Aliens Cause Global Warming by Michael Crichton
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Beyond Westworld
“We Don’t Know Exactly How They Work”: Making Sense of Technophobia in 1973 Westworld, Futureworld, and Beyond Westworld Stefano Bigliardi Al Akhawayn University in Ifrane - Morocco Abstract This article scrutinizes Michael Crichton’s movie Westworld (1973), its sequel Futureworld (1976), and the spin-off series Beyond Westworld (1980), as well as the critical literature that deals with them. I examine whether Crichton’s movie, its sequel, and the 1980s series contain and convey a consistent technophobic message according to the definition of “technophobia” advanced in Daniel Dinello’s 2005 monograph. I advance a proposal to develop further the concept of technophobia in order to offer a more satisfactory and unified interpretation of the narratives at stake. I connect technophobia and what I call de-theologized, epistemic hubris: the conclusion is that fearing technology is philosophically meaningful if one realizes that the limitations of technology are the consequence of its creation and usage on behalf of epistemically limited humanity (or artificial minds). Keywords: Westworld, Futureworld, Beyond Westworld, Michael Crichton, androids, technology, technophobia, Daniel Dinello, hubris. 1. Introduction The 2016 and 2018 HBO series Westworld by Jonathan Nolan and Lisa Joy has spawned renewed interest in the 1973 movie with the same title by Michael Crichton (1942-2008), its 1976 sequel Futureworld by Richard T. Heffron (1930-2007), and the short-lived 1980 MGM TV series Beyond Westworld. The movies and the series deal with androids used for recreational purposes and raise questions about technology and its risks. I aim at an as-yet unattempted comparative analysis taking the narratives at stake as technophobic tales: each one conveys a feeling of threat and fear related to technological beings and environments. -
Accommodating Climate Change Science: James Hansen and the Rhetorical/Political Emergence of Global Warming
Science in Context 26(1), 137–152 (2013). Copyright ©C Cambridge University Press doi:10.1017/S0269889712000312 Accommodating Climate Change Science: James Hansen and the Rhetorical/Political Emergence of Global War ming Richard D. Besel California Polytechnic State University E-mail: [email protected] Argument Dr. James Hansen’s 1988 testimony before the U.S. Senate was an important turning point in the history of global climate change. However, no studies have explained why Hansen’s scientific communication in this deliberative setting was more successful than his testimonies of 1986 and 1987. This article turns to Hansen as an important case study in the rhetoric of accommodated science, illustrating how Hansen successfully accommodated his rhetoric to his non-scientist audience given his historical conditions and rhetorical constraints. This article (1) provides a richer explanation for the rhetorical/political emergence of global warming as an important public policy issue in the United States during the late 1980s and (2) contributes to scholarly understanding of the rhetoric of accommodated science in deliberative settings, an often overlooked area of science communication research. Standing on the promontory of the rocky rims in Billings, Montana, there is usually a distinct horizontal line between the clear, blue sky and the white, snowcapped Beartooth Mountains. But the summer of 1988 was different. A fuzzy, reddish tint lingered across the once pristine skyline of “Big Sky Country.” The reason: More than one hundred miles to the south, Yellowstone National Park smoldered in one of the most devastating forest fires of the twentieth century (Anon. 1988, A18; Stevens 1999, 129–130). -
Michael Crichton
Michael Crichton Genre: Science fiction/Thrillers/Adventure Remember that huge movie years ago called Jurassic Park? Did you know that was based off of Michael Crichton’s book of the same name? Michael Crichton’s books can extremely detailed and involve science, adventure, political and thriller elements. While most famous for Jurassic Park and it’s sequel, The Lost World, he has written many other books tackling a wide range of subjects. The Great Train Robbery is his foray into historical fiction, and Rising Sun is a suspense story with political elements. Read-a-likes Greg Bear If you the science fiction aspect of Crichton, try Greg Bear. The Forge of God is disaster science fiction where two sets of aliens visit Earth and set in motion humanity’s demise. Darwin’s Radio tackles human evolution, where as Blood Music deals with nanotechnology. Philip Kerr Like Crichton, Kerr’s books are in a wide variety of genres. His Bernie Gunther novels, starting with March Violets, start a detective during the World War II period. The Second Angel and The Grid are science fiction thrillers, much like Crichton’s. Dark Matter: The Private Life of Sir Isaac Newton: A Novel is Kerr’s stab at historical mystery. John Darnton A scientific thriller writer, Darnton’s novels explore human cloning, evolution, and the soul. His book Mind Catcher deals with whether souls can be transferred to a computer chip. Two scientists get caught up in a conspiracy when they discover ancient ancestors of human in Neanderthal. Steven Alten If you have a taste for science fiction thrillers that are on the weird side, try Alten’s books. -
