DOCSLIB.ORG

Somatic MYH7, MYBPC3, TPM1, TNNT2 and TNNI3 Mutations In

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Somatic MYH7, MYBPC3, TPM1, TNNT2 and TNNI3 Mutations In Circulation Journal Supplementary File Official Journal of the Japanese Circulation Society http://www.j-circ.or.jp Circ J 2013; 77: 2358 – 2365 Somatic MYH7, MYBPC3, TPM1, TNNT2 and TNNI3 Mutations in Sporadic Hypertrophic Cardiomyopathy Lucía Núñez, PhD; Juan Ramón Gimeno-Blanes, MD, PhD; María Isabel Rodríguez-García, BSc, PhD; Lorenzo Monserrat, MD, PhD; Esther Zorio, MD; Caroline Coats, BSc; Christopher G. McGregor, MD; Juan Pedro Hernandez del Rincón, MD, PhD; Alfonso Castro-Beiras, MD, PhD; Manuel Hermida-Prieto, BSc, PhD ——— Supplementary File 1 ——— Table S1. Mutations Previously Described in the Literature Familial studies: FH Index Presence of Mutation CA/CAN/CNS/ Functional studies of Other information Ref. cases other mutations NCA/NCNA/OM SCD MYBPC3 A216T 2 Not performed Not performed Y S1, S2 V219L 2 Performed (NI) Not performed S3, S4 E258K 12 Performed: The dramatic change in Y MYBPC3-R834W, Founder effect S5–S13 7/2/0/0/1/4/1 charge associated with MYBPC3-L1200P, suggested the E258K must be the MYH7-R869H, Could affect the splice responsible of the damage. TNNI3-A86fs site (exon 6 skipped) Haploinsufficiency seem and could produce to be the procedure premature termination implicated to cause the Structure: surface of disease. the C1 domain structure G278E 4 Not performed Not performed S14–S17 IVS14–13G>A 2 Performed: Not performed S18, S19 1/0/0/0/0/0 R495W 3 Performed: Not performed Y Hotspots: R495W/ S2, S20–S22 1/2/0/0/0/0 R495Q/R495G R502W 54 Performed: May only be degraded Y MYBPC3-S858N, Hotspots: R502W/ S1, S3, S4, 17/5/15/0/14/4 by the UPS MYBPC3-E542Q, R502Q S10, MYBPC3-G148R, S14–S16, MYH7-D587N S22–S29 IVS17+4A>T 2 Performed (NI) Haploinsufficiency Y TNNT2-R286H S4, S10, S24, seems to be the proce- S28 dure implicated A833T 12 Performed: Haploinsufficiency Y MYBPC3-IVS23- Founder effect S3, S5, S16, 8/3/0/2/2/1 seems to be the proce- 2delA, suggested S30–S35 dure implicated MYH7-L390V, Hotspots: A833T, May disrupt the bonds TNNT2-R286H A833V between EF-Motif 6 and Found the mutated BC-Motif 7, resulting in allele in 2 of 200 incorrect packing and healthy controls assembly of MyBPC IVS23–2A>G 3 Not performed Not performed S3, S6, S36 R1022P 5 Performed: Not performed MYH7-A868P, S2, S16, 3/0/0/2/0/0 MYBPC3-R810L S17, S37 IVS30+5G>C 1 Performed: Not performed S38 8/1/0/0/7/0 MYH7 V606M 18 Performed: Show defects in the Y MYPN-P1112L Associated with benign S14, S16, 21/2/0/0/7/0 ATPase activity. effect S17, S24, S39–S62 R719Q 18 Performed: Large effect on phos- Y MYBPC3-V158M, Hotspots: R719Q/ S1, S3, 6/2/0/0/0/3 phorylation-dependent MYBPC3-R273H, R719W/R719P S14–S17, regulation MYH7-T1513S S24, S25, Could have an effect on S28, S50, motility S51, S53, Presented moderately S61, reduced level of force S63–S75 Alters gene transcription A797T 21 Performed: Not performed Y Milder clinical disease S4, S6, S55, 18/22/0/0/31/0 course S67, S69, Founder mutation S76–S82 K847E 7 Performed (NI) Not performed Favorable prognosis S4, S83 K847del 4 Not performed Not performed S69, S84–S85 E1356K 5 Not performed