THE ROLE OF POLYAMINE UPTAKE TRANSPORTERS ON GROWTH AND DEVELOPMENT OF ARABIDOPSIS THALIANA
Jigarkumar Patel
A Dissertation
Submitted to the Graduate College of Bowling Green State University in partial fulfillment of the requirements for the degree of
DOCTOR OF PHILOSOPHY
May 2015
Committee:
Paul Morris, Advisor
Wendy D Manning Graduate Faculty Representative
Vipaporn Phuntumart
Scott Rogers
Ray Larsen
© 2015
Jigarkumar Patel
All Rights Reserved iii ABSTRACT
Paul Morris, Advisor
Transgenic manipulation of polyamine levels has provided compelling evidence that polyamines enable plants to respond to environmental cues by activation of stress and developmental pathways. Here we show that the chloroplasts of A. thaliana and soybeans contain both an arginine decarboxylase, and an arginase/agmatinase. These two enzymes combine to synthesize putrescine from arginine. Since the sequences of plant arginases show conservation of key residues and the predicted 3D structures of plant agmatinases overlap the crystal structure of the enzyme from Deinococcus radiodurans, we suggest that these enzymes can synthesize putrescine, whenever they have access to the substrate agmatine. Finally, we show that synthesis of putrescine by ornithine decarboxylase takes place in the ER. Thus A. thaliana has two, and soybeans have three separate pathways for the synthesis of putrescine. This study also describes key changes in plant phenotypes in response to altered transport of polyamines. iv
Dedicated to my father, Jayantilal Haribhai Patel v ACKNOWLEDGMENTS
I would like to thank my advisor, Dr. Paul F. Morris, for helping me learn and grow during my Ph.D. Dr. Morris has an open door policy, and he was always available to answer my questions and provide helpful suggestions. He taught me how to identify a problem and be resourceful to find solutions. I would also like to thank my committee members Dr. Vipa
Phuntumart, Dr. Scott Rogers, Dr. Ray Larsen and Dr. Wendy Manning, they were very helpful in guiding me towards the right path during my Ph.D. I would also like to thank my lab mates
Lingxiao Ge, Sheaza Ahmed, Menaka Ariyaratne and my colleagues at BGSU. A special thanks to my mother Hansaben Patel, and my brother Rahul Patel for supporting me and motivating me to get through my Ph.D. My wife, Ashley, deserves a special thanks as well for being by my side whenever I needed her and adjusting her schedule so I can work long hours to do my research. I would also like to thank the faculty and staff members of the biology department for being very helpful and supportive. vi
TABLE OF CONTENTS
Page
GENERAL INTRODUCTION ...... 1
References ...... 9
CHAPTER 1: HIDING IN PLAIN SIGHT: A THIRD ROUTE FOR PUTRESCINE
BIOSYNTHESIS IN PLANTS ...... 25
Abstract ...... 25
Introduction, Results and Discussion ...... 26
References ...... 35
Supplementary Material for Hiding in Plain Sight: A Third Route for Putrescine
Biosynthesis in Plants ...... 39
Supplementary materials and methods ...... 39
Supplementary figures and tables ...... 42
Supplementary references ...... 49
CHAPTER 2: CONTROL OF FLOWERING IN A. THALIANA BY ALTERED EXPRESSION
OF POLYAMINE TRANSPORTERS...... 51
Introduction ...... 51
Materials and Methods ...... 55
Plant material and growth conditions ...... 55 vii
Subcellular localization analysis ...... 56
Generation of transgenic Arabidopsis plants ...... 57
Phenotypic analysis ...... 57
GUS Analysis...... 58
HPLC analysis of WT and transgenic plants ...... 58
Results ...... 60
Discussion ...... 74
References ...... 78
CHAPTER 3: OVEREXPRESSION OF OSPUT3 CONFERS DROUGHT TOLERANCE IN
ARABIDOPSIS THALIANA ...... 84
Introduction ...... 84
Materials and Methods ...... 87
Plant material and growth conditions ...... 87
Subcellular localization analysis ...... 87
Generation of transgenic Arabidopsis plants ...... 88
Phenotypic analysis ...... 88
Drought stress tolerance assay ...... 88
Results ...... 89 viii
Subcellular localization of OSPUT3 ...... 89
Overexpression of OsPUT3 in Arabidopsis increases leaf and stem size ...... 89
Overexpression of OsPUT3 in Arabidopsis enhances drought stress tolerance
along with an increase in yield and biomass...... 90
Discussion ...... 95
References ...... 98
SUMMARY ...... 107
ix
LIST OF FIGURES
Figure Page
1 Polyamine biosynthetic pathways in plants...... 3
2 Localization analysis of AtADC2 and AtARGAH2 by transient expression in N.
benthamiana leaves ...... 29
3 Characterization of Arabidopsis agmatinase by complementation in yeast ...... 29
4 Predicted 3D structure of AtARGAH2 is highly similar to the crystal structure of
Deinococcus radiodurans agmatinase ...... 31
5 Subcellular localization of OsODC ...... 33
6 Localization of full-length OsPUT1 ...... 61
7 Localization of half OsPUT1-GFP fusion protein ...... 62
8 AtPUT3 and AtPUT2 are localized to the chloroplast ...... 63
9 Transgenic plants overexpressing OsPUT1 and OsPUT3 are delayed in flowering. 64
10 Transgenic plants with increased expression of OsPUT1 and OsPUT3 had larger
leaves……………………………………………………………………………….. 65
11 Transgenic plants with increased expression of OsPUT3 had thicker stems...... 65
12 Transgenic plants with increased expression of OsPUT3 had increased yield ...... 66
13 Transgenic plants with increased expression of OsPUT1 and OsPUT3 were
delayed in senescence ...... 67
14 Gus expression of promoter region of AtPUT5 in A. thaliana ...... 68
15 Plants expressing AtPUT5::OsPUT1 were delayed in flowering ...... 69
16 Plants expressing AtPUT5::OsPUT1 were taller compared to WT and
CS869507……...... 70 x
17 Plants expressing AtPUT5::OsPUT1 had larger leaves compared to WT and
CS859607…... …………..…...... 70
18 Expression of AtPUT5::OsPUT1 in A. thaliana resulted in increased silique
production...... 71
19 Plants expressing AtPUT5::OsPUT1 had thicker stems as compared to WT and
CS859607……...... 71
20 Levels of polyamines in WT, OsPUT1, and OsPUT3 plants before, during, and
after flowering under continuous light ...... 72
21 Polyamine levels in CS859607, WT, and OX 19553 were assessed at two, four
and six weeks...... 73
22 Overexpression of OsPUT3 in Arabidopsis enhances drought stress tolerance ...... 91
23 Plants overexpressing OsPUT3 are taller as compared to WT and have increased
silique length……...... 92
24 Overexpression of OsPUT3 in Arabidopsis leads to 5 fold increase in yield as
compared to wild type ...... 93
25 OsPUT3 is localized to the chloroplast ...... 94 xi
LIST OF SUPPLEMENTARY FIGURES
Figure Page
S1 Phylogenetic analysis of plant arginine decarboxylases ...... 45
S2 Phylogenetic analyses of Plant arginase/agmatinases ...... 46
S3 Characterization of Soybean agmatinase by complementation in yeast ...... 47
S4 Comparison of active site residues of Dienococcus radiodurans agmatinase and
arginases from Arabidopsis, Glycine max, and Populus trichocarpa ...... 48 xii
LIST OF TABLES
Table Page
1 List of polyamine biosynthetic genes in Arabidopsis and the factors that enhance
the expression of those genes...... 5
S1 List of primers used in this study ...... 42
S2 Predicted localization of Arginine decarboxylase genes from sequenced plant
genomes……...... 43
S3 Predicted localization of Arginase/agmatinase genes from sequenced plant
genomes…..…...... 44
1
GENERAL INTRODUCTION
Plants are sessile organisms that have acquired the ability to adapt to a continuously changing environment. Plants can survive, grow, and propagate even in harsh environmental conditions by activating specific signaling pathways. Polyamines (PAs) are emerging as essential plant growth and development regulators (Mattoo, Minocha, Minocha, & Handa, 2010). PAs play significant roles in physiological and developmental processes (Nambeesan, Mattoo, &
Handa, 2008). Increase in PA concentration in plants during growth development, and stress responses have been well documented (Shi & Chan, 2014a). The rise in PA levels, in response to development and stress, is usually attributed to increased activity of PA biosynthetic or catabolic enzymes (Kusano & Suzuki, 2015). While the role of PA biosynthesis and PA catabolism in maintaining cellular PA levels is broadly understood, PA transport in plants has not been thoroughly dissected yet.
PAs are low molecular weight, polycationic molecules bearing amino groups. Diamine putrescine, triamine spermidine (Spd), and tetraamine spermine (Spm) are the most common PAs in higher organisms, and exist in almost all organisms including, bacteria, animals, and plants
(Hussain, Ali, Ahmad, & Siddique, 2011). Additionally, PAs such as cadaverine, norspermidine, and thermospermine are present in many organisms. In plants, PAs are widely implicated in chromatin organization, DNA synthesis, gene transcription, protein translation, cell division and differentiation, programmed cell death, root elongation, floral development, and leaf senescence
(Alcázar, Altabella et al., 2010; Alet et al., 2012; Shi & Chan, 2014a; Tavladoraki et al., 2012;
Wimalasekera, Villar, Begum, & Scherer, 2011; Z. Zhang et al., 2011). In addition, PAs play a significant role in many environmental stresses, including salt, drought, temperature, ozone, wounding, and metal oxidative stresses (Cuevas et al., 2008; J. Liu, Kitashiba, Wang, Ban, &
2
Moriguchi, 2007; Rider et al., 2007; Tavladoraki et al., 2012; Urano et al., 2004; Wimalasekera et al., 2011; Yamaguchi et al., 2007a). Recent molecular genetic studies, involving transgenic plants with altered PA biosynthesis and mutants deficient in PA biosynthesis, have provided convincing evidence that PAs act as critical modulators of various physiological processes during plant growth and development (Alcázar, Planas et al., 2010; Kusano, Berberich, Tateda,
& Takahashi, 2008b; Takahashi & Kakehi, 2010b). In plants, homeostasis of PAs is crucial for optimal growth and development, as well as stress responses (Tiburcio, Altabella, Bitrián, &
Alcázar, 2014). Intracellular homeostasis of PAs is regulated by biosynthesis, catabolism, conjugation and transport (Wallace, Fraser, & Hughes, 2003). The current study is focused on understanding the role of PA transport on plant growth, development and stress responses.
It is essential to understand how PA homeostasis is achieved by regulation of genes and enzymes involved in the biosynthesis, catabolism, conjugation and transport of PAs, before considering the involvement of PAs in development and stress. In plants, putrescine is synthesized from ornithine or arginine. Conversion of ornithine to putrescine is mediated by ornithine decarboxylase (ODC), also known as ODC pathway, and this pathway is also used by almost all eukaryotes to synthesize putrescine (Fig. 1). Plants also have an alternative pathway for putrescine synthesis, in which putrescine is synthesized from arginine by a three-step enzymatic reaction, the ADC pathway. Arginine is converted to agmatine by arginine decarboxylase (ADC) followed by two successive steps catalyzed by agmatine iminohydrolase
(AIH – agmatine to N-carbamoyl-putrescine) and N-carbamoyl-putrescine amidohydrolase (CPA
– N-carbamoyl-putrescine to putrescine) (Kusano & Suzuki, 2015) (Fig. 1). Spd is synthesized from putrescine by the transfer of an aminopropyl group from decarboxylated S- adenosylmethionine (dcSAM), in a reaction catalyzed by spermidine synthase (SPDS; Fig. 1).
