Michael Crichton

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Michael Crichton Genre: Science fiction/Thrillers/Adventure Remember that huge movie years ago called Jurassic Park? Did you know that was based off of Michael Crichton’s book of the same name? Michael Crichton’s books can extremely detailed and involve science, adventure, political and thriller elements. While most famous for Jurassic Park and it’s sequel, The Lost World, he has written many other books tackling a wide range of subjects. The Great Train Robbery is his foray into historical fiction, and Rising Sun is a suspense story with political elements. Read-a-likes Greg Bear If you the science fiction aspect of Crichton, try Greg Bear. The Forge of God is disaster science fiction where two sets of aliens visit Earth and set in motion humanity’s demise. Darwin’s Radio tackles human evolution, where as Blood Music deals with nanotechnology. Philip Kerr Like Crichton, Kerr’s books are in a wide variety of genres. His Bernie Gunther novels, starting with March Violets, start a detective during the World War II period. The Second Angel and The Grid are science fiction thrillers, much like Crichton’s. Dark Matter: The Private Life of Sir Isaac Newton: A Novel is Kerr’s stab at historical mystery. John Darnton A scientific thriller writer, Darnton’s novels explore human cloning, evolution, and the soul. His book Mind Catcher deals with whether souls can be transferred to a computer chip. Two scientists get caught up in a conspiracy when they discover ancient ancestors of human in Neanderthal. Steven Alten If you have a taste for science fiction thrillers that are on the weird side, try Alten’s books. Meg is about a very large prehistoric shark that is unleashed on the modern day world. The Loch focuses on a certain famous lake in Scotland, whereas Domain centers on aliens and the pyramids..
Recommended publications
  • Beyond Westworld

    Beyond Westworld

    “We Don’t Know Exactly How They Work”: Making Sense of Technophobia in 1973 Westworld, Futureworld, and Beyond Westworld Stefano Bigliardi Al Akhawayn University in Ifrane - Morocco Abstract This article scrutinizes Michael Crichton’s movie Westworld (1973), its sequel Futureworld (1976), and the spin-off series Beyond Westworld (1980), as well as the critical literature that deals with them. I examine whether Crichton’s movie, its sequel, and the 1980s series contain and convey a consistent technophobic message according to the definition of “technophobia” advanced in Daniel Dinello’s 2005 monograph. I advance a proposal to develop further the concept of technophobia in order to offer a more satisfactory and unified interpretation of the narratives at stake. I connect technophobia and what I call de-theologized, epistemic hubris: the conclusion is that fearing technology is philosophically meaningful if one realizes that the limitations of technology are the consequence of its creation and usage on behalf of epistemically limited humanity (or artificial minds). Keywords: Westworld, Futureworld, Beyond Westworld, Michael Crichton, androids, technology, technophobia, Daniel Dinello, hubris. 1. Introduction The 2016 and 2018 HBO series Westworld by Jonathan Nolan and Lisa Joy has spawned renewed interest in the 1973 movie with the same title by Michael Crichton (1942-2008), its 1976 sequel Futureworld by Richard T. Heffron (1930-2007), and the short-lived 1980 MGM TV series Beyond Westworld. The movies and the series deal with androids used for recreational purposes and raise questions about technology and its risks. I aim at an as-yet unattempted comparative analysis taking the narratives at stake as technophobic tales: each one conveys a feeling of threat and fear related to technological beings and environments.
  • Michael Crichton and the Distancing of Scientific Discourse

