficiency (e.g. blood spots).

30 Figure 9. Amplification of KCNRG exon 1 by nested PCR.

3.5 Direct sequencing of KCNRG exons 1 and 3 in multiple myeloma cell lines

RPMI-8226, NCI-H929 and U266B1

DNA from three multiple myeloma cell lines was extracted and both exons 1 and

3 of KCNRG gene were amplified and detected by gel electrophoresis to confirm amplification of the expected target (Figure 10). The PCR primers and products were then used in direct gene sequencing reactions to determine the nucleotide sequence of

PCR the fragments; each reaction was performed in duplicate (by Masoumeh Sikaroodi,

Senior Research Technician, Environmental Science & Policy Department, George

Mason University). KCNRG-S mRNA transcript, containing alternatively spliced exon 2

(97 bp) derived from an AluSp SINE repeat, is expressed in human tissues at

substantially lower amounts than KCNRG-L and there is no significant difference in

potassium regulation activity between the two isoforms (Birerdinc A, 2008; Cho et al.

31 2006). Since there is no evidence that exon 2 of KCNRG-S plays a role in MM and because of its repetitive nature, exon 2 of the minor isoform was not sequenced. After scrutinization of the sequencing chromatograms, a consensus nucleotide sequence for exon 1 for each cell type was established for and compared to the KCNRG sequences stored in the GenBank database for Homo sapiens (Figure 11). The sequences of cell line

NCI-H929 exactly matched the wild type sequence listed in the database. The comparisons of sequences obtained using RPMI-8226 and U266B2 DNAs as template each demonstrated a discrepancy, an insertion of cytosine at the same position in the intragenic region downstream of the coding region of exon 1. The sequence with the additional C was not found to represent any known single nucleotide polymorphism

(SNP) previously described in the publicly available databases. Since this insertion is in the intron there is no reason to believe that it is involved with MM. Additionally, in the case of the RPMI-8226 cell line, the sequence comparison also revealed a point mutation delT in the +30 position of the 5’ non-coding area of KCNR gene (position indicated according to mRNA Ac. Num. NM_199464). Figure 12 shows all three of the cell lines’ chromatograms at the region where the mutation was found. A search of publicly available databases revealed no known human SNPs in this nucleotide position (Table 3).

Upon analysis with MatInspector software, matches to transcription factor binding matrices revealed the core promoter initiator element (INR) that overlaps the mutated position (Figure 4). When matched to matrix O$DINR.01 from the matrix family based on INR elements, the deletion of T decreases the matrix similarity from 0.945 to 0.941

32 (1.000 is a perfect match) indicating that the mutation may negatively influence the expression of KCNRG in RPMI-82226 cells (Table 4).

Figure 10. Amplification of KCNRG exons 1 and 3 in three different MM cell lines: NCI- H929, RPMI-8226, U266B2.

Figure 11. Sequence alignment of product of L1R1 for cell lines NCI-H929, RPMI-8226, U266B2 and the reference sequence from the GenBank database (5’-3’). NCI-H929 sequence is highlighted in yellow, RPMI-8226 is highlighted in green, and U266B2 is highlighted in pink. The sequence from GenBank is unhighlighted with blue bases for the 5’ non-coding region, purple bases for exon 1 and black bases for the intronic region. The difference in the 3’ termini is due to the point at which the chromatogram began to show reliable peak information, which may differ for each reaction.

Figure 12. Screenshot of chromatograms for cell lines showing delT in RPMI-8226.