3
Spm is synthesized from Spd by spermine synthase (SPMS; Fig. 1). Thermospermine is formed by the action of thermospermine synthase (TSPMS) (Fig. 1). Cadaverine is generated from lysine through the action of lysine decarboxylase (LDC; Fig. 1).
Figure 1. Polyamine biosynthetic pathways in plants. Aminopropyl and aminobutyl groups in polyamines are shown as NC4 and NC3, respectively. (Adopted from Kusano and Suzuki, 2015).
ADC, AIH and CPA, genes involved in the ADC pathway in plants are postulated to be derived from the cyanobacterial ancestor of the chloroplast by endosymbiotic gene transfer to the nuclear genome of the plant cell (Illingworth et al., 2003). Plant ADC differs from bacterial ADC because it has a chloroplast transit peptide, and ADC proteins have been detected in chloroplasts of oat and tobacco (Borrell et al., 1995; Bortolotti et al., 2004). ODC genes have been identified in many plant species (Fuell, Elliott, Hanfrey, Franceschetti, & Michael, 2010), but ODC is absent in many species of Brassicaceae (Hanfrey, Sommer, Mayer, Burtin, & Michael, 2001). In bacteria, a third pathway for putrescine biosynthesis exists, in which putrescine is generated from arginine by a two-step reaction. Arginine is converted to agmatine by the action of ADC
4 followed by direct conversion of agmatine to putrescine by agmatinase (AUH) (Ahn et al.,
2004). There is no evidence, yet, that plants have agmatinases, but bioinformatics analysis has revealed that plant arginases are very similar to bacterial agmatinases (Chen, McCaig, Melotto,
He, & Howe, 2004).
The differential contribution of ADC and ODC pathways to stress, development and tissue specificity may be a reason for the co-existence of ADC and ODC pathways in some plants. ODC pathway is required for cell proliferation and putrescine biosynthesis in roots whereas ADC pathway is activated under stress (Carbonell & Blázquez, 2009). In plants missing
ODC, there is a duplication of ADC, and it has been suggested that it may be a compensatory mechanism (Galloway, Malmberg, & Price, 1998; Hanfrey et al., 2001). Plant ODC is insensitive to exogenous application of Spd, or Spm and the degradation of ODC is not feedback regulated by PAs (Fuell et al., 2010; Hiatt, McIndoo, & Malmberg, 1986; Illingworth et al., 2003). The expression of ADC, is induced in many biotic and abiotic stress responses, however AIH and
CPA transcripts are usually not increased under stress (Alcázar, GarcíaǦMartínez, Cuevas,
Tiburcio, & Altabella, 2005; Alcázar et al., 2010). A list of genes involved in polyamine biosynthesis and factors that enhance their expression is shown in table 1 (Kusano & Suzuki,
2015). Many studies have shown that change in biosynthesis of PAs is co-related with plant development and stress responses but the underlying mechanism is not completely understood
(Tiburcio et al., 2014).
5
Table 1. List of polyamine biosynthetic genes in Arabidopsis and the factors that enhance the expression of those genes. (Adopted from Kusano and Suzuki, 2015).
Apart from biosynthesis, the homeostasis of PAs in plants can also be maintained by conjugation and catabolism. PAs in plants are present as perchloric acid (PCA)-soluble of PCA- insoluble conjugates with cinnamic acids such as p-coumaric, caffeic, and ferulic acids. PA conjugates such as hydroxycinnamic acid amides (HCAA) and phenolamides or phenylamides, are known to play a significant role in promoting flowering, protection against pathogens, detoxifying phenolic compounds, acting as a bridge between different cell wall polymers, and serving as a reserve of polyamines for proliferating tissues (Bagni & Tassoni, 2001; Bassard,
Ullmann, Bernier, & Werck-Reichhart, 2010; Martin-Tanguy, 1985). Transglutaminase (TGase) activity also plays a significant role in conjugation of PAs. PAs can be covalently bound to glutamine residues of proteins by TGase activity. TGase activity is widespread in all plant tissues, which suggests the importance of inter- or intramolecular cross-link formation of the proteins by PAs (Serafini-Fracassini & Del Duca, 2008). The photosynthetic protein complexes, in the chloroplast, may be stabilized by TGases (Serafini-Fracassini, Di Sandro, & Del Duca,
2010).
6
Catabolism (degradation) of PAs is catalyzed by two classes of amine oxidases: the copper-containing amine oxidases (CuAOs) and the polyamines oxidases (PAOs) (Kusano &
Suzuki, 2015). CuAOs are involved in terminal catabolism, which converts putrescine or Spd to
4-aminobutanal, ammonia and H2O2. CuAOs in Arabidopsis are localized to the peroxisomes and apoplast (Møller & McPherson, 1998; Planas-Portell, Gallart, Tiburcio, & Altabella, 2013).
PAOs are involved in terminal catabolism as well as back conversion of PAs. Back conversion of
PAs is an oxidation reaction in which higher polyamines (such as Spd and Spm) are converted to putrescine along with the production of 3-aminopropanal and H2O2. PAOs have been localized to cytoplasm, peroxisomes, and apoplast in Arabidopsis and Oryza sativa (rice), so far (Kusano &
Suzuki, 2015). The H2O2 production through PA degradation has been corelated with cell death, lignification, xylem differentiation, and hypersensitive response (Angelini et al., 2008; Kusano &
Suzuki, 2015; Moller & McPherson, 1998; Walters, 2003). It has been suggested that the H2O2 produced through PA catabolism is used as a signaling molecule for stress signal transduction
(Mitsuya et al., 2009; Yoda, Hiroi, & Sano, 2006). The back conversion of Spm to Spd, and Spd to putrescine results in elevated putrescine levels in plants under stress (Cona, Rea, Angelini,
Federico, & Tavladoraki, 2006; Moschou, Paschalidis, & Roubelakis-Angelakis, 2008). Most reports of physiological roles of CuAO and PAO genes are based on data using CuAO or PAO inhibitors. Transgenic lines with altered expression of genes involved in PA oxidation may provide more insights on the role of PA catabolism in plant development and stress responses.
Intracellular levels of PAs in plants are also regulated by PA uptake and transport
(Igarashi & Kashiwagi, 2010). In plant cells, PAs are localized in cell walls, vacuoles, nuclei, mitochondria and chloroplasts (Slocum, 1991). PAs are now considered as signaling molecules, and an important criterion for signaling molecules is translocation from the site of synthesis to
7 the site of function. Therefore, understanding the transport of PA is critical. There is a significant amount of information about PA transport systems in bacteria, yeast, and mammals, but PA transport system in plants has not been well characterized. The detection of PAs in phloem and xylem sap in different plant species indicated that a PA transport system must exist in plants
(Antognoni, Fornalè, Grimmer, Komor, & Bagni, 1998; Pistocchi, Bagni, & Creus, 1987).
Our lab was the first to identify PA transporters in plants (Mulangi, Phuntumart, Aouida,
Ramotar, & Morris, 2012a). Orthologous sequences of known systems in other organisms were used to identify PA transporters in plants. OsPUT1, a Polyamine Uptake Transporter (PUT) in rice, was characterized using heterologous expression and yeast complementation assays
(Mulangi et al., 2012a). PAs (Such as Putrescine and Cad) as well as the PA precursors ornithine and agmatine did not compete for Spd uptake mediated by OsPUT1 (Mulangi et al., 2012a).
However, OsPUT1 could not be localized in transiently transformed onion or rice protoplasts
(Mulangi et al., 2012a). Research in our lab, has also identified and characterized five additional
PA transporters from Arabidopsis and rice, OsPUT2, OsPUT3, AtPUT1, AtPUT2, and AtPUT3, as PUTs, these transporters cluster in the same clade as OsPUT1 (Mulangi, Chibucos,
Phuntumart, & Morris, 2012). Based on conservation of key residues within the members of this clade and experimental evidence it has been postulated that all plant proteins in this clade are PA transporters (Mulangi et al., 2012a). Meanwhile, Fujita et. al (2012) have identified an
Arabidopsis L-type amino acid transporter (LAT) family transporter, named RMV1 as a transporter of PAs and its structural analog paraquat (Fujita et al., 2012). A mutation in AtPAR1
(At1G31830), identical to AtPUT2, results in lower levels of paraquat accumulation in the chloroplasts, suggesting that AtPUT2/AtPAR1 may be involved in intracellular transport of PQ into chloroplast (J. Li et al., 2013). The same group has reported that OsPAR1, identical to
8
OsPUT3, regulates rice sensitivity to paraquat just like AtPUT2/AtPAR1 (J. Li et al., 2013).
Paraquat is translocated in plants via PA transporters (Fujita & Shinozaki, 2014). However, the translocation of paraquat is inhibited by exogenous application of PAs (Hart, Ditomaso, Linscott,
& Kochian, 1992; Kurepa, Smalle, Van Montagu, & Inzé, 1998). The understanding of PA transport system in plants is still in its early phase and requires more research. There is a lack of studies involving analysis of growth, development, and stress responses in plants with increased or decreased expression or PA transporters. Here we show that:
1) Selected plants have a third pathway for putrescine biosynthesis.
2) Change in expression of Polyamine Uptake Transporters alters the growth and development of
Arabidopsis thaliana.
3) Increased expression of OsPUT3 enhances drought tolerance in Arabidopsis thaliana.
9
References
Abd EA, K. M. (2004). Stimulation effect of spermidine and stigmasterol on growth, flowering,
biochemical constituents and essential oil of chamomile plant (chamomilla recutita L.,
rausch). Bulg. J. Plant Physiol, 30, 48.
Ahn, H. J., Kim, K. H., Lee, J., Ha, J. Y., Lee, H. H., Kim, D., . . . Suh, S. W. (2004). Crystal
structure of agmatinase reveals structural conservation and inhibition mechanism of the
ureohydrolase superfamily. The Journal of Biological Chemistry, 279(48), 50505-50513.
doi:10.1074/jbc.M409246200 [doi]
Alcázar, R., Altabella, T., Marco, F., Bortolotti, C., Reymond, M., Koncz, C., . . . Tiburcio, A. F.
(2010). Polyamines: Molecules with regulatory functions in plant abiotic stress tolerance.
Planta, 231(6), 1237-1249.
Alcázar, R., GarcíaǦMartínez, J. L., Cuevas, J. C., Tiburcio, A. F., & Altabella, T. (2005).
Overexpression of ADC2 in arabidopsis induces dwarfism and lateǦflowering through GA
deficiency. The Plant Journal, 43(3), 425-436.
Alcázar, R., Marco, F., Cuevas, J. C., Patron, M., Ferrando, A., Carrasco, P., . . . Altabella, T.
(2006). Involvement of polyamines in plant response to abiotic stress. Biotechnology
Letters, 28(23), 1867-1876.
Alcázar, R., Planas, J., Saxena, T., Zarza, X., Bortolotti, C., Cuevas, J., . . . Altabella, T. (2010).
Putrescine accumulation confers drought tolerance in transgenic arabidopsis plants over-
10
expressing the homologous arginine decarboxylase 2 gene. Plant Physiology and
Biochemistry, 48(7), 547-552.
Alcazar, R., Altabella, T., Marco, F., Bortolotti, C., Reymond, M., Koncz, C., . . . Tiburcio, A. F.
(2010). Polyamines: Molecules with regulatory functions in plant abiotic stress tolerance.
Planta, 231(6), 1237-1249. Retrieved from
http://www.hubmed.org/display.cgi?uids=20221631
Aldesuquy, H., Haroun, S., Abo-Hamed, S., & El-Saied, A. (2014). Involvement of spermine and
spermidine in the control of productivity and biochemical aspects of yielded grains of wheat
plants irrigated with waste water. Egyptian Journal of Basic and Applied Sciences, 1(1), 16-
28.
