DOCSLIB.ORG

Mugs of the Quarter 2020 - Q1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mugs of the Quarter 2020 - Q1 Mugs of the Quarter 2020 - Q1 Travis Nelson - Custodial Travis, a Facilities Services Custodian, Yellowstone Park to attend their spring has been with us nearly two years. He fair. He also likes to visit Las Vegas, currently works in the Eames Building. where he enjoys time with his family His favorite part of working at Idaho and, of course, the Las Vegas shows. State University is the community of He also likes to watch Gold Rush friendly people. episodes and eat Thai or Mexican Travis likes to hunt, ski, fish, and food. enjoy the outdoors on a 4-wheeler. For a favorite vacation, he went to West Favortie Color: Green Joanna Wells - Idaho Falls Joanna is a Custodian on the Her favorite outdoor activity Idaho Falls campus. She will hit her is swimming. She also enjoys one year mark with Facilities in April. boating at Palisades. She enjoys Joanna enjoys her co-workers and these activities with her kids and appreciates the team environment that family. Her favorite vacation was to is on the Idaho Falls campus. Joanna Cancun, Mexico. She got to spend graduated from Boise State, and is time by the pool at the resort, and looking forward to continuing her spend time at the ocean. She also education at ISU. She plans on going visited Chichen Itza, a famous to graduate school to further her Mayan pyramid. degree in education. Thank you Joanna for being Joanna enjoys the outdoors, such a great member of the especially in the summer time. Facilities Services team. Tony Razo - PDC Tony has worked at ISU for including the Hobbit, and anything three years now, and is currently by Quentin Tarantino. When it our Drafter. He loves being able comes to reading, Tony’s favorite to watch the campus develop and authors include Michael Crichton, improve. In his free time, Tony enjoys Stephen King, and Khalid Hussain. any sort of sport or activity that gets Tony’s favorite vacation spot is his blood going; two of his favorites the Oregon Coast, where he goes include soccer and biking. Tony is for his family reunions. While there, also an amazing artist and loves to they stay at a house on the beach draw. When asked what his favorite and enjoy the touristy stuff, including color was, he thought for a moment whale tours. and then replied, “Every color.” Tony has two dogs, Indiana and His favorite foods are anything Frankie. A fun fact that you might his dad cooks. Tony’s favorite movies not know about Tony is that he can are the Lord of the Rings series, not juggle. Darwin Lee - Meridian Darwin has worked as the BMX biking. When Darwin gets the Mechanical Systems supervisor on chance to fish, he likes to go to Arrow the Meridian campus for about two Rock Reservoir. One thing Darwin has and a half years. Darwin’s favorite always wanted to do was to go deep sea part of the job is making the faculty fishing. & students happy. He enjoys Darwin’s favorite food is ribs and providing an environment where his favorite restaurant is Goodwood they can learn and work and be BBQ in Boise. The potato salad at successful. Goodwood BBQ is the best he has ever Some of Darwin’s hobbies include had. Darwin’s favorite vacation was to motorcycling, bicycling, and fishing. the Oregon Coast. He got to spend Darwin likes to ride motorcycles at time doing some beach combing and he Pickles Butte. Darwin does a lot of visited a number of lighthouses. different types of bicycling; mountain biking, biking around town, and Sterling Ritcheson - Idaho Falls Sterling has worked as the and cheers for Notre Dame and the Landscape Foreman for the Idaho Green Bay Packers. Sterling’s dream Falls campus for a little over a vacation would be to go to Indiana year. Sterling’s favorite thing about or Wisconsin to see these teams play working for ISU is the team that he in person. Every year, Sterling tries works with. Idaho Falls has had a to make it to a college bowl game. lot of snow this year, so Sterling has This past year Sterling went to the been busy keeping the grounds safe. Fiesta Bowl in Phoenix, Arizona. Sterling graduated from ISU Thank you Sterling for taking such in Athletics Administration, and good care of our grounds in Idaho athletics plays a big part in Sterling’s Falls! life. Sterling enjoys staying active, and rides his bike to work when he Favorite Superhero: can. Sterling is a huge football fan Batman James Rhoades - Custodial James has worked at ISU woodworking, hunting, fishing and for two years and really likes his being in the great outdoors. He schedule. He appreciates the likes to vacation in Michigan where