    Michael Crichton and the Distancing of Scientific Discourse

    ASp la revue du GERAS 55 | 2009 Varia Apparent truth and false reality: Michael Crichton and the distancing of scientific discourse Stéphanie Genty Electronic version URL: http://journals.openedition.org/asp/290 DOI: 10.4000/asp.290 ISBN: 978-2-8218-0408-1 ISSN: 2108-6354 Publisher Groupe d'étude et de recherche en anglais de spécialité Printed version Date of publication: 1 March 2009 Number of pages: 95-106 ISSN: 1246-8185 Electronic reference Stéphanie Genty, « Apparent truth and false reality: Michael Crichton and the distancing of scientific discourse », ASp [Online], 55 | 2009, Online since 01 March 2012, connection on 02 November 2020. URL : http://journals.openedition.org/asp/290 ; DOI : https://doi.org/10.4000/asp.290 This text was automatically generated on 2 November 2020. Tous droits réservés Apparent truth and false reality: Michael Crichton and the distancing of scie... 1 Apparent truth and false reality: Michael Crichton and the distancing of scientific discourse Stéphanie Genty Introduction 1 This article began as an inquiry into the relation of FASP, or professional-based fiction, to professional reality. I was interested in elucidating the ways in which this reality, which formed the basis for such fiction, was transformed by the writer in his/her work and the reasons behind the transformation. Since my own professional activity has been related to the sciences, I chose to study the novels of Michael Crichton, a commercially-successful writer whose credentials and practice qualify him as an author of professional-based fiction as defined by Michel Petit in his 1999 article “La fiction à substrat professionnel: une autre voie d'accès à l'anglais de spécialité”.
  • Complicated Views: Mainstream Cinema's Representation of Non

    Complicated Views: Mainstream Cinema's Representation of Non

    University of Southampton Research Repository Copyright © and Moral Rights for this thesis and, where applicable, any accompanying data are retained by the author and/or other copyright owners. A copy can be downloaded for personal non-commercial research or study, without prior permission or charge. This thesis and the accompanying data cannot be reproduced or quoted extensively from without first obtaining permission in writing from the copyright holder/s. The content of the thesis and accompanying research data (where applicable) must not be changed in any way or sold commercially in any format or medium without the formal permission of the copyright holder/s. When referring to this thesis and any accompanying data, full bibliographic details must be given, e.g. Thesis: Author (Year of Submission) "Full thesis title", University of Southampton, name of the University Faculty or School or Department, PhD Thesis, pagination. Data: Author (Year) Title. URI [dataset] University of Southampton Faculty of Arts and Humanities Film Studies Complicated Views: Mainstream Cinema’s Representation of Non-Cinematic Audio/Visual Technologies after Television. DOI: by Eliot W. Blades Thesis for the degree of Doctor of Philosophy May 2020 University of Southampton Abstract Faculty of Arts and Humanities Department of Film Studies Thesis for the degree of Doctor of Philosophy Complicated Views: Mainstream Cinema’s Representation of Non-Cinematic Audio/Visual Technologies after Television. by Eliot W. Blades This thesis examines a number of mainstream fiction feature films which incorporate imagery from non-cinematic moving image technologies. The period examined ranges from the era of the widespread success of television (i.e.
  • Jurassic Park Feature Matrix

    Jurassic Park Feature Matrix

    Jurassic Park Feature Matrix Main Like the blockbuster movies, the Jurassic Park pinball experience generates heart pounding excitement as the player progresses through the game Attractions Players will be transported to Isla Nublar, attempting to rescue park staff and recapturing escaped dinosaurs from the chaos invoked by Dennis Nedry's computer virus All Jurassic Park pinball machine models feature a unique spinning kinetic newton ball Jungle Explorer Vehicle, three flippers, four ramps and a custom T-Rex sculpt Premium and LE models feature a motorized animatronic ball eating, ball throwing T-Rex mechanism and an interactive Raptor Pen ball lock mechanism Stunning and distinctive hand-drawn artwork by Johnny Bergeron (AKA Johnny Crap) Features John Williams' famous Jurassic Park theme music PRO PREM LE Game Production limited to 500 machines ✓ Features Certificate of Authenticity signed by Gary Stern ✓ LE Designer Autographed collectible featuring signature by game designer Keith Elwin ✓ Only Serialized number plate ✓ Limited Edition illuminated mirrored backglass with stunning and distinctive high definition hand-drawn art ✓ Limited Edition exclusive Midnight Battle theme full color high definition decal cabinet hand-drawn artwork ✓ Limited Edition exclusive inside art blades ✓ Upgraded high definition speaker system with 3-channel amplifier ✓ High definition anti-reflection pinball glass ✓ Shaker motor ✓ Metallic hunter green high gloss powder coated armor and legs ✓ Game Animatronic articulated moving ball eating, ball throwing
  • Global Warming, the Politicization of Science, and Michael Crichton's State of Fear

    Global Warming, the Politicization of Science, and Michael Crichton's State of Fear

