DOCSLIB.ORG

Gene Expression Profiling of Chromosome 10 in PTEN-Knockout

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Gene Expression Profiling of Chromosome 10 in PTEN-Knockout Gene Reports 21 (2020) 100895 Contents lists available at ScienceDirect Gene Reports journal homepage: www.elsevier.com/locate/genrep Gene expression profiling of chromosome 10 in PTEN-knockout (−/−) T human neural and mesenchymal stem cells: A system biology study ⁎ Hamid Fiujia, ,1, Mohammadreza Nassirib,1 a Department of Biochemistry, Faculty of Science, Payame Noor University of Mashhad (PNUM), Mashhad, Iran b Recombinant Protein Research Group, The Institute of Biotechnology, Ferdowsi University of Mashhad, Mashhad, Iran ARTICLE INFO ABSTRACT Keywords: The present study investigates the effects of PTEN deletion in human neuro and mesenchymal stem cells related PTEN deletion to the chromosome 10 gene expression profile. The RNA sequencing (RNA-seq) performed on four neural and NSCs four mesenchymal stem cells. DEG analysis outcome revealed 122 genes for neural stem cells (57 up-regulated MSCs and 65 down-regulated genes) and 258 genes for mesenchymal stem cells (98 up-regulated and 160 down- RNA sequencing regulated genes) that were deferentially expressed in the PTEN (-/-) group compared to the normal group. Gene Hub genes ontology analysis indicated that in the NSCs upregulated DEGs were significantly enriched in transcriptional Tumor progression activator activity, phosphatidylinositol phosphate phosphatase activity, MAP kinase activity while the down- regulated DEGs were mainly involved in glycolytic process through glucose-6-phosphate, canonical glycolysis, glucose catabolic process to pyruvate. Meanwhile, in MSCs, the upregulated DEGs were mainly enriched in positive regulation of cell migration, chromatin silencing complex, RNA polymerase core enzyme binding while the downregulated DEGs phosphofructokinase activity, focal adhesion, glycolytic process through glucose-6- phosphate. On the basis of the PPI network of the DEGs, the following top hub genes were detected: six hub genes (PTEN, MAPK8, VCL, PAX2, ITGB1 and RET) in neural stem cells and 9 hub genes (PTEN, CDK1, KIF11, VCL, HK1, KIF20B, SIRT1, ACTR1A and ITGB1) appeared in mesenchymal stem cells respectively in each of the top 10 gene lists. In conclusion, PTEN, VCL and ITGB are found to be the main hub genes in both neural and mesenchymal stem cells, which involve in cell cycle, tumor progression and metastasis. 1. Introduction 2013). PTEN or phosphatase and tensin homolog deleted on chromo- some 10 (or MMAC1/TEP1) was introduced as a tumor suppressor lo- One of the subjects of interest is identifying genes on the chromo- cated on human chromosome 10q23 by three independent scientific some. The predicted number of genes varies due to employing different groups in 1997 (Stiles et al., 2004). approaches by the researchers. It is estimated that the gene numbers on It is reported that the numerous sporadic human cancer, such as chromosome 10 to produce protein are almost 700 to 800, playing prostate, breast, endometrial and glioblastoma are associated with de- various roles in the body (Deloukas et al., 2004). letion and mutation in the PTEN gene (Dahia, 2000). Moreover, the Moreover, alteration in chromosome 10 in terms of number or mutation rate in human cancer is similar to that of the P53 gene structure is associated with several types of cancer. The gliomas, for (Stokoe, 2001). instance, known as a brain tumor, is resulted from a loss of all or part of The later investigation indicated that PTEN suppresses the phos- chromosome 10. Regarding the association between the loss of chro- phatidylinositol-3-kinase (PI3K)/AKT signaling pathway, thereby in- mosome 10 and cancerous tumors, it is suggested that genes on this activating cell growth being influenced negatively on the survival sig- chromosome