DOCSLIB.ORG

Molecular Evolution of the Vertebrate Hexokinase Gene Family: Identification of a Conserved Fifth Vertebrate Hexokinase Gene ⁎ David M

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Evolution of the Vertebrate Hexokinase Gene Family: Identification of a Conserved Fifth Vertebrate Hexokinase Gene ⁎ David M 中国科技论文在线 http://www.paper.edu.cn Comparative Biochemistry and Physiology, Part D 3 (2008) 96–107 Molecular evolution of the vertebrate hexokinase gene family: Identification of a conserved fifth vertebrate hexokinase gene ⁎ David M. Irwin a, , Huanran Tan b a Department of Laboratory Medicine and Pathobiology, Banting and Best Diabetes Centre, University of Toronto, Toronto, Canada b Department of Pharmacology, Peking University Health Sciences Centre, Beijing, China Received 6 October 2007; received in revised form 12 November 2007; accepted 13 November 2007 Available online 3 December 2007 Abstract Hexokinases (HK) phosphorylate sugar immediately upon its entry into cells allowing these sugars to be metabolized. A total of four hexokinases have been characterized in a diversity of vertebrates—HKI, HKII, HKIII, and HKIV. HKIV is often called glucokinase (GCK) and has half the molecular weight of the other hexokinases, as it only has one hexokinase domain, while other vertebrate HKs have two. Differing hypothesis has been proposed to explain the diversification of the hexokinase gene family. We used a genomic approach to characterize hexokinase genes in a diverse array of vertebrate species and close relatives. Surprisingly we identified a fifth hexokinase-like gene, HKDC1 that exists and is expressed in diverse vertebrates. Analysis of the amino acid sequence of HKDC1 suggests that it may function as a hexokinase. To understand the evolution of the vertebrate hexokinase gene family we established a phylogeny of the hexokinase domain in all of the vertebrate hexokinase genes, as well as hexokinase genes from close relatives of the vertebrates. Our phylogeny demonstrates that duplication of the hexokinase domain, yielding a HK with two hexokinase domains, occurred prior to the diversification of the hexokinase gene family. We also establish that GCK evolved from a two hexokinase domain-containing gene, but has lost its N-terminal hexokinase domain. We also show that parallel changes in enzymatic function of HKI and HKIII have occurred. © 2007 Elsevier Inc. All rights reserved. Keywords: Glucokinase; Gene duplication; Hexokinase; Gene evolution 1. Introduction 1995, 2003; Cárdenas et al., 1998). Hexokinase IV is more often called glucokinase (GCK) although it does not differ in its Phosphorylation of glucose by ATP occurs immediately specificity to glucose compared to the other hexokinases upon its import into eukaryotic cells, with the phosphorylation (Wilson, 1995, 2003; Cárdenas et al., 1998). Most hexokinases being mediated by hexokinases (HK) (Wilson, 1995, 2003; are widely expressed but distinct hexokinases dominate specific Cárdenas et al., 1998). Hexokinases phosphorylate a variety of tissues (Katzen and Schimke, 1965, Rogers et al., 1975). HKI is hexose sugars, although their preferred substrate is glucose the most abundant hexokinase in brain and kidney (Griffin (Wilson, 1995). Phosphorylated sugars become substrates for et al., 1992). HKII is the primary hexokinase in muscle and differing metabolic fates, dependent upon the cell type and its adipose tissues (Postic et al., 1994). HKIII predominates in metabolic status (Wilson, 1995, 2003; Cárdenas et al., 1998). A spleen and lymphocytes (Coerver et al., 1998). Glucokinase total of four hexokinases have been identified and extensively (HKIV) is the major hexokinase in glucose sensitive tissues studied in vertebrates, hexokinase I, II, III, and IV (Wilson, such as liver and pancreatic tissues (Printz et al., 1993). In addition to the well-characterized hexokinases, an expressed gene has been identified in mammalian genomes that encode a ⁎ Corresponding author. Department of Laboratory Medicine and Pathobiol- ogy, University of Toronto, 100 College St., Toronto, Ont., Canada M5G 1L5. product that has ADP-dependent glucokinase activity, although Tel.: +1 416 978 0519. this activity has not been demonstrated in vivo (Ronimus and E-mail address: david.irwin@utoronto.ca (D.M. Irwin). Morgan, 2004), thus its role in glucose metabolism is unclear. 