    Journal of Scientific Exploration, Vol. 19, No. 2, pp. 247-256, 2005 0892-33 1OlO5 Global Warming, the Politicization of Science, and Michael Crichton's State of Fear College of Geoscience University of Oklahoma Norman, Oklahoma 7301 9 e-mail: ddeming @ou.edu Abstract-Michael Crichton's book State of Fear addresses the politicization of science, in particular the topics of climate change and global warming, through the vehicle of a novel. In the author's opinion, Crichton is correct: the field of climate research has become highly politicized. An example is provided by the revisionist efforts of some researchers to extinguish the existence of a Medieval Warm Period. The politicization of science is a threat to the process of free inquiry necessary for human progress. Keywords: global warming-temperature-Crichton-climate- Medieval Warm Period On December 26, 2004, a magnitude 9.0 earthquake occurred off the coast of Northern Sumatra. The massive temblor, the largest in 40 years, spawned tsunamis that killed more than 280,000 people. The next day, a colleague at a think tank emailed me to ask whether I had any opinions about the new Michael Crichton book, State of Fear (Crichton, 2004). Although State of Fear is a fictional thriller about eco-terrorism, its real thesis is the politicization of science, in particular climate change and global warming. Because global warming is a highly-charged political subject, Crichton's book has received a lot of attention in the press, including a review by Washington Post columnist George Will (Will, 2004). My colleague closed his email with a little joke: P.S.-I'm also anxious to see if anyone blames this weekend's tsunami in Indonesia on global warming.
  • Opinion Where Is Reform Judaism Now That We Need

    Opinion Where Is Reform Judaism Now That We Need

    ---- ------------------------ ••••••••••••••••••••••••5-DIGIT 02906 2239 11/30/ 88 • • 33 Inside: Local News, pages 2-3 R. I . JE WISH HISTOR I CAL ASS OCIATION Opinion, page 4 130 SESSION S ST . PROV 1 DENC E, RI 02906 Around Town, page 8 Anti-Semitism Without Anti-Semites The Battle Of The Blaze In The House Of The Rising Sun by Rabbi Abraham Cooper History has taugh t us to bla med international .Jewish Rockefellers, Duponts, Morgans associate anti-Semitism with conspi racies for a va riety of t he and Mellons! Jews, Japanese threats, di scrimination or violence world's ills - from the overvalued readers a re told, are plotting an against the Jewish people. Yen to an alleged cove r-up of the economic co ll apse fo r 1990 - Throughout the milleni a - from Chern obyl nuclear disaster. One designed to cripple Japan's the Crusades to the Inquisit ion, author - Masami Uno - who economic ascendancy. Other Jews and the 20t h century Nazi professes to be a fundamentalist plot WW III - guaranteed, - they Holocaust - Jews have been the Christian minister, has sold over say, to hasten the coming of the targets of well-organized hate 1.5 million vo lumes of his work s, Mc8siah. campaigns, often designed by in cluding If You Understand the Why the Jews? Clearly, cha ri smatic leaders who ignited J ew - You Will Understand the ext remists in the Arab world who deep-seated religious, cultural and World, ~nd If You Understand the have been promoting t hese political prejudices of the masses.
  • Jurassic Park (1993) and Jurassic World (2015)

    Jurassic Park (1993) and Jurassic World (2015)

    Running Header: A NARRATIVE AND CINEMATIC ANALYSIS OF FILM TRAILERS 1 MASTER OF PROFESSIONAL COMMUNICATION MAJOR RESEARCH PAPER A Narrative and Cinematic Analysis of Two Film Trailers: Jurassic Park (1993) and Jurassic World (2015) Emilie Campbell Greg Elmer The Major Research Paper is submitted in partial fulfillment of the requirements for the degree of Master of Professional Communication Ryerson University Toronto, Ontario, Canada August 10, 2018 2 A NARRATIVE AND CINEMATIC ANALYSIS OF TWO FILM TRAILERS Author’s Declaration for Electronic Submission of a Major Research Paper I hereby declare that I am author of this major research paper (MRP) and research poster. This is a true copy of the MRP, including any required final revisions, as accepted by my examiners. I authorize Ryerson University to lend this MRP and Research Poster to other institutions or individuals for scholarly research. I further authorize Ryerson University to reproduce this thesis by photocopying or by other means, in total or in part, at the request of other institutions or individuals for scholarly research. I understand that this major research paper and research poster could be made electronically available to the public. 3 A NARRATIVE AND CINEMATIC ANALYSIS OF TWO FILM TRAILERS Abstract This study explores the narrative elements of film trailers to help understand their role and purpose within the marketability of trailers. Current literature from Kernan (2004) focuses on the evolution and standing of trailers as the primary marketing and promotional tool within the film industry. However, this major research paper (MRP) focuses on developing an understanding of the function of the narrative within a film trailer and how this impacts its marketability.
  • 1) Michael Crichton's Fantasy About Cloning Dinosaurs, Jurassic Park Contains a Putative Dinosaur DNA Sequence