The Dilemma of Reticence: Helmut Landsberg, Stephen Schneider, and Public Communication of Climate Risk, 1971-1976
History of Meteorology 6 (2014) 53 The Dilemma of Reticence: Helmut Landsberg, Stephen Schneider, and public communication of climate risk, 1971-1976 Gabriel Henderson Aarhus University Aarhus, Denmark “Most of the crucial issues of human survival that will confront humanity over the next few decades will call for ethical and political value judgments – decisions on how to act in the face of uncertainties. … Human value judgments are too important to be left exclusively to the experts.” – Stephen Schneider1 “Science is not as objective as some people think. Often human value judgments (or even prejudices) make things move as much as curiosity or the search for answers as to ‘why.’” – Helmut Landsberg2 During the tumultuous mid-1970s, when energy and food shortages, environmental pollution, and political instability induced suspicions that America was increasingly susceptible to increased climatic instability, American climatologists Helmut Landsberg and Stephen Schneider disagreed strongly on whether scientists should engage the public about the future risks and urgency of climate change. On the one hand, Schneider, a young climate modeler with the National Center for Atmospheric Research (NCAR), expressed explicitly an unwillingness to embrace reticence as an appropriate response to the risks of climate change. To illustrate the gravity of the situation, he frequently resorted to vivid and frightening metaphors to convince the public and policy makers that I want to express my gratitude to Ruth Morgan and the anonymous reviewer who contributed thoughtful suggestions to improve and refine the scope of this article. I would also like to thank my colleagues at the Center for Science Studies at Aarhus University for their suggestions to strengthen my narrative and flow of argument: Dania Achermann, Matthias Heymann, and Janet Martin-Nielsen. -
Michael Crichton and the Distancing of Scientific Discourse
ASp la revue du GERAS 55 | 2009 Varia Apparent truth and false reality: Michael Crichton and the distancing of scientific discourse Stéphanie Genty Electronic version URL: http://journals.openedition.org/asp/290 DOI: 10.4000/asp.290 ISBN: 978-2-8218-0408-1 ISSN: 2108-6354 Publisher Groupe d'étude et de recherche en anglais de spécialité Printed version Date of publication: 1 March 2009 Number of pages: 95-106 ISSN: 1246-8185 Electronic reference Stéphanie Genty, « Apparent truth and false reality: Michael Crichton and the distancing of scientific discourse », ASp [Online], 55 | 2009, Online since 01 March 2012, connection on 02 November 2020. URL : http://journals.openedition.org/asp/290 ; DOI : https://doi.org/10.4000/asp.290 This text was automatically generated on 2 November 2020. Tous droits réservés Apparent truth and false reality: Michael Crichton and the distancing of scie... 1 Apparent truth and false reality: Michael Crichton and the distancing of scientific discourse Stéphanie Genty Introduction 1 This article began as an inquiry into the relation of FASP, or professional-based fiction, to professional reality. I was interested in elucidating the ways in which this reality, which formed the basis for such fiction, was transformed by the writer in his/her work and the reasons behind the transformation. Since my own professional activity has been related to the sciences, I chose to study the novels of Michael Crichton, a commercially-successful writer whose credentials and practice qualify him as an author of professional-based fiction as defined by Michel Petit in his 1999 article “La fiction à substrat professionnel: une autre voie d'accès à l'anglais de spécialité”. -
Complicated Views: Mainstream Cinema's Representation of Non
University of Southampton Research Repository Copyright © and Moral Rights for this thesis and, where applicable, any accompanying data are retained by the author and/or other copyright owners. A copy can be downloaded for personal non-commercial research or study, without prior permission or charge. This thesis and the accompanying data cannot be reproduced or quoted extensively from without first obtaining permission in writing from the copyright holder/s. The content of the thesis and accompanying research data (where applicable) must not be changed in any way or sold commercially in any format or medium without the formal permission of the copyright holder/s. When referring to this thesis and any accompanying data, full bibliographic details must be given, e.g. Thesis: Author (Year of Submission) "Full thesis title", University of Southampton, name of the University Faculty or School or Department, PhD Thesis, pagination. Data: Author (Year) Title. URI [dataset] University of Southampton Faculty of Arts and Humanities Film Studies Complicated Views: Mainstream Cinema’s Representation of Non-Cinematic Audio/Visual Technologies after Television. DOI: by Eliot W. Blades Thesis for the degree of Doctor of Philosophy May 2020 University of Southampton Abstract Faculty of Arts and Humanities Department of Film Studies Thesis for the degree of Doctor of Philosophy Complicated Views: Mainstream Cinema’s Representation of Non-Cinematic Audio/Visual Technologies after Television. by Eliot W. Blades This thesis examines a number of mainstream fiction feature films which incorporate imagery from non-cinematic moving image technologies. The period examined ranges from the era of the widespread success of television (i.e. -