Alet, A. I., Sánchez, D. H., Cuevas, J. C., Marina, M., Carrasco, P., Altabella, T., . . . Ruiz, O. A.
(2012). New insights into the role of spermine in arabidopsis thaliana under long-term salt
stress. Plant Science, 182, 94-100.
Angelini, R., Tisi, A., Rea, G., Chen, M. M., Botta, M., Federico, R., & Cona, A. (2008).
Involvement of polyamine oxidase in wound healing. Plant Physiol, 146(1), 162-177.
Retrieved from http://www.hubmed.org/display.cgi?uids=17993545
Antognoni, F., Fornalè, S., Grimmer, C., Komor, E., & Bagni, N. (1998). Long-distance
translocation of polyamines in phloem and xylem of ricinus communis L. plants. Planta,
204(4), 520-527.
11
Anwar, R., Mattoo, A. K., & Handa, A. K. (2015). Polyamine interactions with plant hormones:
Crosstalk at several levels. Polyamines (pp. 267-302) Springer.
Ariyaratne, M. M. (2014). HPLC Analysis of Polyamines in Arabidopsis Thaliana Lines Altered
in the Expression of Polyamine Transport,
Bagni, N., & Tassoni, A. (2001). Biosynthesis, oxidation and conjugation of aliphatic
polyamines in higher plants. Amino Acids, 20(3), 301-317. Retrieved from
http://www.hubmed.org/display.cgi?uids=11354606
Bassard, J., Ullmann, P., Bernier, F., & Werck-Reichhart, D. (2010). Phenolamides: Bridging
polyamines to the phenolic metabolism. Phytochemistry, 71(16), 1808-1824.
Borrell, A., Culianez-Macia, F. A., Altabella, T., Besford, R. T., Flores, D., & Tiburcio, A. F.
(1995). Arginine decarboxylase is localized in chloroplasts. Plant Physiology, 109(3), 771-
776.
Bortolotti, C., Cordeiro, A., Alcázar, R., Borrell, A., CuliañezǦMacià, F. A., Tiburcio, A. F., &
Altabella, T. (2004). Localization of arginine decarboxylase in tobacco plants. Physiologia
Plantarum, 120(1), 84-92.
Capell, T., Bassie, L., & Christou, P. (2004). Modulation of the polyamine biosynthetic pathway
in transgenic rice confers tolerance to drought stress. Proc Natl Acad Sci U S A, 101(26),
9909-9914. Retrieved from http://www.hubmed.org/display.cgi?uids=15197268
Carbonell, J., & Blázquez, M. A. (2009). Regulatory mechanisms of polyamine biosynthesis in
plants. Genes & Genomics, 31(2), 107-118.
12
Chen, H., McCaig, B. C., Melotto, M., He, S. Y., & Howe, G. A. (2004). Regulation of plant
arginase by wounding, jasmonate, and the phytotoxin coronatine. The Journal of Biological
Chemistry, 279(44), 45998-46007. doi:10.1074/jbc.M407151200 [doi]
Cona, A., Rea, G., Angelini, R., Federico, R., & Tavladoraki, P. (2006). Functions of amine
oxidases in plant development and defence. Trends Plant Sci, 11(2), 80-88. Retrieved from
http://www.hubmed.org/display.cgi?uids=16406305
Cuevas, J. C., Lopez-Cobollo, R., Alcazar, R., Zarza, X., Koncz, C., Altabella, T., . . . Ferrando,
A. (2008). Putrescine is involved in arabidopsis freezing tolerance and cold acclimation by
regulating abscisic acid levels in response to low temperature. Plant Physiol, 148(2), 1094-
1105. Retrieved from http://www.hubmed.org/display.cgi?uids=18701673
Davies, P. J. (1995). The plant hormones: Their nature, occurrence, and functions. Plant
hormones (pp. 1-12) Springer.
Earley, K. W., Haag, J. R., Pontes, O., Opper, K., Juehne, T., Song, K., & Pikaard, C. S. (2006).
GatewayǦcompatible vectors for plant functional genomics and proteomics. The Plant
Journal, 45(4), 616-629.
Emanuelsson, O., Nielsen, H., Brunak, S., & von Heijne, G. (2000). Predicting subcellular
localization of proteins based on their N-terminal amino acid sequence. J Mol Biol, 300(4),
1005-1016. Retrieved from http://www.hubmed.org/display.cgi?uids=10891285
13
Fischer, R., Byerlee, D., & Edmeades, G. O. (2009). Can technology deliver on the yield
challenge to 2050. Paper presented at the Expert Meeting on how to Feed the World In, ,
2050 46.
Fuell, C., Elliott, K. A., Hanfrey, C. C., Franceschetti, M., & Michael, A. J. (2010). Polyamine
biosynthetic diversity in plants and algae. Plant Physiology and Biochemistry, 48(7), 513-
520.
Fujita, M., Fujita, Y., Noutoshi, Y., Takahashi, F., Narusaka, Y., Yamaguchi-Shinozaki, K., &
Shinozaki, K. (2006). Crosstalk between abiotic and biotic stress responses: A current view
from the points of convergence in the stress signaling networks. Current Opinion in Plant
Biology, 9(4), 436-442.
Fujita, M., Fujita, Y., Iuchi, S., Yamada, K., Kobayashi, Y., Urano, K., . . . Shinozaki, K. (2012).
Natural variation in a polyamine transporter determines paraquat tolerance in arabidopsis.
Proceedings of the National Academy of Sciences of the United States of America, 109(16),
6343-6347. doi:10.1073/pnas.1121406109 [doi]
Fujita, M., & Shinozaki, K. (2014). Identification of polyamine transporters in plants: Paraquat
transport provides crucial clues. Plant & Cell Physiology, 55(5), 855-861.
doi:10.1093/pcp/pcu032 [doi]
Galloway, G. L., Malmberg, R. L., & Price, R. A. (1998). Phylogenetic utility of the nuclear
gene arginine decarboxylase: An example from brassicaceae. Molecular Biology and
Evolution, 15(10), 1312-1320.
14
Gill, S. S., & Tuteja, N. (2010). Polyamines and abiotic stress tolerance in plants. Plant
Signaling & Behavior, 5(1), 26-33.
Hanfrey, C., Sommer, S., Mayer, M. J., Burtin, D., & Michael, A. J. (2001). Arabidopsis
polyamine biosynthesis: Absence of ornithine decarboxylase and the mechanism of arginine
decarboxylase activity. Plant J, 27(6), 551-560. Retrieved from
http://www.hubmed.org/display.cgi?uids=11576438
Hart, J. J., Ditomaso, J. M., Linscott, D. L., & Kochian, L. V. (1992). Transport interactions
between paraquat and polyamines in roots of intact maize seedlings. Plant Physiol, 99(4),
1400-1405. Retrieved from http://www.hubmed.org/display.cgi?uids=16669051
Hiatt, A. C., McIndoo, J., & Malmberg, R. L. (1986). Regulation of polyamine biosynthesis in
tobacco. effects of inhibitors and exogenous polyamines on arginine decarboxylase,
ornithine decarboxylase, and S-adenosylmethionine decarboxylase. The Journal of
Biological Chemistry, 261(3), 1293-1298.
Hussain, S. S., Ali, M., Ahmad, M., & Siddique, K. H. (2011). Polyamines: Natural and
engineered abiotic and biotic stress tolerance in plants. Biotechnology Advances, 29(3), 300-
311.
Igarashi, K., & Kashiwagi, K. (2010). Characteristics of cellular polyamine transport in
prokaryotes and eukaryotes. Plant Physiol Biochem, 48(7), 506-512. Retrieved from
http://www.hubmed.org/display.cgi?uids=20159658
15
Illingworth, C., Mayer, M. J., Elliott, K., Hanfrey, C., Walton, N. J., & Michael, A. J. (2003).
The diverse bacterial origins of the arabidopsis polyamine biosynthetic pathway. FEBS
Letters, 549(1), 26-30.
Ioannidis, N. E., Cruz, J. A., Kotzabasis, K., & Kramer, D. M. (2012). Evidence that putrescine
modulates the higher plant photosynthetic proton circuit. PloS One, 7(1), e29864.
Jefferson, R. A., Kavanagh, T. A., & Bevan, M. W. (1987). GUS fusions: Beta-glucuronidase as
a sensitive and versatile gene fusion marker in higher plants. EMBO J, 6(13), 3901-3907.
Retrieved from http://www.hubmed.org/display.cgi?uids=3327686
Karimi, M., Inze, D., & Depicker, A. (2002). GATEWAY vectors for agrobacterium-mediated
plant transformation. Trends Plant Sci, 7(5), 193-195. Retrieved from
http://www.hubmed.org/display.cgi?uids=11992820
Kasukabe, Y., He, L., Nada, K., Misawa, S., Ihara, I., & Tachibana, S. (2004). Overexpression of
spermidine synthase enhances tolerance to multiple environmental stresses and up-regulates
the expression of various stress-regulated genes in transgenic arabidopsis thaliana. Plant
Cell Physiol, 45(6), 712-722. Retrieved from
http://www.hubmed.org/display.cgi?uids=15215506
Kelley, L. A., & Sternberg, M. J. (2009). Protein structure prediction on the web: A case study
using the phyre server. Nature Protocols, 4(3), 363-371.
16
Kurepa, J., Smalle, J., Van Montagu, M., & Inzé, D. (1998). Effects of sucrose supply on growth
and paraquat tolerance of the late-flowering gi-3 mutant. Plant Growth Regulation, 26(2),
91-96.
Kusano, T., Berberich, T., Tateda, C., & Takahashi, Y. (2008a). Polyamines: Essential factors
for growth and survival. Planta, 228(3), 367-381.
Kusano, T., & Suzuki, H. (2015). Polyamines: A universal molecular nexus for growth, survival,
and specialized metabolism Springer.
Kusano, T., Berberich, T., Tateda, C., & Takahashi, Y. (2008b). Polyamines: Essential factors
for growth and survival. Planta, 228(3), 367-381. Retrieved from
http://www.hubmed.org/display.cgi?uids=18594857
Kusano, T., Yamaguchi, K., Berberich, T., & Takahashi, Y. (2007). Advances in polyamine
research in 2007. J Plant Res, 120(3), 345-350. Retrieved from
http://www.hubmed.org/display.cgi?uids=17351711
Li, Z., Zhou, H., Peng, Y., Zhang, X., Ma, X., Huang, L., & Yan, Y.Exogenously applied
spermidine improves drought tolerance in creeping bentgrass associated with changes in
antioxidant defense, endogenous polyamines and phytohormones. Plant Growth Regulation,
, 1-12.
Li, J., Mu, J., Bai, J., Fu, F., Zou, T., An, F., . . . Zuo, J. (2013). Paraquat Resistant1, a golgi-
localized putative transporter protein, is involved in intracellular transport of paraquat. Plant
Physiology, 162(1), 470-483. doi:10.1104/pp.113.213892 [doi]
17
Liu, J., Kitashiba, H., Wang, J., Ban, Y., & Moriguchi, T. (2007). Polyamines and their ability to
provide environmental stress tolerance to plants. Plant Biotechnology, 24(1), 117-126.
Liu, G., Ji, Y., Bhuiyan, N. H., Pilot, G., Selvaraj, G., Zou, J., & Wei, Y. (2010). Amino acid
homeostasis modulates salicylic acid-associated redox status and defense responses in
arabidopsis. The Plant Cell, 22(11), 3845-3863. doi:10.1105/tpc.110.079392 [doi]
Lobell, D. B., Cassman, K. G., & Field, C. B. (2009). Crop yield gaps: Their importance,
magnitudes, and causes. Annual Review of Environment and Resources, 34(1), 179.