Thermodynamically Y S16, S37, destabilized the protein S69, and decreased the S86–S88 ability of the protein to form filaments TNNT2 R278C 7 Performed: Not performed Y Hotspots: R278C/ S38, 3/0/0/0/0/0 R278P S89–S92 TNNI3 R186Q 11 Performed: Not performed Y S14, S16, 5/6/0/0/8/0 S17, S75, S93–S97 CA, carriers affected; CAN, carriers non-affected; CNS, carriers non-evaluated clinically; FH, family history; NCA, non-carriers affected; NCNA, non-carriers non-affected; NI, non-specific information given; OM, carriers of other mutations; SCD, sudden cardiac death; UPS, ubiq- uitin-proteosome system. Circulation Journal Vol.77, September 2013 Rhythm 2012; 9: 57 – 63. Supplementary References S28. Marston SB. How do mutations in contractile proteins cause the S1. Fokstuen S, Lyle R, Munoz A, Gehrig C, Lerch R, Perrot A, et al. primary familial cardiomyopathies? J Cardiovasc Transl Res 2011; A DNA resequencing array for pathogenic mutation detection in 4: 245 – 255. hypertrophic cardiomyopathy. Hum Mutat 2008; 29: 879 – 885. S29. Kindel SJ, Miller EM, Gupta R, Cripe LH, Hinton RB, Spicer RL, S2. Rodríguez-García MI, Monserrat L, Ortiz M, Fernández X, Cazón et al. Pediatric cardiomyopathy: Importance of genetic and meta- L, Núñez L, et al. Screening mutations in myosin binding protein bolic evaluation. J Card Fail 2012; 18: 396 – 403. C3 gene in a cohort of patients with Hypertrophic Cardiomyopathy. S30. Alders M, Jongbloed R, Deelen W, van den Wijngaard A, BMC Med Genet 2010; 11: 67. Doevendans P, Ten Cate F, et al. The 2373insG mutation in the S3. Van Driest SL, Vasile VC, Ommen SR, Will ML, Tajik AJ, Gersh MYBPC3 gene is a founder mutation, which accounts for nearly BJ, et al. Myosin binding protein C mutations and compound het- one-fourth of the HCM cases in the Netherlands. Eur Heart J 2003; erozygosity in hypertrophic cardiomyopathy. J Am Coll Cardiol 24: 1848 – 1853. 2004; 44: 1903 – 1910. S31. Mörner S, Richard P, Kazzam E, Hellman U, Hainque B, Schwartz S4. Kaski JP, Syrris P, Esteban MT, Jenkins S, Pantazis A, Deanfield K, et al. Identification of the genotypes causing hypertrophic car- JE, et al. Prevalence of sarcomere protein gene mutations in pre- diomyopathy in northern Sweden. J Mol Cell Cardiol 2003; 35: adolescent children with hypertrophic cardiomyopathy. Circ Car- 841 – 849. diovasc Genet 2009; 2: 436 – 441. S32. Hershberger RE, Norton N, Morales A, Li D, Siegfried JD, Gonzalez- S5. Andersen PS, Havndrup O, Hougs L, Sørensen KM, Jensen M, Quintana J. Coding sequence rare variants identified in MYBPC3, Larsen LA, et al. Diagnostic yield, interpretation, and clinical utility MYH6, TPM1, TNNC1, and TNNI3 from 312 patients with famil- of mutation screening of sarcomere encoding genes in Danish hy- ial or idiopathic dilated cardiomyopathy. Circ Cardiovasc Genet pertrophic cardiomyopathy patients and relatives. Hum Mutat 2009; 2010; 3: 155 – 161. 