Global Phosphoproteomic Profiling Reveals Perturbed Signaling in a Mouse Model of Dilated Cardiomyopathy
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												  Activated Peripheral-Blood-Derived Mononuclear CellsTranscription factor expression in lipopolysaccharide- activated peripheral-blood-derived mononuclear cells Jared C. Roach*†, Kelly D. Smith*‡, Katie L. Strobe*, Stephanie M. Nissen*, Christian D. Haudenschild§, Daixing Zhou§, Thomas J. Vasicek¶, G. A. Heldʈ, Gustavo A. Stolovitzkyʈ, Leroy E. Hood*†, and Alan Aderem* *Institute for Systems Biology, 1441 North 34th Street, Seattle, WA 98103; ‡Department of Pathology, University of Washington, Seattle, WA 98195; §Illumina, 25861 Industrial Boulevard, Hayward, CA 94545; ¶Medtronic, 710 Medtronic Parkway, Minneapolis, MN 55432; and ʈIBM Computational Biology Center, P.O. Box 218, Yorktown Heights, NY 10598 Contributed by Leroy E. Hood, August 21, 2007 (sent for review January 7, 2007) Transcription factors play a key role in integrating and modulating system. In this model system, we activated peripheral-blood-derived biological information. In this study, we comprehensively measured mononuclear cells, which can be loosely termed ‘‘macrophages,’’ the changing abundances of mRNAs over a time course of activation with lipopolysaccharide (LPS). We focused on the precise mea- of human peripheral-blood-derived mononuclear cells (‘‘macro- surement of mRNA concentrations. There is currently no high- phages’’) with lipopolysaccharide. Global and dynamic analysis of throughput technology that can precisely and sensitively measure all transcription factors in response to a physiological stimulus has yet to mRNAs in a system, although such technologies are likely to be be achieved in a human system, and our efforts significantly available in the near future. To demonstrate the potential utility of advanced this goal. We used multiple global high-throughput tech- such technologies, and to motivate their development and encour- nologies for measuring mRNA levels, including massively parallel age their use, we produced data from a combination of two distinct signature sequencing and GeneChip microarrays.
- 
												  A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes MellitusPage 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
- 
												  TERT Promoter Mutations Occur Frequently in Gliomas and a Subset of Tumors Derived from Cells with Low Rates of Self-RenewalTERT promoter mutations occur frequently in gliomas and a subset of tumors derived from cells with low rates of self-renewal Patrick J. Killelaa,1, Zachary J. Reitmana,1, Yuchen Jiaob,1, Chetan Bettegowdab,c,1, Nishant Agrawalb,d, Luis A. Diaz, Jr.b, Allan H. Friedmana, Henry Friedmana, Gary L. Galliac,d, Beppino C. Giovanellae, Arthur P. Grollmanf, Tong-Chuan Heg, Yiping Hea, Ralph H. Hrubanh, George I. Jalloc, Nils Mandahli, Alan K. Meekerh,m, Fredrik Mertensi, George J. Nettoh,l, B. Ahmed Rasheeda, Gregory J. Rigginsc, Thomas A. Rosenquistf, Mark Schiffmanj, Ie-Ming Shihh, Dan Theodorescuk, Michael S. Torbensonh, Victor E. Velculescub, Tian-Li Wangh, Nicolas Wentzensenj, Laura D. Woodh, Ming Zhangb, Roger E. McLendona, Darell D. Bignera, Kenneth W. Kinzlerb, Bert Vogelsteinb,2, Nickolas Papadopoulosb, and Hai Yana,2 aThe Preston Robert Tisch Brain Tumor Center at Duke, Pediatric Brain Tumor Foundation Institute at Duke, and Department of Pathology, Duke University Medical Center, Durham, NC 27710; bLudwig Center for Cancer Genetics and Howard Hughes Medical Institutions, Johns Hopkins Kimmel Cancer Center, Johns Hopkins Medical Institutions, Baltimore, MD 21231; Departments of cNeurosurgery, dOtolaryngology—Head and Neck Surgery, hPathology, lUrology, and mOncology, Johns Hopkins University School of Medicine, Baltimore, MD 21231; eChristus Stehlin Foundation for Cancer Research, Houston, TX 77025; fDepartment of Pharmacological Sciences, Stony Brook University, Stony Brook, NY 11794; gMolecular Oncology Laboratory, Department of Orthopaedic
- 
												  Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel Kwww.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
- 