1744-117X/$ - see front matter © 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.cbd.2007.11.002 转载 中国科技论文在线 http://www.paper.edu.cn D.M. Irwin, H. Tan / Comparative Biochemistry and Physiology, Part D 3 (2008) 96–107 97 Mammalian hexokinases I, II, and III are approximately explain the evolution of glucokinase, but also help explain the 100 kDa in size, while glucokinase (HKIV) is only half of this diversification of this gene family and provide insights into how size at only 50 kDa (Wilson, 1995, 2003; Cárdenas et al., 1998). the changes in enzymatic function of these enzymes have Hexokinases from non-vertebrate animals, as well as plants and occurred. fungi are similar in size to glucokinase (Wilson, 1995, 2003; Here we report a characterization of the hexokinase gene Cárdenas et al., 1998). These observations had suggested that family in vertebrates with an analysis of their evolutionary the 100 kDa mammalian hexokinases were the product of a history. Surprisingly we found five, not four, types of duplication of an ancestral 50 kDa hexokinase (Colowick, 1973; hexokinase-like genes. All five of these hexokinase genes Easterby and O'Brien, 1973). Subsequent analysis of the amino were found throughout vertebrates, and in similar genomic acid sequences of hexokinases revealed extensive sequence locations, suggesting that they were products of gene duplica- similarity between the proteins, and clearly demonstrated that tion events that occurred very early in vertebrate evolution. the hexokinase I, II, and III sequences possess duplicated Multiple hexokinase sequences were also found in non- hexokinase domains, and likely were descendent from a gene vertebrate species, including sea urchin and two species of generated by the duplication and fusion of a single hexokinase Ciona, species that are closely related to vertebrates. None of domain-containing ancestor (Griffin et al., 1991; Kogure et al., the non-vertebrate species, though, encoded a hexokinase 1993; Cárdenas et al., 1998). The existence of two hexokinase encoding more than one hexokinase domain. Phylogenetic domains in the HK1, HKII, and HKIII enzymes suggested the analysis of vertebrate and non-vertebrate hexokinases showed possibility that each of these hexokinases may have two active that all the vertebrate sequences were more closely related to sites. Only HKII has been shown to have two active sites (Tsai each other than to any other species, suggesting independent and Wilson, 1996), as the N-terminal hexokinase domains of duplications of the hexokinase genes on multiple lineages, and both HKI and HKIII do not have catalytic activity (White and that the 100 kDa hexokinase originated on the vertebrate lineage Wilson, 1989; Tsai and Wilson, 1997; Tsai, 1999). The after divergence from non-vertebrate species. Our phylogenetic determination of the crystal structure of hexokinase I (Aleshin analysis also showed that the ancestor of all vertebrate et al., 1998a,b) and glucokinase (Kamata et al., 2004) together hexokinases contained two hexokinase domains, thus glucoki- with molecular modeling and site-directed mutagenesis studies nase did lose its N-terminal hexokinase domain. Our phylogeny of glucokinase (Xu et al., 1994, 1995; Mahalingam et al., 1999; also shows that the N-terminal hexokinase domains of HKI and Marotta et al., 2005) have led to a better understanding of the HKIII independently lost