35 Table 3. Human SNPs described within KCNRG gene and present in NCBI database

Reference SNP ID # Sequence rs117506193 TTAAAATATACTTTTTTTTTTTTTTT[G/T]GGTAAAGGTAGGCGTATTTTAAGAT rs117227775 AAAAATTAATACAATTTGTTTGATCA[A/G]ATGTTTTCTTTAGAAAGTGATCTCT rs117138858 CTCCTTTTTGAACTGGCTCAAATGGA[A/G]AAGTGTAGTTGCTTTTAAATGTTAA rs116690099 ATACATGTTAGCCAAATCTACACTCA[C/G]CCTAACTCTTGGCTTCATCTGCTGC rs116205746 AGGCTGAGGCAAGAGAATAGCCTAAA[C/T]CTGGGAGGCAGAGGTTGCTGAGAGC rs115559748 AAGTTCCTCAGGCCTGTAACTTCTGG[A/T]AAAGATGATTATTCAAAATAATGTT rs115175217 TGACAGAGTAAGACTCCATCTCAAAA[A/G]AAAAAAAAAAAAAATCACTCATTTG rs114807393 TACTTTTTTTTTTTTTTTTGGTAAAG[G/T]TAGGCGTATTTTAAGATATTTTCTT rs113779715 TTTTTTTTTGAGACGGAGTCTCGCTC[C/T]GTCACCCAGGCTGGAGTGCAATGGC rs113366761 AATAGTTATATAAAAATTAATACAAT[-/TTAA]TTGTTTGATCAAATGTTTTCTTTAG rs112950191 AATGGTAACTTTTTCCCTCCTCAGAT[A/G]ACCTTACTTCCACTGCCTCCACAAA rs112511197 GACAGAGTAAGACTCCATCTCAAAAG[-/AAA]AAAAAAAAAAATCACTCATTTGGAT rs111416355 TTCAATACATCTTTCCCTTTCTCTTC[G/T]TCATGAATGCTTATGAGCCGAGATT rs79937928 AAAATATACTTTTTTTTTTTTTTTTG[G/T]TAAAGGTAGGCGTATTTTAAGATAT rs79932244 TTCCCTTTTTATGTTGTGTTTTAGAA[A/G]CAGCACGAAAGTTTTTTCCATTTTA rs79753747 ACTGCCTCCACAAAGACCTTCTTACC[A/C]TGACCTGGTTTTCCAGTGTGGTTCT rs79562491 TTCTTTTTTTCTTTTGTTTTTTTTTT[G/T]GAGACGGAGTCTCGCTCTGTCACCC rs79554101 AAGGTAAATTTCATAGGAGTAAGTCG[A/C]AAAGGAAAATCCATAATGTCAGTGC rs79503531 TCTTTTTTTCTTTTGTTTTTTTTTTT[G/T]AGACGGAGTCTCGCTCTGTCACCCA rs79339814 TCATTTAAAATATACTTTTTTTTTTT[-/TTTT]TGGTAAAGGTAGGCGTATTTTAAGA

Table 4. Results from MatInspector software matching KCNRG INR sequence with and without mutation

Matrix Core similarity Matrix similarity Sequence O$DINR.01 0.968 0.945 ttTCATtttgt O$DINR.01 0.968 0.941 ttTCATtttga

36 Complete sequencing of exon 3 was unsuccessful in every attempt. All reactions with primer L4 produced a clear chromatogram until the detection of a string of adenines in the sequence where the peaks of the chromatogram began to overlap (Figure 13).

Unfortunately this run of adenines is located in the intragenic region upstream of the exon, so any bases identified by distinct peaks did not pertain to the coding region. In all cases reactions with primer R5 displayed an output with poor quality peaks at the start and at the end. The middle section that was comprised of distinguishable peaks again corresponds to the intron upstream to the start of the exon. Although not performed in this study, a sequencing reaction run using primer R4 may generate a chromatogram with a higher quality sequence to permit base calling throughout exon 3.

Figure 13. Screenshot example of a chromatogram from a gene sequencing reaction with L4.

3.6 An analysis of the array chromosome genomic hybridization (aCGH) of NCI-60 cell lines with KCNRG probe

In the late 1980s the US National Cancer Institute developed a human tumor cell line panel, named NCI-60, with representative cells from a diverse set of tissues: brain, blood and bone marrow, breast, colon, kidney, lung, ovary, prostate and skin. Over the years these cell lines have been used by the cancer research community in an assortment of experiments including extensive pharmacological characterization of therapeutic 37 compounds, chromosome karyotyping and gene expression analysis using various DNA microarray platforms. Array comparative genomic hybridization (aCGH) is a high resolution technique that was used on NCI-60 DNA to detect gene copy number variations in these cell lines; the results of this project were made publicly available through the CellMiner database.

To study copy number of the KCNRG locus in NCI-60 cell lines, aCGH data for this locus were extracted from the CellMiner (Table 5). A ratio of fluorescence intensity value of 0 means that there is no difference in copy number between the tumor cell line and the reference (normal) sample. A value above 0 indicates amplification and a value below 0 indicates deletion. As can be seen in the Table, 26 out of the 60 tumor cell lines

(43%) have negative values for the ratio of fluorescence intensity in aCGH using the

KCNRG probe, indicating loss of DNA in this locus for at least one copy of chromosome

13. The tumor tissue types with KCRG deletions cover the entire tissue spectrum except colon tissue. Amplification of the KCNRG locus was detected in 5 cell lines (8%). These data indicate that KCNRG is more often lost than amplified in tumor cell lines, thus, providing additional evidence towards its likely tumor suppressor function.