faculty, students, and his co- he watches the ships come and go, workers because they are great to visits the lighthouses, checks out the work with. tugboat museum, and enjoys the James’ heroes are Mom and Dad. waterfront restaurants. Stephen King, Belle, who is a plott hound, and author of the Dark Tower Series, is Nemesis, a pug, are the pets that his favorite author. hang around James’ house. Thank you for your hard work and He has too many hobbies dedication! to count but he does enjoy Todd Adams - PDC Todd has been a Project Manager include banana cream pie, steak, and at ISU for three and a half years now. dark chocolate. His favorite restaurants One of his favorite thing about his are Texas Roadhouse and PF Changs in job is being able to work on projects Boise, which he highly recommends you that help improve the campus for our visit the next time you go to Boise. students and faculty. Todd’s favorite vacation was his Todd enjoys spending his free time 23rd anniversary when they went to the outdoors. He loves fishing, horseback Oregon Coast. This was the first time riding, and woodworking. He also he spent time on the ocean. Some his enjoys watching mysteries that make favorite activities there were walking you think, like National Treasure and along the coast and picking up rocks the Da Vinci Code, as well as classics and shells. like James Bond and the Fugitive. Some of Todd’s favorite foods Josiah Nielsen - Custodial Josiah has been working the for some delicious curry. past two years as a Custodian in the Josiah considers Christina Tosi, Facilities Services Department. For a real life chef and blogger, a super him, the best thing about his job is the hero who inspires him in his baking quiet work environment. ventures. He also follows the blog He likes to spend time playing of Mandy Lee who wrote The Art of Dungeons and Dragons and Escapism Cooking: A Survival Story. entertaining his cat, Patches. When he is hungry, he likes to make a batch of his favorite cheesecake or visit his Favorite Color: Pink favorite restaurant, the Everest Kitchen, Louisa Cattabriga - Grounds Louisa is in her third year of Louisa’s favorite restaurant in working with Facilities Services. town is El Herradero, and one of her Louisa enjoys the Grounds team, and favorite foods to get there is tacos. appreciates the support from her co- Louisa also enjoys Italian food. workers. Louisa works on the athletics Louisa’s family is Italian, and they can grounds areas and spends a lot of make some amazing Italian food. time at Davis Field and Miller Ranch Louisa has done quite a bit of Stadium. She loves to be around the traveling, but her favorite trip was athletes and enjoys helping them. visiting her grandmother in Florida; Louisa is currently in school, which she got to spend time with family, and keeps her very busy. She is in the relaxed at the beach. Medical Coding program. When Louisa is a hard worker, and is Louisa does have some spare time, she valuable member of the Grounds likes to spend it outside. She enjoys team. hunting, fly fishing, and skiing. Congratulations to all our Mugs of the Quarter Recipients! Brian Hiltbrand - Custodial Brian is an outdoors kind of Brian has three real life heroes: guy who likes walking, hiking, and Alexander Fleming who discovered capturing the beauty of nature with penicillin, Albert Einstein who is his camera. He has made several responsible for many inventions and fun visits to the Cub River area near discoveries, and Alfred Nobel who Preston, Idaho where there is a invented dynamite and founded the glacier fed spring and no cell service. Nobel Prizes. Another favorite pastime for Brian is Brian has been with Facilities as reading. A good book allows him a Custodian for almost a year and the luxury of just leaving the world appreciates the type of work, the behind. He also likes playing games, environment, the tuition benefits and and watching TV and Batman the schedule that are a great fit for movies. him. Steve Kingery - M&O Steve has worked in the Heat Plant favorite vacation was his trip to for two years. In this short time, he has Hawaii where he went snorkeling, come to value and appreciate the sense body surfing, hiking, and sightseeing. of teamwork that his coworkers show. Steve has several dogs and mouser Steve enjoys many hobbies including cats that roam his property. hunting, fishing, and woodworking. He loves Dutch oven cooking and cast iron cooking. He also enjoys watching Favortie Color: Green mystery and action movies. Steve’s favorite foods are wings, pizza, and diet Mountain Dew. His Troy Burge - M&O Troy has worked at ISU for two wrote the Mountain Man series and half years.