hexokinase activity. amino acid residues essential for catalytic activity. While it is clear that HKI, HKII, and HKIII are descendent 2. Materials and methods from a common ancestor that was generated by the duplication of a single hexokinase domain-containing gene, the relationship 2.1. Molecular databases and sequence analysis of glucokinase to these two hexokinase domain-containing hexokinases, as well as the relationships among these Protein databases maintained by the National Center for hexokinases are unclear. Previous sequence analyses have Biotechnology Information (NCBI GenBank, www.ncbi.nlm. yielded support for two different evolutionary histories. A nih.gov) were searched using the BLASTP algorithm (Altschul phylogenetic analysis by Griffin et al. (1991) suggested that the et al., 1997) for sequences similar to human hexokinases I, II, C-terminal hexokinase domains of hexokinases I, II, and III are III, and IV (GCK). Genomic databases of diverse vertebrate more closely related to glucokinase than they were to the N- species (see Table 2) maintained by Ensembl (version 45, www. terminal hexokinase domains of these hexokinases. This ensembl.org) and NCBI were then searched for gene sequences relationship would suggest that glucokinase is descendent similar to human hexokinase genes using the tBLASTN from a hexokinase that contained two hexokinase domains, but algorithm (Altschul et al., 1997). Gene sequences were that it lost its N-terminal hexokinase domain after it diverged downloaded and used for reciprocal BLAST searches to confirm from the other hexokinases (Griffin et al., 1991; Tsai and that they were more similar to human hexokinase genes than to Wilson, 1996). In contrast, Cárdenas et al. (1998) concluded any other gene. Hexokinase sequences from non-vertebrate from their phylogenetic analysis that glucokinase diverged from hexokinase species (i.e., Ciona intestinalis, Ciona savignyi, and the ancestor of the other hexokinase genes prior to the Strongylocentrotus purpuratus) were used to search the duplication of the hexokinase domain (Cárdenas et al.,
Load more

Recommended publications
  • Ck1δ Over-Expressing Mice Display ADHD-Like Behaviors, Frontostriatal Neuronal Abnormalities and Altered Expressions of ADHD-Candidate Genes
    Molecular Psychiatry (2020) 25:3322–3336 https://doi.org/10.1038/s41380-018-0233-z ARTICLE CK1δ over-expressing mice display ADHD-like behaviors, frontostriatal neuronal abnormalities and altered expressions of ADHD-candidate genes 1 1 1 2 1 1 1 Mingming Zhou ● Jodi Gresack ● Jia Cheng ● Kunihiro Uryu ● Lars Brichta ● Paul Greengard ● Marc Flajolet Received: 8 November 2017 / Revised: 4 July 2018 / Accepted: 18 July 2018 / Published online: 19 October 2018 © Springer Nature Limited 2018 Abstract The cognitive mechanisms underlying attention-deficit hyperactivity disorder (ADHD), a highly heritable disorder with an array of candidate genes and unclear genetic architecture, remain poorly understood. We previously demonstrated that mice overexpressing CK1δ (CK1δ OE) in the forebrain show hyperactivity and ADHD-like pharmacological responses to D- amphetamine. Here, we demonstrate that CK1δ OE mice exhibit impaired visual attention and a lack of D-amphetamine- induced place preference, indicating a disruption of the dopamine-dependent reward pathway. We also demonstrate the presence of abnormalities in the frontostriatal circuitry, differences in synaptic ultra-structures by electron microscopy, as 1234567890();,: 1234567890();,: well as electrophysiological perturbations of both glutamatergic and GABAergic transmission, as observed by altered frequency and amplitude of mEPSCs and mIPSCs. Furthermore, gene expression profiling by next-generation sequencing alone, or in combination with bacTRAP technology to study specifically Drd1a versus Drd2 medium spiny neurons, revealed that developmental CK1δ OE alters transcriptional homeostasis in the striatum, including specific alterations in Drd1a versus Drd2 neurons. These results led us to perform a fine molecular characterization of targeted gene networks and pathway analysis. Importantly, a large fraction of 92 genes identified by GWAS studies as associated with ADHD in humans are significantly altered in our mouse model.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • Supplementary Table 1. List of Genes Up-Regulated in Abiraterone-Resistant Vcap Xenograft Samples PIK3IP1 Phosphoinositide-3-Kin