Marco, F., Alcázar, R., Tiburcio, A. F., & Carrasco, P. (2011). Interactions between polyamines
and abiotic stress pathway responses unraveled by transcriptome analysis of polyamine
overproducers. Omics: A Journal of Integrative Biology, 15(11), 775-781.
Marina, M., Maiale, S. J., Rossi, F. R., Romero, M. F., Rivas, E. I., Garriz, A., . . . Pieckenstain,
F. L. (2008). Apoplastic polyamine oxidation plays different roles in local responses of
tobacco to infection by the necrotrophic fungus sclerotinia sclerotiorum and the biotrophic
bacterium pseudomonas viridiflava. Plant Physiology, 147(4), 2164-2178.
doi:10.1104/pp.108.122614 [doi]
Martin-Tanguy, J. (1985). The occurrence and possible function of hydroxycinnamoyl acid
amides in plants. Plant Growth Regulation, 3(3-4), 381-399.
Mattoo, A. K., Minocha, S. C., Minocha, R., & Handa, A. K. (2010). Polyamines and cellular
metabolism in plants: Transgenic approaches reveal different responses to diamine
18
putrescine versus higher polyamines spermidine and spermine. Amino Acids, 38(2), 405-
413. Retrieved from http://www.hubmed.org/display.cgi?uids=19956999
Mitsuya, Y., Takahashi, Y., Berberich, T., Miyazaki, A., Matsumura, H., Takahashi, H., . . .
Kusano, T. (2009). Spermine signaling plays a significant role in the defense response of
arabidopsis thaliana to cucumber mosaic virus. J Plant Physiol, 166(6), 626-643. Retrieved
from http://www.hubmed.org/display.cgi?uids=18922600
Møller, S. G., & McPherson, M. J. (1998). Developmental expression and biochemical analysis
of the arabidopsis atao1 gene encoding an H2O2Ǧgenerating diamine oxidase. The Plant
Journal, 13(6), 781-791.
Moller, S. G., & McPherson, M. J. (1998). Developmental expression and biochemical analysis
of the arabidopsis atao1 gene encoding an H2O2-generating diamine oxidase. Plant J, 13(6),
781-791. Retrieved from http://www.hubmed.org/display.cgi?uids=9681017
Moschou, P. N., Paschalidis, K. A., & Roubelakis-Angelakis, K. A. (2008). Plant polyamine
catabolism: The state of the art. Plant Signal Behav, 3(12), 1061-1066. Retrieved from
http://www.hubmed.org/display.cgi?uids=19513239
Muilu-Mäkelä, R., Vuosku, J., Läärä, E., Saarinen, M., Heiskanen, J., Häggman, H., & Sarjala,
T. (2015). Water availability influences morphology, mycorrhizal associations, PSII
efficiency and polyamine metabolism at early growth phase of scots pine seedlings. Plant
Physiology and Biochemistry, 88, 70-81.
19
Mulangi, V., Phuntumart, V., Aouida, M., Ramotar, D., & Morris, P. (2012a). Functional
analysis of OsPUT1, a rice polyamine uptake transporter. Planta, 235(1), 1-11.
Mulangi, V., Chibucos, M. C., Phuntumart, V., & Morris, P. F. (2012). Kinetic and phylogenetic
analysis of plant polyamine uptake transporters. Planta, 236(4), 1261-1273.
Mulangi, V., Phuntumart, V., Aouida, M., Ramotar, D., & Morris, P. (2012b). Functional
analysis of OsPUT1, a rice polyamine uptake transporter. Planta, 235(1), 1-11.
Nambeesan, S., Mattoo, A., & Handa, A. (2008). Polyamines and regulation of ripening and
senescence. Postharvest Biology and Technology of Fruits, Vegetables and Flowers, , 319-
340.
Peremarti, A., Bassie, L., Christou, P., & Capell, T. (2009). Spermine facilitates recovery from
drought but does not confer drought tolerance in transgenic rice plants expressing datura
stramonium S-adenosylmethionine decarboxylase. Plant Molecular Biology, 70(3), 253-
264.
Pistocchi, R., Bagni, N., & Creus, J. A. (1987). Polyamine uptake in carrot cell cultures. Plant
Physiol, 84(2), 374-380. Retrieved from
http://www.hubmed.org/display.cgi?uids=16665446
Planas-Portell, J., Gallart, M., Tiburcio, A. F., & Altabella, T. (2013). Copper-containing amine
oxidases contribute to terminal polyamine oxidation in peroxisomes and apoplast of
arabidopsis thaliana. BMC Plant Biology, 13, 109-2229-13-109. doi:10.1186/1471-2229-13-
109 [doi]
20
Rasband, W. S. (2008). ImageJ. Http://Rsbweb.Nih.Gov/Ij/,
Rider, J. E., Hacker, A., Mackintosh, C. A., Pegg, A. E., Woster, P. M., & Casero, R. A. (2007).
Spermine and spermidine mediate protection against oxidative damage caused by hydrogen
peroxide. Amino Acids, 33(2), 231-240. Retrieved from
http://www.hubmed.org/display.cgi?uids=17396215
Roychoudhury, A., Basu, S., & Sengupta, D. N. (2011). Amelioration of salinity stress by
exogenously applied spermidine or spermine in three varieties of indica rice differing in
their level of salt tolerance. Journal of Plant Physiology, 168(4), 317-328.
Saleem, B., Malik, A., Anwar, R., & and Farooq, M. (2008). EXOGENOUS APPLICATION OF
POLYAMINES IMPROVES FRUIT SET, YIELD AND QUALITY OF SWEET
ORANGES. . Acta Hort. (ISHS), 774, 187.
Saleethong, P., Sanitchon, J., Kong-Ngern, K., & Theerakulpisut, P. (2013). Effects of
exogenous spermidine (spd) on yield, yield-related parameters and mineral composition of
rice ('oryza sativa'L. ssp.'indica') grains under salt stress.
Schmidhuber, J., & Tubiello, F. N. (2007). Global food security under climate change.
Proceedings of the National Academy of Sciences of the United States of America, 104(50),
19703-19708. doi:0701976104 [pii]
Serafini-Fracassini, D., Di Sandro, A., & Del Duca, S. (2010). Spermine delays leaf senescence
in lactuca sativa and prevents the decay of chloroplast photosystems. Plant Physiology and
Biochemistry, 48(7), 602-611.
21
Serafini-Fracassini, D., & Del Duca, S. (2008). Transglutaminases: Widespread cross-linking
enzymes in plants. Annals of Botany, 102(2), 145-152. doi:10.1093/aob/mcn075 [doi]
Shaddad, M., El-Samad, M. H. A., & Mohammed, H. (2011). Interactive effects of drought stress
and phytohormones or polyamines on growth and yield of two M (zea maize L) genotypes.
American Journal of Plant Sciences, 2(06), 790.
Shi, H., & Chan, Z. (2014a). Improvement of plant abiotic stress tolerance through modulation of
the polyamine pathway. Journal of Integrative Plant Biology, 56(2), 114-121.
Shi, H., & Chan, Z. (2014b). Improvement of plant abiotic stress tolerance through modulation
of the polyamine pathway. Journal of Integrative Plant Biology, 56(2), 114-121.
Slocum, R. D. (1991). Polyamine biosynthesis in plants. Biochemistry and Physiology of
Polyamines in Plants, , 23-40.
Sparkes, I. A., Runions, J., Kearns, A., & Hawes, C. (2006). Rapid, transient expression of
fluorescent fusion proteins in tobacco plants and generation of stably transformed plants.
Nature Protocols, 1(4), 2019-2025.
Sugar, D. (1988). Effect of putrescine sprays at anthesis on'comice'pear yield components.
QRUNFLEH MM, SUWWAN MA-Response of Three Summer Annuals to Paclobu, , 27.
Takahashi, T., & Kakehi, J. (2010a). Polyamines: Ubiquitous polycations with unique roles in
growth and stress responses. Annals of Botany, 105(1), 1-6. doi:10.1093/aob/mcp259 [doi]
22
Takahashi, T., & Kakehi, J. (2010b). Polyamines: Ubiquitous polycations with unique roles in
growth and stress responses. Ann Bot, 105(1), 1-6. Retrieved from
http://www.hubmed.org/display.cgi?uids=19828463
Tavladoraki, P., Cona, A., Federico, R., Tempera, G., Viceconte, N., Saccoccio, S., . . .
Agostinelli, E. (2012). Polyamine catabolism: Target for antiproliferative therapies in
animals and stress tolerance strategies in plants. Amino Acids, 42(2-3), 411-426.
Tiburcio, A. F., Altabella, T., Bitrián, M., & Alcázar, R. (2014). The roles of polyamines during
the lifespan of plants: From development to stress. Planta, 240(1), 1-18.
Urano, K., Yoshiba, Y., Nanjo, T., Ito, T., Yamaguchi-Shinozaki, K., & Shinozaki, K. (2004).
Arabidopsis stress-inducible gene for arginine decarboxylase AtADC2 is required for
accumulation of putrescine in salt tolerance. Biochem Biophys Res Commun, 313(2), 369-
375. Retrieved from http://www.hubmed.org/display.cgi?uids=14684170
Vaishali Mulangi, G. R. (2011). Characterization of polyamine transporters from rice and
arabidopsis Retrieved from http://rave.ohiolink.edu/etdc/view?acc_num=bgsu1303231265
Verslues, P. E., Agarwal, M., Katiyar-Agarwal, S., Zhu, J., & Zhu, J. (2006). Methods and
concepts in quantifying resistance to drought, salt and freezing, abiotic stresses that affect
plant water status. The Plant Journal, 45(4), 523-539. doi:10.1111/j.1365-
313X.2005.02593.x
Wallace, H. M., Fraser, A. V., & Hughes, A. (2003). A perspective of polyamine metabolism.
Biochem J, 376, 1-14. Retrieved from http://www.hubmed.org/display.cgi?uids=13678416
23
Walters, D. (2003). Resistance to plant pathogens: Possible roles for free polyamines and
polyamine catabolism. New Phytologist, 159(1), 109-115.
Wang, W., Vinocur, B., & Altman, A. (2003). Plant responses to drought, salinity and extreme
temperatures: Towards genetic engineering for stress tolerance. Planta, 218(1), 1-14.
Wimalasekera, R., Villar, C., Begum, T., & Scherer, G. F. (2011). COPPER AMINE
OXIDASE1 (CuAO1) of arabidopsis thaliana contributes to abscisic acid- and polyamine-
induced nitric oxide biosynthesis and abscisic acid signal transduction. Molecular Plant,
4(4), 663-678. doi:10.1093/mp/ssr023 [doi]
Woo, N. S., Badger, M. R., & Pogson, B. J. (2008). A rapid, non-invasive procedure for
quantitative assessment of drought survival using chlorophyll fluorescence. Plant Methods,
4, 27-4811-4-27. doi:10.1186/1746-4811-4-27 [doi]
Yamaguchi, K., Takahashi, Y., Berberich, T., Imai, A., Takahashi, T., Michael, A. J., & Kusano,
T. (2007a). A protective role for the polyamine spermine against drought stress in
arabidopsis. Biochemical and Biophysical Research Communications, 352(2), 486-490.