play critical roles in either growth or cell cycle and divi- naling pathway (Stiles et al., 2004; Downes et al., 2007). sion. Lack of these genes has led to unleashed cell division, resulting in PTEN deficiency has been reported in many investigations as reg- cancerous status (Deloukas et al., 2004). As well as gliomas, other ef- ulators of growth, survival, and cell proliferation by preventing the fects of chromosomal abnormalities resulted from gene deletion are PI3K-AKT-mTOR pathway in several cancers such as thyroid or breast accompanied by cellular or intracellular disabilities (Chang et al., cancers and syndrome-like Cowden syndrome (Lee et al., 2018; ⁎ Corresponding author. E-mail address: [email protected] (H. Fiuji). 1 H.F. and M.N. made equal contribution to this study. https://doi.org/10.1016/j.genrep.2020.100895 Received 3 July 2020; Received in revised form 3 September 2020; Accepted 26 September 2020 Available online 08 October 2020 2452-0144/ © 2020 Elsevier Inc. All rights reserved. H. Fiuji and M. Nassiri Gene Reports 21 (2020) 100895 Fig. 1. Differentially expressed (DE) genes between PTEN (−/−) and control groups in human neuro and mesenchymal stem cells represented in the characteristic trumpet shape of MA plots (A) Correlation analysis of gene expression changes between deleted PTEN vs. control samples in NSCs. (B) Correlation analysis of gene expression changes between deleted PTEN vs. control samples in MSCs. The log fold change is plotted on the y-axis and the mean expression of the reads counts is shown on the x-axis. Each point represents a gene at adjusted p value (adjP) ≤ 0.1. Fig. 2. Gene Ontology analysis classified the differentially expressed genes into 3 groups. Molecular function, biological process, and cellular component in Neural stem cells (NSCs). 2 H. Fiuji and M. Nassiri Gene Reports 21 (2020) 100895 Table 1 dephosphorylating of the lipid substrate phosphatidylinositol-3, 4, 5- The top 15 enriched gene ontology terms of up-regulated DEGs and down- triphosphate (PIP3) in the cell (Stiles et al., 2004; Downes et al., 2007). regulated DEGs. (NSCs). A, The top 15 enriched gene ontology terms of the In addition, it is illustrated that the lipid phosphatidylinositol (3,4,5)- upregulated DEGs. B, The top 15 enriched gene ontology terms of the down- triphosphate [PtdIns (3,4,5) P3], which is a direct product of PI3-kinase regulated DEGs. (PI3K), is one of the major substrates of PTEN in both in virto and in A vivo circumstances (Stambolic et al., 1998; Maehama and Dixon, 1998; Myers et al., 1998). Interestingly, PTEN deficiency in embryonic stem Category Term Count P-value (ES) cells and human cancer cell lines results in subsequent accumu- BP Inositol phosphate dephosphorylation 2 0.0001 lation of PtdIns(3,4,5)P3 (Kimura et al., 2003). BP Phosphorylated carbohydrate dephosphorylation 2 0.0001 In the present study, a gene expression profile was downloaded from BP Neuron projection extension involved in neuron 2 0.0002 the NCBI sequence read archive (SRA) database with following ID: SRA projection guidance study: SRP047516; GEO: GSE61794 (Duan et al., 2015). We selected 8 BP Axon extension involved in axon guidance 2 0.0002 BP Inositol phosphate catabolic process 2 0.0002 cases from these data set, including neural and mesenchymal stem cells CC Meiotic cohesin complex 1 0.01 containing null and normal PTEN gene. Both Linux (Ubuntu 19.10) and CC Early endosome 3 0.02 R packages were employed to analyze the differentially expressed genes CC Secondary lysosome 1 0.03 (DEGs); Gene Ontology (GO), Kyoto Encyclopedia of Genes and Gen- CC COPII vesicle coat 1 0.03 omes (KEGG) and Reactome analysis were applied to analyze the CC Axon 2 0.06 MF Transcriptional activator activity, RNA polymerase 2 0.01 functional enrichment and significant pathways associated with the II core promoter proximal region sequence-specific DEGs. In