Chelon Labrosus) from the Basque Coast (Bay of Biscay) Applying a Biomarker Based Approach

Hazards of the Endocrine Disruptors on Mullets (Chelon labrosus) from the Basque Coast (Bay of Biscay) Applying a Biomarker Based Approach

Iman Abumourad1,2*, Cristina Bizarro1, Pedro Aragón3, Ángel Maquieira3, Asier Vallejo4, Olatz Zuloaga4, Miren López de Alda5, Bayona Josep5, Damia Barceló5, Miren Cagaraville1 and Maren Ortiz-Zarragoitia1

1 CBET Research Group, UPV/EHU, Basque Country, Spain 2 Deparment of Hydrobiology, Veterinary Division, National Research Center, Cairo, Egypt 3 IRMDT, UPV, Valencia, Spain 4 Kimika Analitikoa Saila, UPV/EHU, Basque Country, Spain 5 Deparment of Environmental Chemistry, IIQABCSIC, Barcelona, Catalunya, Spain

Received April 14, 2014; accepted July 31, 2014

Summary Biomonitoring programs are essential tools to evaluate the biological quality status of aquatic environments. Recently, several compounds with endocrine disruption ability have been included in the list of priority substances and therefore, implementation of biomarkers assessing the presence and the effects of such substances are required. In the present work we applied a battery of chemical and biological markers in order to study the effects of endocrine disruptors in four thicklip grey mullet (Chelon labrosus) populations from the Basque Country (Bay of Biscay) inhabiting differently polluted estuaries: Arriluze and Pasaia are marinas located in highly industrialized and densely populated areas, Plentzia is a leisure and touristic town and Gernika is located in the Biosphere Reserve of Urdaibai. Chemical analyses of ﬁsh bile were performed in order to determine the uptake of endocrine disruptors. Liver, gonad and brain samples were collected for the study of expression levels of genes associated with reproduction and development such as vtg, cyp19a1 and a2, er and rxr. Histological analysis of gonads was performed to identify possible gametogenic alterations such as intersex gonads. Results indicated clear pollution-dependent responses among four estuaries. Endocrine disruption effects were very marked in mullets from Gernika and Plentzia; these two populations showed high vtg gene expression levels in male mullets together with high alkylphenol metabolites in the bile. Bisphenol A was also present at high concentration in mullets from Gernika. cyp19a2 was upregulated in male mullets from Plentzia. Intersex ﬁsh were found in Gernika and Pasaia, the last ones showing high hormone metabolites in bile. The combination of chemical and biomarker approaches in biomonitoring programmes can be a valuable tool to be implemented within the framework of the new water policies.

Key words Water pollution, Endocrine disruptor, Intersex gonad, Vitellogenin, Expression of aromatase and nuclear receptors, Thicklip grey mullet, Chelon labrosus.

Many different environmental chemicals have the potential to disrupt critical hormone- regulated processes of reproduction and development because the chemical has structural similarities to hormones such as steroids; as a result the endocrine disruptors bind to a hormone receptor or to an enzyme that catalyzes hormone synthesis or degradation and disrupt its function (Atanasov et al. 2005, Baker 2001), even if they existed at low concentrations and transient exposures (Phillips and Harrison 1999). Endocrine disrupting chemicals (EDCs) have been deﬁned

* Corresponding author, e-mail: [email protected] DOI: 10.1508/cytologia.79.517 518 I. M. K. Abumourad et al. Cytologia 79(4) early in 1996 by the European Community as “an exogenous substance or mixture that alters function(s) of the endocrine system” and consequently cause adverse effects in an intact organism or its progeny or subpopulations (Baker et al. 2009). EDCs have been linked to a range of effects on reproductive health in humans (Phillips and Harrison 1999) and in animals in the natural environment (Crisp et al. 1998, Phillips and Harrison 1999, McLachlan 2001), and in fishes (Oleksiak 2008). Pollutants are discharged into rivers, lakes and the ocean, where they accumulate in aquatic species. Humans and wildlife are exposed to these compounds directly and through fish and shellfish consumption. In addition, humans are exposed to endocrine disruptors via polluted drinking water. Pollutants are most often present as complex mixtures, with additive, synergistic or antagonistic properties. Neither correlational nor experimental approaches address the ultimate biological consequences of multigenerational exposures for populations of animals living long term in polluted environments, and only rarely have physiological or genetic adaptations that affect reproductive success of these populations been investigated. Xenoestrogens and their degradation products comprise a broad range of widely used and structurally diverse chemicals (Sharpe et al. 1995, Gozzo and Poupaert 1998, Oettel 2002, Yu et al. 2002), and include organochlorine pesticides, fungicides, insecticides, polychlorinated biphenyls (PCBs), detergent derivatives like alkylphenols, plasticizers like phthalates, polycyclic aromatic hydrocarbons (PAHs), polychlorinated dibenzodioxins (PCDDs), surfactants, industrial chemicals, and some natural chemicals such as phytoestrogens and mycoestrogens (Sultan et al. 2001, Starek 2003). At least 45 chemicals or their metabolites have been identified as endocrine disrupters (Colborn et al. 1993). These chemicals share a common mode of action by activating the estrogen receptor (ER) and thereby elicit estrogenic responses (Witorsch 2002). Estrogenic compounds (xenoestrogens) constitute a particular group of EDCs with the ability to mimic natural estrogen (Goksøyr et al. 2003), and also may cause malformation of reproductive organs (Berg et al. 1999), impaired sexual behavior (Halldin et al. 1999), and changes in sexually dimorphic neural circuits (Panzica et al. 2002). One of the most important and sensitive responses to estrogen is the induction of vitellogenin, protein transcription and translation. This makes testing for vitellogenin useful as an indicator of estrogenic activity over a wide range of vertebrate groups (Palmer and Palmer 1995). Vitellogenin (VTG) is a bulky, complex phospholipoglycoprotein bound to calcium, produced by hepatocytes in the liver of females in response to estrogen, secreted in blood and transported to ovaries to form the yolk protein that serves as nutrient to growing oocytes. The estrogen response will be elicited if an estrogenic compound binds to and activates or inhibits the estrogen receptors in hepatocytes. Males normally have no detectable production of vitellogenin due to their normally low levels of endogenous estrogens (Wang et al. 1985, LeGuellec et al. 1988). However, their liver is capable of synthesizing and secreting vitellogenin into the blood in response to exogenous estrogen stimulation (Morales et al. 1991). The response is not as rapid or as strong as in females that are exposed to the same concentrations of estrogen (Danko and Callard 1981). However, since males normally have no vitellogenin, the expression of any vitellogenin serves as an ideal biomarker for xenobiotic estrogenic stimulation. Vitellogenin expression has been used successfully for identification of exposure to environmental estrogens in fish, including wild populations (Goodwin et al. 1992, Purdon et al. 1994), and under laboratory (Chen et al. 1986) and in vitro conditions (Jobling and Sumpter 1993). Xenoestrogens may elicit these effects by direct binding to estrogen receptors (ERs) which regulate VTG synthesis by binding estrogen, or through other nuclear receptors which interact with estrogen response elements (EREs), or the retionoid X receptor (RXR), which has an important role in the regulation of metabolism and development (Arukwe and Goksøyr 2003). Legislation has been implemented world-wide to protect and restore ecological quality in estuarine, coastal and marine systems, for instance Oceans Act in the USA, Australia or Canada, 2014 Hazards of the Endocrine Disruptors on Mullets (Chelon labrosus) 519 the Water Framework Directive (WFD, 2000/60/EC) and Marine Strategy Framework Directive (MSFD, 2008/56/EC) in Europe, and the National Water Act in South Africa (Borja et al. 2008). Since the publication of the MSFD in June 2008 by the European Parliament and Council. Monitoring the quality of marine ecosystems has become an urgent priority. The MSFD states that by 2015 at the latest, “a programme of measures has to be designed to achieve or maintain good environmental status.” This good status should be achieved in 2020 (European Commission 2010). In this context, it is important to measure the concentrations of various pollutants in the marine environment, but it is even more important to describe the possible impact these pollutants may have on the organisms living in the ecosystem. Recently, several compounds with endocrine disruption ability have been included in the list of priority substances of the EU, and therefore, implementation of biomarkers assessing the presence and the effects of such substances is required. The fish species selected for this study is the thicklip grey mullet Chelon labrosus belonging to the family Mugilidae. Mullets are appropriate sentinel species since they can inhabit highly polluted environments and feed on suspended particles and small organisms but also sedimented detritus. It is a euryhaline bottom dweller, inhabiting rivers, estuarine and coastal waters and an abundant species in eastern Atlantic estuaries. It is an omnivorous scavenger and able to endure highly polluted environments, displaying several of the characteristics required for estuarine sentinel species (Ferreira et al. 2004). Thicklip grey mullet first mature at two years and 20 cm of total length (TL) in males and at three years and 23 cm of TL in females (Sostoa 1983). Mugilids present amphidromic life cycles with significant migrations into the estuaries and coastal lagoons (Granado-Lorencio 1996). Mugilidae are considered gonochoristic but are capable of exhibiting nonfunctional hermaphroditic characteristics in differentiated mature gonads (McDonough et al. 2005). Recent works have reported the presence of hermaphroditic or intersex mugilids in polluted estuaries of Portugal, Korea and Japan (Aoki et al. 2010, Ferreira et al. 2002, 2004), and male mugilids with high concentrations of plasma VTG in polluted estuarine and coastal areas of Japan and Korea (Aoki et al. 2010). In the present work, a battery of selected molecular, chemical and tissue level biomarkers were studied. Histological examination of gonads was performed in order to detect possible intersex gonads or other gamete alterations. Plasma VTG and vtga mRNA levels were determined as biomarkers of estrogenicity. The mRNA levels of genes related to sexual determination and differentiation in fish such as cyp19a1 and cyp19a2 aromatase and nuclear receptors erα and rxrα were also determined by quantitative real time polymerase chain reaction (qPCR).