												  Ten Commandments for a Good ScientistUnravelling the mechanism of differential biological responses induced by food-borne xeno- and phyto-estrogenic compounds Ana María Sotoca Covaleda Wageningen 2010 Thesis committee Thesis supervisors Prof. dr. ir. Ivonne M.C.M. Rietjens Professor of Toxicology Wageningen University Prof. dr. Albertinka J. Murk Personal chair at the sub-department of Toxicology Wageningen University Thesis co-supervisor Dr. ir. Jacques J.M. Vervoort Associate professor at the Laboratory of Biochemistry Wageningen University Other members Prof. dr. Michael R. Muller, Wageningen University Prof. dr. ir. Huub F.J. Savelkoul, Wageningen University Prof. dr. Everardus J. van Zoelen, Radboud University Nijmegen Dr. ir. Toine F.H. Bovee, RIKILT, Wageningen This research was conducted under the auspices of the Graduate School VLAG Unravelling the mechanism of differential biological responses induced by food-borne xeno- and phyto-estrogenic compounds Ana María Sotoca Covaleda Thesis submitted in fulfillment of the requirements for the degree of doctor at Wageningen University by the authority of the Rector Magnificus Prof. dr. M.J. Kropff, in the presence of the Thesis Committee appointed by the Academic Board to be defended in public on Tuesday 14 September 2010 at 4 p.m. in the Aula Unravelling the mechanism of differential biological responses induced by food-borne xeno- and phyto-estrogenic compounds. Ana María Sotoca Covaleda Thesis Wageningen University, Wageningen, The Netherlands, 2010, With references, and with summary in Dutch. ISBN: 978-90-8585-707-5 “Caminante no hay camino, se hace camino al andar. Al andar se hace camino, y al volver la vista atrás se ve la senda que nunca se ha de volver a pisar” - Antonio Machado – A mi madre.
- 
												  WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT (51) International Patent Classification: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, C12Q 1/68 (2018.01) A61P 31/18 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, C12Q 1/70 (2006.01) HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/US2018/056167 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (22) International Filing Date: SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 16 October 2018 (16. 10.2018) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, (30) Priority Data: UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 62/573,025 16 October 2017 (16. 10.2017) US TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, ΓΕ , IS, IT, LT, LU, LV, (71) Applicant: MASSACHUSETTS INSTITUTE OF MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TECHNOLOGY [US/US]; 77 Massachusetts Avenue, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, Cambridge, Massachusetts 02139 (US).
- 
												  Genome-Scale Identification of Transcription Factors That Mediate AnARTICLE DOI: 10.1038/s41467-018-04406-2 OPEN Genome-scale identification of transcription factors that mediate an inflammatory network during breast cellular transformation Zhe Ji 1,2,4, Lizhi He1, Asaf Rotem1,2,5, Andreas Janzer1,6, Christine S. Cheng2,7, Aviv Regev2,3 & Kevin Struhl 1 Transient activation of Src oncoprotein in non-transformed, breast epithelial cells can initiate an epigenetic switch to the stably transformed state via a positive feedback loop that involves 1234567890():,; the inflammatory transcription factors STAT3 and NF-κB. Here, we develop an experimental and computational pipeline that includes 1) a Bayesian network model (AccessTF) that accurately predicts protein-bound DNA sequence motifs based on chromatin accessibility, and 2) a scoring system (TFScore) that rank-orders transcription factors as candidates for being important for a biological process. Genetic experiments validate TFScore and suggest that more than 40 transcription factors contribute to the oncogenic state in this model. Interestingly, individual depletion of several of these factors results in similar transcriptional profiles, indicating that a complex and interconnected transcriptional network promotes a stable oncogenic state. The combined experimental and computational pipeline represents a general approach to comprehensively identify transcriptional regulators important for a biological process. 1 Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, MA 02115, USA. 2 Broad Institute of MIT and Harvard, Cambridge, MA 02142, USA. 3 Department of Biology, Howard Hughes Medical Institute and David H. Koch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, MA 20140, USA. 4Present address: Department of Pharmacology and Biomedical Engineering, Northwestern University, Evanston 60611 IL, USA.