    Supplementary Table 1. List of genes up-regulated in abiraterone-resistant VCaP xenograft samples PIK3IP1 phosphoinositide-3-kinase interacting protein 1 TMEM45A transmembrane protein 45A THBS1 thrombospondin 1 C7orf63 chromosome 7 open reading frame 63 OPTN optineurin FAM49A family with sequence similarity 49, member A APOL4 apolipoprotein L, 4 C17orf108|LOC201229 chromosome 17 open reading frame 108 | hypothetical protein LOC201229 SNORD94 small nucleolar RNA, C/D box 94 PCDHB11 protocadherin beta 11 RBM11 RNA binding motif protein 11 C6orf225 chromosome 6 open reading frame 225 KIAA1984|C9orf86|TMEM14 1 KIAA1984 | chromosome 9 open reading frame 86 | transmembrane protein 141 KIAA1107 TLR3 toll-like receptor 3 LPAR6 lysophosphatidic acid receptor 6 KIAA1683 GRB10 growth factor receptor-bound protein 10 TIMP2 TIMP metallopeptidase inhibitor 2 CCDC28A coiled-coil domain containing 28A FBXL2 F-box and leucine-rich repeat protein 2 NOV nephroblastoma overexpressed gene TSPAN31 tetraspanin 31 NR3C2 nuclear receptor subfamily 3, group C, member 2 DYNC2LI1 dynein, cytoplasmic 2, light intermediate chain 1 C15orf51 dynamin 1 pseudogene SAMD13 sterile alpha motif domain containing 13 RASSF6 Ras association (RalGDS/AF-6) domain family member 6 ZNF167 zinc finger protein 167 GATA2 GATA binding protein 2 NUDT7 nudix (nucleoside diphosphate linked moiety X)-type motif 7 DNAJC18 DnaJ (Hsp40) homolog, subfamily C, member 18 SNORA57 small nucleolar RNA, H/ACA box 57 CALCOCO1 calcium binding and coiled-coil domain 1 RLN2 relaxin 2 ING4 inhibitor of
    [Show full text]
  • A Curated Biochemical Pathways Database for the Laboratory Mouse Alexei V Evsikov, Mary E Dolan, Michael P Genrich, Emily Patek and Carol J Bult
    Open Access Software2009EvsikovetVolume al. 10, Issue 8, Article R84 MouseCyc: a curated biochemical pathways database for the laboratory mouse Alexei V Evsikov, Mary E Dolan, Michael P Genrich, Emily Patek and Carol J Bult Address: The Jackson Laboratory, Main Street, Bar Harbor, ME 04609, USA. Correspondence: Carol J Bult. Email: Carol.Bult@jax.org Published: 14 August 2009 Received: 22 May 2009 Revised: 17 July 2009 Genome Biology 2009, 10:R84 (doi:10.1186/gb-2009-10-8-r84) Accepted: 14 August 2009 The electronic version of this article is the complete one and can be found online at http://genomebiology.com/2009/10/8/R84 © 2009 Evsikov et al,; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. MouseCyc<p>MouseCyc database is a database of curated metabolic pathways for the laboratory mouse.</p> Abstract Linking biochemical genetic data to the reference genome for the laboratory mouse is important for comparative physiology and for developing mouse models of human biology and disease. We describe here a new database of curated metabolic pathways for the laboratory mouse called MouseCyc http://mousecyc.jax.org. MouseCyc has been integrated with genetic and genomic data for the laboratory mouse available from the Mouse Genome Informatics database and with pathway data from other organisms, including human. Rationale Biochemical interactions and transformations among organic The availability of the nearly complete genome sequence for molecules are arguably the foundation and core distinguish- the laboratory mouse provides a powerful platform for pre- ing feature of all organic life.