    1) Michael Crichton's Fantasy About Cloning Dinosaurs, Jurassic Park Contains a Putative Dinosaur DNA Sequence

    1) Michael Crichton's fantasy about cloning dinosaurs, Jurassic Park contains a putative dinosaur DNA sequence. Use nucleotide-nucleotide BLAST against the default nucleotide database to identify the real source of the following sequence: >DinoDNA "Dinosaur DNA" from Crichton's JURASSIC PARK p. 103 nt 1-1200 GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC GGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG TGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGC TGCTCACGCTGTACCTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTG CCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAA AGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAG ATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACT CCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCT GGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGG CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA CGGCTCTTACCAGCCTAACTTCGATCACTGGACCGCTGATCGTCACGGCGATTTATGCCG CACATGGACGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAA CAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAA GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG CTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTG ACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCA ACACGACTTAACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACCTTGTCTGCCTCCCC GCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGG CCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGG CCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCT 2) Mark Boguski of the NBCI noticed
  • Jurassic Park”!

    Jurassic Park”!

    TwoSYNOPSIS: paleontologists are offered the chance of a lifetime when they are asked to inspect a new park where dinosaurs have literally come to life. But when a technical issue results in the dinosaurs being set free, this chance of a lifetime becomes a run for their life as everyone in park tries to escape to safety. Get ready to help “life find a way” with this week’s exciting film “Jurassic Park”! After the movie, check out some of our fun activities and games below to bring the adventure from “Jurassic Park” into your own home! Pop some popcorn, grab TheDESIGN scientists in A“Jurassic DINO Park” used fossils and DNA to bring dinosaurs a pillow and get ready from the past back to life. While the dinosaurs in the film ended up not for an adventure in your being quite what they seemed at first, they still looked like the dinosaurs own home! Join us every we know from fossils and records. But what if the scientists in the movie week for Sam Noble tried to combine different types of dinosaurs to create a new, unique Movie Night, where we one? Follow the steps below to try to design a dinosaur of your own! will bring some of your favorite movies to life • On separate pieces of paper, write the features for the categories: with fun activities and games that bring the Legs: Special Features: movie experience right o Two legs o Horns into your living room! o Four legs o Sharp teeth Neck: o Beak o Long neck o Armor o Short neck o Spikes Tail: o Frill (the large part at the o Long tail back of Triceratop’s head) NOW o Short tail SHOWING • Put the pieces of paper from each category in their own separate JURASSIC containers or piles PARK • Pick one random piece of paper each from the “neck”, “legs” and “tail” categories (1993) • Pick two random pieces of paper from the “special features” category Rated PG-13 • Use the features you selected to design your own dinosaur! Draw or paint your dinosaur on a piece of paper or use some playdough.
  • GUIDE for Rider Safety and Accessibility Ver

    UNIVERSAL ORLANDO RESORT GUIDE FOR Rider Safety and Accessibility ver. 2021.06 UNIVERSAL STUDIOS FLORIDA AND UNIVERSAL’S ISLANDS OF ADVENTURE Welcome to Universal Orlando Resort We have provided this guide to give you as much detailed information about each attraction experience as possible. Our goal is to ensure that everyone is able to make well-informed decisions about their ability to safely, comfortably, and conveniently experience each of our attractions. If, at any time, you feel that you do not have enough information to make these decisions, please feel free to contact us. Additionally, we have included specific information for Guests with disabilities. This information provides a clear outline of the accommodations at each attraction, as well as the physical requirements for entering or exiting ride vehicles and other attraction areas. It is important to note that although all of our Attractions Attendants are eager to make your day as pleasant as possible, they are not trained in lifting or carrying techniques and therefore cannot provide physical assistance. We suggest that Guests with disabilities bring a companion who can provide any physical assistance that may be needed. Our goal is to provide the best accommodations possible to all of our Guests. With the information that follows, and with the information our Team Members can provide in answering questions, we are confident the experience you have with us will exceed your expectations. How to Contact Us You can message us at www.visitorsatisfaction.com/contactus/. Guest Services Coordinators are available seven days a week from 8:30AM until park close and make every effort to respond to messages in 24 to 48 hours; however, due to current high volume of emails received each day, please allow several days for a response.
  • Remixing Generalized Symbolic Media in the New Scientific Novel Søren Brier