- 
												  MBT1 to Promote Repression of Notch Signaling Via Histone Demethylase1 RBPJ/CBF1 interacts with L3MBTL3/MBT1 to promote repression 2 of Notch signaling via histone demethylase KDM1A/LSD1 3 Tao Xu1,†, Sung-Soo Park1,†, Benedetto Daniele Giaimo2,†, Daniel Hall3, Francesca Ferrante2, 4 Diana M. Ho4, Kazuya Hori4, Lucas Anhezini5,6, Iris Ertl7,8, Marek Bartkuhn9, Honglai Zhang1, 5 Eléna Milon1, Kimberly Ha1, Kevin P. Conlon1, Rork Kuick10, Brandon Govindarajoo11, Yang 6 Zhang11, Yuqing Sun1, Yali Dou1, Venkatesha Basrur1, Kojo S. J. Elenitoba-Johnson1, Alexey I. 7 Nesvizhskii1,11, Julian Ceron7, Cheng-Yu Lee5, Tilman Borggrefe2, Rhett A. Kovall3 & Jean- 8 François Rual1,* 9 1Department of Pathology, University of Michigan Medical School, Ann Arbor, MI 48109, USA; 10 2Institute of Biochemistry, University of Giessen, Friedrichstrasse 24, 35392, Giessen, Germany; 11 3Department of Molecular Genetics, Biochemistry and Microbiology, University of Cincinnati 12 College of Medicine, Cincinnati, OH 45267, USA; 13 4Department of Cell Biology, Harvard Medical School, Boston, MA 02115, USA; 14 5Life Sciences Institute, University of Michigan, Ann Arbor, MI 48109, USA; 15 6Current address: Instituto de Ciências Biológicas e Naturais, Universidade Federal do 16 Triângulo Mineiro, Uberaba, MG 38025-180, Brasil; 17 7Cancer and Human Molecular Genetics, Bellvitge Biomedical Research Institute, L’Hospitalet 18 de Llobregat, Barcelona, Spain; 19 8Current address: Department of Urology, Medical University of Vienna, Währiger Gürtel 18-20, 20 Vienna, Austria; 21 9Institute for Genetics, University of Giessen, Heinrich-Buff-Ring 58, 35390, Giessen, Germany; 22 10Center for Cancer Biostatistics, School of Public Health, University of Michigan, Ann Arbor, MI 23 48109, USA; 24 11Department of Computational Medicine & Bioinformatics, University of Michigan, Ann Arbor, 25 MI 48108, USA; 26 †These authors contributed equally to this work; 27 *Correspondence and requests for materials should be addressed to J.F.R.