38 Table 5. Results of aCGH with probe for KCNRG from CellMiner web application. Deletions are shown in blue and amplifications are shown in red.

Ratio of fluorescence Tissue of origin Cell line name intensity Breast MCF7 ‐0.76 Breast MDA‐MB‐231 ‐0.60 Breast HS578T 0.00 Breast BT‐549 0.00 Breast T47D ‐0.93 CNS SF‐268 0.00 CNS SF‐295 0.00 CNS SF‐539 ‐0.41 CNS SNB‐19 ‐0.52 CNS SNB‐75 ‐0.73 CNS U251 0.00 Colon COLO205 1.25 Colon HCC‐2998 0.29 Colon HCT‐116 0.00 Colon HCT‐15 0.00 Colon HT29 0.00 Colon KM12 0.00 Colon SW‐620 0.67 Leukemia CCRF‐CEM 0.00 Leukemia HL‐60 0.33 Leukemia K‐562 ‐0.48 Leukemia MOLT‐4 0.00 Leukemia RPMI‐8226 ‐0.77 Leukemia SR 0.00 Melanoma LOXIMVI 0.00 Melanoma MALME‐3M 0.00 Melanoma M14 0.00 Melanoma SK‐MEL‐2 ‐0.58 Melanoma SK‐MEL‐28 ‐0.47 Melanoma SK‐MEL‐5 0.00 Melanoma UACC‐257 ‐0.19 Melanoma UACC‐62 ‐0.91

39 Ratio of fluorescence Tissue of origin Cell line name intensity Melanoma MDA‐MB‐435 0.00 Melanoma MDA‐N 0.00 non‐small cell lung A549 0.00 non‐small cell lung EKVX ‐0.54 non‐small cell lung HOP‐62 ‐0.22 non‐small cell lung HOP‐92 ‐0.15 non‐small cell lung NCI‐H226 ‐0.21 non‐small cell lung NCI‐H23 ‐0.62 non‐small cell lung NCI‐H322M 0.00 non‐small cell lung NCI‐H460 0.00 non‐small cell lung NCI‐H522 ‐0.96 Ovarian IGROV1 0.00 Ovarian OVCAR‐3 ‐0.58 Ovarian OVCAR‐4 0.00 Ovarian OVCAR‐5 0.00 Ovarian OVCAR‐8 0.45 Ovarian SK‐OV‐3 ‐0.38 Ovarian NCI‐ADR‐RES 0.00 Prostate PC‐3 ‐0.48 Prostate DU‐145 ‐0.60 Renal 786‐0 ‐0.90 Renal A498 ‐0.45 Renal ACHN 0.00 Renal CAKI‐1 0.00 Renal RXF‐393 0.00 Renal SN12C ‐0.63 Renal TK‐10 ‐0.94 Renal UO‐31 0.00

3.7. Analysis of GEO datasets

The Gene Expression Omnibus (GEO) is an NCBI public repository for gene expression data submitted by the scientific community (Barrett T and Edgar R, 2006;

Barrett, T et al. 2005). This database archives and distributes microarray, next-generation

40 sequencing, and other forms of high-throughput functional genomic data and also freely

provides to users various web-based interfaces and applications in order to assist them in

searching and downloading the experiments and gene expression patterns stored there. A search for data submitted on KCNRG produced many gene expression profiles comparing mRNA expressed in cancerous versus noncancerous conditions. In many cases the

KCNRG transcript was downregulated in the cancerous specimens. One study is an

analysis of peripheral blood mononuclear cells from occupational benzene (leukemogen) exposure of shoe factory workers. Overall the expression profile shows a downregulation of KCNRG in the benzene exposed cells (Figure 14).

In a second study, an analysis of the vincristine-sensitive SKOV3 ovarian carcinoma cell line and its vincristine-resistant derivative was performed. Vincristine is a

mitotic inhibitor that targets rapidly dividing cells and is used in cancer chemotherapy.

This vinca alkyloid binds to tubulin dimers, inhibiting microtubule assembly and

therefore arrests mitosis in metaphase. The expression profile clearly shows a decrease in

KCNRG in the vincristine-resistant cells as compared to the vincrstine-sensitive cells,

which provides evidence to support the connection between KCNRG and proliferation.