addition, identification of hub genes was performed through binding integrating the DEGs into a protein-protein interaction (PPI) network MF Phosphatidylinositol phosphate phosphatase 3 0.01 for modular analysis. Eventually, this study aimed to investigate the activity MF Monoamine transmembrane transporter activity 1 0.02 knocked out PTEN effects on the different pathways and possible dis- MF Inositol trisphosphate phosphatase activity 1 0.02 orders related to chromosome 10 genes in neural and mesenchymal MF MAP kinase activity 1 0.03 stem cells, which will give us a deeper understanding of PTEN function in the cells. B 2. Method Category Term Count P-value 2.1. RNA-seq read alignment and transcriptome processing BP Glycolytic process through glucose-6-phosphate 3 7.16E-05 BP Canonical glycolysis 3 7.16E-05 2.1.1. Sequence retrieval BP Glucose catabolic process to pyruvate 3 7.16E-05 BP Positive regulation of metanephros development 2 0.0002 The RNA-Seq raw data files containing both neural and mesench- BP Myoblast differentiation 2 0.001 ymal cases were downloaded from NCBI, GEO, and SRA (series ID CC Cytoplasmic vesicle lumen 4 0.0008 GSE61794) (Duan et al., 2015) These datasets included eight samples CC Mitochondrion 10 0.001 containing four human neural stem cells (NSCs) and four mesenchymal CC Focal adhesion 5 0.005 CC Membrane raft 3 0.006 stem cells (MSCs), of them, were control samples where PTEN ex- CC Ficolin-1-rich granule lumen 3 0.007 pressed normally contrasting the remaining samples which PTEN were MF Carboxylic acid binding 2 0.005 knocked out through deletion of their first exon in PTEN gene. MF Actin binding 4 0.009 Heterogeneity of the datasets allowed us to look at the isoform ex- MF Hydro-lyase activity 2 0.009 pression variations across different conditions in NSCs& MSCs. These MF Kinase binding 5 0.01 MF Iron ion binding 2 0.01 data files were submitted on 26-Sep-2014. Downloading the SRA files, they then converted into Fastq files by SRA TOOLKITS assigned in DEG, differentially expressed gene; BP, biological process; CC, cellular com- NCBI. ponent; MF, molecular function. 2.1.2. Quality control Stambolic et al., 1998). PTEN can also dephosphorylate both lipids and FastQC (Andrews, 2016) and Trimmomatic (Bolger et al., 2014) proteins specifically.
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • A Multistep Bioinformatic Approach Detects Putative Regulatory
    BMC Bioinformatics BioMed Central Research article Open Access A multistep bioinformatic approach detects putative regulatory elements in gene promoters Stefania Bortoluzzi1, Alessandro Coppe1, Andrea Bisognin1, Cinzia Pizzi2 and Gian Antonio Danieli*1 Address: 1Department of Biology, University of Padova – Via Bassi 58/B, 35131, Padova, Italy and 2Department of Information Engineering, University of Padova – Via Gradenigo 6/B, 35131, Padova, Italy Email: Stefania Bortoluzzi - [email protected]; Alessandro Coppe - [email protected]; Andrea Bisognin - [email protected]; Cinzia Pizzi - [email protected]; Gian Antonio Danieli* - [email protected] * Corresponding author Published: 18 May 2005 Received: 12 November 2004 Accepted: 18 May 2005 BMC Bioinformatics 2005, 6:121 doi:10.1186/1471-2105-6-121 This article is available from: http://www.biomedcentral.com/1471-2105/6/121 © 2005 Bortoluzzi et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Searching for approximate patterns in large promoter sequences frequently produces an exceedingly high numbers of results. Our aim was to exploit biological knowledge for definition of a sheltered search space and of appropriate search parameters, in order to develop a method for identification of a tractable number of sequence motifs. Results: Novel software (COOP) was developed for extraction of sequence motifs, based on clustering of exact or approximate patterns according to the frequency of their overlapping occurrences.