30: 363 – 370. S33. Rampersaud E, Siegfried JD, Norton N, Li D, Martin E, Hershberger S6. Girolami F, Olivotto I, Passerini I, Zachara E, Nistri S, Re F, et al. RE. Rare variant mutations identified in pediatric patients with di- A molecular screening strategy based on beta-myosin heavy chain, lated cardiomyopathy. Prog Pediatr Cardiol 2011; 31: 39 – 47. cardiac myosin binding protein C and troponin T genes in Italian S34. Posch MG, Waldmuller S, Müller M, Scheffold T, Fournier D, patients with hypertrophic cardiomyopathy. J Cardiovasc Med 2006; Andrade-Navarro MA, et al. Cardiac alpha-myosin (MYH6) is the 7: 601 – 607. predominant sarcomeric disease gene for familial atrial septal de- S7. Hofman N, Tan HL, Clur SA, Alders M, van Langen IM, Wilde fects. PLoS One 2011; 6: e28872, doi:10.1371/journal.pone.0028872. AA. Contribution of inherited heart disease to sudden cardiac death S35. Brion M, Allegue C, Santori M, Gil R, Blanco-Verea A, Haas C, et in childhood. Pediatrics 2007; 120: e967 – e973, doi:10.1542/peds. al. Sarcomeric gene mutations in sudden infant death syndrome 2006-3751. (SIDS). Forensic Sci Int 2012; 219: 278 – 281. S8. Govada L, Carpenter L, da Fonseca PC, Helliwell JR, Rizkallah P, S36. Roncarati R, Latronico MV, Musumeci B, Aurino S, Torella A, Bang Flashman E, et al. Crystal structure of the C1 domain of cardiac ML, et al. Unexpectedly low mutation rates in beta-myosin heavy myosin binding protein-C: Implications for hypertrophic cardiomy- chain and cardiac myosin binding protein genes in Italian patients opathy. J Mol Biol 2008; 378: 387 – 397. with hypertrophic cardiomyopathy. J Cell Physiol 2011; 226: 2894 – S9. Ehlermann P, Weichenhan D, Zehelein J, Steen H, Pribe R, Zeller 2900. R, et al. Adverse events in families with hypertrophic or dilated S37. Brito D, Madeira H. Malignant mutations in hypertrophic cardio- cardiomyopathy and mutations in the MYBPC3 gene. BMC Med myopathy: Fact or fancy? Rev Port Cardiol 2005; 24: 1137 – 1146. Genet 2008; 9: 95. S38. Watkins H, Conner D, Thierfelder L, Jarcho JA, MacRae C, S10. Marston S, Copeland O, Jacques A, Livesey K, Tsang V, McKenna McKenna WJ, et al. Mutations in the cardiac myosin binding pro- WJ, et al. Evidence from human myectomy samples that MYBPC3 tein-C gene on chromosome 11 cause familial hypertrophic cardio- mutations cause hypertrophic cardiomyopathy through haploinsuf- myopathy. Nat Genet 1995; 11: 434 – 437. ficiency.Circ Res 2009; 105: 219 – 222. S39. Watkins H, Thierfelder L, Anan R, Jarcho J, Matsumori A, S11. Skrzynia C, Demo EM, Baxter SM. Genetic counseling and testing McKenna W, et al. Independent origin of identical beta cardiac for hypertrophic cardiomyopathy: An adult perspective. J Cardio- myosin heavy-chain mutations in hypertrophic cardiomyopathy. vasc Transl Res 2009; 2: 493 – 499. Am J Hum Genet 1993; 53: 1180 – 1185. S12. Demo EM, Skrzynia C, Baxter S. Genetic counseling and testing S40. Fananapazir L, Epstein ND. Genotype-phenotype correlations in for hypertrophic cardiomyopathy: The pediatric perspective. J Car- hypertrophic cardiomyopathy: Insights provided by comparisons of diovasc Transl Res 2009; 2: 500 – 507. kindreds with distinct and identical beta-myosin heavy chain gene S13. Girolami F, Ho CY, Semsarian C, Baldi M, Will ML, Baldini K, et mutations. Circulation 1994; 89: 22 – 32. al. Clinical features and outcome of hypertrophic cardiomyopathy S41. Straceski AJ, Geisterfer-Lowrance A, Seidman CE, Seidman JG, associated with triple sarcomere protein gene mutations. J Am Coll Leinwand LA. Functional analysis of myosin missense mutations Cardiol 2010; 55: 1444 – 1453.