Figure 14. KCNRG expression profile of normal and benzene exposed peripheral blood mononuclear cells

CHAPTER 4: Conclusion

The data collected in this study show that DNA extraction from live cells in

culture with numbers as low as 10,000 can yield enough material for PCR amplification

and the utilization of the nested PCR technique may enable researchers to amplify

regions of DNA from even smaller quantities of cells.

Both exon 1 and exon 3 of the human KCNRG gene can successfully be amplified in their entirety by the use of the combinations of PCR primers described here.

No mutations were found in multiple myeloma cell lines NCI-H929 and U266B2 when direct sequencing of KCNRG exon 1 was conducted supporting the hypothesis that haploinsufficiency mechanism for tumor suppressor gene inactivation may play a key role in multiple myeloma.

Multiple myeloma cell line RPMI-8226 contains delT mutation in the core promoter initiator element that might influence levels of KCNRG expression in this

model line.

The role of KCNRG in tumor suppression may not be limited to multiple

myeloma but may also be relevant to many other human malignancies.

43 APPENDIX 1

Screenshot of chromatograms for cell lines showing insC in U266B1 and RPMI-8226

44 APPENDIX 2

KCNRG expression profile of vincristine-sensitive and vincristine-resistant SKOV-3 cells

REFERENCES

Alimohammadi M, Dubois N, Sköldberg F, Hallgren A, Tardivel I, Hedstrand H, Haavik J, Husebye ES, Gustafsson J, Rorsman F, Meloni A, Janson C, Vialettes B, Kajosaari M, Egner W, Sargur R, Pontén F, Amoura Z, Grimfeld A, De Luca F, Betterle C, Perheentupa J, Kämpe O, Carel JC. Pulmonary autoimmunity as a feature of autoimmune polyendocrine syndrome type 1 and identification of KCNRG as a bronchial autoantigen. Proc Natl Acad Sci U S A. 2009 Mar 17;106(11):4396-401.

Alyea E, Weller E, Schlossman R, Canning C, Webb I, Doss D, Mauch P, Marcus K, Fisher D, Freeman A, Parikh B, Gribben J, Soiffer R, Ritz J, Anderson K. T-cell- depleted allogeneic bone marrow transplantation followed by donor lymphocyte infusion in patients with multiple myeloma: induction of graft-versus myeloma effect. Blood 98, 934–939 (2001).

Ares MPS, Po¨rn-Ares MI, Thyberg J, Juntti-Berggren L, Berggren, P-O, Diczfalusy U, Kallin, B, Bjo¨rkhem I, Orrenius S, Nilsso, J. Ca2+ channel blockers verapamil and nifedipine inhibit apoptosis induced by 25-hydroxycholesterol in human aortic smooth muscle cells. (1997) J. Lipid Res. 38, 2049–2061.

Attal, M. & Harousseau, J. L. Randomized trial experience of the Intergroupe Francophone du Myelome. Semin. Hematol.38, 226–230 (2001).

Avdonin V, Kasuya J, Ciorba MA, Kaplan B, Hoshi T, Iverson L. Apoptotic proteins Reaper and Grim induce stable inactivation in voltage-gated K+ channels. Proc Natl Acad Sci U S A. 1998 Sep 29;95(20):11703-8.

Avet-Loiseau H, Andree-Ashley LE, Moore II D, Mellerin MP, Feusner J, Bataille R, Pallavicini MG. Molecular cytogenetic abnormalities in multiple myeloma and plasma cell leukemia measured using comparative genomic hybridization. Genes, Chromosomes and Cancer. 1997 Jun;19(2):124-133.

Badros A, Barlogie B, Morris C, Desikan R, Martin SR, Munshi N, Zangari M, Mehta J, Toor A, Cottler-Fox M, Fassas A, Anaissie E, Schichman S, Tricot G. High response rate in refractory and poor risk multiple myeloma after allotransplantation using a nonmyeloablative conditioning regimen and donor lymphocyte infusions. Blood 97, 2574–2579 (2001).

47 Bähring R, Milligan CJ, Vardanyan V, Engeland B, Young BA, Dannenberg J, Waldschütz R, Edwards JP, Wray D, and Pongs O. Coupling of voltage-dependent potassium channel inactivation and oxidoreductase active site of Kvβ subunits (2001) J. Biol. Chem. 276, 22923–22929.