Materials and methods

Description of the study area The estuary of Urdaibai (43°23′N–2°41′W), UNESCO Biosphere Reserve, is located on the Basque coast, in the Bay of Biscay on the northern Iberian Peninsula. The estuary is 13 km long and has an average width of 500 m. The main human activity in the area is agriculture. Nevertheless, a variety of industries can be found, such as metallurgy, shipyards, surface treatment, and dye and cutlery production, mainly in the surroundings of the main town in the area, Gernika-Lumo. In general, the estuary presents scarce maritime trafﬁc. Four different populations from the Basque coast (Southeast Bay of Biscay) were sampled between May 25th and June 10th, 2010. Arriluze: Located in the mouth of Nerbioi river is a leisure port within the area of the commercial port of Bilbao. Historically highly polluted place. Plentzia: A leisure and tourist town in the mouth of Butroi river. Low to medium pollution levels. Gernika: Placed within the Biosphere Reserve of Urdaibai, one of the best preserved areas in the Basque Country. Pasaia: Commercial port area, considered as highly polluted. (Tueros et al. 2009). The Abra estuary (43°23′N–3°W) is also located on the Basque Coast, in the mouth of the Nerbioi river. 520 I. M. K. Abumourad et al. Cytologia 79(4)

Fig. 1. Map showing sampling sites for mullets.

It is 15 km long. Several studies showed that the Abra estuary contains more organic xenobiotics and heavy metals than Urdaibai (Orbea et al. 2002, Belzunce et al. 2004, Cearreta et al. 2004) as a consequence of the heavy industrial pressure suffered over the past 150 years and the intense maritime trafﬁc in the Abra estuary.

Sample collection At each site 22 to 30 thicklip grey mullets (C. labrosus) were collected by fishing rod. Fish were anaesthetised by immersion in a saturated solution of aminobenzocaine. From each animal, the liver, brain, gonad, blood and bile were collected for histological, molecular and chemical analyses (Puy-Azurmendi et al. in press, Vallejo et al. 2010). Sediments from each sampling point were also sampled for the determination of endocrine disruptor compounds (Puy-Azurmendi et al. 2010). The brain, liver and gonad from each fish were dissected out. One piece of liver and gonad were fixed in 10% neutral buffered formalin containing 1% glutaraldehyde solution for histological examination and stored at 4°C. A further piece of each organ was placed in RNA-later and then frozen in liquid nitrogen for transcription level analysis. Fish bile was taken and frozen in liquid nitrogen for chemical analysis. Samples were then transported to the laboratory and all frozen samples were stored at -80°C until processing.

Chemical analysis of EDs in sediments Sediment samples were extracted by ultrasonication with methanol–acetone (1 : 1) for estrogenic hormones, with dichloromethane–methanol (7 : 3, v/v) for APs, BPA and phthalates, and with toluene–acetic acid (10 : 4) for OTs. The extracts were puriﬁed and then analysed by liquid chromatography-tandem mass spectrometry (LC-MS/MS) for estrogenic hormones (Rodríguez- Mozaz et al. 2004), APs, BPA and phthalates (Petrovic et al. 2003), and by gas chromatography- mass spectrometry (GC-MS) for OTs using the standard reference material PACS-2 (NRCC, Canada).

Chemical analysis of APs in fish bile Bile samples were hydrolysed by a modification of the method described by Escartín and Porte (1999). Briefly, 100 μL of bile was incubated for 1 h at 40°C in the presence of 1 mL 0.4 M acetic acid/sodium acetate buffer pH 5.0, containing 2000 units of β-glucuronidase and 50 U of 2014 Hazards of the Endocrine Disruptors on Mullets (Chelon labrosus) 521 sulphatase. Hydrolysed metabolites were extracted with 1 mL of ethyl acetate (×3), and the extracts recombined and reduced under a nitrogen stream. Dry residues of bile metabolites were derivatised by the addition of 100 mL of bis(trimethylsilyl)trifluoroacetamide, heated for 1 h at 70°C, reduced under a nitrogen stream and analysed by gas chromatography-mass spectrometry electron impact mode. The equipment was a Fisons GC 8000 Series chromatograph interfaced to a Fisons MD800 mass spectrometer. The column, a 30 m×0.25 mm i.d. HP-5MS cross-linked 5% PH ME siloxane (Hewlett-Packard, USA), was programmed from 90 to 140 at 10°C/min and from 140 to 300 at 4°C/min. The carrier gas was helium at 80 kPa. The injector temperature was 250°C and the ion source and the analyser were maintained at 200°C and 250°C, respectively. Just prior to sample analysis, calibration curves were performed with reference compounds and operated in selected ion monitoring mode. Octyl- and nonylphenol were identified by comparison of retention times and spectra of reference compounds; 4-nonylphenol was reported as the sum of 10 to 11 isomers. The silylation derivative ions used for monitoring nonylphenol (NP) were: m/z 207 and 193; and m/z 207 for 4-tert-octylphenol (OP). Concentrations are expressed as ng/g of bile.