    [Show full text]
  • Bioinformatics Analysis of HKDC1 Expression in Non-Small Cell Lung Cancer and Its Relationship to Survival
    Journal of Nutritional Oncology, February 15, 2020, Volume 5, Number 1 DOI: 10.34175/jno202001004 · 31 · Bioinformatics Analysis of HKDC1 Expression in Non-small Cell Lung Cancer and Its Relationship to Survival Lei Wang, Wei Yuan Li, Fang Fang Li, Chun Yan Yang, Deng Cai Mu, Shang Yong Zheng School of Medicine, Yunnan University, Kunming, Yunnan 650091, China Abstract: Lung cancer has become one of the most common types of cancer, and has the highest morbidity and mortality rates. We herein performed a bioinformatic analysis to explore the gene expression of hexokinase domain containing 1 (HKDC1) to further illuminate the molecular mechanisms involved in non-small cell lung cancer (NSCLC). We also examined the relationship between HKDC1 expression and patient survival. The Oncomine and cBioPortal cancer genomics databases were used to investigate the expression of HKDC1 in NSCLC. Then the protein-protein interaction network and protein expression intensity of HKDC1 were examined with the Gene MANIA and The Human Protein Atlas databases. Finally, the prognostic impact of HKDC1 was evaluated via the GEPIA, Oncolnc and Kaplan-Meier Plotter online tools. HKDC1 was significantly up-regulated in NSCLC patients. In addition, the mutation frequency of HKDC1 in NSCLC was high in a large number of studies. Moreover, HKDC1 expression was correlated with a poor prognosis in NSCLC patients. These findings suggest that HKDC1 represents a novel therapeutic target for NSCLC. Key words: HKDC1; NSCLC; Bioinformatics; Expression; Carbohydrate metabolism Introduction genome-scale data source in life science research. Unlike Lung cancer (LC) is a life-threatening disease and the DNA sequence analysis and genotyping, microarrays most prominent cause of cancer morbidity and mortality in analyze mRNA.
    [Show full text]
  • Mouse Models of Inherited Retinal Degeneration with Photoreceptor Cell Loss
    cells Review Mouse Models of Inherited Retinal Degeneration with Photoreceptor Cell Loss 1, 1, 1 1,2,3 1 Gayle B. Collin y, Navdeep Gogna y, Bo Chang , Nattaya Damkham , Jai Pinkney , Lillian F. Hyde 1, Lisa Stone 1 , Jürgen K. Naggert 1 , Patsy M. Nishina 1,* and Mark P. Krebs 1,* 1 The Jackson Laboratory, Bar Harbor, Maine, ME 04609, USA; gayle.collin@jax.org (G.B.C.); navdeep.gogna@jax.org (N.G.); bo.chang@jax.org (B.C.); nattaya.damkham@jax.org (N.D.); jai.pinkney@jax.org (J.P.); Lillian.Hyde@jax.org (L.F.H.); lisa.stone@jax.org (L.S.); juergen.naggert@jax.org (J.K.N.) 2 Department of Immunology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand 3 Siriraj Center of Excellence for Stem Cell Research, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand * Correspondence: patsy.nishina@jax.org (P.M.N.); mark.krebs@jax.org (M.P.K.); Tel.: +1-207-2886-383 (P.M.N.); +1-207-2886-000 (M.P.K.) These authors contributed equally to this work. y Received: 29 February 2020; Accepted: 7 April 2020; Published: 10 April 2020 Abstract: Inherited retinal degeneration (RD) leads to the impairment or loss of vision in millions of individuals worldwide, most frequently due to the loss of photoreceptor (PR) cells. Animal models, particularly the laboratory mouse, have been used to understand the pathogenic mechanisms that underlie PR cell loss and to explore therapies that may prevent, delay, or reverse RD. Here, we reviewed entries in the Mouse Genome Informatics and PubMed databases to compile a comprehensive list of monogenic mouse models in which PR cell loss is demonstrated.