Baranova A, Hammarsund M, Ivanov D, Skoblov M, Sangfelt O, Corcoran M, Borodina T, Makeeva N, Pestova A, Tyazhelova T, Nazarenko S, Gorreta F, Alsheddi T, Schlauch K, Nikitin E, Kapanadze B, Shagin D, Poltaraus A, Ivanovich Vorobiev A, Zabarovsky E, Lukianov S, Chandhoke V, Ibbotson R, Oscier D, Einhorn S, Grander D, Yankovsky N. Distinct organization of the candidate tumor suppressor gene RFP2 in human and mouse: multiple mRNA isoforms in both species- and human-specific antisense transcript RFP2OS. Gene. 2003 Dec 4;321:103-12.

Barton K, Nucifora G. AML1 haploinsufficiency, gene dosage, and the predisposition to acute leukemia. Bioessays. 2000 Mar;22(3):214-8.

Birerdinc, A (2008) Role of KCNRG in B-cell chronic lymphocytic leukemia. PhD thesis. George Mason University

Bixby KA, Nanao MH, Shen NV, Kreusch A, Bellamy H, Pfaffinger PJ, Choe S. Zn2+-binding and molecular determinants of tetramerization in voltage-gated K+ channels. Nat. Struct. Biol. 6 38-43 1999 [PubMed: 9886290]

Brevet M, Haren N, Sevestre H, Merviel P, Ouadid-Ahidouch H. DNA methylation of K(v)1.3 potassium channel gene promoter is associated with poorly differentiated breast adenocarcinoma Cell. Physiol. Biochem. 24 (2009) 25–32.

Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S, Noch E, Aldler H, Rattan S, Keating M, Rai K, Rassenti L, Kipps T, Negrini M, Bullrich F, Croce CM. Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc Natl Acad Sci U S A. 2002 Nov 26;99(24):15524- 9.

Cho YG, Kim CJ, Song JH, Rhie DJ, Park YK, Kim SY, Nam SW, Yoo NJ, Lee JY, Park WS. Genetic and expression analysis of the KCNRG gene in hepatocellular carcinomas.Exp Mol Med. 2006 Jun 30;38(3):247-55.

Collins C. Problems monitoring response in multiple myeloma. Cancer Imaging. 2005; 5(Spec No A): S119–S126.

Cushman SJ, Nanao MH, Jahng AW, DeRubeis D, Choe S, Pfaffinger PJ. Voltage dependent activation of potassium channels is coupled to T1 domain structure. Nat Struct Biol. 2000 May;7(5):403-7.

48 Dohner H, Stilgenbauer S, Dohner K, Bentz M, Lichter P. Chromosome aberrations in B cell chronic lymphocytic leukemia: reassessment based on molecular cytogenetic analysis. J Mol Med. 1999 Feb;77(2):266-81. Review.

Elnenaei MO, Hamoudi RA, Swansbury J, Gruszka-Westwood AM, Brito-Babapulle V, Matutes E, Catovsky D. Delineation of the minimal region of loss at 13q14 in multiple myeloma. Genes Chromosomes Cancer. 2003 Jan;36(1):99-106.

Enari M, Sakahira H, Yokoyama H, Okawa K, Iwamatsu A, Nagata S. A caspase- activated DNase that degrades DNA during apoptosis, and its inhibitor ICAD. Nature 1998 Jan;391, 43-50

Fermand, J. P. et al. High-dose therapy and autologous peripheral blood stem cell transplantation in multiple myeloma: up-front or rescue treatment? Results of a multicenter sequential randomized clinical trial. Blood 92,3131–3136 (1998).

Gahrton G, Sante Tura S, Ljungman P, Belanger C, Brandt L, Cavo M, Facon T, Granena A, Gore M, Gratwohl A, Löwenberg B, Nikoskelainen J, Reiffers JJ, Samson D, Verdonck L, Volin L, the European Group for Bone Marrow Transplantation. Allogeneic bone marrow transplantation in multiple myeloma. N. Engl. J. Med. 325, 1267– 1273(1991).

Gregory, W. M., Richards, M. A. & Malpas, J. S. Combination chemotherapy versus melphalan and prednisolone in the treatment of multiple myeloma: an overview of published trials. J. Clin. Oncol. 10, 334–342 (1992).

Greipp PR, San Miguel J, Durie BGM, Crowley JJ, Barlogie B, Bladé J, Boccadoro M, Child JA, Avet-Loiseau H, Kyle RA, Lahuerta JJ, Ludwig H, Morgan G, Powles R, Shimizu K, Shustik C, Sonneveld P, Tosi P, Turesson I, Westin J. International Staging System for Multiple Myeloma. Journal of Clinical Oncology, Vol 23, No 15 (May 20), 2005: pp. 3412-3420.