    [Show full text]
  • Bioinformatics Analyses of Genomic Imprinting
    Bioinformatics Analyses of Genomic Imprinting Dissertation zur Erlangung des Grades des Doktors der Naturwissenschaften der Naturwissenschaftlich-Technischen Fakultät III Chemie, Pharmazie, Bio- und Werkstoffwissenschaften der Universität des Saarlandes von Barbara Hutter Saarbrücken 2009 Tag des Kolloquiums: 08.12.2009 Dekan: Prof. Dr.-Ing. Stefan Diebels Berichterstatter: Prof. Dr. Volkhard Helms Priv.-Doz. Dr. Martina Paulsen Vorsitz: Prof. Dr. Jörn Walter Akad. Mitarbeiter: Dr. Tihamér Geyer Table of contents Summary________________________________________________________________ I Zusammenfassung ________________________________________________________ I Acknowledgements _______________________________________________________II Abbreviations ___________________________________________________________ III Chapter 1 – Introduction __________________________________________________ 1 1.1 Important terms and concepts related to genomic imprinting __________________________ 2 1.2 CpG islands as regulatory elements ______________________________________________ 3 1.3 Differentially methylated regions and imprinting clusters_____________________________ 6 1.4 Reading the imprint __________________________________________________________ 8 1.5 Chromatin marks at imprinted regions___________________________________________ 10 1.6 Roles of repetitive elements ___________________________________________________ 12 1.7 Functional implications of imprinted genes _______________________________________ 14 1.8 Evolution and parental conflict ________________________________________________
    [Show full text]
  • Physical and Linkage Mapping of Mammary-Derived Expressed Sequence Tags in Cattle
    Genomics 83 (2004) 148–152 www.elsevier.com/locate/ygeno Physical and linkage mapping of mammary-derived expressed sequence tags in cattle E.E. Connor,a,* T.S. Sonstegard,a J.W. Keele,b G.L. Bennett,b J.L. Williams,c R. Papworth,c C.P. Van Tassell,a and M.S. Ashwella a U.S. Beltsville Agricultural Research Center, ARS, U.S. Department of Agriculture, 10300 Baltimore Avenue, Beltsville, MD 20705, USA b U.S. Meat Animal Research Center, ARS, U.S. Department of Agriculture, P.O. Box 166, Clay Center, NE 68933-0166, USA c Roslin Institute (Edinburgh), Roslin, Midlothian EH25 9PS, Scotland, United Kingdom Received 2 June 2003; accepted 5 July 2003 Abstract This study describes the physical and linkage mapping of 42 gene-associated markers developed from mammary gland-derived expressed sequence tags to the cattle genome. Of the markers, 25 were placed on the USDA reference linkage map and 37 were positioned on the Roslin 3000-rad radiation hybrid (RH) map, with 20 assignments shared between the maps. Although no novel regions of conserved synteny between the cattle and the human genomes were identified, the coverage was extended for bovine chromosomes 3, 7, 15, and 29 compared with previously published comparative maps between human and bovine genomes. Overall, these data improve the resolution of the human–bovine comparative maps and will assist future efforts to integrate bovine RH and linkage map data. Crown Copyright D 2003 Published by Elsevier Inc. All rights reserved. Keywords: RH mapping; Linkage mapping; SNP; Cattle; EST Selection of positional candidate genes controlling eco- pig [4,5], and cattle [6], and serve as a resource for nomically important traits in cattle requires a detailed candidate gene identification.