Global Warming, the Politicization of Science, and Michael Crichton's State of Fear
Journal of Scientific Exploration, Vol. 19, No. 2, pp. 247-256, 2005 0892-33 1OlO5 Global Warming, the Politicization of Science, and Michael Crichton's State of Fear College of Geoscience University of Oklahoma Norman, Oklahoma 7301 9 e-mail: ddeming @ou.edu Abstract-Michael Crichton's book State of Fear addresses the politicization of science, in particular the topics of climate change and global warming, through the vehicle of a novel. In the author's opinion, Crichton is correct: the field of climate research has become highly politicized. An example is provided by the revisionist efforts of some researchers to extinguish the existence of a Medieval Warm Period. The politicization of science is a threat to the process of free inquiry necessary for human progress. Keywords: global warming-temperature-Crichton-climate- Medieval Warm Period On December 26, 2004, a magnitude 9.0 earthquake occurred off the coast of Northern Sumatra. The massive temblor, the largest in 40 years, spawned tsunamis that killed more than 280,000 people. The next day, a colleague at a think tank emailed me to ask whether I had any opinions about the new Michael Crichton book, State of Fear (Crichton, 2004). Although State of Fear is a fictional thriller about eco-terrorism, its real thesis is the politicization of science, in particular climate change and global warming. Because global warming is a highly-charged political subject, Crichton's book has received a lot of attention in the press, including a review by Washington Post columnist George Will (Will, 2004). My colleague closed his email with a little joke: P.S.-I'm also anxious to see if anyone blames this weekend's tsunami in Indonesia on global warming. -
1) Michael Crichton's Fantasy About Cloning Dinosaurs, Jurassic Park Contains a Putative Dinosaur DNA Sequence
1) Michael Crichton's fantasy about cloning dinosaurs, Jurassic Park contains a putative dinosaur DNA sequence. Use nucleotide-nucleotide BLAST against the default nucleotide database to identify the real source of the following sequence: >DinoDNA "Dinosaur DNA" from Crichton's JURASSIC PARK p. 103 nt 1-1200 GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC GGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG TGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGC TGCTCACGCTGTACCTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTG CCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAA AGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAG ATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACT CCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCT GGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGG CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA CGGCTCTTACCAGCCTAACTTCGATCACTGGACCGCTGATCGTCACGGCGATTTATGCCG CACATGGACGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAA CAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAA GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG CTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTG ACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCA ACACGACTTAACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACCTTGTCTGCCTCCCC GCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGG CCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGG CCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCT 2) Mark Boguski of the NBCI noticed -
How We Got Here: the 70'S
HOW WE GOT HERE: THE 70’S. Book review David Frum How We Got Here: The 70’s: The Decade that Brought You Modern Life—For Better or For Worse. (Toronto: Random House Canada; 2000) pp. xxiv + 419 pages, hardcover, ISBN 0-679-30966-7 James Allan Evans h, the seventies! According to tion in faculty hiring, produced a well- t was a period when experts created my calculations, David Frum footnoted report which concluded I problems for the best reasons, and A was only ten years old when that they did. There followed a brief then established programs to repair they started, but he is a qualified post- bout of academic breast-beating, but them. For instance: dyslexia, which NAFTA observer, having spent his boy- the Canadians are not a recognized baffled educationists. “Dyslexia” does hood in Toronto and his university victim group and in any case, the not refer to tiresome rhetoric, as its years at Yale and Harvard. The war in attention span in the Groves of Greek roots imply, but rather the Vietnam ended in the 1970s with an Academe is short. The Symons Report inability to read. Parents noticed that undignified American exit. While it generated no “rights” and was soon some of their offspring, who had been lasted, it brought Canada a string of forgotten. The péquiste government of taught reading according to the most Vietnam refugees, and refugee partners René Lévesque was elected, and up-to-date methods, could not read at or mothers, including Diane Francis Quebec’s first referendum closed the all. -