Grogan T, Spier CM, Salmon SE, Matzner M, Rybski J, Weinstein RS, Scheper RJ, Dalton WS. P-glycoprotein expression in human plasma cell myeloma: correlation with prior chemotherapy. Blood 81, 490–495 (1993).

Gulbins E, Sassi N, Grassmè H, Zoratti M, Szabò I. Role of Kv1.3 mitochondrial potassium channel in apoptotic signalling in lymphocytes.Biochim Biophys Acta. 2010 Jun-Jul;1797(6-7):1251-9.

Gulbis JM, Mann S, MacKinnon R. Structure of a voltage-dependent K+ channel beta subunit. Cell. 1999 Jun 25;97(7):943-52. PMID: 10399921

49 Gulbis JM, Zhou M, Mann S, MacKinnon R. Structure of the cytoplasmic beta subunit-T1 assembly of voltage-dependent K+ channels. Science. 2000 Jul 7;289(5476):123-7.

Harrison CJ, Mazzullo H, Cheung KL, Gerrard G, Jalali GR, Mehta A, Osier DG, Orchard KH. Cytogenetics of multiple myeloma: interpretation of fluorescence in situ hybridization results. Br J Haematol. 2003 Mar;120(6):944-52.

Ivanov DV, Tyazhelova TV, Lemonnier L, Kononenko N, Pestova AA, Nikitin EA, Prevarskaya N, Skryma R, Panchin YV, Yankovsky NK, Baranova AV. A new human gene KCNRG encoding potassium channel regulating protein is a cancer suppressor gene candidate located in 13q14.3. FEBS Lett. 2003 Mar 27;539(1-3):156-60.

Kapanadze B, Kashuba V, Baranova A, Rasool O, van Everdink W, Liu Y, Syomov A, Corcoran M, Poltaraus A, Brodyansky V, Syomova N, Kazakov A, Ibbotson R, van den Berg A, Gizatullin R, Fedorova L, Sulimova G, Zelenin A, Deaven L, Lehrach H, Grander D, Buys C, Oscier D, Zabarovsky ER, Einhorn S, Yankovsky N. A cosmid and cDNA fine physical map of a human chromosome 13q14 region frequently lost in B- cell chronic lymphocytic leukemia and identification of a new putative tumor suppressor gene, Leu5. FEBS Lett. 1998 Apr 17;426(2):266-70.

Kroger N, Schwerdtfeger R, Kiehl M, Sayer HG, Renges H, Zabelina T, Fehse B, Tögel F, Wittkowsky G, Kuse R, Zander AR. Autologous stem cell transplantation followed by a dose-reduced allograft induces high complete remission rate in multiple myeloma. Blood 100, 755–760 (2002).

Lenhoff S, Hjorth M, Holmberg E, Turesson I, Westin J, Nielsen JL, Wislöff F, Brinch L, Carlson K, Carlsson M, Dahl IM, Gimsing P, Hippe E, Johnsen HE, Lamvik J, Löfvenberg E, Nesthus I, Rödjer S. Impact on survival of high-dose therapy with autologous stem cell support in patients younger than 60 years with newly diagnosed multiple myeloma: a population-based study. Blood 95, 7–11 (2000).

Lewis RS, Cahalan MD. Potassium and calcium channels in lymphocytes. Annu Rev Immunol. 1995;13:623-53.

Liu Y, Corcoran M, Rasool O, Ivanova G, Ibbotson R, Grandér D, Iyengar A, Baranova A, Kashuba V, Merup M, Wu X, Gardiner A, Mullenbach R, Poltaraus A, Hultström AL, Juliusson G, Chapman R, Tiller M, Cotter F, Gahrton G, Yankovsky N, Zabarovsky E, Einhorn S, Oscier D. Cloning of two candidate tumor suppressor genes within a 10 kb region on chromosome 13q14, frequently deleted in chronic lymphocytic leukemia. Oncogene. 1997 Nov 13;15(20):2463-73.

Long SB, Campbell EB, Mackinnon R. Crystal structure of a mammalian voltage dependent Shaker family K+ channel. Science. 2005 Aug 5;309(5736):897-903. 50 Lu L, Yang T, Markakis D, Guggino WB, Craig RW. Alterations in a voltage-gated K+ current during the differentiation of ML-1 human myeloblastic leukemia cells. J Membr Biol. 1993 Mar;132(3):267-74.