    [Show full text]
  • Ck1δ Over-Expressing Mice Display ADHD-Like Behaviors, Frontostriatal Neuronal Abnormalities and Altered Expressions of ADHD-Candidate Genes
    Molecular Psychiatry (2020) 25:3322–3336 https://doi.org/10.1038/s41380-018-0233-z ARTICLE CK1δ over-expressing mice display ADHD-like behaviors, frontostriatal neuronal abnormalities and altered expressions of ADHD-candidate genes 1 1 1 2 1 1 1 Mingming Zhou ● Jodi Gresack ● Jia Cheng ● Kunihiro Uryu ● Lars Brichta ● Paul Greengard ● Marc Flajolet Received: 8 November 2017 / Revised: 4 July 2018 / Accepted: 18 July 2018 / Published online: 19 October 2018 © Springer Nature Limited 2018 Abstract The cognitive mechanisms underlying attention-deficit hyperactivity disorder (ADHD), a highly heritable disorder with an array of candidate genes and unclear genetic architecture, remain poorly understood. We previously demonstrated that mice overexpressing CK1δ (CK1δ OE) in the forebrain show hyperactivity and ADHD-like pharmacological responses to D- amphetamine. Here, we demonstrate that CK1δ OE mice exhibit impaired visual attention and a lack of D-amphetamine- induced place preference, indicating a disruption of the dopamine-dependent reward pathway. We also demonstrate the presence of abnormalities in the frontostriatal circuitry, differences in synaptic ultra-structures by electron microscopy, as 1234567890();,: 1234567890();,: well as electrophysiological perturbations of both glutamatergic and GABAergic transmission, as observed by altered frequency and amplitude of mEPSCs and mIPSCs. Furthermore, gene expression profiling by next-generation sequencing alone, or in combination with bacTRAP technology to study specifically Drd1a versus Drd2 medium spiny neurons, revealed that developmental CK1δ OE alters transcriptional homeostasis in the striatum, including specific alterations in Drd1a versus Drd2 neurons. These results led us to perform a fine molecular characterization of targeted gene networks and pathway analysis. Importantly, a large fraction of 92 genes identified by GWAS studies as associated with ADHD in humans are significantly altered in our mouse model.
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • Pi4k2a (BC022127) Mouse Tagged ORF Clone – MG207674 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MG207674 Pi4k2a (BC022127) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Pi4k2a (BC022127) Mouse Tagged ORF Clone Tag: TurboGFP Symbol: Pi4k2a Synonyms: MGC37783, Pi4k2 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Pi4k2a (BC022127) Mouse Tagged ORF Clone – MG207674 ORF Nucleotide >MG207674 representing BC022127 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACGAGACGAGCCCGCTAGTGTCCCCCGAGCGGGCCCAACCCCCGGAGTACACCTTCCCGTCGGGCT CCGGAGCTCACTTTCCGCAAGTACCGGGGGGCGCGGTCCGCGTGGCGGCGGCGGCCGGCTCCGGCCCGTC ACCGCCGTGCTCGCCCGGCCACGACCGGGAGCGGCAGCCCCTGCTGGACCGGGCCCGGGGCGCGGCGGCG CAGGGCCAGACCCACACGGTGGCGGTGCAGGCCCAGGCCCTGGCCGCCCAGGCGGCCGTGGCGGCGCACG CCGTTCAGACCCACCGCGAGCGGAACGACTTCCCGGAGGACCCCGAGTTCGAGGTGGTGGTGCGGCAGGC CGAGGTTGCCATCGAGTGCAGCATCTATCCCGAGCGCATCTACCAGGGCTCCAGTGGAAGCTACTTCGTC AAGGACTCTCAGGGGAGAATCGTTGCTGTCTTCAAACCCAAGAATGAAGAGCCATATGGGCACCTTAACC CTAAGTGGACCAAGTGGCTGCAGAAGCTATGCTGCCCCTGCTGCTTCGGCCGAGACTGCCTTGTTCTCAA CCAGGGCTATCTCTCAGAGGCAGGGGCTAGCCTGGTGGACCAAAAACTGGAACTCAACATTGTACCACGT
    [Show full text]
  • Mutation Analysis of Genes Within the Dynactin Complex in a Cohort of Hereditary Peripheral Neuropathies