Yamaguchi, K., Takahashi, Y., Berberich, T., Imai, A., Takahashi, T., Michael, A. J., & Kusano,
T. (2007b). A protective role for the polyamine spermine against drought stress in
arabidopsis. Biochem Biophys Res Commun, 352(2), 486-490. Retrieved from
http://www.hubmed.org/display.cgi?uids=17118338
24
Yoda, H., Hiroi, Y., & Sano, H. (2006). Polyamine oxidase is one of the key elements for
oxidative burst to induce programmed cell death in tobacco cultured cells. Plant Physiology,
142(1), 193-206. doi:pp.106.080515 [pii]
Zeier, J. (2013). New insights into the regulation of plant immunity by amino acid metabolic
pathways. Plant, Cell & Environment, 36(12), 2085-2103.
Zhang, X., Henriques, R., Lin, S., Niu, Q., & Chua, N. (2006). Agrobacterium-mediated
transformation of arabidopsis thaliana using the floral dip method. Nature Protocols, 1(2),
641-646.
Zhang, Z., Ogawa, M., Fleet, C. M., Zentella, R., Hu, J., Heo, J., . . . Sun, T. (2011).
SCARECROW-LIKE 3 promotes gibberellin signaling by antagonizing master growth
repressor DELLA in arabidopsis. Proceedings of the National Academy of Sciences, 108(5),
2160-2165. doi:10.1073/pnas.1012232108
Zhou, Q., & Yu, B. (2010). Changes in content of free, conjugated and bound polyamines and
osmotic adjustment in adaptation of vetiver grass to water deficit. Plant Physiology and
Biochemistry, 48(6), 417-425.
25
CHAPTER 1: HIDING IN PLAIN SIGHT: A THIRD ROUTE FOR PUTRESCINE
BIOSYNTHESIS IN PLANTS
Jigar Patel1, Lingxiao Ge1, Sheaza Ahmed1, Menaka Ariyaratne1, Vipaporn Phuntumart1, Andrea
Kalinoski 2, Paul F. Morris1.
1 Department of Biological Sciences, Bowling Green State University, Bowling Green OH
43403.
2 Department of Surgery, University of Toledo, Toledo OH 43614
Abstract
Transgenic manipulation of polyamine levels has provided compelling evidence that polyamines enable plants to respond to environmental cues by activation of stress and developmental pathways. While it has been thought that A. thaliana has only a single cytosolic pathway for putrescine synthesis, here we show that both A. thaliana and soybeans have a plastid-localized putrescine pathway consisting of an arginine decarboxylase and an enzyme with arginase/agmatinase activity. Since the sequences of plant arginases show conservation of key residues and the predicted 3D structure of plant agmatinases overlaps the crystal structure of the enzyme from Deinococcus radiodurans, we suggest that these enzymes can synthesize putrescene, whenever they have access to the substrate agmatine. Finally, we demonstrate that the synthesis of putrescine by ornithine decarboxylase is localized to the endoplasmic reticulum.
Our observations point to a complex compartmentalization of putrescine synthesis in plants.
26
Introduction, Results and Discussion
A distinguishing feature of eukaryotic cells is the presence of membrane-bound organelles and vesicles. In plants, these cellular rooms have multiple functions that include the specialized compartmentation of metabolic processes such as carbon fixation, and respiration, thylakoid membranes to capture light energy, and the sequestering of waste products or anti- feedants that are normally released only upon cell lysis (Lunn 2007).
In addition to its role in photosynthesis, the plastid plays a major role in the biosynthesis of amino acids, nucleotides, fatty acids, and vitamins. This compartmentation of metabolism requires the organized import and export of metabolites, but also prevents futile cycling of metabolites (Linka and Weber 2010). An additional feature of plant metabolism is the redundancy of certain metabolic pathways (Plaxton 1996, Krueger, Niehl et al. 2009, Ros,
Munoz-Bertomeu et al. 2014). This is also the case for polyamine biosynthesis. Ornithine decarboxylase (ODC) converts ornithine directly to putrescine (Fuell, Elliott et al. 2010) and then putrescine serves as one of the building blocks for spermidine, thermospermine, and spermine. A second route for putrescine biosynthesis, utilizes arginine decarboxylase (ADC) to convert arginine to agmatine, and two additional enzymes, agmatine deiminase (AtAI) and N- carbamoyl putrescine aminohydrolase (At-NLP1) are needed to complete the pathway.
Polyamines are essential for cell viability (Imai, Matsuyama et al. 2004), and levels of putrescine along with the other polyamines spermidine, and spermine are strongly correlated with cellular responses to development and various environmental stresses (Tiburcio, Altabella et al. 2014).
Two independent pathways for polyamines enable plants to differentially activate the pathways in response to an environmental stimulus. In the course of evolution, A. thaliana has lost ODC, and thus the second known pathway, but now has two ADC’s (Hanfrey, Sommer et al. 2001).
27
The two ADCs also show a strong divergence in expression, and up-regulation of ADC2 has been implicated in multiple stress responses (Winter, Vinegar et al. 2007). Presently there is no experimental evidence to indicate where these proteins are localized in the plant cell (Sun,
Zybailov et al. 2009). However in oats and tobacco, an ADC was localized to the chloroplast
(Borrell, Culiañez-Macià et al. 1995, Bortolotti, Cordeiro et al. 2004). Spatial separation of the two ADCs between the chloroplast and the cytosol in A. thaliana could indicate that agmatine produced by the two enzymes is diverted to different metabolic pathways.
In E coli and humans, putrescine can be synthesized in a two-step process from arginine by arginine decarboxylase, which makes agmatine; and agmatinase, which converts agmatine to putrescine with the release of urea (Heller, Rostomily et al. 1983, Satishchandran and Boyle
1986, Mistry, Burwell et al. 2002). Phylogenetic analyses suggest that plant arginases may be more similar to bacterial agmatinases than bacterial or mammalian arginases (Chen, McCaig et al. 2004). Enzymes with agmatinase activity are members of the ureohydrolase superfamily that also include enzymes with arginase, forminoglutamase, and proclavaminate amidoinohydrolase activities (Ahn, Kim et al. 2004). However plant enzymes with arginase activity appear to have little or no agmatinase activity (Hwang, Kim et al. 2001, Chen, McCaig et al. 2004).
A. thaliana contains two predicted genes with Arginase/Agmatinase activity (At4g08870 and At4G0890) that have not been fully characterized. Both proteins have been localized to the plastid in independent proteome experiments (Sun, Zybailov et al. 2009). Non-aqueous fraction, followed by MS analysis has emerged as a means of predicting the localization of metabolites to specific subcellular compartments (Krueger, Giavalisco et al. 2011). Using this approach, arginine, and the polyamines, putrescine and spermidine, were found to be enriched in the chloroplast fraction of A. thaliana. To summarize, localization of the two ADCs, has not been
28 established, but both the substrate and product for ADC are enriched in the plastid fraction
(Krueger, Niehl et al. 2009). MS analysis provides support for one enzyme with potential agmatinase activity being associated with the chloroplast (At4g08870), but this enzyme has also been associated with mitochondrial fractions, and its activity as an agmatinase has not been demonstrated.
To address gaps in the localization of polyamine biosynthesis, we first sought to confirm the cytosolic location of ADC1 by transient expression of N-terminal and C-terminal GFP fusions in tobacco leaves. Both constructs were found to localize to the cytosol. Since ATAIH and ATNLP have been previously localized to the cytosol in a proteomic study (Ito, Batth et al.
2011) all of the enzymes of this putrescine pathway are localized in the cytosol. The Arabidopsis genome contains two ADCs, one of which has a predicted chloroplast translocation signal (Table
S2) and two genes with predicted arginase/agmatinase activity. One of these, (ARGAH2), was found to be associated with the chloroplast proteome (Kleffmann, Russenberger et al. 2004).
Transient expression of ADC2-GFP and ARGAH2-GFP in N. benthamiana leaves showed that both these proteins are localized to the chloroplast (Fig. 2). To investigate whether these two enzymes could function together in a cell to synthesize putrescine, the two genes were tested together using a yeast complementation assay. Yeast mutants lacking ornithine decarboxylase
(Spe1) are deficient in the synthesis of putrescine, and cease growth in the absence of exogenous polyamines (Schwartz, Hittelman et al. 1995). Co-transformation of an oat ADC and either a human or an E. coli agmatinase gene has previously been used to reconstitute a putrescine biosynthetic pathway in yeast (Mistry, Burwell et al. 2002). Using a similar strategy we transformed AtADC2 and AtARGAH2 in the yeast mutant Spe1. Transformants expressing only
AtADC2 or AtARGAH2 did not grow in the absence of exogenous putrescine (Fig. 3).
29
Expression of both genes fully complemented the growth defect of Spe1. Thus the two chloroplast-localized genes are capable of working in concert to synthesize putrescine.
Figure 2. Localization analysis of AtADC2 and AtARGAH2 by transient expression in N. benthamiana leaves. N. benthamiana leaves were infiltrated by Agrobacterium tumefecians (GV3101) containing expression plasmids harboring the full-length AtADC2 or AtARGAH2 fused to GFP at its C terminus under the control of the CaMV 35S promoter. GFP fluorescence and chlorophyll autofluorescence of transformed leaves were observed by confocal microscopy.
Figure 3. Characterization of Arabidopsis agmatinase by complementation in yeast. WT, spe1, spe1+ AtADC2, spe1 +AtARGAH2 and spe1 + AtADC2 +AtARGAH2 were plated on SC minimal media in the presence and absence of exogenous putrescine.
To investigate whether this pathway might exist in other plants, we examined the genomes of several species for evidence of multiple ADCs and multiple genes with predicted agmatinase activity. We searched 43 sequenced and annotated green plant genomes from
Phytozome for a plastid-localized putrescine pathway. We found that, 23 of 43 sequenced and annotated plant genomes had more than one ADC, and 12 of these genomes had at least one ADC with predicted localization to the plastid (Table S2). Within in this subset of plant genomes, 13
30 genomes included more than one gene with predicted ARGAH activity. Phylogenetic analysis showed that all of the ADCs from seven Brassica genomes grouped together in two clades of nine and five sequences (Fig. S1). AtADC2 was in a clade separate for AtADC1 and all the members of the clade with AtADC2 which included at least one gene from each species, were predicted to be localized to the plastid. Other dicot species with two ADC genes included cacao, strawberry, tomato, potato, soybeans and Mimulus guttatus. With the exception of soybeans, at least one of the ADCs in each of these species had a predicted plastid localization. The monocots; corn, rice and Panicum virgatum also contained two ADC genes, but none of these genes were predicted to be targeted to the chloroplast. We also noted that moss has three predicted ADC genes, and one of them is predicted to be localized in the chloroplast. A smaller number of species were found to have two genes with predicted ARGAH activity (Fig. S2).
Species that contained two members of both ADC and ARGAH included four members of the
Brassicaciae, along with tomatoes, and soybeans. Dicots that had duplications in only ARGAH, but not ADC, included cassava, flax, and poplar. No monocot species were identified with more than one ARGAH.
To determine whether a complete biosynthetic pathway for putrescine in the chloroplast might exist outside of the Brassicaceae, we used transient expression assays of both
Glyma.03G028000, (ADC2); and Glyma03g03270, (ARGAH) in N. benthamiana leaves to show that these two genes are localized to the chloroplast (Fig. S4.). In the yeast complementation assay, the expression of ATADC2 and Glyma03g03270 in the yeast mutant strain Spe1 enabled the yeast strain to grow in the absence of exogenous putrescine. Thus soybeans, along with A. thaliana have a complete chloroplast-localized putrescine biosynthetic pathway. Sequence alignment of plant agmatinases retrieved from phytozome showed that these proteins have a high
31 level of sequence conservation. Protein homology modeling of ARGAHs from A. thaliana,
Glycine max, and Populus trichocarpa using PHYRE2 (Kelley and Sternberg 2009) showed that these proteins are structurally similar to agmatinase from Deinococcus radiodurans (DR) (Fig 4).