Lu W, Takahashi H, Furusato M, Maekawa S, Nakano M, Meng C, Kikuchi Y, Sudo A, Hano H. Allelotyping analysis at chromosome 13q of high-grade prostatic intraepithelial neoplasia and clinically insignificant and significant prostate cancers. Prostate. 2006 Mar 1;66(4):405-12.

Mertens D, Wolf S, Tschuch C, Mund C, Kienle D, Ohl S, Schroeter P, Lyko F, Döhner H, Stilgenbauer S, Lichter P. Allelic silencing at the tumor-suppressor locus 13q14.3 suggests an epigenetic tumor- suppressor mechanism. Proceedings of the National Academy of Sciences of the United States of America. 2006 May;103(20):7741-7746.

Miller C. An overview of the potassium channel family. Genome Biol. 2000;1(4):REVIEWS0004.

Minor DL, Lin YF, Mobley BC, Avelar A, Jan YN, Jan LY, Berger JM. The polar T1 interface is linked to conformational changes that open the voltage-gated potassium channel. Cell. 2000 Sep 1;102(5):657-70.

Myeloma Trialists’ Collaborative Group. Combination chemotherapy versus melphalan plus prednisone as treatment for multiple myeloma: an overview of 6,633 patients from 27 randomized trials. J. Clin. Oncol. 16, 3832–3842 (1998).

Nagaya N, Papazian DM. Potassium channel α and β subunits assemble in the endoplasmic reticulum (1997) J. Biol. Chem. 272, 3022–3027.

Orrenius, S., Ankarcrona, M. & Nicotera, P. Mechanisms of calcium-related cell death. (1996) Adv. Neurol. 71, 137–151.

Ouadid-Ahidouch H, Chaussade F, Roudbaraki M, Slomianny C, Dewailly E, Delcourt P, Prevarskaya N. KV1.1 K(+) channels identification in human breast carcinoma cells: involvement in cell proliferation. Biochem Biophys Res Commun 278 (2000) 272-7.

Rane S. Potassium channels as targets for modulating cell growth and differentiation. Perspect. Drug Des. Discovery 16 (1999), pp. 295–311.

Rosenwald A, Ott G, Krumdiek AK, Dreyling MH, Katzenberger T, Kalla J, Roth S, Ott MM, Muller-Hermelink HK. A biological role for deletions in chromosomal band 13q14 in mantle cell and peripheral t-cell lymphomas? Genes Chromosomes Cancer. 1999. Nov;26(3):210-4.

Rowntree C, Duke V, Panayiotidis P, Kotsi P, Palmisano GL, Hoffbrand AV, Foroni 51 L. Deletion analysis of chromosome 13q14.3 and characterisation of an alternative splice form of LEU1 in B cell chronic lymphocytic leukemia. Leukemia. 2002 Jul;16(7):1267-75.

Ruppel, M (2009) Elucidation of the epigenetic code of the chromosomal region 13q14.3 in Chronic Lymphocytic Leukemia (CLL). PhD thesis. Technical University of Darmstadt.

Rybalchenko V, Prevarskaya N, Van Coppenolle F, Legrand G, Lemonnier L, Le Bourhis X, Skryma R. Verapamil inhibits proliferation of LNCaP human prostate cancer cells influencing K+ channel gating. Mol Pharmacol. 2001 Jun;59(6):1376-87.

Salmon SE, Dalton WS, Grogan TM, Plezia P, Lehnert M, Roe DJ, Miller TP. Multidrug-resistant myeloma: laboratory and clinical effects of verapamil as a chemosensitizer. Blood 78, 44–50 (1991).

Sansom M.S. Potassium channels: watching a voltage-sensor tilt and twist. Curr. Biol. 10 R206-R209 2000.

Santarosa M, Ashworth A. Haploinsufficiency for tumour suppressor genes: when you don't need to go all the way. Biochim Biophys Acta. 2004 Jun 7;1654(2):105-22.

Schwartz, L. M. & Milligan, C. E. Cold thoughts of death: the role of ICE proteases in neuronal cell death. (1996) Trends Neurosci. 19,555–562.

Sewing S, Roeper J, Pongs O. Kv beta 1 subunit binding specific for shaker-related potassium channel alpha subunits. Neuron. 1996 Feb;16(2):455-63.

Shen AY, Wu SN, Chiu CT. Synthesis and cytotoxicity evaluation of some 8- hydroxyquinoline derivatives. J Pharm Pharmacol. 1999 May;51(5):543-8.