Load more

Recommended publications
  • Genetic Variation Screening of TNNT2 Gene in a Cohort of Patients with Hypertrophic and Dilated Cardiomyopathy
    Physiol. Res. 61: 169-175, 2012 https://doi.org/10.33549/physiolres.932157 Genetic Variation Screening of TNNT2 Gene in a Cohort of Patients With Hypertrophic and Dilated Cardiomyopathy M. JÁCHYMOVÁ1, A. MURAVSKÁ1, T. PALEČEK2, P. KUCHYNKA2, H. ŘEHÁKOVÁ1, S. MAGAGE2, A. KRÁL2, T. ZIMA1, K. HORKÝ2, A. LINHART2 1Institute of Clinical Chemistry and Laboratory Diagnostics, First Faculty of Medicine and General University Hospital, Charles University, Prague, Czech Republic, 2Second Department of Internal Medicine – Clinical Department of Cardiology and Angiology, First Faculty of Medicine and General University Hospital, Charles University, Prague, Czech Republic Received February 1, 2011 Accepted October 17, 2011 On-line January 31, 2012 Summary Introduction Mutations in troponin T (TNNT2) gene represent the important part of currently identified disease-causing mutations in Cardiomyopathies are generally defined as hypertrophic (HCM) and dilated (DCM) cardiomyopathy. The aim myocardial disorders in which the heart muscle is of this study was to analyze TNNT2 gene exons in patients with structurally and functionally abnormal, in the absence of HCM and DCM diagnosis to improve diagnostic and genetic coronary artery disease, hypertension, valvular disease consultancy in affected families. All 15 exons and their flanking and congenital heart disease sufficient to cause the regions of the TNNT2 gene were analyzed by DNA sequence observed myocardial abnormality (Elliott et al. 2008). analysis in 174 patients with HCM and DCM diagnosis. We According to the morphological and functional phenotype identified genetic variations in TNNT2 exon regions in 56 patients the diagnosis of hypertrophic and dilated cardiomyopathy and genetic variations in TNNT2 intron regions in 164 patients.
    [Show full text]
  • Defining Functional Interactions During Biogenesis of Epithelial Junctions
    ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK.
    [Show full text]
  • Cardiomyopathy
    UNIVERSITY OF MINNESOTA PHYSICIANS OUTREACH LABS Submit this form along with the appropriate MOLECULAR DIAGNOSTICS (612) 273-8445 Molecular requisition (Molecular Diagnostics or DATE: TIME COLLECTED: PCU/CLINIC: Molecular NGS Oncology). AM PM PATIENT IDENTIFICATION DIAGNOSIS (Dx) / DIAGNOSIS CODES (ICD-9) - OUTPATIENTS ONLY SPECIMEN TYPE: o Blood (1) (2) (3) (4) PLEASE COLLECT 5-10CC IN ACD-A OR EDTA TUBE ORDERING PHYSICIAN NAME AND PHONE NUMBER: Tests can be ordered as a full panel, or by individual gene(s). Please contact the genetic counselor with any questions at 612-624-8948 or by pager at 612-899-3291. _______________________________________________ Test Ordered- EPIC: Next generation sequencing(Next Gen) Sunquest: NGS Brugada syndrome DMD Aortopathy Full panel DNAJC19 SCN5A DSP Full panel GPD1L Cardiomyopathy, familial MYH11 CACNA1C hypertrophic ACTA2 SCN1B Full panel MYLK KCNE3 ANKRD1 FBN2 SCN3B JPH2 SLC2A10 HCN4 PRKAG2 COL5A2 MYH7 COL5A1 MYL2 COL3A1 Cardiomyopathy ACTC1 CBS Cardiomyopathy, dilated CSRP3 SMAD3 Full panel TNNC1 TGFBR1 LDB3 MYH6 TGFBR2 LMNA VCL FBN1 ACTN2 MYOZ2 Arrhythmogenic right ventricular DSG2 PLN dysplasia NEXN CALR3 TNNT2 TNNT2 NEXN Full panel RBM20 TPM1 TGFB3 SCN5A MYBPC3 DSG2 MYH6 TNNI3 DSC2 TNNI3 MYL3 JUP TTN TTN RYR2 BAG3 MYLK2 TMEM43 DES Cardiomyopathy, familial DSP CRYAB EYA4 restrictive PKP2 Full panel Atrial fibrillation LAMA4 MYPN TNNI3 SGCD MYPN TNNT2 Full panel CSRP3 SCN5A MYBPC3 GJA5 TCAP ABCC9 ABCC9 SCN1B PLN SCN2B ACTC1 KCNQ1 MYH7 KCNE2 TMPO NPPA VCL NPPA TPM1 KCNA5 TNNC1 KCNJ2 GATAD1 4/1/2014
    [Show full text]
  • Sarcomere Gene Variants Act As a Genetic Trigger Underlying the Development of Left Ventricular Noncompaction
    www.nature.com/pr BASIC SCIENCE ARTICLE Sarcomere gene variants act as a genetic trigger underlying the development of left ventricular noncompaction Asami Takasaki1, Keiichi Hirono1, Yukiko Hata2, Ce Wang1,3, Masafumi Takeda4, Jun K Yamashita4, Bo Chang1, Hideyuki Nakaoka1, Mako Okabe1, Nariaki Miyao1, Kazuyoshi Saito1, Keijiro Ibuki1, Sayaka Ozawa1, Michikazu Sekine5, Naoki Yoshimura6, Naoki Nishida2, Neil E. Bowles7 and Fukiko Ichida1 BACKGROUND: Left ventricular noncompaction (LVNC) is a primary cardiomyopathy with heterogeneous genetic origins. The aim of this study was to elucidate the role of sarcomere gene variants in the pathogenesis and prognosis of LVNC. METHODS AND RESULTS: We screened 82 Japanese patients (0–35 years old), with a diagnosis of LVNC, for mutations in seven genes encoding sarcomere proteins, by direct DNA sequencing. We identified variants in a significant proportion of cases (27%), which