    Clin Genet 2016: 90: 127–133 © 2015 John Wiley & Sons A/S. Printed in Singapore. All rights reserved Published by John Wiley & Sons Ltd CLINICAL GENETICS doi: 10.1111/cge.12712 Original Article Mutation analysis of genes within the dynactin complex in a cohort of hereditary peripheral neuropathies a a Tey S., Ahmad-Annuar A., Drew A.P., Shahrizaila N., Nicholson G.A., S. Tey , A. Ahmad-Annuar , Kennerson M.L. Mutation analysis of genes within the dynactin complex in A.P. Drewb, N. Shahrizailac, , a cohort of hereditary peripheral neuropathies. G.A. Nicholsonb d and Clin Genet 2016: 90: 127–133. © John Wiley & Sons A/S. Published by M.L. Kennersonb,d John Wiley & Sons Ltd, 2015 aDepartment of Biomedical Science, The cytoplasmic dynein–dynactin genes are attractive candidates for Faculty of Medicine, University of Malaya, b neurodegenerative disorders given their functional role in retrograde Kuala Lumpur, Malaysia, Northcott transport along neurons. The cytoplasmic dynein heavy chain (DYNC1H1) Neuroscience Laboratory, ANZAC Research Institute, and Sydney Medical gene has been implicated in various neurodegenerative disorders, and School, University of Sydney, Sydney, dynactin 1 (DCTN1) genes have been implicated in a wide spectrum of Australia, cDepartment of Medicine, disorders including motor neuron disease, Parkinson’s disease, spinobulbar Faculty of Medicine, University of Malaya, muscular atrophy and hereditary spastic paraplegia. However, the Kuala Lumpur, Malaysia, and dMolecular involvement of other dynactin genes with inherited peripheral neuropathies Medicine Laboratory, Concord Hospital, (IPN) namely, hereditary sensory neuropathy, hereditary motor neuropathy Sydney, Australia and Charcot–Marie–Tooth disease is under reported. We screened eight genes; DCTN1-6 and ACTR1A and ACTR1B in 136 IPN patients using Key words: Charcot–Marie–Tooth – whole-exome sequencing and high-resolution melt (HRM) analysis.
    [Show full text]
  • Mouse Models for Hereditary Spastic Paraplegia Uncover a Role Of
    University of Dundee Mouse models for hereditary spastic paraplegia uncover a role of PI4K2A in autophagic lysosome reformation Khundadze, Mukhran; Ribaudo, Federico; Hussain, Adeela; Stahlberg, Henry; Brocke- Ahmadinejad, Nahal; Franzka, Patricia Published in: Autophagy DOI: 10.1080/15548627.2021.1891848 Publication date: 2021 Licence: CC BY Document Version Publisher's PDF, also known as Version of record Link to publication in Discovery Research Portal Citation for published version (APA): Khundadze, M., Ribaudo, F., Hussain, A., Stahlberg, H., Brocke-Ahmadinejad, N., Franzka, P., Varga, R-E., Zarkovic, M., Pungsrinont, T., Kokal, M., Ganley, I. G., Beetz, C., Sylvester, M., & Hübner, C. A. (2021). Mouse models for hereditary spastic paraplegia uncover a role of PI4K2A in autophagic lysosome reformation. Autophagy. https://doi.org/10.1080/15548627.2021.1891848 General rights Copyright and moral rights for the publications made accessible in Discovery Research Portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from Discovery Research Portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain. • You may freely distribute the URL identifying the publication in the public portal. Take down policy If you believe that this document breaches
    [Show full text]