Load more

Recommended publications
  • Beyond Westworld
    “We Don’t Know Exactly How They Work”: Making Sense of Technophobia in 1973 Westworld, Futureworld, and Beyond Westworld Stefano Bigliardi Al Akhawayn University in Ifrane - Morocco Abstract This article scrutinizes Michael Crichton’s movie Westworld (1973), its sequel Futureworld (1976), and the spin-off series Beyond Westworld (1980), as well as the critical literature that deals with them. I examine whether Crichton’s movie, its sequel, and the 1980s series contain and convey a consistent technophobic message according to the definition of “technophobia” advanced in Daniel Dinello’s 2005 monograph. I advance a proposal to develop further the concept of technophobia in order to offer a more satisfactory and unified interpretation of the narratives at stake. I connect technophobia and what I call de-theologized, epistemic hubris: the conclusion is that fearing technology is philosophically meaningful if one realizes that the limitations of technology are the consequence of its creation and usage on behalf of epistemically limited humanity (or artificial minds). Keywords: Westworld, Futureworld, Beyond Westworld, Michael Crichton, androids, technology, technophobia, Daniel Dinello, hubris. 1. Introduction The 2016 and 2018 HBO series Westworld by Jonathan Nolan and Lisa Joy has spawned renewed interest in the 1973 movie with the same title by Michael Crichton (1942-2008), its 1976 sequel Futureworld by Richard T. Heffron (1930-2007), and the short-lived 1980 MGM TV series Beyond Westworld. The movies and the series deal with androids used for recreational purposes and raise questions about technology and its risks. I aim at an as-yet unattempted comparative analysis taking the narratives at stake as technophobic tales: each one conveys a feeling of threat and fear related to technological beings and environments.
    [Show full text]
  • Michael Crichton
    Michael Crichton Genre: Science fiction/Thrillers/Adventure Remember that huge movie years ago called Jurassic Park? Did you know that was based off of Michael Crichton’s book of the same name? Michael Crichton’s books can extremely detailed and involve science, adventure, political and thriller elements. While most famous for Jurassic Park and it’s sequel, The Lost World, he has written many other books tackling a wide range of subjects. The Great Train Robbery is his foray into historical fiction, and Rising Sun is a suspense story with political elements. Read-a-likes Greg Bear If you the science fiction aspect of Crichton, try Greg Bear. The Forge of God is disaster science fiction where two sets of aliens visit Earth and set in motion humanity’s demise. Darwin’s Radio tackles human evolution, where as Blood Music deals with nanotechnology. Philip Kerr Like Crichton, Kerr’s books are in a wide variety of genres. His Bernie Gunther novels, starting with March Violets, start a detective during the World War II period. The Second Angel and The Grid are science fiction thrillers, much like Crichton’s. Dark Matter: The Private Life of Sir Isaac Newton: A Novel is Kerr’s stab at historical mystery. John Darnton A scientific thriller writer, Darnton’s novels explore human cloning, evolution, and the soul. His book Mind Catcher deals with whether souls can be transferred to a computer chip. Two scientists get caught up in a conspiracy when they discover ancient ancestors of human in Neanderthal. Steven Alten If you have a taste for science fiction thrillers that are on the weird side, try Alten’s books.