were associated with poor prognosis (p = 0.012), particularly variants in TPM1, TNNC1, and ACTC1 (p = 0.012). To elucidate the pathological role, we developed and studied human-induced pluripotent stem cells (hiPSCs) from a patient carrying a TPM1 p. Arg178His mutation, who underwent heart transplantation. These cells displayed pathological changes, with mislocalization of tropomyosin 1, causing disruption of the sarcomere structure in cardiomyocytes, and impaired calcium handling. Microarray analysis indicated that the TPM1 mutation resulted in the down-regulation of the expression of numerous genes involved in heart development, and positive regulation of cellular process, especially the calcium signaling pathway. CONCLUSIONS: Sarcomere genes are implicated as genetic triggers in the development of LVNC, regulating the expression of numerous genes involved in heart development, or modifying the severity of disease.
    [Show full text]
  • Key Genes Regulating Skeletal Muscle Development and Growth in Farm Animals
    animals Review Key Genes Regulating Skeletal Muscle Development and Growth in Farm Animals Mohammadreza Mohammadabadi 1 , Farhad Bordbar 1,* , Just Jensen 2 , Min Du 3 and Wei Guo 4 1 Department of Animal Science, Faculty of Agriculture, Shahid Bahonar University of Kerman, Kerman 77951, Iran; [email protected] 2 Center for Quantitative Genetics and Genomics, Aarhus University, 8210 Aarhus, Denmark; [email protected] 3 Washington Center for Muscle Biology, Department of Animal Sciences, Washington State University, Pullman, WA 99163, USA; [email protected] 4 Muscle Biology and Animal Biologics, Animal and Dairy Science, University of Wisconsin-Madison, Madison, WI 53558, USA; [email protected] * Correspondence: [email protected] Simple Summary: Skeletal muscle mass is an important economic trait, and muscle development and growth is a crucial factor to supply enough meat for human consumption. Thus, understanding (candidate) genes regulating skeletal muscle development is crucial for understanding molecular genetic regulation of muscle growth and can be benefit the meat industry toward the goal of in- creasing meat yields. During the past years, significant progress has been made for understanding these mechanisms, and thus, we decided to write a comprehensive review covering regulators and (candidate) genes crucial for muscle development and growth in farm animals. Detection of these genes and factors increases our understanding of muscle growth and development and is a great help for breeders to satisfy demands for meat production on a global scale. Citation: Mohammadabadi, M.; Abstract: Farm-animal species play crucial roles in satisfying demands for meat on a global scale, Bordbar, F.; Jensen, J.; Du, M.; Guo, W.
    [Show full text]
  • Supplemental Material and Methods Expression Plasmids, Sirna, Cell
    Supplemental Material and Methods Expression Plasmids, siRNA, Cell culture and reagents. The full-length human SETD2 cDNA was cloned into pMSCV-puro/neo to generate SETD2 expression plasmids. SETD2 shRNA sequences are CCGGTGATAGCCATGATAGTATTAACTCGAGTTAATACTATCATGGCTA TCATTTTTG; CCGGCAGGGAGAACAGGCGTAATAACTCGAGTTATTACGCCTGTTC TCCCTGTTTTTG. SSO with 2’-O-methoxyethyl (MOE)-phosphorothioate modification was targeted to the 3’-splice site of intron 2 in DVL2 pre-mRNA. SSO sequence is CACCCUUCUAGCUGGUGUCCUC. HCT116, DLD1, RKO and 293T cells were obtained from ATCC and cultured in DMEM with 10% fetal bovine serum. Cells were transfected with siRNA duplexes (60 nM) or Antisense Oligonucleotide (60 nM) by using Lipofectamine 2000 (Invitrogen) or Dharmacon Transfection (Dharmacon) reagents according to manufacturer’s instructions. To establish the individual stable cells, retrovirus/lentivirus was used. Cell proliferation assay was performed using CellTiter 96® Non-Radioactive Cell Proliferation Assay (MTT) kit (Promega) based on the manufacturer’s instructions. Standard 24-well Boyden invasion chambers (BD Biosciences) were used to assess cell migration abilities following the manufacturer’s suggestions. For oncosphere formation assay, cells were suspended in serum-free DMEM-F12 medium containing N-2 Plus Media Supplement (Life Technologies), B-27 Supplement (Life Technologies), 20 ng/ml EGF (PeproTech) and 10 ng/ml FGF (PeproTech) in ultra-low attachment 96-well plate to support growth of oncospheres. Colonies were scored and documented by photomicroscopy 1 week after preparations. For soft-agar colony formation assay, cells were suspended in DMEM containing 0.35% low-melting agar (Invitrogen) and 10% FBS and seeded onto a coating of 0.7% low-melting agar in DMEM containing 10% FBS. Plates were incubated at 37 °C and 5% CO2 and colonies were scored 3 weeks after preparations.