Histology and assessment of gamete development After ﬁxation in 10% neutral buffered formalin containing 1% glutaraldehyde for 1 d, samples of gonad for histological studies were dehydrated in a graded ethanol series and embedded in resin (Technovit 7100, Wehrheim, Germany) following the manufacturer’s instructions. Then, sections of 5-μm thickness were obtained in a Jung Supercut 2065 microtome (Leica Microsystems, Nussloch, Germany). Tissue sections were stained with hematoxylin/eosin (Gamble and Wilson 2002) and mounted with DPX. The slides were examined under a Leitz Laborlux S light microscope (Ernest Leitz GmbH, Wetzlar, Germany). Five gonad reproductive stages were distinguished according to criteria used by McDonough et al. (2005): 1=immature; 2=developing; 3=running or mature; 4=atretic or spent; and 5=inactive or resting.

Determination of plasma VTG levels by specific ELISA Levels of vitellogenin in the plasma of mullets were assessed using specific ELISA. Detectable levels of vitellogenin were measured in male mullets from all four populations. VTG was isolated from plasma of fish samples by chromatography as previously described (Asturiano et al. 2005). Vials containing VTG were pooled and applied to a DEAE (diethylaminoethyl) Sepharose CL-6B (Fluka, Sigma Chemical, Madrid, Spain), into a 1.5×25 cm column. Fractions containing significant amounts of protein were evaluated for the presence of VTG by denaturing gel electrophoresis. Purified VTG (912,000 ng/mL) was stored at -80°C to be used as standard. Polyclonal antibodies against C. labrosus vitellogenin (Ab) were raised in three California×New Zealand female rabbits using standard immunological methods (Asturiano et al. 2005). The obtained serum was stored at -20°C in 2% sodium azide. Serum IgGs were precipitated in 33% ammonium sulphate, centrifuged, and the pellet resuspended in 2.5 mL of 10 mM PBS and dialysed against the same buffer overnight at 4°C. The biotinylation of 10 mL of dialysed anti-VTG rabbit IgGs was conducted by mixing with biotin-7-NHS solution (2 mg/mL in dimethyl sulphoxide). The preparation was dialysed and stocked at -20°C. ELISA assays were carried out in polystyrene 96- well microtitre plates from Costar (Cambridge, MA, USA). Plates were coated overnight (4°C) with 150 μL/well of raw serum anti-VTG, diluted in 0.5 M carbonate buffer. The next day, wells were blocked with 200 μL of 1% PBST-BSA, for 1 h at 4°C. After rinsing, 100 μL/well of sample or standard serially diluted with 10 mM PBST was added to the microplates and incubated at room temperature. Next, 100 μL/well of biotinylated antibody diluted in PBST was added and incubated for 1 h. Then, 100 μL/well of streptavidin peroxidase conjugate (HRPO) was added and incubated under the same conditions. After washing, 100 μL/well of enzymatic substrate solution (2 mg/mL

OPD and 0.012% H2O2 in 25 mM-sodium citrate, 62 mM-sodium phosphate buffer, pH 5.0) was 522 I. M. K. Abumourad et al. Cytologia 79(4)

Table 1. List of studied genes and their accession number, forward primer, reverse primer and probe sequences used for transcription level analysis by qPCR.

Gene Accession Forward (5′ to 3′) Reverse (5′ to 3′) Probe (5′ to 3′) name number

Vtg a EF535844 CGAGAGCCGGACTCAAAGT CCACAAGCTTCAGCAGGTATTTG CTGCAGCGCTGATGAG Cyp19a1 EF535845 ACGCACCTGGACGACTTG TGCAGCGCAGCAAACG ACGTGAGCCAAACTGT ER DQ011293.1 GCATGCTGGACACCATCAC TGCTGCTGAGCCGAGAAC TTGGCCGATGTGATGTATGA RXR DC011294 ACGAGCAGGCTGGAATGAG ATGCCGTCTTTAACCGTGACT ATCGATGCGAGAACGAG 18S rRNA AY825252 GGTAATTCCAGCTCCAATAGCGTAT CCGAGATCCAACTACGAGCTTTT AACTGCAGCAACTTTAAG added as developer for approximately 20 min in the dark. The reaction was stopped with 2.5 M

H2SO4 reading the colour at 490 and 650 nm in a microtitre plate reader (Wallac, model Victor 1420 multi-label counter, Turku, Finland). The limit of detection was 2 ng/mL and the dynamic ranges between 6 and 180 ng/mL. Concentrations of VTG are expressed as ng/mL. mRNA transcription level analysis Thicklip grey mullet mRNA transcription levels analysis was carried out for samples collected in 2010. Transcription levels of vtg a, cyp19a1, er and rxr were measured by qPCR using TaqMan. Samples were homogenised in TRIzol® (Invitrogen, Carlsbad, CA, USA) using a Hybaid RyboliserTM (Hybaid, Ashford, UK) cell disruptor at a shaking speed of 4 m/s for 40 s. Total RNA was isolated following the manufacturer’s instructions. The RNA from the liver and brain was puriﬁed using an RNA cleanup kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. RNA was measured spectrophotometrically and cDNA was obtained from 2 μg of total RNA by Super ScriptTM II reverse transcriptase PCR (Invitrogen, Leek, the Netherlands) using random hexamers and following the manufacturer’s recommendations in an iCycler thermocycler (Bio-Rad, CA, USA). PCR was run in 25 μL reactions on a 7003 PCR machine (Applied Biosystems, CA, USA) using TaqMan Reverse Transcription Reagent (NJ, USA). TaqMan probes and primers from C. labrosus-speciﬁc sequences were designed using Primer Express 3.0 software (Applied Biosystems, CA, USA) (Table 1). Universal PCR conditions were used for all genes: one cycle at 50°C for 2 min, one cycle at 95°C for 10 min, 40 cycles at 95°C for 15 s and at 60°C for 1 min. A control without template was run for quality assessment. The 18S rRNA was used for normalisation (Raingeard et al. 2006) of transcription levels of target genes. Relative gene expression was calculated with the 2－ΔΔCt method (Livak and Schmittgen 2001) relative to the lowest value for each gene in the whole study.

Statistics Statistical analyses for the mRNA transcription levels were performed with the aid of the SPSS.16 statistical package (SPSS Inc., Microsoft Co., Redmond, USA). Signiﬁcant differences between seasons, sampling points and sexes were studied using Kruskal–Wallis followed by the Mann–Whitney U-test, after testing for normality of data (Kolmogorov–Smirnov’s test) and homogeneity of variances (Levene’s test). Fish bile chemical analysis data and mRNA level values were subjected to correlation analyses using Spearman’s correlation index. Signiﬁcance was established at p<0.05.

Results

Chemical analyses in sediments Samplings carried out in sediments from the studied areas showed that (Tables 2 and 3) high levels of PAHs were detected in sediments from Arriluze. Levels of octylphenol (OP) and 2014 Hazards of the Endocrine Disruptors on Mullets (Chelon labrosus) 523

Table 2. Levels of selected endocrine disruptors in sediments.