These plant genes along with the human mitochondrial agamatinase. (Ahn, Kim et al. 2004) have conservation of the critical Mn binding sites and the predicted catalytic residues. PHYRE2 analysis also revealed that the Mn binding sites and catalytic sites are highly conserved amongst the ARGAHs investigated and DR agmatinase (Fig S4). Thus we predict that the ARGAHs from
A. thaliana, Glycine max, and Populus trichocarpa must have agmatinase activity.
Figure 4. Predicted 3D structure of AtARGAH2 is highly similar to the crystal structure of Deinococcus radiodurans agmatinase. (A) DR agmatinase, (B) AT agmatinase (C) superpose of A and B. Structure of AT agmatinase was predicted using PHYRE2 and superposition of DR agmatinase and AT agmatinase was done using Chimera. As an additional test of this hypothesis, we also tested the other AtARGAH gene in the yeast complementation assay. As expected, this gene was also able to complement the yeast mutant (Data no shown). Plant arginases exhibit a clear substrate preference for arginine over agmatine at mM levels (Chen, McCaig et al. 2004). The dual activities of these enzymes enables them to function both as arginases in the urea cycle during tissue senescence, and also serve as an agmatinase to synthesize putrescine at other times. Plant agmatine transporters have
32 not yet been characterized, but the transport of agmatine into the mitochondria could enable agmatinases located there, to synthesize putrescine.
The localization of ornithine decarboxylase has not yet been clearly established. However, since we noted spatial separation of the two putrescine biosynthesis pathways starting with ADC, we postulated that synthesis of ornithine decarboxylase might be spatially separated from the cytosolic ADC pathway. The subcellular localization of OsODC was determined by transient expression of GFP fusions in Nicotiana benthamiana leaves mediated by
Agrobacterium. The GFP signals overlapped with the mCherry signals of the endoplasmic reticulum (ER) marker (Fig 5. A&B). Bombardment assay of onion epidermal cells confirmed the localization of ODC to the ER. Localization of ornithine decarboxylase to the ER may enable simultaneous operation of the urea cycle, and polyamine synthesis, which share a common substrate. It may also enable putrescine that is synthesized in the ER to be directly exported from the cell by secretion to the apoplast.
33
Figure 5. Subcellular localization of OsODC. A. Confocal images of Nicotiana benthamiana leaf cells expressing OsODC-GFP under control of a cauliflower mosaic virus (CaMV) 35S constitutive promoter and fused with a C-terminus GFP tag. Scale bars, 25μm. Pictures were taken 3 days after the infiltration of Agrobacterium into tobacco leaves. B. Confocal images of onion epidermis cells expressing OsODC-GFP under control of a cauliflower mosaic virus (CaMV) 35S constitutive promoter and fused with N-terminus GFP tag. Scale bars, 50μm. Pictures were taken 16 hours after the particle bombardment. In this study we have confirmed the localization of two enzymes that enable the synthesis of putrescine in the chloroplast of A. thaliana and G. max. Our study also identified many plant species with two ADCs, some of which have been predicted to be localized to the plastid.
However, plant genomes with two ADCs and two agmatinases are not common, and notably, none of the sequenced monocot genomes contain two agmatinases. Thus the retention of a complete plastid pathway is relatively uncommon in plant genomes. Of the seven sequenced
Brassica genomes with two ADC’s, only four were found to have retained two ARGAH genes.
In this scenario, agmatine would then have to be exported from the plastid to be metabolized in the cytoplasm by the cytosolic pathway, or imported into the mitochondria to be converted to
34 putrescine by agmatinases located there. Given the importance of interspecies hybridization and whole genome duplication events in the evolutionary history of plants, the absence of a separate plastid pathway hints that for most plants, this pathway would be disadvantageous. Perhaps this is a consequence of that putrescine may also act as a permeant buffer in the thylakoid spaces, and under certain conditions impair the normal activity of the ETC (Ioannidis, Cruz et al. 2012,
Ioannidis and Kotzabasis 2014). Some plant genomes such as flax and cassava have two agmatinases. In these plants, synthesis of putrescine may also occur, if there is a plastid- localized agmatine transporter or exchanger.
The persistence of two or more biosynthetic pathways for polyamines is a likely consequence of the multiplicity of roles that these compounds have been shown to have in developmental and stress responses of plants. The spatial organization of these pathways also highlight the importance of PA transporters in providing an additional means of regulating localized changes of these signaling compounds. We hope that the elucidation of this pathway may renew interest in manipulating PA levels to optimize crop responses to climate change.
35
References
Ahn, H. J., K. H. Kim, J. Lee, J. Y. Ha, H. H. Lee, D. Kim, H. J. Yoon, A. R. Kwon and S. W.
Suh (2004). "Crystal structure of agmatinase reveals structural conservation and
inhibition mechanism of the ureohydrolase superfamily." J Biol Chem 279(48): 50505-
50513.
Borrell, A., F. A. Culiañez-Macià, T. Altabella, R. T. Besford, D. Flores and A. F. Tiburcio
(1995). "Arginine decarboxylase is localized in chloroplasts " Plant Physiol 109(3): 771-
776.
Bortolotti, C., A. Cordeiro, R. Alcázar, A. Borrell, F. A. Culiañez-Macià, A. F. Tiburcio and T.
Altabella (2004). " Localization of arginine decarboxylase in tobacco plants." Physiologia
Plantarum 120(1): 84-92.
Chen, H., B. C. McCaig, M. Melotto, S. Y. He and G. A. Howe (2004). "Regulation of plant
arginase by wounding, jasmonate, and the phytotoxin coronatine." J Biol Chem 279(44):
45998-46007.
Fuell, C., K. A. Elliott, C. C. Hanfrey, M. Franceschetti and A. J. Michael (2010). "Polyamine
biosynthetic diversity in plants and algae." Plant Physiol Biochem 48(7): 513-520.
Hanfrey, C., S. Sommer, M. J. Mayer, D. Burtin and A. J. Michael (2001). "Arabidopsis
polyamine biosynthesis: absence of ornithine decarboxylase and the mechanism of
arginine decarboxylase activity. ." Plant J 27: 551-560.
Heller, J. S., R. Rostomily, D. A. Kyriakidis and E. S. Canellakis (1983). "Regulation of
polyamine biosynthesis in Escherichia coli by basic proteins." Proc Natl Acad Sci U S A
80(17): 5181-5184.
36
Hwang, H. J., E. H. Kim and Y. D. Cho (2001). "Isolation and properties of arginase from a
shade plant, ginseng (Panax ginseng C.A. Meyer) roots." Phytochemistry 58(7): 1015-
1024.
Imai, A., T. Matsuyama, Y. Hanzawa, T. Akiyama, M. Tamaoki, H. Saji, Y. Shirano, T. Kato, H.
Hayashi, D. Shibata, S. Tabata, Y. Komeda and T. Takahashi (2004). "Spermidine
synthase genes are essential for survival of Arabidopsis." Plant Physiol. 135(3): 1565-
1573.
Ioannidis, N. E., J. A. Cruz, K. Kotzabasis and D. M. Kramer (2012). "Evidence that putrescine
modulates the higher plant photosynthetic proton circuit." PLoS One 7(1): e29864.
Ioannidis, N. E. and K. Kotzabasis (2014). "Polyamines in chemiosmosis in vivo: A cunning
mechanism for the regulation of ATP synthesis during growth and stress." Front Plant Sci
5: 71.
Ito, J., T. S. Batth, C. J. Petzold, A. M. Redding-Johanson, A. Mukhopadhyay, R. Verboom, E.
H. Meyer, A. H. Millar and J. L. Heazlewood (2011). "Analysis of the Arabidopsis
cytosolic proteome highlights subcellular partitioning of central plant metabolism." J
Proteome Res 10(4): 1571-1582.
Kelley, L. A. and M. J. Sternberg (2009). "Protein structure prediction on the Web: a case study
using the Phyre server." Nat Protoc 4(3): 363-371.
Kleffmann, T., D. Russenberger, A. von Zychlinski, W. Christopher, K. Sjolander, W. Gruissem
and S. Baginsky (2004). "The Arabidopsis thaliana chloroplast proteome reveals pathway
abundance and novel protein functions." Curr Biol 14(5): 354-362.
37
Krueger, S., P. Giavalisco, L. Krall, M. C. Steinhauser, D. Bussis, B. Usadel, U. I. Flugge, A. R.
Fernie, L. Willmitzer and D. Steinhauser (2011). "A topological map of the
compartmentalized Arabidopsis thaliana leaf metabolome." PLoS One 6(3): e17806.
Krueger, S., A. Niehl, M. C. Lopez Martin, D. Steinhauser, A. Donath, T. Hildebrandt, L. C.
Romero, R. Hoefgen, C. Gotor and H. Hesse (2009). "Analysis of cytosolic and plastidic
serine acetyltransferase mutants and subcellular metabolite distributions suggests
interplay of the cellular compartments for cysteine biosynthesis in Arabidopsis." Plant
Cell Environ 32(4): 349-367.
Linka, N. and A. P. Weber (2010). "Intracellular metabolite transporters in plants." Mol Plant
3(1): 21-53.
Lunn, J. E. (2007). "Compartmentation in plant metabolism." J Exp Bot 58(1): 35-47.
Mistry, S. K., T. J. Burwell, R. M. Chambers, L. Rudolph-Owen, F. Spaltmann, W. J. Cook and
S. M. Morris, Jr. (2002). "Cloning of human agmatinase. An alternate path for polyamine
synthesis induced in liver by hepatitis B virus." Am J Physiol Gastrointest Liver Physiol
282(2): G375-381.
Plaxton, W. C. (1996). "The Organization and Regulation of Plant Glycolysis." Annu Rev Plant
Physiol Plant Mol Biol 47: 185-214.
Ros, R., J. Munoz-Bertomeu and S. Krueger (2014). "Serine in plants: biosynthesis, metabolism,
and functions." Trends Plant Sci 19(9): 564-569.
Satishchandran, C. and S. M. Boyle (1986). "Purification and properties of agmatine
ureohydrolyase, a putrescine biosynthetic enzyme in Escherichia coli." J Bacteriol
165(3): 843-848.
38
Schwartz, B., A. Hittelman, L. Daneshvar, H. S. Basu, L. J. Marton and B. G. Feuerstein (1995).
"A new model for disruption of the ornithine decarboxylase gene, Spe1, in
Saccharomyces-cerevisiae exhibits growth arrest and genetic instability at the MAT
locus." Biochemical Journal 312: 83-90.
Sun, Q., B. Zybailov, W. Majeran, G. Friso, P. Olinares and K. van Wijk (2009). "PPDB, the
Plant Proteomics Database at Cornell." Nucleic Acids Res (Database issue):D969-74.
doi: 10.1093/nar/gkn654.
Tiburcio, A. F., T. Altabella, M. Bitrian and R. Alcazar (2014). "The roles of polyamines during
the lifespan of plants: from development to stress." Planta.
Winter, D., B. Vinegar, H. Nahal, R. Ammar, G. V. Wilson and N. J. Provart (2007). "An
"Electronic Fluorescent Pictograph" browser for exploring and analyzing large-scale
biological data sets." PLoS One 2(1): e718.
39
Supplementary Material for Hiding in Plain Sight: A Third Route for Putrescine Biosynthesis in
Plants
Jigar Patel1, Lingxiao Ge1, Sheaza Ahmed1, Menaka Ariyaratne1, Vipaporn Phuntumart1, Andrea
Kalinoski 2, Paul F. Morris1.
1 Department of Biological Sciences, Bowling Green State University, Bowling Green OH
43403.