    [Show full text]
  • Gene Expression Profiling of Chromosome 10 in PTEN-Knockout
    Gene Reports 21 (2020) 100895 Contents lists available at ScienceDirect Gene Reports journal homepage: www.elsevier.com/locate/genrep Gene expression profiling of chromosome 10 in PTEN-knockout (−/−) T human neural and mesenchymal stem cells: A system biology study ⁎ Hamid Fiujia, ,1, Mohammadreza Nassirib,1 a Department of Biochemistry, Faculty of Science, Payame Noor University of Mashhad (PNUM), Mashhad, Iran b Recombinant Protein Research Group, The Institute of Biotechnology, Ferdowsi University of Mashhad, Mashhad, Iran ARTICLE INFO ABSTRACT Keywords: The present study investigates the effects of PTEN deletion in human neuro and mesenchymal stem cells related PTEN deletion to the chromosome 10 gene expression profile. The RNA sequencing (RNA-seq) performed on four neural and NSCs four mesenchymal stem cells. DEG analysis outcome revealed 122 genes for neural stem cells (57 up-regulated MSCs and 65 down-regulated genes) and 258 genes for mesenchymal stem cells (98 up-regulated and 160 down- RNA sequencing regulated genes) that were deferentially expressed in the PTEN (-/-) group compared to the normal group. Gene Hub genes ontology analysis indicated that in the NSCs upregulated DEGs were significantly enriched in transcriptional Tumor progression activator activity, phosphatidylinositol phosphate phosphatase activity, MAP kinase activity while the down- regulated DEGs were mainly involved in glycolytic process through glucose-6-phosphate, canonical glycolysis, glucose catabolic process to pyruvate. Meanwhile, in MSCs, the upregulated
    [Show full text]
  • Supplementary Table 1. Expression
    Supplementary Table 1. Expression (Mean Standard Deviation of the log2 average expression or transcript detection) of Sus scrofa specific miRNAs detected by the GeneChip™ miRNA 4.0 Array (ThermoFisher Scientific) in spermatozoa retrieved from the SRF of the ejaculate of healthy mature boars (n=3). The miRNA is designed to interrogate all mature miRNA sequences in miRBase v20. The array includes 30.424 mature miRNA (all organisms) and we select specifically the 326 Sus scrofa- specific miRNAs included in the array. Expression Mean ± Standard Deviation Sequence Transcript ID (log2) Accession Length Sequence ssc-miR-1285 13.98 ± 0.13 MIMAT0013954 24 CUGGGCAACAUAGCGAGACCCCGU ssc-miR-16 12.6 ± 0.74 MIMAT0007754 22 UAGCAGCACGUAAAUAUUGGCG ssc-miR-4332 12.32 ± 0.29 MIMAT0017962 20 CACGGCCGCCGCCGGGCGCC ssc-miR-92a 12.06 ± 0.09 MIMAT0013908 22 UAUUGCACUUGUCCCGGCCUGU ssc-miR-671-5p 11.73 ± 0.54 MIMAT0025381 24 AGGAAGCCCUGGAGGGGCUGGAGG ssc-miR-4334-5p 11.31 ± 0.05 MIMAT0017966 19 CCCUGGAGUGACGGGGGUG ssc-miR-425-5p 10.99 ± 0.15 MIMAT0013917 23 AAUGACACGAUCACUCCCGUUGA ssc-miR-191 10.57 ± 0.22 MIMAT0013876 23 CAACGGAAUCCCAAAAGCAGCUG ssc-miR-92b-5p 10.53 ± 0.18 MIMAT0017377 24 AGGGACGGGACGCGGUGCAGUGUU ssc-miR-15b 10.01 ± 0.9 MIMAT0002125 22 UAGCAGCACAUCAUGGUUUACA ssc-miR-30d 9.89 ± 0.36 MIMAT0013871 24 UGUAAACAUCCCCGACUGGAAGCU ssc-miR-26a 9.62 ± 0.47 MIMAT0002135 22 UUCAAGUAAUCCAGGAUAGGCU ssc-miR-484 9.55 ± 0.14 MIMAT0017974 20 CCCAGGGGGCGACCCAGGCU ssc-miR-103 9.53 ± 0.22 MIMAT0002154 23 AGCAGCAUUGUACAGGGCUAUGA ssc-miR-296-3p 9.41 ± 0.26 MIMAT0022958
    [Show full text]
  • New Insights Into Gestational Glucose Metabolism: Lessons Learned from 21St Century Approaches