    [Show full text]
  • Michael Crichton and the Distancing of Scientific Discourse
    ASp la revue du GERAS 55 | 2009 Varia Apparent truth and false reality: Michael Crichton and the distancing of scientific discourse Stéphanie Genty Electronic version URL: http://journals.openedition.org/asp/290 DOI: 10.4000/asp.290 ISBN: 978-2-8218-0408-1 ISSN: 2108-6354 Publisher Groupe d'étude et de recherche en anglais de spécialité Printed version Date of publication: 1 March 2009 Number of pages: 95-106 ISSN: 1246-8185 Electronic reference Stéphanie Genty, « Apparent truth and false reality: Michael Crichton and the distancing of scientific discourse », ASp [Online], 55 | 2009, Online since 01 March 2012, connection on 02 November 2020. URL : http://journals.openedition.org/asp/290 ; DOI : https://doi.org/10.4000/asp.290 This text was automatically generated on 2 November 2020. Tous droits réservés Apparent truth and false reality: Michael Crichton and the distancing of scie... 1 Apparent truth and false reality: Michael Crichton and the distancing of scientific discourse Stéphanie Genty Introduction 1 This article began as an inquiry into the relation of FASP, or professional-based fiction, to professional reality. I was interested in elucidating the ways in which this reality, which formed the basis for such fiction, was transformed by the writer in his/her work and the reasons behind the transformation. Since my own professional activity has been related to the sciences, I chose to study the novels of Michael Crichton, a commercially-successful writer whose credentials and practice qualify him as an author of professional-based fiction as defined by Michel Petit in his 1999 article “La fiction à substrat professionnel: une autre voie d'accès à l'anglais de spécialité”.
    [Show full text]
  • Complicated Views: Mainstream Cinema's Representation of Non
    University of Southampton Research Repository Copyright © and Moral Rights for this thesis and, where applicable, any accompanying data are retained by the author and/or other copyright owners. A copy can be downloaded for personal non-commercial research or study, without prior permission or charge. This thesis and the accompanying data cannot be reproduced or quoted extensively from without first obtaining permission in writing from the copyright holder/s. The content of the thesis and accompanying research data (where applicable) must not be changed in any way or sold commercially in any format or medium without the formal permission of the copyright holder/s. When referring to this thesis and any accompanying data, full bibliographic details must be given, e.g. Thesis: Author (Year of Submission) "Full thesis title", University of Southampton, name of the University Faculty or School or Department, PhD Thesis, pagination. Data: Author (Year) Title. URI [dataset] University of Southampton Faculty of Arts and Humanities Film Studies Complicated Views: Mainstream Cinema’s Representation of Non-Cinematic Audio/Visual Technologies after Television. DOI: by Eliot W. Blades Thesis for the degree of Doctor of Philosophy May 2020 University of Southampton Abstract Faculty of Arts and Humanities Department of Film Studies Thesis for the degree of Doctor of Philosophy Complicated Views: Mainstream Cinema’s Representation of Non-Cinematic Audio/Visual Technologies after Television. by Eliot W. Blades This thesis examines a number of mainstream fiction feature films which incorporate imagery from non-cinematic moving image technologies. The period examined ranges from the era of the widespread success of television (i.e.
    [Show full text]
  • Global Warming, the Politicization of Science, and Michael Crichton's State of Fear
    Journal of Scientific Exploration, Vol. 19, No. 2, pp. 247-256, 2005 0892-33 1OlO5 Global Warming, the Politicization of Science, and Michael Crichton's State of Fear College of Geoscience University of Oklahoma Norman, Oklahoma 7301 9 e-mail: ddeming @ou.edu Abstract-Michael Crichton's book State of Fear addresses the politicization of science, in particular the topics of climate change and global warming, through the vehicle of a novel. In the author's opinion, Crichton is correct: the field of climate research has become highly politicized. An example is provided by the revisionist efforts of some researchers to extinguish the existence of a Medieval Warm Period. The politicization of science is a threat to the process of free inquiry necessary for human progress. Keywords: global warming-temperature-Crichton-climate- Medieval Warm Period On December 26, 2004, a magnitude 9.0 earthquake occurred off the coast of Northern Sumatra. The massive temblor, the largest in 40 years, spawned tsunamis that killed more than 280,000 people. The next day, a colleague at a think tank emailed me to ask whether I had any opinions about the new Michael Crichton book, State of Fear (Crichton, 2004). Although State of Fear is a fictional thriller about eco-terrorism, its real thesis is the politicization of science, in particular climate change and global warming. Because global warming is a highly-charged political subject, Crichton's book has received a lot of attention in the press, including a review by Washington Post columnist George Will (Will, 2004). My colleague closed his email with a little joke: P.S.-I'm also anxious to see if anyone blames this weekend's tsunami in Indonesia on global warming.