PAH mg⁄kg Arriluze Plentzia Gernika Pasaia

Naphthalene 0.0160 0.0180 0.0080 0.0090 Acenphthene 0.1560 0.0150 0.0100 0.0180 Acenphthene 0.1010 0.0180 0.0120 0.0310 Fluorene 0.3060 0.0360 0.0180 0.0590 Phenantherene 1.5340 0.20000 0.0890 0.2230 Anthracene 0.9160 0.0690 0.0160 0.0470 Fluoranthene 1.8770 0.3620 0.0990 0.0880 Pyrene 1.8170 0.4600 0.1940 0.6340 Benzo(a)anthracene 0.9730 0.2190 0.1290 0.1330 Benzo(b) 1.1300 0.1700 0.0490 0.0460 ﬂuoranthene Benzo(k) 0.4220 0.0680 0.0260 0.0220 ﬂuoranthene Benzo(a)pyrene 0.2850 0.0650 0.0250 0.0240 Chrysene 0.3760 0.0540 0.0210 0.0280 Indeno(1,2,3cd) 0.1100 0.0300 0.0190 0.0190 pyrene Benzo(g,h,i)pyrene 0.0520 0.0330 0.0250 0.0250 Dibenzo(a,h) 0.1930 0.0330 0.0170 0.0170 anthracene ∑PAHs 10.264 1.85 0.757 1.423

Table 3. Levels of PAHs detected in sediments in the four studied areas, nd=not detected.

ng⁄g Arriluze Plentzia Gernika Pasaia

NP nd nd nd nd OP 70.96 28.81 nd nd BPA 44.56 35.85 nd 414.16 DMP nd nd nd nd DEP 291.16 700.1 191.61 498.69 DBP 124.31 39.01 57.82 173.6 DEHP 4362.98 1949.44 5327.94 8018.52 E1 nd nd 3.46 9.9 E2 nd nd nd nd E3 nd nd nd nd DES nd nd nd nd EE2 nd nd nd nd TBT 27 5 2 14 DBT 19 7 8 10 MTB 9 4 11 5 bisphenol A (BPA) were low to moderate in Arriluze and Plentzia. In Pasaia high levels of BPA were measured. Phthalates were present in all studied sediments showing very high levels in the port areas, Arriluze and Pasaia, and Gernika and lower levels in Plentzia. Synthetic and natural hormones were not detected in sediments with the exception of the low levels of estrone (E1) measured in sediments from Gernika and Pasaia. Regarding organotin compounds, measured ratios for TBT/(DBT+MBT) in Arriluze and Pasaia indicated that TBT is still released at these locations. NP: nonylphenol; OP: octylphenol; BPA: bisphenol-A; DMP: dimethylphthalate; DEP: diethylphthalate; DBP: dibutylphthalate; DEHP: diethylhexylphthalate; E1: estrone; E2: 17b-estradiol; E3: estriol; DES: diethylstilbestrol; EE2: 17a-ethynylestradiol; TBT: tributyltin; DBT: dibutyltin; MBT: monobutyltin. 524 I. M. K. Abumourad et al. Cytologia 79(4)

Table 4. Levels of xenoestrogens in ﬁsh bile, nd=not detected.

ng⁄g Arriluze Plentzia Gernika Pasaia

4tOP 83–549 82–496 35–116 26–211 4nOP nd–80 nd nd–293 nd NP mix nd–5451 nd–7344 nd–2295 nd–1452 BPA nd–633 nd 69–277 nd–287 E1 nd–24 nd–44 nd–219 nd–121 E2 nd nd–248 27–328 29–918 E3 38–850 40–65 nd nd EE2 78–681 105–2325 126–1161 109–4554 MeEE2 nd nd nd–162 nd

Fig. 2. Gamete development of the four locations where ﬁsh were studied.

Mullets from Plentzia and Arriluze showed high levels of alkylphenols in the bile. Fish from Arriluze also contained high levels of BPA in the bile. Hormones were detected in the bile of studied ﬁshes with EE2 being the compound showing higher accumulation levels. 4tOP: 4-tert- octylphenol; 4nOP: 4-noctylphenol; NPmixture: nonylphenol mixture; BPA: bisphenol-A; E1: estrone; E2: 17b-estradiol; E3: estriol (Table 4).

Chemical analyses of fish bile Mullets from Plentzia and Arriluze showed high levels of alkylphenols in the bile. Fish from Arriluze also contained high levels of BPA in the bile. Hormones were detected in the bile of studied ﬁshes with EE2 being the compound showing higher accumulation levels. 4tOP: 4-tert- octylphenol; 4nOP: 4-noctylphenol; NPmixture: nonylphenol mixture; BPA: bisphenol-A; E1: estrone; E2: 17b-estradiol; E3: estriol; EE2: 17a-ethynylestradiol; MeEE2: methyl-ethynylestradiol (Table 4).

Histology and assessment of gamete development Gametogenic development and intersex investigation of the studied animals showed low developed gonads (gametogenesis at immature or early developing stages). Plentzia females showed the most advanced development among studied populations. However, among males, those from Gernika were at a more advanced stage than others (Fig. 2). Mullets from the four locations 2014 Hazards of the Endocrine Disruptors on Mullets (Chelon labrosus) 525

Fig. 3. Micrographs showing histological sections of mullet gonads stained with H&E. (a) Female gonad showing previtellogenic oocytes. (b) Male gonad with cysts containing spermatogonia and few primary spermatocytes. (c) Intersex gonad composed of cysts with spermatogonia and few previtellogenic oocytes (arrows).

Fig. 4. Levels of vitellogenin in the plasma of mullets assessed using speciﬁc ELISA. were commonly at immature/resting stages with some few individuals in early gamete developing stage. Figure 3 illustrates that intersex ﬁsh were detected in the populations from Gernika (18% of males) and Pasaia (10% of males).

VTG levels in fish plasma Detectable levels of vitellogenin were measured in male mullets from all four populations. Some males from Arriluze and Gernika showed high levels of vitellogenin. In the case of females the highest levels were obtained in females from Plentzia and Gernika (Fig. 4). mRNA transcription level analysis Results of relative transcript levels of selected genes after TaqMan analysis showed that elevated vitellogenin transcript levels were measured in male mullets from Plentzia and Gernika. Females from Gernika and Plentzia showed higher VTG expression levels than females from Arriluze and Pasaia. Males from Gernika and especially those from Plentzia showed high VTG expression levels (Fig. 5). Females from Pasaia and Plentzia showed higher liver ER expression levels than females from Arriluze and Gernika. No differences were detected in liver ER expression levels in males (Fig. 6). Females from Pasaia and Gernika showed higher liver RXR expression levels than females from Arriluze and Plentzia. No differences were detected in liver RXR expression levels in males (Fig. 7). No differences were detected in gonad CYP19A1 expression levels in females. Males from Pasaia showed lower gonad CYP19A1 expression levels than males from Gernika (Fig. 8). 526 I. M. K. Abumourad et al. Cytologia 79(4)

Fig. 5. Box-plot graphs showing the results of relative transcript levels of vitilloginine from the four studied areas.

Fig. 6. Box-plot graphs showing the results of relative transcript levels of liver estrogen receptor (ER) from the four studied areas.