    Diabetes Volume 64, February 2015 327 Anthony R. Angueira,1 Anton E. Ludvik,1 Timothy E. Reddy,2,3 Barton Wicksteed,4 William L. Lowe Jr.,1 and Brian T. Layden1,5 New Insights Into Gestational Glucose Metabolism: Lessons Learned From 21st Century Approaches Diabetes 2015;64:327–334 | DOI: 10.2337/db14-0877 Pregnancy presents a unique physiological challenge that gestational diabetes mellitus (GDM) (i.e., new-onset hyper- requires changes coordinated by placentally and non– glycemia that presents during pregnancy) (1). Exemplifying PERSPECTIVES IN DIABETES placentally derived hormones to prepare the mother for the importance of studying GDM is that hyperglycemia the metabolic stress presented by fetal development and during pregnancy not only increases the risk of maternal to ensure appropriate nutrient allocation between mother type 2 diabetes (T2D), but also predisposes the developing and fetus. Of particular importance is the maintenance of fetus to poor metabolic health later in life (2). In this Per- normal glucose metabolism during pregnancy. Here, we spectives in Diabetes article, we first highlight key aspects of describe physiological changes in glucose metabolism normal gestational glucose metabolism. We then describe during pregnancy and highlight new insights into these new findings that have emerged in recent years spurred by adaptations that have emerged over the past decade us- new technologies (genome-wide association studies [GWAS], ing novel methodologies, specifically genome-wide asso- metabolomics, and gut microbiota investigations). Finally, ciation studies (GWAS) and metabolomics. While GWAS fi fi we place these ndings in context with current knowledge have identi ed some novel associations with metabolic fi traits during pregnancy, the majority of the findings over- in the eld and emphasize new directions emerging from lap with those observed in nonpregnant populations and these investigations.
    [Show full text]
  • Genomic Analyses Reveal Recurrent Mutations in Epigenetic Modifiers
    ARTICLE Received 6 Jul 2015 | Accepted 25 Aug 2015 | Published 29 Sep 2015 DOI: 10.1038/ncomms9470 OPEN Genomic analyses reveal recurrent mutations in epigenetic modifiers and the JAK–STAT pathway in Se´zary syndrome Mark J. Kiel1,*, Anagh A. Sahasrabuddhe1,*,w, Delphine C.M. Rolland2,*, Thirunavukkarasu Velusamy1,*, Fuzon Chung1, Matthew Schaller1, Nathanael G. Bailey1, Bryan L. Betz1, Roberto N. Miranda3, Pierluigi Porcu4, John C. Byrd4, L. Jeffrey Medeiros3, Steven L. Kunkel1, David W. Bahler5, Megan S. Lim2 & Kojo S.J. Elenitoba-Johnson2,6 Se´zary syndrome (SS) is an aggressive leukaemia of mature T cells with poor prognosis and limited options for targeted therapies. The comprehensive genetic alterations underlying the pathogenesis of SS are unknown. Here we integrate whole-genome sequencing (n ¼ 6), whole-exome sequencing (n ¼ 66) and array comparative genomic hybridization-based copy- number analysis (n ¼ 80) of primary SS samples. We identify previously unknown recurrent loss-of-function aberrations targeting members of the chromatin remodelling/histone mod- ification and trithorax families, including ARID1A in which functional loss from nonsense and frameshift mutations and/or targeted deletions is observed in 40.3% of SS genomes. We also identify recurrent gain-of-function mutations targeting PLCG1 (9%) and JAK1, JAK3, STAT3 and STAT5B (JAK/STAT total B11%). Functional studies reveal sensitivity of JAK1-mutated primary SS cells to JAK inhibitor treatment. These results highlight the complex genomic landscape of SS and a role for inhibition of JAK/STAT pathways for the treatment of SS. 1 Department of Pathology, University of Michigan Medical School, Ann Arbor, Michigan 48109, USA.