2 Department of Surgery, University of Toledo, Toledo OH 43614
Supplementary materials and methods
Genes and constructs cDNA clones of Arabidopsis thaliana ADC2 (At4G34710) ARGAH 1 (At4G08900) ARGAH2
(At4G08870) were obtained from ABRC. Genes were amplified via PCR using gene-specific primer pairs listed in Table S1. AtADC1 was amplified from genomic DNA of A. thaliana Col-
0. Rice genomic DNA was isolated from the rice cultivar Nipponbare using the CTAB method
(Clarke 2009). The full length OsODC gene was amplified from the genomic DNA. GmODC was amplified by PCR using genomic DNA from the cultivar Williams. The sequence of
Glyma.03g028000 (GmARGAH) was codon-optimized for expression in yeast and synthesized by GenScript, Pistcataway, NJ. GmADC (Glyma.06G007500)...
Subcellular localization analysis
AtADC2, AtARGAH2, AtADC1, OsODC, GmADC, GmARGAH, and GmODC were cloned into plant expression vectors pGWB5/pGWB6 to generate constructs with C or N terminal GFP, using GATEWAY recombination system (Nakagawa et al. 2007). Inserts were verified by PCR
40 and/or sequencing. The resulting constructs were then transformed into Agrobacterium tumefaciens strain GV3101 and infiltrated into tobacco (Nicotiana benthamiana) leaves (Sparkes et al. 2006). Infiltrated leaves were subjected to confocal laser-scanning analysis after 12-48 hours of infiltration with a TCS SP5 multi-photon laser scanning confocal microscope.
Fluorescence of chlorophyll or mCherry tagged ER Marker (ER-rbCD3960) (Nelson et al. 2007) was used as organelle markers. Excitation wavelengths of 488 nm for GFP and 590 nm for mCherry were used. Fluorescence was detected at 510 nm for GFP and at 590 nm for mCherry.
Images were merged using ImageJ (Rasband, 2008).
Yeast complementation assay
The SPE1 yeast knockout strain that lacks ornithine decarboxylase (YSC6273-201936543) was obtained from GE Darmacon, Lafayette, CO. BY4741 served as a wild-type control. Yeast strains were maintained on enriched medium (YEPD) or SC minimal medium supplemented with
1 mM putrescine. The two plasmid constructs pAG303-ADC2 and pYES-DEST52-ARGAH2 were introduced to yeast SPE1 mutant strain separately. Competent yeast spe1 mutant cells were grown on liquid YEPD medium and incubated overnight at 30°C. The pAG303-ADC2 plasmid construct was introduced to yeast spe1 mutant cells by electroporation. The resulting transformants were selected on SC minimal medium lacking histidine and containing putrescine
(1 mM). Selected colonies were transferred to liquid YEPD medium to obtain competent cells.
The pYES-DEST52-ARGAH2 plasmid construct was then introduced to the above competent cells by electroporation. The resulting transformants were again selected on SC minimal medium plates lacking uracil and containing putrescine (1mM). Finally, selected transformants were tested for growth in SC minimal media with 1% raffinose and 2% galactose lacking exogenous polyamines.
41
Phylogenetic analysis
Protein sequences of ADC and agmatinase/arginase were obtained from assembled plant genomes (Goodstein et al. 2012). The amino acid sequence alignment was created using
MUSCLE (Edgar 2004). Phylogenetic trees were constructed by MEGA 6.06 (Tamura et al.
2013) using the maximum likelihood method based on the Jones-Taylor-Thornton (JTT) matrix- based model. The reliability of the trees was tested using a bootstrapping test with 1000 duplicates.
Structural modelling
Three-dimensional structures of arginases/agmatinases from Arabidopsis, soybeans, and poplar were predicted using Phyre2 (Kelley & Sternberg, 2009). The predicted structures were then compared to three-dimensional structure of Dienococcus radiodurans agmatinase (PDB entry
1WOHA) using Chimera (http://www.cgl.ucsf.edu/chimera). The 3D structures were superimposed using matchmaker tool of Chimera. Active site regions of DR. agmatinase and plant arginases were compared using match-align tool of Chimera.
42
Supplementary figures and tables
Table S1. List of primers used in this study.
PCR Forward Reverse Comme targets nt OsODC CACCATGGCAGCAGCAGAA GGTGGCACTTTCCCAGT Full- GAT length OsODC AGATGGAGGCCGTGCTGG CCGGCTCGGCTATCACC sequenc T ing GmODC CACCATGCCTTCACTAGTTG TTAGAACATGCTGTGTT Full- CCG length GmODC GTTCGCCAATAACCACG sequenc CCTCATGGACAAATGGGCCT AGC ing AtARGA CACCATGTCGAGGATTATTGGTA TCATTTCGAGATTTTCG Full- H1 GAAAAGG CAGCTA length
AtARGA CACCATGTCGAGGATTATTGGTA TTTCGAGATTTTCGCAG No stop H1 GAAAAGG CTAAT reverse AtARGA CACCATGTGGAAGATTGGGCAG TCATTTTGACATTTTTGC Full- H2 AG GGCTA length AtARGA CACCATGTGGAAGATTGGGCAG TTTTGACATTTTTGCGG No stop H2 AG CTAGC reverse AtADC2 CACCATGCCTGCTTTAGCTTGC TCACGCAGAGATGTAAT Full- CGTAG length AtADC2 CACCATGCCTGCTTTAGCTTGC CGCAGAGATGTAATCGT No stop AGACG reverse
43
Table S2. Predicted localization of Arginine decarboxylase genes from sequenced plant genomes
Species Name Gene PLPred TargetP Predota WolfPSo Arabidopsis lyrata 491183 Plastid Plastid Arabidopsis lyrata 931833 Plastid Plastid Arabidopsis thaliana AT4G34710 Plastid Arabidopsis thaliana AT2G16500 Plastid Plastid Plastid Brassica napa BnaA03g53010D Plastid Plastid Plastid Brassica napa BnaC07g45200D Plastid Plastid Plastid Brassica rapa Brara.K00332 Plastid Plastid Plastid Brassica rapa Brara.A00352 Plastid Capsella grandiflora Cagra.2350s0020 Plastid Plastid Plastid Capsella grandiflora Cagra.21579s0001 Plastid Capsella rubella Carubv10004246m.g Plastid Plastid Plastid Capsella rubella Carubv10013090m.g Plastid Eutrema salsugineum Thhalv10024529m.g Plastid Plastid Plastid Eutrema salsugineum Thhalv10022578m.g Plastid Fragaria vesca gene00390-v1.0-hybrid Plastid Plastid Fragaria vesca gene01668-v1.0-hybrid Plastid Plastid Glycine max Glyma.06G007500 Plastid Glycine max Glyma.04G007700 Plastid Mimulus guttatus Migut.N01279 Plastid Plastid Mimulus guttatus Migut.B00171 Plastid Oryza sativa LOC_Os06g04070 Oryza sativa LOC_Os04g01690 Panicum virgatum Pavir.J13691 Plastid Panicum virgatum Pavir.J33899 Physcomitrella patens Phpat.006G071900 Physcomitrella patens Phpat.005G013600 Physcomitrella patens Phpat.016G006200 Plastid Solanum lycopersicum Solyc10g054440.1 Plastid Solanum lycopersicum Solyc01g110440.2 Plastid Solanum tuberosum PGSC0003DMG400026 Plastid Plastid Solanum tuberosum PGSC0003DMG400001 Plastid Plastid Theobroma cacao Thecc1EG006773 Plastid Plastid Plastid Theobroma cacao Thecc1EG020310 Plastid Plastid Zea mays GRMZM2G396553 Zea mays GRMZM2G374302 Plastid
44
Table S3. Predicted localization of Arginase/agmatinase genes from sequenced plant genomes
Species Name Gene PLPred TargetP Predotar WolfPSort Arabidopsis lyrata 489723 Plastid Plastid Arabidopsis lyrata 489781 Plastid Arabidopsis thaliana AT4G08900 Plastid Arabidopsis thaliana AT4G08870 Plastid Brassica napa BnaC03g28300D Plastid Plastid Brassica napa BnaA03g23800D Plastid Plastid Capsella rubella Carubv10001349m.g Plastid Capsella rubella Carubv10001337m.g Plastid Glycine max Glyma.17G131300 Plastid Glycine max Glyma.01G140200 Plastid Glycine max Glyma.03G028000 Plastid Linum usitatissimum Lus10000795.g Plastid Linum usitatissimum Lus10030288.g Plastid Plastid Manihot esculenta cassava4.1_011300m.g Plastid Manihot esculenta cassava4.1_011323m.g Plastid Plastid Populus trichocarpa Potri.002G146200 Plastid Plastid Populus trichocarpa Potri.014G067700 Plastid Solanum lycopersicum Solyc01g091160.2 Plastid Plastid Solanum lycopersicum Solyc01g091170.2 Plastid
45
Figure S1. Phylogenetic analysis of plant arginine decarboxylases.
46
Figure S2. Phylogenetic analyses of Plant arginase/agmatinases.
47
Figure S3. Characterization of Soybean agmatinase by complementation in yeast. WT, spe1, spe1+ AtADC2, spe1 +GmARGAH , and spe1 + AtADC2 + GmARGAH were plated on SC minimal media in the presence and absence of exogenous putrescine.
48
Figure S4. Comparison of active site residues of Dienococcus radiodurans agmatinase and arginases from Arabidopsis, Glycine max, and Populus trichocarpa. Red boxes show the active site residues.
49
Supplementary references
Chen H, McCaig BC, Melotto M, He SY, Howe GA (2004) Regulation of plant arginase by
wounding, jasmonate, and the phytotoxin coronatine. J Biol Chem 279 (44):45998-
46007. doi:10.1074/jbc.M407151200
Clarke JD (2009) Cetyltrimethyl ammonium bromide (CTAB) DNA miniprep for plant DNA
isolation. Cold Spring Harbor protocols 2009 (3):pdb prot5177.
doi:10.1101/pdb.prot5177
Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy and high
throughput. Nucleic Acids Res 32 (5):1792-1797. doi:10.1093/nar/gkh340
Goodstein DM, Shu S, Howson R, Neupane R, Hayes RD, Fazo J, Mitros T, Dirks W, Hellsten
U, Putnam N, Rokhsar DS (2012) Phytozome: a comparative platform for green plant
genomics. Nucleic Acids Res 40 (Database issue):D1178-1186. doi:10.1093/nar/gkr944
Nakagawa T, Kurose T, Hino T, Tanaka K, Kawamukai M, Niwa Y, Toyooka K, Matsuoka K,
Jinbo T, T. K (2007) Development of series of Gateway binary vectors, pGWBs, for
realizing efficient construction of fusion genes for plant transformation. J Bioscience
Bioeng 104:34-41
Nelson BK, Cai X, Nebenfuhr A (2007) A multicolored set of in vivo organelle markers for co-
localization studies in Arabidopsis and other plants. Plant J 4:1126-1136
Schneider CA, Rasband WS, Eliceiri KW (2012) NIH Image to ImageJ: 25 years of image
analysis. Nature methods 9 (7):671-675
50
Sparkes IA, Runions J, Kearns A, Hawes C (2006) Rapid, transient expression of fluorescent
fusion proteins in tobacco plants and generation of stably transformed plants." Nature
protocol, November 30: 2019-2015. . Nat Protocol 1:2019-2025
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular Evolutionary
Genetics Analysis version 6.0. Molecular biology and evolution 30 (12):2725-2729.
doi:10.1093/molbev/mst197
51
CHAPTER 2: CONTROL OF FLOWERING IN A. THALIANA BY ALTERED EXPRESSION
OF POLYAMINE TRANSPORTERS.