Discussion

In the present work, the studied animals showed low developed gonads (gametogenesis at immature or early developing stages). Plentzia females showed the most advanced development among the studied populations. However, among males, those from Gernika were at a more advanced stage than the others. Mullets from the four locations were commonly at immature/resting stages with some few individuals in early gamete developing stage. Presence of two intersex fish was detected in the populations from Gernika (18% of males) and one in Pasaia (10% of males). We have measured concentrations of several EDs in sediments, and several molecular, cellular and tissue level biomarkers in thicklip grey mullets from the Bay of Biscay with the purpose of determining the presence and possible exposure and effects of EDs in this protected area. Concerning BPA, the European Commission has recently published a report that summarizes BPA concentrations in different environmental compartments; in freshwater sediments concentrations of BPA were measured from <0.2 to 1630 ng/g (EUR 24588 EN-2010). In this study, Pasaia showed high levels of BPA and octylphenol (OP), where low to moderate levels were detected in Arriluze and Plentzia. Concentrations of BPA in this study were similar to the minimum value reported and much lower than the concentrations showing estrogenic effects in fish (Bonefels-Jørgensen et al. 2007). Samplings carried out in sediments from the studied areas showed that high levels of PAHs were detected in sediments from Arriluze, probably due to the high maritime traffic and industrial inputs from the surrounding areas. Phthalate concentrations at a range of 210–8440 ng/g and 190–3040 ng/g have been reported in 2014 Hazards of the Endocrine Disruptors on Mullets (Chelon labrosus) 527

Fig. 7. Box-plot graphs showing the results of relative transcript levels of liver RXR from the four studied areas.

Fig. 8. Box-plot graphs showing the results of relative transcript levels of gonad CYP19A1 from the four studied areas. sediments from Germany (Fromme et al. 2002) and the Cantabrian coast, Bay of Biscay (Antizar- Ladislao 2009), respectively. Similar concentrations were measured in the present study, values of up to 8 μg/g sediment being found. Soil from electric and electronic waste recycling sites in China has been described as extremely contaminated by phthalates with concentrations ranging from 12,566 to 46,669 μg/g (Liu et al. 2009). In this study, phthalates were present in all studied sediments showing very high levels in the port areas, Arriluze and Pasaia, and Gernika and lower levels in Plentzia. In comparison, the concentrations of phthalates in the present work were commonly high which could pose a risk to aquatic fauna. Studies have demonstrated that NP and OP have estrogenic activity at a range of μM concentrations (Kortner et al. 2009). In this study, NP and OP concentrations in sediments were much lower than the concentrations reported to be estrogenic to fish. The relatively low abundance of OP compared to NP has already been reported in other studies, and attributed to its lower commercial use (Lavado et al. 2004). Additionally, different studies have confirmed that the effect of two or more compounds with a capacity for endocrine disruption, even at low concentrations, can be additive or synergetic (Rajapakse et al. 2002, Silva et al. 2002). Studies carried out in sewage-impacted sediments have reported similar concentrations of natural and synthetic hormones (Braga et al. 2005, Reddy and Brownawell 2005). In Catalonia, levels of EE2 up to 22.8 ng/g were measured in sediments from rivers where a high prevalence of intersex and VTG induction in fish was observed (López de Alda and Barceló 2001). In Venice Lagoon, which suffers heavy anthropogenic pressure, levels of EE2 up to 41 ng/g were measured 528 I. M. K. Abumourad et al. Cytologia 79(4)

(Pojana et al. 2007). In the present work concentrations of studied hormones were below detection limits in sediments from Gernika and Arriluze. Several works have shown that hormones can act at very low concentrations. Thus, sex ratio skewness to female has been observed in fish exposed to only 1 ng/L and 0.32 ng/L of EE2 (Orn et al. 2003, Parrot and Blunt 2005). Brian et al. (2005) exposed fish to BPA, NP, OP, EE2 and E2 at concentrations that did not affect them individually and showed that these compounds can act together and induce significant estrogenic effects. Synthetic and natural hormones were not detected in sediments with the exception of the low levels of estrone (E1) measured in sediments from Gernika and Pasaia. Regarding organotin compounds, measured ratios for TBT/(DBT+MBT) in Arriluze and Pasaia indicated that TBT is still released at these locations. Mullets from Plentzia and Arriluze showed high levels of alkylphenols in the bile. Fish from Arriluze also contained high levels of BPA in the bile. Hormones were detected in the bile of studied fishes with EE2 being the compound showing higher accumulation levels. The high levels of alkylphenols, bisphenol A and ethynylestradiol measured in the bile of mullets indicated that these compounds could be responsible for the observed alterations. The origin of these compounds is not clear, since low levels of these compounds were detected in sediments. Only phthalates and in the case of Arriluze the PAHs were measured at high levels in sediments. We cannot discard that phthalates and PAHs could also contribute to the observed effects. Effects of endocrine disruption were detected in the four populations analyzed. High transcription levels of vtg together with elevated plasma vitellogenin levels in males indicated the exposure to xenoestrogenic compounds. Accordingly, intersex fish were detected in mullet populations from Gernika and Pasaia. The high variability in VTG protein levels in plasma among individuals makes it difficult to set a definite background value. Nonetheless, an average level ranging from 100 to 300 ng/mL has been established for male and juvenile fish not exposed to estrogenic compounds. Bjerreggaard et al. (2008), having analysed juvenile brown trout in the field and in the laboratory, considered that male and juvenile fish with plasma VTG protein levels above 1000 ng/mL were affected by estrogens. Accordingly, analyses of VTG protein levels in the present work by specific ELISA showed VTG levels above 1000 ng/mL in the plasma of more than 60% of undifferentiated, male and intersex fish from Gernika but not in Arriluze. It could not be assured, however, that fish with high VTG protein levels but below 1000 ng/mL were not affected by estrogenic compounds. Most interestingly, we found a significant positive correlation between VTG protein levels in plasma and liver vtg mRNA levels. In a study carried out in UK rivers, Jobling et al. (1998) noted that intersex fish showed intermediate VTG levels between females and males. The same trend was observed in the present work. The fact that male mullets from Gernika (18%) and Pasaia (10%) showed high vitellogenin protein and mRNA levels supports that estrogenic EDs are bioavailable and cause significant effects in the Bay of Biscay waters. Induction of VTG in fish sampled downstream from sewage treatment plants has been well documented (Desforges et al. 2010). Aromatase cyp19 and er genes are the key players in sexual hormone synthesis and action in teleosts. As reported in some studies, both isoforms of aromatase cyp19 are expressed differentially between tissue types, with cyp19a1 being mainly expressed in the gonads and cyp19a2 in the brain (Nocillado et al. 2007, Patil and Gunasekera 2008). Accordingly, in this work, cyp19a1 mRNA levels were positively correlated with er and rxr mRNA levels in the gonads. Several studies have shown sexually dimorphic transcription levels of both cyp19a1 and cyp19a2 mRNA, showing significantly higher levels in females than in males due to the primordial role of aromatase during oogenesis (Cheshenko et al. 2008). Generally, transcription levels of cyp19a1 mRNA increase during gametogenesis and decrease at spawning and postspawning stages (Nocillado et al. 2007). In the present work, no differences were observed between sexes. The lack of differences in gonad 2014 Hazards of the Endocrine Disruptors on Mullets (Chelon labrosus) 529 cyp19a1 expression levels is consistent with the observed low gamete developmental stages in all populations in mRNA transcription levels of cyp19a1, suggesting again that the studied male fish might be affected by estrogenic active compounds. Marked differences in the expression patterns of er and rxr between tissues, degree of maturity and time of year have been provided in C. labrosus (Raingeard et al. 2009). In the present study, transcription levels of both genes were observed in all tissues analyzed, as described previously (Raingeard et al. 2009), in agreement with the wide spectrum of physiological effects of estrogens and the involvement of rxr in many metabolic pathways. Higher er hepatic mRNA levels have been detected in Fundulus heteroclitus in reproductively-active female individuals compared to inactive ones but not between males and females (Greytak and Callard 2007); in the present work, higher ER expression levels in females from Plentzia and Pasaia are possibly associated with more developed gonads in both populations. The lack of differences in gonad cyp19a1 expression levels between females is consistent with the observed low gamete developmental stages in all populations. Estrogen receptors are directly involved in E2-dependent induction of the aromatase cyp19 gene (Menuet et al. 2005). In this study, significant positive correlations were observed among transcription levels of er, rxr and cyp19 aromatase mRNA. Histological examinations of mullet gonads showed a high prevalence of intersex fish in Gernika and Pasaia. Mullets have been described as a gonochoristic species and the prevalence of natural hermaphroditism is non-existent or very low (Bayhan and Acarli 2006). However, a high percentage of hermaphrodite or intersex gonads has been reported in mullets from Portuguese estuaries polluted with PCBs and 1,1,1-trichloro-2-(p-chlorophenyl) 2-(o-chlorophenyl) ethane (DDT) (Ferreira et al. 2002, 2004). These mullets displayed testis-ova gonads with previtellogenic oocytes surrounded by testis tissue, similar to our findings in Gernika and Pasaia mullets. There are clearly documented adverse impacts of EDs on fish populations in the field. Intersex gonads have been reported in other fish species sampled in waters contaminated by mixed municipal and industrial effluents, as well as in areas around wastewater treatment plant waters (Woodling et al. 2006). Overall, all these data indicate that the intersex condition found in mullets from the Bay of Biscay could be associated with the presence of EDs. It must be highlighted that these fish were collected nearby the wastewater treatment plant of Gernika and thus, they could be exposed to effluent discharges that, based on data reported in this study, could be the origin of the high NP levels measured in fish bile.