    [Show full text]
  • Sarcomeres Regulate Murine Cardiomyocyte Maturation Through MRTF-SRF Signaling
    Sarcomeres regulate murine cardiomyocyte maturation through MRTF-SRF signaling Yuxuan Guoa,1,2,3, Yangpo Caoa,1, Blake D. Jardina,1, Isha Sethia,b, Qing Maa, Behzad Moghadaszadehc, Emily C. Troianoc, Neil Mazumdara, Michael A. Trembleya, Eric M. Smalld, Guo-Cheng Yuanb, Alan H. Beggsc, and William T. Pua,e,2 aDepartment of Cardiology, Boston Children’s Hospital, Boston, MA 02115; bDepartment of Biostatistics and Computational Biology, Dana-Farber Cancer Institute, Boston, MA 02215; cDivision of Genetics and Genomics, The Manton Center for Orphan Disease Research, Boston Children’s Hospital and Harvard Medical School, Boston, MA 02115; dAab Cardiovascular Research Institute, Department of Medicine, University of Rochester School of Medicine and Dentistry, Rochester, NY 14642; and eHarvard Stem Cell Institute, Harvard University, Cambridge, MA 02138 Edited by Janet Rossant, The Gairdner Foundation, Toronto, ON, Canada, and approved November 24, 2020 (received for review May 6, 2020) The paucity of knowledge about cardiomyocyte maturation is a Mechanisms that orchestrate ultrastructural and transcrip- major bottleneck in cardiac regenerative medicine. In develop- tional changes in cardiomyocyte maturation are beginning to ment, cardiomyocyte maturation is characterized by orchestrated emerge. Serum response factor (SRF) is a transcription factor that structural, transcriptional, and functional specializations that occur is essential for cardiomyocyte maturation (3). SRF directly acti- mainly at the perinatal stage. Sarcomeres are the key cytoskeletal vates key genes regulating sarcomere assembly, electrophysiology, structures that regulate the ultrastructural maturation of other and mitochondrial metabolism. This transcriptional regulation organelles, but whether sarcomeres modulate the signal trans- subsequently drives the proper morphogenesis of mature ultra- duction pathways that are essential for cardiomyocyte maturation structural features of myofibrils, T-tubules, and mitochondria.