- 
												  Pi4k2a (BC022127) Mouse Tagged ORF Clone – MG207674 | OrigeneOriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MG207674 Pi4k2a (BC022127) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Pi4k2a (BC022127) Mouse Tagged ORF Clone Tag: TurboGFP Symbol: Pi4k2a Synonyms: MGC37783, Pi4k2 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 Pi4k2a (BC022127) Mouse Tagged ORF Clone – MG207674 ORF Nucleotide >MG207674 representing BC022127 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACGAGACGAGCCCGCTAGTGTCCCCCGAGCGGGCCCAACCCCCGGAGTACACCTTCCCGTCGGGCT CCGGAGCTCACTTTCCGCAAGTACCGGGGGGCGCGGTCCGCGTGGCGGCGGCGGCCGGCTCCGGCCCGTC ACCGCCGTGCTCGCCCGGCCACGACCGGGAGCGGCAGCCCCTGCTGGACCGGGCCCGGGGCGCGGCGGCG CAGGGCCAGACCCACACGGTGGCGGTGCAGGCCCAGGCCCTGGCCGCCCAGGCGGCCGTGGCGGCGCACG CCGTTCAGACCCACCGCGAGCGGAACGACTTCCCGGAGGACCCCGAGTTCGAGGTGGTGGTGCGGCAGGC CGAGGTTGCCATCGAGTGCAGCATCTATCCCGAGCGCATCTACCAGGGCTCCAGTGGAAGCTACTTCGTC AAGGACTCTCAGGGGAGAATCGTTGCTGTCTTCAAACCCAAGAATGAAGAGCCATATGGGCACCTTAACC CTAAGTGGACCAAGTGGCTGCAGAAGCTATGCTGCCCCTGCTGCTTCGGCCGAGACTGCCTTGTTCTCAA CCAGGGCTATCTCTCAGAGGCAGGGGCTAGCCTGGTGGACCAAAAACTGGAACTCAACATTGTACCACGT
- 
												  SUPPLEMENTARY NOTE Co-Activation of GR and NFKBSUPPLEMENTARY NOTE Co-activation of GR and NFKB alters the repertoire of their binding sites and target genes. Nagesha A.S. Rao1*, Melysia T. McCalman1,*, Panagiotis Moulos2,4, Kees-Jan Francoijs1, 2 2 3 3,5 Aristotelis Chatziioannou , Fragiskos N. Kolisis , Michael N. Alexis , Dimitra J. Mitsiou and 1,5 Hendrik G. Stunnenberg 1Department of Molecular Biology, Radboud University Nijmegen, the Netherlands 2Metabolic Engineering and Bioinformatics Group, Institute of Biological Research and Biotechnology, National Hellenic Research Foundation, Athens, Greece 3Molecular Endocrinology Programme, Institute of Biological Research and Biotechnology, National Hellenic Research Foundation, Greece 4These authors contributed equally to this work 5 Corresponding authors E-MAIL: [email protected] ; TEL: +31-24-3610524; FAX: +31-24-3610520 E-MAIL: [email protected] ; TEL: +30-210-7273741; FAX: +30-210-7273677 Running title: Global GR and NFKB crosstalk Keywords: GR, p65, genome-wide, binding sites, crosstalk SUPPLEMENTARY FIGURES/FIGURE LEGENDS AND SUPPLEMENTARY TABLES 1 Rao118042_Supplementary Fig. 1 A Primary transcript Mature mRNA TNF/DMSO TNF/DMSO 8 12 r=0.74, p< 0.001 r=0.61, p< 0.001 ) 2 ) 10 2 6 8 4 6 4 2 2 0 Fold change (mRNA) (log Fold change (primRNA) (log 0 −2 −2 −2 0 2 4 −2 0 2 4 Fold change (RNAPII) (log2) Fold change (RNAPII) (log2) B chr5: chrX: 56 _ 104 _ DMSO DMSO 1 _ 1 _ 56 _ 104 _ TA TA 1 _ 1 _ 56 _ 104 _ TNF TNF Cluster 1 1 _ Cluster 2 1 _ 56 _ 104 _ TA+TNF TA+TNF 1 _ 1 _ CCNB1 TSC22D3 chr20: chr17: 25 _ 33 _ DMSO DMSO 1 _ 1 _ 25 _ 33 _ TA TA 1 _ 1 _ 25 _ 33 _ TNF TNF Cluster 3 1 _ Cluster 4 1 _ 25 _ 33 _ TA+TNF TA+TNF 1 _ 1 _ GPCPD1 CCL2 chr6: chr22: 77 _ 35 _ DMSO DMSO 1 _ 77 _ 1 _ 35 _ TA TA 1 _ 1 _ 77 _ 35 _ TNF Cluster 5 Cluster 6 TNF 1 _ 1 _ 77 _ 35 _ TA+TNF TA+TNF 1 _ 1 _ TNFAIP3 DGCR6 2 Supplementary Figure 1.