Conclusion

Effects of endocrine disruption were detected in the four populations analyzed. High transcription levels of vtg together with elevated plasma vitellogenin levels in males indicated the exposure to xenoestrogenic compounds. Accordingly, intersex ﬁsh were detected in mullet populations from Gernika and Pasaia. The high levels of alkylphenols, bisphenol A and ethynylestradiol measured in the bile of mullets indicated that these compounds could be responsible for the observed alterations. The origin of these compounds is not clear, since low levels of these compounds were detected in sediments. Only phthalates and in the case of Arriluze the PAHs were measured at high levels in sediments. We cannot discard that phthalates and PAHs could also contribute to the observed effects. The combined chemical and biological approach applied can be considered as a useful tool to be implemented in biomonitoring programs within the framework of the new water policies.

Acknowledgments

This work was supported by Basque Water Agency (URA 10/02); Basque Government (K 530 I. M. K. Abumourad et al. Cytologia 79(4)

EGOKITZEN IE09–245 and grant to consolidated research groups GIC07/26-IT 393–07) and UPV/EHU (UFI 11/37).

References

Antizar-Ladislao, B. 2009. Polycyclic aromatic hydrocarbons, polychlorinated biphenyls, phthalates and organotins in northern Atlantic Spain’s coastal marine sediments. J. Environ. Monit. 11: 85–91. Aoki, J. Y., Nagae, M., Takao, Y., Hara, A., Lee, Y. D., Yeo, I. K., Lim, B. S., Park, C. B. and Soyano, K. 2010. Survey of contamination of estrogenic chemicals in Japanese and Korean coastal waters using the wild grey mullet (Mugil cephalus). Sci. Total Environ. 408: 660–665. Arukwe, A. and Goksøyr, A. 2003. Eggshell and egg yolk proteins in fish: hepatic proteins for the next generation: oogenetic, population, and evolutionary implications of endocrine disruption. Comp. Hepatol. 2: 4–24. Asturiano, J. F., Romaguera, F., Aragón, P., Atienza, J., Puchades, R. and Maquieira, A. 2005. Sandwich immunoassay for determination of vitellogenin in golden grey mullet (Liza aurata) serum as a field exposure biomarker. Anal. Bioanal. Chem. 381: 1152–1160. Atanasov, Vladimir, Conrad S. Ciccotello and Stanley B. Gyoshev, 2005. How does law affect finance? An empirical examination of tunneling in an emerging market. The William Davidson Institute Working Paper 742. Baker, M. E., Ruggeri, B., Sprague, L. J., Eckhardt, C., Lapira, J., Wick, I., Soverchia, L., Ubaldi, M., Magni, A. M. P., Dorsch, D. V., Bay, S., Gully, J. R., Reyes, J. A., Kelley, K. M., Schlenk, D., Breen, E. C., Šášik, R. and Hardiman, G. 2009. Analysis of Endocrine Disruption in Southern California Coastal Fish using an Aquatic Multi-Species Microarray. Nature Precedings: hdl:10101/npre..2823.1 Bayhan, B. and Acarli, D. 2006. Hermaphrodite thinlip mullet Liza ramada (Risso, 1810) (Teleostei: Mugilidae) from Homa Lagoon (Izmir Bay-Aegean Sea). Aquac. Res. 37: 1050–1052. Belzunce, M. J., Solaun, O., González-Oreja, J. A., Millán, E. and Pérez, V. 2004. Contaminants in sediments. In: Borja, A. and Collins, M. (eds.). Oceanography and Marine Environment of the Basque Country. Elsevier BV, Amsterdam. pp. 27–50. Berg, C., Halldin, K., Fridolfsson, A.-K., Brandt, I. and Brunström, B. 1999. The avian egg as a test system for endocrine disrupters: effects of diethyl-stilbestrol and ethynylestradiol on sex organ development. Science of the Total Environment 233: 57–66. Bjerreggaard, L. B., Lindholst, C., Korsggaard, B. and Bjerreggaard, P. 2008. Sex hormone concentrations and gonad histology in brown trout (Salmo trutta) exposed to 17β-estradiol and bisphenol A. Ecotoxicology 17: 252–263. Bonefels-Jørgensen, E. C., Long, M., Homeister, M. V. and Vinggaard, A. M. 2007. Endocrine-disrupting potential of bisphenol A, bisphenol A dimethacrylate, 4-n-nonylphenol, and 4-n-octylphenol in vitro: new data and a brief review. Environ. Health Perspect. 115: 69–76. Borja, Angel, Bricker, Suzanne, B., Dauer, Daniel, M., et al. 2008. Overview of integrative tools and methods in assessing ecological integrity in estuarine and coastal systems worldwide. Mar. Poll. Bull. 56:1519–1537. Braga, O., Smythe, G. A., Schäfer, A. I. and Feitz, A. J. 2005. Fate of steroid estrogens in Australina inland and coastal wastewater treatments plants. Environ. Sci. Technol. 39: 3351–3358. Brian, J. V., Harris, C. A., Scholze, M., Backhaus, T., Booy, P., Lamoree, M., Pojana, G., Jonkers, N., Runnalls, T., Bonfà, A., Marcomini, A. and Sumpter, J. P. 2005. Accurate prediction of the response of freshwater fish to a mixture of estrogenic chemicals. Environ. Health 113: 721–728. Cearreta, A., Irabien, M. J. and Pascual, A. 2004. Human activities along the Basque coast during the last two centuries: geological perspective of recent anthropogenic impact on the coast and its environmental consequences. In: Borja, A. and Collins, M. (eds.). Oceanography and Marine Environment of the Basque Country. Elsevier BV, Amsterdam. pp. 27–50. Chen, T. T., Peid, P. C., Van Beneden, R. and Sonstegard, R. R. 1986. Effect of aroclor 1254 and mirex on estradiol- induced vitellogenin production in juvenile rainbow trout, Salmo gairdneri. Can. J. Fish. Aquatic Sci. 43: 169. Cheshenko, K., Pakdel, F., Segner, H., Kah, O. and Eggen, R. I. L. 2008. Interference of endocrine disrupting chemicals with aromatase CYP19 expression or activity, and consequences for reproduction of teleost fish. Gen. Comp. Endocrinol. 155: 31–62. Colborn, T., vom-Saal, F. S. and Soto, A. M. 1993. Developmental effects of endocrine-disrupting chemicals in wildlife and humans. Environ. Health Perspect. 101: 378–384. Crisp, T. M., Clegg, E. D., Cooper, R. L., Wood, W. P., Anderson, D. G., Baetcke, K. P., Hoffmann, J. L., Morrow, M. S., Rodier, D. J., Schaeffer, J. E., Touart, L. W., Zeeman, M. G. and Patel, Y. M., 1998. Environmental endocrine disruption: An effects assessment and analysis. Environ. Health Perspect. 106 (Suppl 1): 11–56. Danko, D. and Callard, I. P. 1981. Effect of exogenous estradiol-173 on plasma vitellogenin levels in male and female Chrysemysand its modulation by testosterone and progesterone. Gen. Comp. Endocrinol. 43: 413–421. 2014 Hazards of the Endocrine Disruptors on Mullets (Chelon labrosus) 531