    [Show full text]
  • Snapshot: Actin Regulators II Anosha D
    SnapShot: Actin Regulators II Anosha D. Siripala and Matthew D. Welch Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720, USA Representative Proteins Protein Family H. sapiens D. melanogaster C. elegans A. thaliana S. cerevisiae Endocytosis and Exocytosis ABP1/drebrin mABP1, drebrin, drebrin- †Q95RN0 †Q9XUT0 Abp1 like EPS15 EPS15 Eps-15 EHS-1 †Q56WL2 Pan1 HIP1R HIP1R †Q8MQK1 †O62142 Sla2 Synapsin synapsin Ia, Ib, IIa, IIb, III Synapsin SNN-1 Plasma Membrane Association Anillin anillin Scraps ANI-1, 2, 3 Annexins annexin A1–11, 13 (actin Annexin B9-11 NEX-1–4 ANN1-8 binding: 1, 2, 6) ERM proteins ezrin, radixin, moesin DMoesin ERM-1 MARCKS MARCKS, MRP/ Akap200 MACMARCKS/F52 Merlin *merlin/NF2 Merlin NFM-1 Protein 4.1 4.1R, G, N, B Coracle Spectrin α-spectrin (1–2), β-spectrin α-spectrin, β-spectrin, β heavy- SPC-1 (α-spectrin), UNC-70 (1–4), β heavy-spectrin/ spectrin/Karst (β-spectrin), SMA-1 (β heavy- karst spectrin) Identifi ed Cellular Role: X Membrane traffi cking and phagocytosis Cell-Cell Junctions X Cytokinesis α-catenin α-catenin 1–3 α-catenin HMP-1 X Cell surface organization and dynamics X Cell adhesion Afadin afadin/AF6 Canoe AFD-1 X Multiple functions ZO-1 ZO-1, ZO-2, ZO-3 ZO-1/Polychaetoid †Q56VX4 X Other/unknown Cell-Extracellular Matrix Junctions †UNIPROT database accession number *Mutation linked to human disease Dystrophin/utrophin *dystrophin, utrophin/ Dystrophin DYS-1 DRP1, DRP2 LASP LASP-1, LASP-2, LIM- Lasp †P34416 nebulette Palladin palladin Parvin α-, β-, χ-parvin †Q9VWD0 PAT-6
    [Show full text]
  • Bee1, a Yeast Protein with Homology to Wiscott-Aldrich Syndrome Protein, Is Critical for the Assembly of Cortical Actin Cytoskel
    Published February 10, 1997 Bee1, a Yeast Protein with Homology to Wiscott-Aldrich Syndrome Protein, Is Critical for the Assembly of Cortical Actin Cytoskeleton Rong Li Department of Cell Biology, Harvard Medical School, Boston, MA 02115 Abstract. Yeast protein, Bee1, exhibits sequence ho- associated patches, actin filaments in the buds of Dbee1 mology to Wiskott-Aldrich syndrome protein (WASP), cells form aberrant bundles that do not contain most of a human protein that may link signaling pathways to the cortical cytoskeletal components. It is significant the actin cytoskeleton. Mutations in WASP are the pri- that Dbee1 is the only mutation reported so far that mary cause of Wiskott-Aldrich syndrome, character- abolishes cortical actin patches in the bud. Bee1 protein ized by immuno-deficiencies and defects in blood cell is localized to actin patches and interacts with Sla1p, a morphogenesis. This report describes the character- Src homology 3 domain–containing protein previously ization of Bee1 protein function in budding yeast. Dis- implicated in actin assembly and function. Thus, Bee1 ruption of BEE1 causes a striking change in the organi- protein may be a crucial component of a cytoskeletal zation of actin filaments, resulting in defects in budding complex that controls the assembly and organization of Downloaded from and cytokinesis. Rather than assemble into cortically actin filaments at the cell cortex. roteins that are conserved between yeast and mam- In addition to the conserved actin-binding proteins, mals are likely to carry out fundamental cellular building blocks of protein interactions common to mam- P functions. The complete yeast genome database malian cytoskeletal and signaling molecules are also found on April 4, 2017 provides a facile route for the identification of these pro- in yeast.
    [Show full text]
  • Chemical Agent and Antibodies B-Raf Inhibitor RAF265
    Supplemental Materials and Methods: Chemical agent and antibodies B-Raf inhibitor RAF265 [5-(2-(5-(trifluromethyl)-1H-imidazol-2-yl)pyridin-4-yloxy)-N-(4-trifluoromethyl)phenyl-1-methyl-1H-benzp{D, }imidazol-2- amine] was kindly provided by Novartis Pharma AG and dissolved in solvent ethanol:propylene glycol:2.5% tween-80 (percentage 6:23:71) for oral delivery to mice by gavage. Antibodies to phospho-ERK1/2 Thr202/Tyr204(4370), phosphoMEK1/2(2338 and 9121)), phospho-cyclin D1(3300), cyclin D1 (2978), PLK1 (4513) BIM (2933), BAX (2772), BCL2 (2876) were from Cell Signaling Technology. Additional antibodies for phospho-ERK1,2 detection for western blot were from Promega (V803A), and Santa Cruz (E-Y, SC7383). Total ERK antibody for western blot analysis was K-23 from Santa Cruz (SC-94). Ki67 antibody (ab833) was from ABCAM, Mcl1 antibody (559027) was from BD Biosciences, Factor VIII antibody was from Dako (A082), CD31 antibody was from Dianova, (DIA310), and Cot antibody was from Santa Cruz Biotechnology (sc-373677). For the cyclin D1 second antibody staining was with an Alexa Fluor 568 donkey anti-rabbit IgG (Invitrogen, A10042) (1:200 dilution). The pMEK1 fluorescence was developed using the Alexa Fluor 488 chicken anti-rabbit IgG second antibody (1:200 dilution).TUNEL staining kits were from Promega (G2350). Mouse Implant Studies: Biopsy tissues were delivered to research laboratory in ice-cold Dulbecco's Modified Eagle Medium (DMEM) buffer solution. As the tissue mass available from each biopsy was limited, we first passaged the biopsy tissue in Balb/c nu/Foxn1 athymic nude mice (6-8 weeks of age and weighing 22-25g, purchased from Harlan Sprague Dawley, USA) to increase the volume of tumor for further implantation.