Smith GA, Tsui HW, Newell EW, Jiang X, Zhu XP, Tsui FW, Schlichter LC. Functional up-regulation of HERG K+ channels in neoplastic hematopoietic cells. J Biol Chem. 2002 May 24;277(21):18528-34. Epub 2002 Mar 13. PMID: 11893742

Sonneveld, P., Schoester, M. & de Leeuw, K. Clinical modulation of multidrug resistance in multiple myeloma: effects of cyclosporine on resistant tumor cells. J. Clin. Oncol. 12, 1584–1591 (1994).

Spary LK, Schouten JP, Morse HR. Detection of chromosome 13 deletion events in multiple myeloma and osteosarcoma using multiplex ligation-dependent probe amplification (MLPA).The Netherlands Abstracts / Toxicology 226 (2006) 12–77.

52 Stilgenbauer S, Döhner K, Bentz M, Lichter P, Döhner H. Molecular cytogenetic analysis of B-cell chronic lymphocytic leukemia. Ann Hematol. 1998 Mar-Apr;76(3- 4):101-10.

Tipparaju, S. M., Saxena, N., Liu, S. Q., Kumar, R., and Bhatanagar, A. Differential regulation of voltage-gated K+ channels by oxidized and reduced pyridine nucleotide coenzymes (2005) Am. J. Physiol. 288, C366–C376

Tyybakinoja A, Vilpo J, Knuutila S. High-resolution oligonucleotide array-CGH pinpoints genes involved in cryptic losses in chronic lymphocytic leukemia. Cytogenet Genome Res. 2007;118(1):8-12.

Usman H, Mathew MK. Potassium channel regulator KCNRG regulates surface expression of Shaker-type potassium channels. Biochemical and Biophysical Research Communications. 2010 Jan;391(3):1301-1305. van Everdink WJ, Baranova A, Lummen C, Tyazhelova T, Looman MW, Ivanov D, Verlind E, Pestova A, Faber H, van der Veen AY, Yankovsky N, Vellenga E, Buys CH. RFP2, c13ORF1, and FAM10A4 are the most likely tumor suppressor gene candidates for B-cell chronic lymphocytic leukemia. Cancer Genet Cytogenet. 2003 Oct 1;146(1):48-57. PMID: 14499696

Wang G, Covarrubias M. Voltage-dependent gating rearrangements in the intracellular T1-T1 interface of a K+ channel. J Gen Physiol. 2006 Apr;127(4):391- 400.

Weng J, Cao Y, Moss N, Zhou, M. Modulation of Voltage-dependent Shaker Family Potassium Channels by an Aldo-Keto Reductase (2006) J. Biol. Chem. 281, 15194– 15200

Shi, G., Nakamira, K., Hammond, S., Rhodes, K. J., Schechter, L. E., and Trimmer, J. S. β Subunits Promote K+ Channel Surface Expression through Effects Early in Biosynthesis (1996) Neuron 16, 843–852.

Wolf S, Mertens D, Schaffner C, Korz C, Döhner H, Stilgenbauer S, Lichter P. B-cell neoplasia associated gene with multiple splicing (BCMS): the candidate B-CLL gene on 13q14 comprises more than 560 kb covering all critical regions. Hum Mol Genet. 2001 Jun 1;10(12):1275-85.

Wu SN, Yu HS, Jan CR, Li HF, Yu CL. Inhibitory effects of berberine on voltage- and calcium-activated potassium currents in human myeloma cells. Life Sci. 1998;62(25):2283-94

53 Xu B, Wilson BA, Lu L. Induction of human myeloblastic ML-1 cell G1 arrest by suppression of K+ channel activity. Am J Physiol. 1996 Dec;271(6 Pt 1):C2037-44.

Yu W, Xu J, Li M. NAB domain is essential for the subunit assembly of both alpha- alpha and alpha-beta complexes of shaker-like potassium channels. Neuron. 1996 Feb;16(2):441-53.

Zhou Q, Kwan HY, Chan HC, Jiang JL, Tam SC, Yao X. Blockage of voltage-gated K+ channels inhibits adhesion and proliferation of hepatocarcinoma cells. Int J Mol Med. 2003 Feb;11(2):261-6.

CURRICULUM VITAE

Stephanie Coon graduated from Falls Church High School, Fairfax, Virginia, in 1998. She received her Bachelor of Science from George Mason University in 2002. While completing her master’s degree she worked as a senior medical technologist in the Molecular Infectious Disease department of Quest Diagnostics Nichols Institute, Chantilly, Virginia.