  • ACTR1A (NM 005736) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG200738 ACTR1A (NM_005736) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: ACTR1A (NM_005736) Human Tagged ORF Clone Tag: TurboGFP Symbol: ACTR1A Synonyms: ARP1; Arp1A; CTRN1 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG200738 representing NM_005736 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGTCCTACGATGTGATCGCCAACCAGCCTGTCGTGATCGACAACGGATCCGGTGTGATTAAAGCTG GTTTTGCTGGTGATCAGATCCCCAAATACTGCTTTCCAAACTATGTGGGCCGACCCAAGCACGTTCGTGT CATGGCAGGAGCCCTTGAAGGCGACATCTTCATTGGCCCCAAAGCTGAGGAGCACCGAGGGCTGCTTTCA ATCCGCTATCCCATGGAGCATGGCATCGTCAAGGATTGGAACGACATGGAACGCATTTGGCAATATGTCT ATTCTAAGGACCAGCTGCAGACTTTCTCAGAGGAGCATCCTGTGCTCCTGACTGAGGCGCCTTTAAACCC ACGAAAAAACCGGGAACGAGCTGCCGAAGTTTTCTTCGAGACCTTCAATGTGCCCGCTCTTTTCATCTCC ATGCAAGCTGTACTCAGCCTTTACGCTACAGGCAGGACCACAGGGGTGGTGCTGGATTCTGGGGATGGAG TCACCCATGCTGTGCCCATCTATGAGGGCTTTGCCATGCCCCACTCCATCATGCGCATCGACATCGCGGG CCGGGACGTCTCTCGCTTCCTGCGCCTCTACCTGCGTAAGGAGGGCTACGACTTCCACTCATCCTCTGAG TTTGAGATTGTCAAGGCCATAAAAGAAAGAGCCTGTTACCTATCCATAAACCCCCAAAAGGATGAGACGC TAGAGACAGAGAAAGCTCAGTACTACCTGCCTGATGGCAGCACCATTGAGATTGGTCCTTCCCGATTCCG GGCCCCTGAGTTGCTCTTCAGGCCAGATTTGATTGGAGAGGAGAGTGAAGGCATCCACGAGGTCCTGGTG TTCGCCATTCAGAAGTCAGACATGGACCTGCGGCGCACGCTTTTCTCTAACATTGTCCTCTCAGGAGGCT
    [Show full text]
  • Dynein Activators and Adaptors at a Glance Mara A
    © 2019. Published by The Company of Biologists Ltd | Journal of Cell Science (2019) 132, jcs227132. doi:10.1242/jcs.227132 CELL SCIENCE AT A GLANCE Dynein activators and adaptors at a glance Mara A. Olenick and Erika L. F. Holzbaur* ABSTRACT ribonucleoprotein particles for BICD2, and signaling endosomes for Cytoplasmic dynein-1 (hereafter dynein) is an essential cellular motor Hook1. In this Cell Science at a Glance article and accompanying that drives the movement of diverse cargos along the microtubule poster, we highlight the conserved structural features found in dynein cytoskeleton, including organelles, vesicles and RNAs. A long- activators, the effects of these activators on biophysical parameters, standing question is how a single form of dynein can be adapted to a such as motor velocity and stall force, and the specific intracellular wide range of cellular functions in both interphase and mitosis. functions they mediate. – Recent progress has provided new insights dynein interacts with a KEY WORDS: BICD2, Cytoplasmic dynein, Dynactin, Hook1, group of activating adaptors that provide cargo-specific and/or Microtubule motors, Trafficking function-specific regulation of the motor complex. Activating adaptors such as BICD2 and Hook1 enhance the stability of the Introduction complex that dynein forms with its required activator dynactin, leading Microtubule-based transport is vital to cellular development and to highly processive motility toward the microtubule minus end. survival. Microtubules provide a polarized highway to facilitate Furthermore, activating adaptors mediate specific interactions of the active transport by the molecular motors dynein and kinesin. While motor complex with cargos such as Rab6-positive vesicles or many types of kinesins drive transport toward microtubule plus- ends, there is only one major form of dynein, cytoplasmic dynein-1, University of Pennsylvania Perelman School of Medicine, Philadelphia, PA 19104, which drives the trafficking of a wide array of minus-end-directed USA.
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]