Desforges, J. P., Peachey, B. D. L., Sanderson, P. M., White, P. A. and Blais, J. M. 2010. Plasma vitellogenin in male teleost fish from 43 rivers worldwide is correlated with upstream human population size. Environ. Pollut. 158: 3279–3284. Escartín, E. and Porte, C. 1999. Assessment of PAH pollution in coastal areas from the NW Mediterranean through the analysis of fish bile. Mar. Pollut. Bull. 38: 1200–1206. European Commission, 2010. Commission Decision of 1 September 2010 on criteria and methodological standards on good environmental status of marine waters (notified under document C(2010) 5956)(2010/477/EU). Official Journal of the European Union, L232: 14–24. Ferreira, M., Antunes, P., Gil, O., Vale, C. and Reis-Henriques, M. A. 2002. Testis-ova in mullet (Mugil cephalus) exposed to organic contaminants in the Douro estuary. In: The 21st Conference of European Comparative Endocrinologists, Bonn. pp. 81–85. Ferreira, M., Antunes, P., Gil, O., Vale, C. and Reis-Henriques M. A. 2004. Organochlorine contaminants in flounder (Platichthys flesus) and mullet (Mugil cephalus) from Douro estuary, and their use as sentinel species for environmental monitoring. Aquat. Toxicol. 69: 347–357. Fromme, H., Küchler, T., Otto, T., Pilz, K., Müller, J. and Wenzel, A. 2002. Occurrence of phthalates and bisphenol A and F in the environment. Water Res. 36: 1429–1438. Gamble, M. and Wilson, I. 2002. The hematoxylin and eosin. In: Bancroft, J. D. and Gamble, M. (eds.). Theory and Practice of Histological Techniques. 5th ed. Elsevier Science Ltd., Churchill Livingstone. p.125. Goksøyr, A., Arukwe, A., Larsson, J., Cajaraville, M. P., Hauser, L., Nilsen, B. M., Lowe, D. and Matthiessen, P. 2003. Chapter 5: Molecular/Cellular Processes and the Impact on Reproduction. In: Lawrence, A. J. and Hemingway, K. L. (eds.). Effects of Pollution on Fish. Blackwell Science Ltd., Oxford. pp. 179–220. Goodwin, A. E., Grizzle, J. M., Bradley, J. T. and Estridge, B. H. 1992. Monoclonal antibody-based immunoassay of vitellogenin in the blood of male channel catfish (Ictalurus punctatus). Comp. Biochem. Physiol. 101B: 441–446. Gozzo, F. and Poupaert, J. H., 1998. Xenoestrogens, pollution and health: A critical review. J. Pharm. Belg. 53: 278–286. Granado-Lorencio, C. 1996. Ecología de peces. Secretariado de Publicaciones, University of Seville, Seville. p. 353. Greytak, S. R. and Callard, G. V. 2007. Cloning of three estrogen receptors (ER) from killifish (Fundulus heteroclitus): differences in populations from polluted reference environments. Gen. Comp. Endocrinol. 150: 174–188. Halldin, K., Berg, C., Brandt, I. and Brunström, B. 1999. Sexual behavior in Japanese quail as a test end point for endocrine disruption: Effects of in ovo exposure to ethinylestradiol and diethylstilbestrol. Environmental Health Perspectives 107: 861–866. Jobling, S., Nolan, M., Tyler, C. R., Brighty, G. and Sumpter, J. P. 1998. Widespread sexual disruption in wild fish. Environ. Sci. Technol. 32: 2498–2506. Jobling, S. and Sumpter, J. P. 1993. Detergent components in sewage effluent are weakly oestrogenic to fish: An in vitro study using rainbow trout (Oncorhynchus mykiss) hepatocytes. Aquat. Toxicol. 27: 361–372. Kortner, T. M., Mortensen, A. S., Hansen, M. D. and Arukwe, A. 2009. Neural aromatase transcript and protein levels in Atlantic salmon (Salmo salar) are modulated by the ubiquitous water pollutant, 4-nonylphenol. Gen. Comp. Endocrinol. 164: 91–99. Lavado, R., Thibaut, R., Raldúa, D., Martín, R. and Porte, C. 2004. First evidence of endocrine disruption in feral carp from the Ebro River. Toxicol. Appl. Pharmacol. 196: 247–257. LeGuellec, K., Lawless, K., Valotaire, Y., Kross, M. and Tenniswood, M. 1988. Vitellogenin gene expression in male rainbow trout (Salmo gairdnei). Gen. Comp. Endocrinol. 71: 359–371. Liu, W. L., Shen, C. F., Zhang, Z. and Zhang, C. B. 2009. Distribution of phthalate esters in soil of e-waste recycling sites from Taizhou city in China. Bull. Environ. Contam. Toxicol. 82: 665–667. Livak, K. J. and Schmittgen, T. D. 2001. Analysis of relative gene expression data using real- time quantitative PCR and the 2-ΔΔCt method. Methods 25: 402–408. López de Alda, M. J. and Barceló, D. 2001. Use of solid-phase extraction in various of its modalities for sample preparation in the determination of estrogens and progestogens in sediment and water. J. Chromatogr. A 938: 145–153. McDonough, C. J., Roumillat, W. A. and Wenner, C. A. 2005. Sexual differentiation and gonad development in striped mullet (Mugil cephalus L.) from South Carolina estuaries. Fish. Bull. (Wash. D.C.) 103: 601–619. McLachlan, J. A. 2001. Environmental signaling: What embryos and evolution teach us about endocrine disrupting chemicals. Endocr. Rev. 22: 319–341. Menuet, A., Pellegrini, E., Brion, F., Gueguen, M. M., Anglade, I., Pakdel, F. and Kah, O. 2005. Expression and estrogen- dependent regulation of the zebrafish brain aromatase gene. J. Comp. Neurol. 485: 304–320. Morales, M. H., Osuna, R. and Sanchez, E. 1991. Vitellogenesis in Anolispulchellus induction of VTG-like protein in liver explants from male and immature lizards. J. Exp. Zool. 260: 50–58. Nocillado, J. N., Elizur, A., Avitan, A., Carrick, F. and Levavi-Sivan, B. 2007. Cytochrome P450 aromatase in grey mullet: cDNA and promoter isolation; brain, pituitary and ovarian expression during puberty. Mol. Cell. Endocrinol. 263: 65–78. 532 I. M. K. Abumourad et al. Cytologia 79(4)