    [Show full text]
  • FUNCTIONAL CHARACTERIZATION of HEXOKINASE-LIKE 1 (HKL1) from ARABIDOPSIS THALIANA Abhijit Karve Clemson University, Akarve@Clemson.Edu
    Clemson University TigerPrints All Dissertations Dissertations 12-2008 FUNCTIONAL CHARACTERIZATION OF HEXOKINASE-LIKE 1 (HKL1) FROM ARABIDOPSIS THALIANA Abhijit Karve Clemson University, akarve@clemson.edu Follow this and additional works at: https://tigerprints.clemson.edu/all_dissertations Part of the Genetics Commons Recommended Citation Karve, Abhijit, "FUNCTIONAL CHARACTERIZATION OF HEXOKINASE-LIKE 1 (HKL1) FROM ARABIDOPSIS THALIANA" (2008). All Dissertations. 387. https://tigerprints.clemson.edu/all_dissertations/387 This Dissertation is brought to you for free and open access by the Dissertations at TigerPrints. It has been accepted for inclusion in All Dissertations by an authorized administrator of TigerPrints. For more information, please contact kokeefe@clemson.edu. FUNCTIONAL CHARACTERIZATION OF HEXOKINASE-LIKE 1 (HKL1) FROM ARABIDOPSIS THALIANA A Thesis Presented to the Graduate School of Clemson University In Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy Genetics by Abhijit Avinash Karve December 2008 Accepted by: Dr. Brandon Moore, Committee Chair Dr. William Vance Baird Dr. Albert Abbott Dr. Lesly Temesvari Dr. James Morris ABSTRACT Arabidopsis hexokinase1 (AtHXK1) is a moonlighting protein with roles in both glucose signaling and catalysis. In this study, we first cloned and characterized the six HXK related genes from Arabidopsis. Three of the six encoded proteins were shown not to phosphorylate hexoses and thus, are designated as hexokinase-like (HKL) proteins. Though they are only 50% identical to HXK1, the amino acid sequences of HKL1 and HKL2 both have well conserved glucose binding domains and other recognized structural elements. The possible basis for their lack of catalytic activity was further probed by site-directed mutagenesis and ultimately was attributed to a suite of amino acid substitutions.
    [Show full text]
  • Coordinated Regulatory Variation Associated with Gestational Hyperglycaemia Regulates Expression of the Novel Hexokinase HKDC1
    ARTICLE Received 8 Aug 2014 | Accepted 10 Dec 2014 | Published 4 Feb 2015 DOI: 10.1038/ncomms7069 Coordinated regulatory variation associated with gestational hyperglycaemia regulates expression of the novel hexokinase HKDC1 Cong Guo1,2, Anton E. Ludvik3, Michelle E. Arlotto4, M. Geoffrey Hayes3, Loren L. Armstrong3, Denise M. Scholtens5, Christopher D. Brown6, Christopher B. Newgard4,7,8, Thomas C. Becker4,8, Brian T. Layden3,9, William L. Lowe3 & Timothy E. Reddy2,10 Maternal glucose levels during pregnancy impact the developing fetus, affecting metabolic health both early and later on in life. Both genetic and environmental factors influence maternal metabolism, but little is known about the genetic mechanisms that alter glucose metabolism during pregnancy. Here, we report that haplotypes previously associated with gestational hyperglycaemia in the third trimester disrupt regulatory element activity and reduce expression of the nearby HKDC1 gene. We further find that experimentally reducing or increasing HKDC1 expression reduces or increases hexokinase activity, respectively, in mul- tiple cellular models; in addition, purified HKDC1 protein has hexokinase activity in vitro. Together, these results suggest a novel mechanism of gestational glucose regulation in which the effects of genetic variants in multiple regulatory elements alter glucose homeostasis by coordinately reducing expression of the novel hexokinase HKDC1. 1 Duke University Program in Genetics & Genomics, Durham, North Carolina 27708, USA. 2 Center for Genomic & Computational Biology, Duke University School of Medicine, Durham, North Carolina 27708, USA. 3 Division of Endocrinology, Metabolism & Molecular Medicine, NorthwesternUniversityFeinberg School of Medicine, Chicago, Illinois 60611, USA. 4 Sarah W. Stedman Nutrition & Metabolism Center, Duke Molecular Physiology Institute, Duke University School of Medicine, Durham, North Carolina 27710, USA.
    [Show full text]