Remixing Generalized Symbolic Media in the New Scientific Novel Søren Brier
Ficta: remixing generalized symbolic media in the new scientific novel Søren Brier To cite this version: Søren Brier. Ficta: remixing generalized symbolic media in the new scientific novel. Public Un- derstanding of Science, SAGE Publications, 2006, 15 (2), pp.153-174. 10.1177/0963662506059441. hal-00571086 HAL Id: hal-00571086 https://hal.archives-ouvertes.fr/hal-00571086 Submitted on 1 Mar 2011 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. SAGE PUBLICATIONS (www.sagepublications.com) PUBLIC UNDERSTANDING OF SCIENCE Public Understand. Sci. 15 (2006) 153–174 Ficta: remixing generalized symbolic media in the new scientific novel1 Søren Brier This article analyzes the use of fictionalization in popular science commu- nication as an answer to changing demands for science communication in the mass media. It concludes that a new genre—Ficta—arose especially with the work of Michael Crichton. The Ficta novel is a fiction novel based on a real scientific problem, often one that can have or already does have serious consequences for our culture or civilization. The Ficta novel is a new way for the entertainment society to reflect on scientific theories, their consequences and meaning. -
What Is the Economic Cost of Climate Change?*
August 2008 WHAT IS THE ECONOMIC COST OF CLIMATE CHANGE?* Michael Hanemann 1. INTRODUCTION Much of the economic analysis of climate change revolves around two big questions: What is the economic cost associated with the impacts of climate change under alternative GHG emissions scenarios? What is the economic cost of reducing GHG emissions? The economic aspect of the policy debate intensified with the publication in the UK of the Stern Review of the Economics of Climate Change (Stern, 2006). Stern concluded that, if no mitigative action is taken, “the overall costs and risks of climate change will be equivalent to losing at least 5% of global Gross Domestic Product (GDP) each year, now and forever.” This conclusion has been criticized by many economists, particularly in the United States, where Professor William Nordhaus of Yale, the leading American expert on climate economics, concludes that the economically optimal policy involves only a modest rate of emission reduction in the near term, followed by larger reductions later (Nordhaus 2008). The disagreement between Stern and Nordhaus has aroused considerable interest. Much of the existing discussion focuses on the difference in the discount rate – Stern uses a consumption rate of discount average 1.4% per annum, while Nordhaus uses one averaging 4%. 1 However, I believe that another important factor is the difference in the raw assessment of undiscounted damages from climate change. Because of limited space, that difference is the focus of this chapter. 2 Compared to most other assessments, including those of the DICE model in Nordhaus and Boyer (2000), the Stern Review takes a more pessimistic view of the potential adverse impacts from climate change. -
Ennio Morricone
ENNIO MORRICONE AWARDS & NOMINATIONS *selected ACADEMY AWARD NOMINATION (2015) THE HATEFUL EIGHT Best Original Score GOLDEN GLOBE AWARD (2016) THE HATEFUL EIGHT Best Original Score BAFTA AWARD (2016) THE HATEFUL EIGHT Original Music CRITICS’ CHOICE AWARD (2016) THE HATEFUL EIGHT Best Score ACADEMY AWARD (2007) For magnificent and multifaceted contributions to the HONORARY AWARD art of film music ACADEMY AWARD NOMINATION (2000) MALENA Best Original Score GOLDEN GLOBE NOMINATION (2000) MALENA Best O riginal Score GOLDEN GLOBE AWARD (1999) THE LEGEND OF 1900 Best Original Score GRAMMY AWARD NOMINATION (1998) BULWORTH Best Instrumental Composition Written for a Motion Picture or Television GRAMMY AWARD NOMINATION (1996) THE STAR MAKER Best Instrumental Composition Written for a Motion Picture or Television GRAMMY AWARD NOMINATION (1994) WOLF Best Instrumental Composition Written for a Motion Picture or Television ACADEMY AWARD NOMINATION (1991) BUGSY Best Original Score GOLDEN GLOBE NOMINATION (1991) BUGSY Best Original Score BAFTA AWARD (1991) CINEMA PARADISO Best Original Score GOLDEN GLOBE NOMINATION (1990) CASUALTIES OF WAR Best Original Score 1 The Gorfaine/Schwartz Agency, Inc. (818) 260-8500 ENNIO MORRICONE ACADEMY AWARD NOMINATION (1987) THE UNTOUCHABLES Best Original Score BAFTA AWARD (1988) THE UNTOUCHABLES Best Original Score GOLDEN GLOBE NOMINATION (1988) THE UNTOUCHABLES Best Original Score BAFTA AWARD (1987) THE MISSION Best Original Score ACADEMY AWARD NOMINATION (1986) THE MISSION Best Original Score GOLDEN GLOBE AWARD (1986) THE MISSION Best Original Score BAFTA AWARD (1985) ONCE UPON A TIME IN AMERICA Best Original Score GOLDEN GLOBE NOMINATION (1985) ONCE UPON A TIME IN AMERICA Best Original Score BAFTA AWARD (1980) DAYS OF HEAVEN Anthony Asquith Award fo r Film Music ACADEMY AWARD NOMINATION (1979) DAYS OF HEAVEN Best Original Score MOTION PICTURES THE HATEFUL EIGHT Richard N.