    [Show full text]
  • 1) Michael Crichton's Fantasy About Cloning Dinosaurs, Jurassic Park Contains a Putative Dinosaur DNA Sequence
    1) Michael Crichton's fantasy about cloning dinosaurs, Jurassic Park contains a putative dinosaur DNA sequence. Use nucleotide-nucleotide BLAST against the default nucleotide database to identify the real source of the following sequence: >DinoDNA "Dinosaur DNA" from Crichton's JURASSIC PARK p. 103 nt 1-1200 GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC GGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG TGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGC TGCTCACGCTGTACCTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTG CCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAA AGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAG ATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACT CCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCT GGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGG CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA CGGCTCTTACCAGCCTAACTTCGATCACTGGACCGCTGATCGTCACGGCGATTTATGCCG CACATGGACGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAA CAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAA GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG CTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTG ACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCA ACACGACTTAACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACCTTGTCTGCCTCCCC GCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGG CCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGG CCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCT 2) Mark Boguski of the NBCI noticed
    [Show full text]
  • Remixing Generalized Symbolic Media in the New Scientific Novel Søren Brier
    Ficta: remixing generalized symbolic media in the new scientific novel Søren Brier To cite this version: Søren Brier. Ficta: remixing generalized symbolic media in the new scientific novel. Public Un- derstanding of Science, SAGE Publications, 2006, 15 (2), pp.153-174. 10.1177/0963662506059441. hal-00571086 HAL Id: hal-00571086 https://hal.archives-ouvertes.fr/hal-00571086 Submitted on 1 Mar 2011 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. SAGE PUBLICATIONS (www.sagepublications.com) PUBLIC UNDERSTANDING OF SCIENCE Public Understand. Sci. 15 (2006) 153–174 Ficta: remixing generalized symbolic media in the new scientific novel1 Søren Brier This article analyzes the use of fictionalization in popular science commu- nication as an answer to changing demands for science communication in the mass media. It concludes that a new genre—Ficta—arose especially with the work of Michael Crichton. The Ficta novel is a fiction novel based on a real scientific problem, often one that can have or already does have serious consequences for our culture or civilization. The Ficta novel is a new way for the entertainment society to reflect on scientific theories, their consequences and meaning.
    [Show full text]
  • Ennio Morricone
    ENNIO MORRICONE AWARDS & NOMINATIONS *selected ACADEMY AWARD NOMINATION (2015) THE HATEFUL EIGHT Best Original Score GOLDEN GLOBE AWARD (2016) THE HATEFUL EIGHT Best Original Score BAFTA AWARD (2016) THE HATEFUL EIGHT Original Music CRITICS’ CHOICE AWARD (2016) THE HATEFUL EIGHT Best Score ACADEMY AWARD (2007) For magnificent and multifaceted contributions to the HONORARY AWARD art of film music ACADEMY AWARD NOMINATION (2000) MALENA Best Original Score GOLDEN GLOBE NOMINATION (2000) MALENA Best O riginal Score GOLDEN GLOBE AWARD (1999) THE LEGEND OF 1900 Best Original Score GRAMMY AWARD NOMINATION (1998) BULWORTH Best Instrumental Composition Written for a Motion Picture or Television GRAMMY AWARD NOMINATION (1996) THE STAR MAKER Best Instrumental Composition Written for a Motion Picture or Television GRAMMY AWARD NOMINATION (1994) WOLF Best Instrumental Composition Written for a Motion Picture or Television ACADEMY AWARD NOMINATION (1991) BUGSY Best Original Score GOLDEN GLOBE NOMINATION (1991) BUGSY Best Original Score BAFTA AWARD (1991) CINEMA PARADISO Best Original Score GOLDEN GLOBE NOMINATION (1990) CASUALTIES OF WAR Best Original Score 1 The Gorfaine/Schwartz Agency, Inc. (818) 260-8500 ENNIO MORRICONE ACADEMY AWARD NOMINATION (1987) THE UNTOUCHABLES Best Original Score BAFTA AWARD (1988) THE UNTOUCHABLES Best Original Score GOLDEN GLOBE NOMINATION (1988) THE UNTOUCHABLES Best Original Score BAFTA AWARD (1987) THE MISSION Best Original Score ACADEMY AWARD NOMINATION (1986) THE MISSION Best Original Score GOLDEN GLOBE AWARD (1986) THE MISSION Best Original Score BAFTA AWARD (1985) ONCE UPON A TIME IN AMERICA Best Original Score GOLDEN GLOBE NOMINATION (1985) ONCE UPON A TIME IN AMERICA Best Original Score BAFTA AWARD (1980) DAYS OF HEAVEN Anthony Asquith Award fo r Film Music ACADEMY AWARD NOMINATION (1979) DAYS OF HEAVEN Best Original Score MOTION PICTURES THE HATEFUL EIGHT Richard N.