Oettel, M. 2002. Is there a role for estrogens in the maintenance of men’s health? Aging Male 5: 248–257. Oleksiak, M. F. 2008. Changes in gene expression due to chronic exposure to environmental pollutants. Aquat. Toxicol. 21, 90(3): 161–171. Orbea, A., Ortiz-Zarragoitia, M., Solé, M., Porte, C. and Cajaraville, M. P. 2002. Antioxidant enzymes and peroxisome proliferation in relation to contaminant body burdens of PAHs and PCBs in bivalve molluscs, crabs, and fish from the Urdaibai and Plentzia estuaries (Bay of Biscay). Aquat. Toxicol. 58: 75–98. Orn, S., Holbech, H., Madsen, T. H., Norrgren, L. and Peterson, G. I. 2003. Gonad development and vitellogenin production in zebrafish (Danio rerio) exposed to ethinylestradiol and methyltestosterone. Aquat. Toxicol. 65: 397–411. Palmer, B. D. and Palmer, S. K. 1995. Vitellogenin induction by xenobiotic estrogens in the red-eared turtle and african clawed frog. Environ. Health Perspect. 103: 19–25. Panzica, G. C., Balthazart, J., Pessatti, M. and Viglietti-Panzica, C. 2002. The parvocellular vasotocin system of Japanese quail: A developmental and adult model for the study of influences of gonadal hormones on sexually differentiated and behaviorally relevant neural circuits. Environ. Health Perspectives 110: 423–428. Parrot, J. L. and Blunt, B. R. 2005. Life-cycle exposure of fathead minnows (Pimephales promelas) to an ethinylestradiol concentration below 1 ng/L reduces egg fertilization success and demasculinizes males. Environ. Toxicol. 20: 131–141. Patil, J. G. and Gunasekera, R. M. 2008. Tissue and sexually dimorphic expression of ovarian and brain aromatase mRNA in the Japanese medaka (Oryzias latipes): Implications for their preferential roles in ovarian and neural differentiation and development. Gen. Comp. Endocrinol. 158: 131–137. Petrovic, M., Barceló, D., Díaz, A. and Ventura, F. 2003. Low nanogram per liter determination of halogenated nonylphenols, nonylphenol carboxylates, and their non-halogenated precursors in water and sludge by liquid chromatography electrospray tandem mass spectrometry. J. Am. Soc. Mass Spectrom. 14: 516–527. Phillips, B. and Harrison, P., 1999. Overview of the Endocrine DisruptorIssue. Royal Society of Chemistry, Cambridge. Pojana, G., Gomiero, A., Jonkers, N. and Marcomini, A. 2007. Natural and synthetic endocrine disrupting compounds (EDCs) in water, sediment and biota of a coastal lagoon. Environ. Int. 33: 929–936. Purdon, C. E., Hardiman, P. A., Bye, V. J., Eno, N. C., Tyler, C. R. and Sumpter, J. P. 1994. Estrogenic effects of effluents from sewage treatment works. Chem. Ecol. 8: 275–285. Puy-Azurmendi et al. 2010. Mar. Environ. Res. 69: S63–S66. Puy-Azurmendi, E., Navarro, A., Olivares, A., Fernandes, D., Martínez, E., de Alda, M. L., Porte, C., Cajaravilla, M. P., Barceló, D. and Piña, B. 2010. Origin and distribution of olycyclic aromatic hydrocarbon pollution in sediment and fish in the biosphere S reserve of urdaibai (Bay of Biscay, Basque Country, Spain). Marine Environ. Res. 70: 142. Raingeard, D., Cancio, I. and Cajaraville, M. P. 2006. Cloning and expression pattern of peroxisome proliferator-activated receptor α in the thicklip grey mullet Chelon labrosus. Mar. Environ. Res. 62: 113–117. Raingeard, D., Cancio, I. and Cajaraville, M. P. 2009. Cloning and expression pattern of peroxisome proliferator-activated receptors, estrogen receptor α and retinoid X receptor α in the thicklip grey mullet Chelon labrosus. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 149: 26–35. Rajapakse, N., Silva, E. and Kortenkamp, A. 2002. Combining xenoestrogens at levels below individual no-observed-effect concentrations dramatically enhances steroid hormone action. Environ. Health Perspect. 110: 917–921. Reddy, S. R. and Brownawell, B. J. 2005. Analysis of estrogens in sediment from a sewage-impacted urban estuary using high-performance liquid chromatography/time-of-flight mass spectrometry. Environ. Toxicol. Chem. 24: 1041– 1047. Rodríguez-Mozaz, S., López de Alda, M. J. and Barceló, D. 2004. Picogram per liter level determination of estrogens in natural waters and waterworks by a fully automated on-line solid-phase extraction-liquid chromatography- electrospray tandem mass spectrometry method. Anal. Chem. 76: 6998–7006. Sharp, D. J., Yu, W. and Baas, P. W. 1995. Transport of dendritic microtubules establishes their nonuniform polarity orientation. J. Cell Biol. 130: 93–104. Silva, E., Rajapakse, N. and Kortenkamp, A. 2002. Something from “Nothing”̶eight weak estrogenic chemicals combined at concentrations below NOECs produce significant mixture effects. Environ. Sci. Technol. 36: 1751–1756. Sostoa, A. 1983. Las comunidades de peces del Delta del Ebro. PhD Dissertation. University of Barcelona, Barcelona. Starek, A., 2003. Estrogens and organochlorine xenoestrogens and breast cancer risk. Int. J. Occup. Med. Environ. Health 16: 113–124. Sultan, C., Balaguer, P., Terouanne, B., Georget, V., Paris, F., Jeandel, C., Lumbroso, S. and Nicolas, J. 2001. Environmental xenoestrogens, antiandrogens and disorders of male sexual differentiation. Mol. Cell. Endocrinol. 178: 99–105. Tueros, I., Borja, Á., Larreta, J., Rodríguez, J. G., Valencia, V. and Millán, E. 2009. Integrating long-term water and sediment pollution data, in assessing chemical status within the European Water Framework Directive. Marine Pollution Bulletin 58: 1389–1400. 2014 Hazards of the Endocrine Disruptors on Mullets (Chelon labrosus) 533

Vallejo-Marín, M., Manson, J. S., Thomson, J. D. and Barrett, S. C. H. 2009. Division of labour within flowers: Heteranthery, a floral strategy to reconcile contrasting pollen fates. Journal of Evolutionary Biology 22: 828–839. Wang, A. M., Creasey, A. A., Ladner, M. B., Lin, L. S., Strickler, J., Van Arsdell, J. N., Yamamoto, R. and Mark, D. F. 1985. Molecular cloning of the complementary DNA for human tumor necrosis factor. Science 228: 149–154. Witorsch, R. J. 2002. Endocrine disruptors: Can biological effects and environmental risks be predicted? Regul. Toxicol. Pharmacol. 36: 118–130. Woodling, J. D., Lopez, E. M., Maldonado, T. A., Norris, D. O. and Vajda, A. M. 2006. Intersex and other reproductive disruption of fish in wastewater effluent dominated Colorado streams. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 144: 10–15. Yu, S. J., Keenan, S. M., Tong, W. and Welsh, W. J. 2002. Influence of the structural diversity of data sets on the statistical quality of three-dimensional quantitative structure–activity relationship (3D-QSAR) models: Predicting the estrogenic activity of xenoestrogens. Chem. Res. Toxicol. 15: 1229–1234.