    Remixing Generalized Symbolic Media in the New Scientific Novel Søren Brier

    Ficta: remixing generalized symbolic media in the new scientific novel Søren Brier To cite this version: Søren Brier. Ficta: remixing generalized symbolic media in the new scientific novel. Public Un- derstanding of Science, SAGE Publications, 2006, 15 (2), pp.153-174. 10.1177/0963662506059441. hal-00571086 HAL Id: hal-00571086 https://hal.archives-ouvertes.fr/hal-00571086 Submitted on 1 Mar 2011 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. SAGE PUBLICATIONS (www.sagepublications.com) PUBLIC UNDERSTANDING OF SCIENCE Public Understand. Sci. 15 (2006) 153–174 Ficta: remixing generalized symbolic media in the new scientific novel1 Søren Brier This article analyzes the use of fictionalization in popular science commu- nication as an answer to changing demands for science communication in the mass media. It concludes that a new genre—Ficta—arose especially with the work of Michael Crichton. The Ficta novel is a fiction novel based on a real scientific problem, often one that can have or already does have serious consequences for our culture or civilization. The Ficta novel is a new way for the entertainment society to reflect on scientific theories, their consequences and meaning.
  • Ennio Morricone

    Ennio Morricone

    ENNIO MORRICONE AWARDS & NOMINATIONS *selected ACADEMY AWARD NOMINATION (2015) THE HATEFUL EIGHT Best Original Score GOLDEN GLOBE AWARD (2016) THE HATEFUL EIGHT Best Original Score BAFTA AWARD (2016) THE HATEFUL EIGHT Original Music CRITICS’ CHOICE AWARD (2016) THE HATEFUL EIGHT Best Score ACADEMY AWARD (2007) For magnificent and multifaceted contributions to the HONORARY AWARD art of film music ACADEMY AWARD NOMINATION (2000) MALENA Best Original Score GOLDEN GLOBE NOMINATION (2000) MALENA Best O riginal Score GOLDEN GLOBE AWARD (1999) THE LEGEND OF 1900 Best Original Score GRAMMY AWARD NOMINATION (1998) BULWORTH Best Instrumental Composition Written for a Motion Picture or Television GRAMMY AWARD NOMINATION (1996) THE STAR MAKER Best Instrumental Composition Written for a Motion Picture or Television GRAMMY AWARD NOMINATION (1994) WOLF Best Instrumental Composition Written for a Motion Picture or Television ACADEMY AWARD NOMINATION (1991) BUGSY Best Original Score GOLDEN GLOBE NOMINATION (1991) BUGSY Best Original Score BAFTA AWARD (1991) CINEMA PARADISO Best Original Score GOLDEN GLOBE NOMINATION (1990) CASUALTIES OF WAR Best Original Score 1 The Gorfaine/Schwartz Agency, Inc. (818) 260-8500 ENNIO MORRICONE ACADEMY AWARD NOMINATION (1987) THE UNTOUCHABLES Best Original Score BAFTA AWARD (1988) THE UNTOUCHABLES Best Original Score GOLDEN GLOBE NOMINATION (1988) THE UNTOUCHABLES Best Original Score BAFTA AWARD (1987) THE MISSION Best Original Score ACADEMY AWARD NOMINATION (1986) THE MISSION Best Original Score GOLDEN GLOBE AWARD (1986) THE MISSION Best Original Score BAFTA AWARD (1985) ONCE UPON A TIME IN AMERICA Best Original Score GOLDEN GLOBE NOMINATION (1985) ONCE UPON A TIME IN AMERICA Best Original Score BAFTA AWARD (1980) DAYS OF HEAVEN Anthony Asquith Award fo r Film Music ACADEMY AWARD NOMINATION (1979) DAYS OF HEAVEN Best Original Score MOTION PICTURES THE HATEFUL EIGHT Richard N.