    [Show full text]
  • CGI Training for the Entertainment Film Industry
    Computer Graphics in Entertainment CGI Training for the Entertainment Jacquelyn Ford Morie Film Industry Blue Sky|VIFX onsider a snapshot from 1996: A bright technology. The company’s animation division isn’t inter- Cyoung woman has just earned a degree ested in computer animation and the exchange does not from a prestigious art college, majoring in computer work out. The graduate student—Ed Catmull—goes on animation (a program her school started four years to found a premier computer animation company.1 ago). She is looking for her first job. An excellent stu- dent artist, top in her class, she does not know how to A bit of history program. She is being courted by all the major West The above scenarios illustrate actual examples of peo- Coast studios and has retained an attorney to get her ple trying to get computer graphics jobs in the enter- the best possible deal (among other things, a starting tainment industry. You may recognize yourself among salary in the $60,000 range). them, depending on when you started in computer Cut back to 1990, just six years graphics. Barely three decades old, the computer graph- earlier: A recent graduate is trying to ics field has been through enormous changes. As the digital film industry find a job. He studied computer Possibilities and experimentation have evolved into graphics as an art student and creat- commonly used and widely accepted tools to create matures, the education ed some respectable short anima- effects, images, and characters for films. The education tions. He took a class in general needed to succeed in the digital entertainment indus- needed to become part of it programming but not graphics pro- try has also changed.
    [Show full text]
  • Sci-Fi/Horror 1
    A short list of interesting selections from our inventory. View this email in your browser Between The Covers Rare Books A conversation between Tom and Ashley: T: What are you doing? A: Making a spooky elist for the Halloween season. T: Halloween’s a season? A: Duh! Try not to be scared of all this Sci-Fi and Horror I’ve assembled. OOooOOoo! T: [walks away] A: I knew it was spooky! eCatalog 30: Sci-fi/Horror 1. Doctor Who: The Auction. Saturday 11th May 1991 London: Bonhams 1991 $100 Auction sale of costumes and related material from the BBC. Read More 2. Clive BARKER The Damnation Game London: Weidenfeld & Nicolson (1985) $50 Author's first novel, one of only 3000 copies published. Read More 3. Leigh BRACKETT The Starmen New York: Gnome Press (1952) $65 Author's first book. Read More 4. Ray BRADBURY I Sing The Body Electric! New York: Alfred A. Knopf 1969 $45 First edition. Read More 5. Ray BRADBURY, Al Feldstein, Wally Wood, Al Williamson, Jack Davis, and Graham Ingels EC Portfolio Five Adel, Iowa: Russ Cochran 1974 $85 An oversized collection of reprints from the E.C. Comics with several complete stories from Ray Bradbury and Al Feldstein with art from Wally Wood, Al Williamson, Jack Davis, and Graham Ingels. Read More 6. Michael CRICHTON Jurassic Park New York: Alfred A. Knopf 1990 $100 Basis for the spectacularly successful Steven Spielberg film. Read More 7. Roald DAHL Kiss Kiss New York: Alfred A. Knopf 1960 $200 The author's third collection of stories, including such macabre classics as "Royal Jelly" and "Georgy Porgy." Read More 8.