- 
												  Mouse Models for Hereditary Spastic Paraplegia Uncover a Role OfUniversity of Dundee Mouse models for hereditary spastic paraplegia uncover a role of PI4K2A in autophagic lysosome reformation Khundadze, Mukhran; Ribaudo, Federico; Hussain, Adeela; Stahlberg, Henry; Brocke- Ahmadinejad, Nahal; Franzka, Patricia Published in: Autophagy DOI: 10.1080/15548627.2021.1891848 Publication date: 2021 Licence: CC BY Document Version Publisher's PDF, also known as Version of record Link to publication in Discovery Research Portal Citation for published version (APA): Khundadze, M., Ribaudo, F., Hussain, A., Stahlberg, H., Brocke-Ahmadinejad, N., Franzka, P., Varga, R-E., Zarkovic, M., Pungsrinont, T., Kokal, M., Ganley, I. G., Beetz, C., Sylvester, M., & Hübner, C. A. (2021). Mouse models for hereditary spastic paraplegia uncover a role of PI4K2A in autophagic lysosome reformation. Autophagy. https://doi.org/10.1080/15548627.2021.1891848 General rights Copyright and moral rights for the publications made accessible in Discovery Research Portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from Discovery Research Portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain. • You may freely distribute the URL identifying the publication in the public portal. Take down policy If you believe that this document breaches
- 
												  Notch Signaling in Breast Cancer: a Role in Drug Resistancecells Review Notch Signaling in Breast Cancer: A Role in Drug Resistance McKenna BeLow 1 and Clodia Osipo 1,2,3,* 1 Integrated Cell Biology Program, Loyola University Chicago, Maywood, IL 60513, USA; [email protected] 2 Department of Cancer Biology, Loyola University Chicago, Maywood, IL 60513, USA 3 Department of Microbiology and Immunology, Loyola University Chicago, Maywood, IL 60513, USA * Correspondence: [email protected]; Tel.: +1-708-327-2372 Received: 12 September 2020; Accepted: 28 September 2020; Published: 29 September 2020 Abstract: Breast cancer is a heterogeneous disease that can be subdivided into unique molecular subtypes based on protein expression of the Estrogen Receptor, Progesterone Receptor, and/or the Human Epidermal Growth Factor Receptor 2. Therapeutic approaches are designed to inhibit these overexpressed receptors either by endocrine therapy, targeted therapies, or combinations with cytotoxic chemotherapy. However, a significant percentage of breast cancers are inherently resistant or acquire resistance to therapies, and mechanisms that promote resistance remain poorly understood. Notch signaling is an evolutionarily conserved signaling pathway that regulates cell fate, including survival and self-renewal of stem cells, proliferation, or differentiation. Deregulation of Notch signaling promotes resistance to targeted or cytotoxic therapies by enriching of a small population of resistant cells, referred to as breast cancer stem cells, within the bulk tumor; enhancing stem-like features during the process of de-differentiation of tumor cells; or promoting epithelial to mesenchymal transition. Preclinical studies have shown that targeting the Notch pathway can prevent or reverse resistance through reduction or elimination of breast cancer stem cells. However, Notch inhibitors have yet to be clinically approved for the treatment of breast cancer, mainly due to dose-limiting gastrointestinal toxicity.