    [Show full text]
  • Delineating the Heterogeneity of Matrix-Directed Differentiation Toward Soft and Stiff Tissue Lineages Via Single-Cell Profiling
    Delineating the heterogeneity of matrix-directed differentiation toward soft and stiff tissue lineages via single-cell profiling Shlomi Briellea,b,c, Danny Bavlid, Alex Motzikd, Yoav Kan-Torc, Xue Sund, Chen Kozulind, Batia Avnie, Oren Ramd,1, and Amnon Buxboima,b,c,1 aAlexander Grass Center for Bioengineering, Hebrew University of Jerusalem, 9190401 Jerusalem, Israel; bDepartment of Cell and Developmental Biology, Hebrew University of Jerusalem, 9190401 Jerusalem, Israel; cRachel and Selim Benin School of Computer Science and Engineering, Hebrew University of Jerusalem, 9190401 Jerusalem, Israel; dDepartment of Biological Chemistry, Hebrew University of Jerusalem, 9190401 Jerusalem, Israel; and eDepartment of Bone Marrow Transplantation, Hadassah Medical Center, 91120 Jerusalem, Israel Edited by David A. Weitz, Harvard University, Cambridge, MA, and approved March 7, 2021 (received for review August 2, 2020) Mesenchymal stromal/stem cells (MSCs) form a heterogeneous (7, 8). Characterizing MSC heterogeneity and its clinical implica- population of multipotent progenitors that contribute to tissue tions will thus improve experimental reproducibility and biomedical regeneration and homeostasis. MSCs assess extracellular elasticity standardization. by probing resistance to applied forces via adhesion, cytoskeletal, MSCs are highly sensitive to the mechanical properties of their and nuclear mechanotransducers that direct differentiation to- microenvironment. These extracellular, tissue-specific cues are ward soft or stiff tissue lineages.
    [Show full text]
  • Cell-Cycle Regulation of Formin-Mediated Actin Cable Assembly
    Cell-cycle regulation of formin-mediated actin PNAS PLUS cable assembly Yansong Miaoa, Catherine C. L. Wongb,1, Vito Mennellac,d, Alphée Michelota,2, David A. Agardc,d, Liam J. Holta, John R. Yates IIIb, and David G. Drubina,3 aDepartment of Molecular and Cell Biology, University of California, Berkeley, CA 94720; bDepartment of Chemical Physiology, The Scripps Research Institute, La Jolla, CA 92037; and cDepartment of Biochemistry and Biophysics and dThe Howard Hughes Medical Institute, University of California, San Francisco, CA 94158 Edited by Ronald D. Vale, University of California, San Francisco, CA, and approved September 18, 2013 (received for review July 25, 2013) Assembly of appropriately oriented actin cables nucleated by for- Formin-based actin filament assembly using purified proteins min proteins is necessary for many biological processes in diverse also has been reported (29, 30). However, reconstitution of eukaryotes. However, compared with knowledge of how nucle- formin-derived actin cables under the more physiological con- ation of dendritic actin filament arrays by the actin-related pro- ditions represented by cell extracts has not yet been reported. tein-2/3 complex is regulated, the in vivo regulatory mechanisms The actin nucleation activity of formin proteins is regulated by for actin cable formation are less clear. To gain insights into mech- an inhibitory interaction between the N- and C-terminal domains, anisms for regulating actin cable assembly, we reconstituted the which can be released when GTP-bound Rho protein binds to the assembly process in vitro by introducing microspheres functional- formin N-terminal domain, allowing access of the C terminus ized with the C terminus of the budding yeast formin Bni1 into (FH1-COOH) to actin filament barbed ends (31–40).
    [Show full text]