    [Show full text]
  • Abbey, Cherie D., Ed. Biography Today: Author Series. Profil
    DOCUMENT RESUME ED 434 064 SO 031 051 AUTHOR Harris, Laurie Lanzen, Ed.; Abbey, Cherie D., Ed. TITLE Biography Today: Author Series. Profiles of People of Interest to Young Readers. Volume 5, 1999. ISBN ISBN-0-7808-0372-8 PUB DATE 1999-00-00 NOTE 194p. AVAILABLE FROM Omnigraphics, Inc., 2500 Penobscot Building, Detroit, MI 48226; Tel: 800-234-1340 (Toll Free). PUB TYPE Books (010) EDRS PRICE MF01/PC08 Plus Postage. DESCRIPTORS *Adolescent Literature; *Authors; Biographies; Childrens Literature; Elementary Secondary Education; Language Arts; *Popular Culture; Profiles; Reading Interests; Recreational Reading; Social Studies; Student Interests; *Supplementary Reading Materials IDENTIFIERS *Biodata; *Illustrators; Writing for Children ABSTRACT As with the regular issues of "Biography Today," this special subject volume on "Authors" was created to appeal to young readers in a format they can enjoy reading and readily understand. Each volume contains alphabetically-arranged sketches. Each entry in the volume provides at least one picture of the individual profiled, and bold-faced rubrics lead readers to information on birth, youth, early memories, education, hobbies, and honors and awards. Each entry ends with a list of easily accessible sources designed to lead the student to further reading on the individual and a current address. Obituary entries are also included and clearly marked in both the table of contents and at the beginning of the entry. Ten authors are profiled in this volume:(1) Sharon Creech;(2) Michael Crichton;(3) Karen Cushman;(4) Tomie dePaola;(5) Lorraine Hansberry;(6) Karen Hesse; (7) Brian Jacques;(8) Gary Soto;(9) Richard Wright; and (10) Laurence Yep. A series of general, places of birth, and birthday indexes is included.
    [Show full text]
  • An Ecofeminist Critique of Universal's Jurassic World Nichole R
    Access*: Interdisciplinary Journal of Student Research and Scholarship Volume 2 | Issue 1 Article 4 2018 The aP rk Is Open: An Ecofeminist Critique of Universal's Jurassic World Nichole R. McHugh University of Washington Tacoma, [email protected] Follow this and additional works at: https://digitalcommons.tacoma.uw.edu/access Part of the Feminist, Gender, and Sexuality Studies Commons, Film and Media Studies Commons, Human Ecology Commons, Place and Environment Commons, Political Science Commons, Politics and Social Change Commons, Race, Ethnicity and Post-Colonial Studies Commons, Sociology of Culture Commons, and the Theory, Knowledge and Science Commons Recommended Citation McHugh, Nichole R. (2018) "The aP rk Is Open: An Ecofeminist Critique of Universal's Jurassic World," Access*: Interdisciplinary Journal of Student Research and Scholarship: Vol. 2 : Iss. 1 , Article 4. Available at: https://digitalcommons.tacoma.uw.edu/access/vol2/iss1/4 This Undergraduate Research Paper is brought to you for free and open access by the Teaching and Learning Center at UW Tacoma Digital Commons. It has been accepted for inclusion in Access*: Interdisciplinary Journal of Student Research and Scholarship by an authorized editor of UW Tacoma Digital Commons. McHugh: The Park Is Open: An Ecofeminist Critique Abstract This paper explores an interpretation of Universal Pictures’ Jurassic World (2015) to identify naturalized representations of human relationships and human relationships to the environment. Using the concepts of scholar Noel Sturgeon, the ideological significance of these representations comes down to what she defines as “Politics of The Natural.” Through this avenue, I analyze Jurassic World as a text and I reflect on normalized environmental worldviews, attitudes and values, as well as how these determine humans’ place in this “naturalized” hierarchy.
    [Show full text]