*Sheaza Ahmed, *Menaka Ariyaratne, *Jigar Patel, Vaishali Mulangi,
Vipaporn Phuntumart and Paul F. Morris.
* These individuals contributed equally to this manuscript.
Introduction
The polyamines (PAs) putrescine, spermidine and spermine were amongst the first metabolites to be isolated from living organisms (Wallace, Fraser et al. 2003) but how these compounds function at a molecular level is largely uncharted territory. Polyamines have hormone-like properties in that changes in PA levels are associated with fundamental physiological processes such as embryogenesis, flowering, fruit development and ripening, senescence, and tissue responses to biotic and abiotic stresses (Tiburcio, Altabella et al. 2014);
However their concentrations are much higher than true hormones such as auxins, gibberellins, or brassinosteroids. In A. thaliana, putrescine levels range from 10-50nM/g FW while spermidine levels are typically higher (50-80nmol /g FW) and spermine levels fall in the range of
10-50 nmol /gFW (Naka, Watanabe et al. 2010, Alet, Sanchez et al. 2011). The identification of thermospermine in plant tissues is a more recent development, largely because this compound is not easily resolved from spermine (Naka, Watanabe et al. 2010). Levels of thermospermine in different tissues are estimated to be in the range of 0.5 to 2 nmol/g FW. Conjugated forms of polyamines that include alkaloids, and caffeic, coumaric, and ferulic acids form the largest pools of polyamines in plants (Paschalidis and Roubelakis-Angelakis 2005, Kusano, Berberich et al.
52
2008, Bassard, Ullmann et al. 2010). More recent evidence suggests that some phenolamides have specific roles that include pollen development (Tiburcio, Altabella et al. 2014) and defense responses to pathogens and insects (Bassard, Ullmann et al. 2010). The extent of back conversion of such compounds to the polyamines is also unknown.
These estimates of pool sizes may be misleading, as polyamines are positively charged at cellular pH and can interact with DNA, RNA, nucleotides, phospholipids and some proteins
(Igarashi and Kashiwagi 2010). Thus, the pool of free polyamines in the cytosol is likely much smaller. The association of polyamines with other macromolecules has been estimated for spermidine and spermine for mammalian cells, and putrescine and spermidine in E coli. While polyamines were found to not have a strong affinity for cytosolic proteins, a significant fraction of polyamines were bound to RNA. In bovine lymphocytes, 57% of the spermidine pool, and
65% of spermine was bound to RNA, while in E coli, 48% of the putrescine pool, and 90% of the spermidine was bound to the RNA. In mammalian cells, the percentage of spermidine bound to
DNA, ATP and phosplipids was 13%, 12%, and 3%, and that of spermine was 18%, 9% and
2.5%, respectively. Importantly, the levels of “free” spermidine and spermine in mammalian cells was estimated to be 15% and 5% respectively of the total pools of these PAs. Putrescine levels were not estimated in mammalian cells. However in E coli, this polyamine was found to have a lower affinity for other macromolecules that the larger polyamines. In those cells, the amount of free putrescine was estimated to be 39% of the total pool, while only 4% of the total amount of spermidine in the cell was estimated to be free. In plants, non-aqueous fractionation has been used to fractionate metabolites into a cytosolic compartment, vacuolar, and chloroplast fractions (Krueger, Giavalisco et al. 2011). In this study 61% of the spermidine and 45% of soluble putrescine were estimated to be localized with the chloroplast fraction, while the
53 cytosolic fraction contained 33% of the putrescine and 16% of the spermidine was associated with the cytosolic fraction.
In A thaliana, polyamine synthesis is initiated by one of two arginine decarboxylases
(ADCs). The product of this enzyme agmatine is then converted to putrescine by an agmatine deiminase (At-AI) and N-carbamoyl putrescine aminohydrolase (At-NLP1). In most plants, but not A. thaliana and other members of the Brassica family, an ornithine decarboxylase converts ornithine directly to putrescine. Knockouts of both ADC genes results in an embryo lethal phenotype. The lethality of this phenotype may be due to the fact that spermidine is a precursor of deoxyhypusine which is covalently linked to the conserved eukaryotic translation initiation factor elF5A (Park, Nishimura et al. 2010). Loss of thermospermine synthesis in double knockouts of ACL5/ ACAULIS5 results in a stunting phenotype (Ortiz-Lopez, Chang et al.
2000). The expression of ACL5 is restricted to vessel elements, so thermospermine acts in the same cells where it is synthesized (Muñiz, Minguet et al. 2008). The synthesis of ACL5 is induced by auxin, and the accumulation of thermospermine acts to enhance the translation of the transcription factor SAC51. The leader sequence of SAC51 contains 5uORFs that acts to negatively inhibit the translation of the main ORF (Imai, Hanzawa et al. 2006). A mutation in one of these uORFs leading to a premature stop codon was found to suppress the thermospermine deficient phenotype. Since polyamines are known to bind to RNA(Igarashi and
Kashiwagi 2010) it has been suggested that modification of the secondary structure of mRNA by thermospermine could enable the ribosome to translate the main ORF more efficiently
(Takano, Kakehi et al. 2012). The expression of this gene negatively regulates the synthesis of auxin-responsive transcription factors (Yoshimoto, Noutoshi et al. 2012, Milhinhos, Prestele et
54 al. 2013, Baima, Forte et al. 2014). Taken together, these data suggest that control of thermospermine levels are essential for normal patterns of xylem cell differentiation.
The importance of polyamines in mediating the plant tissue responses to both abiotic and biotic stresses is now well established (Gill and Tuteja 2010) (Sagor, Berberich et al. 2013). Up- regulation of arginine decarboxylase in rice was found to confer enhance salt and drought tolerance in rice (Roy and Wu 2001, Capell, Bassie et al. 2004). Mutants deficient in deficient in arginine decarboxylase showed increased sensitivity to freezing, while transgenics overexpressing ADC showed increased tolerance to freezing (Cuevas, Lopez-Cobollo et al.
2008). In these experiments, feeding polyamines via the roots was also found to increase the freezing tolerance of the shoots in mutant plants. Thus long distance transport of polyamines synthesized in the roots may play a role in the cold acclimation response. In a follow-up experiment, the introduction of the oat arginine decarboxylase gene under the control of a stress inducible promoter has recently been shown to promote freezing tolerance without causing adverse plant growth effects (Alet, Sanchez et al. 2011). Spermidine levels in plants can be increased by increasing the activity of S-adenosylmethionine decarboxylase or spermidine synthase and these strategies have been employed to produce transgenic plants with increased tolerance to both biotic and abiotic stresses (Roy and Wu 2002, Cheng, Zou et al. 2009, Hazarika and Rajam 2011, Sagor, Berberich et al. 2013). Increased polyamine levels don’t simply increase tolerance to abiotic stress through their interactions with other macromolecules, they also impact genetic expression by modulation of signaling pathways (Marco, Alcazar et al. 2011,
Sagor, Berberich et al. 2013, Tiburcio, Altabella et al. 2014).
In prior work, we identified a clade of transporters that act as highly specific polyamine uptake transporters (PUTs) (Mulangi, Chibucos et al. 2012, Mulangi, Phuntumart et al. 2012).
55
We hypothesized that since PUTs function as highly specific polyamine transporters that are present in all plants, natural variation in the expression of these transporters, or their substrate specificity would likely exist across plant accessions. If different rates of PA transport between tissues was not compensated for by changes in biosynthesis or metabolism, then these changes in
PA levels would trigger phenotypic changes in the plants. Indeed, genetic variation in one PUT transporter across different accessions of A. thaliana was found to confer increased tolerance to the herbicide paraquat (Fujita, Fujita et al. 2012, Fujita and Shinozaki 2014).
The role of polyamines as an additional regulator of flowering has established using both feeding experiments and transgenic manipulation of polyamine biosynthesis. In A. thaliana, overexpression of ADC2 produced a dwarfing phenotype and a delay in flowering, both of which were alleviated by the addition of gibberellic acid (GA) (Alcazar, Garcia-Martinez et al. 2005).
In Sinapsis alba, the transition to flowering was marked by changes in the levels of polyamines and polyamine conjugates in xylem and phloem exudates. Furthermore the inhibition of flowering by the application of the putrescine inhibitor DFMO to the leaves and its reversal by application of putrescine to the roots suggest that putrescine production and export from the leaves regulated the timing of flowering (Havelange, Lejeune et al. 1996). In this study we demonstrate that flowering can be controlled by differential expression of PUTs.
Materials and Methods
Plant material and growth conditions
Arabidopsis thaliana ecotype Columbia (Col-0) was used for gene transformations and phenotypic analysis. Seeds were surface sterilized with 70% alcohol for 2 minutes and 10% bleach solution for 10 minutes, rinsed five times with sterile distilled water and sown onto ½
56 strength MS plates for germination or planted on soil directly. Plants were grown in a growth chamber at 22°C with relative humidity of 55% under long-day conditions (16 h light/8 h dark).
Subcellular localization analysis
Rice clone OsPUT1 was obtained from the Rice Genome Resource Center
(http://www.rgrc.dna.affrc.go.jp/index.html). Plasmids expressing AtPUT2 and AtPUT3 were obtained from Arabidopsis Biological Resource Center (ABRC, Ohio, USA) (Alonso et al.,
2003). Full-length cDNA of these transporters was amplified (see Appendix for primer sequences), for half transporters 750bp of OsPUT1 were amplified from C or N terminal. The resulting PCR products were cloned into pENTR/D-TOPO cloning vector (Invitrogen, Carlsbad,
USA) according to the supplier’s protocol. Subsequently, the target gene was transferred to a destination/expression vector, pGWB5/pGWB6 by LR recombination reaction (Invitrogen,
Carlsbad, USA) to generate a construct containing the cDNA flanked with C or N-terminal GFP under the control of CaMV 35S promoter. The resulting constructs were then transformed into
Agrobacterium strain GV3101 and infiltrated into tobacco (Nicotiana benthamiana) leaves
(Sparkes, Runions, Kearns, & Hawes, 2006). The GFP fluorescence was visualized and photographed with a laser scanning confocal microscope (TCS SP5 multi-photon laser scanning confocal microscope - Leica Microsystems). Overlay of GFP and chlorophyll autofluorescence was created using ImageJ (Rasband, 2008).
For transient expression in onion epidermal cells, onions were cut in to ~1cm2 pieces and placed on a wet filter paper in a petri dish, with the inner side oriented upward. Purified DNA was then coated on gold particles and the resulting gold particles were placed on the delivery disk. Onion cells were bombarded at 1300 psi using the PDS-1000 He Biolistic Particle Delivery
System (Bio-Rad, Hercules, CA, USA). Following bombardment, the cells were incubated in the
57 same Petri dishes for 16-24 h at room temperature in dark, before observation. GFP fluorescence was observed using a Zeiss Axiophot microscope equipped with a Micromax cooled CCD digital camera, and electronic shutter control. Images were recorded with Metamorph software
(http://www.spectraservices.com/METAMRPH.html).
Generation of transgenic Arabidopsis plants
The full-length coding sequences of OsPUT1 and OsPUT3 were cloned into pENTR/D-
TOPO cloning vector (Invitrogen, Carlsbad, USA) according to the supplier’s protocol. The resulting plasmids were used to mobilize target genes into plant expression vector, pGWB2, to generate pGWB2-OsPUT3 and pGWB2-OsPUT1 by LR recombination reaction (Invitrogen,
Carlsbad, USA). The plant expression vectors were then transformed into Agrobacterium strain
GV3101 followed by a transformation into Arabidopsis Col-0 plants using the floral dip method
(Zhang, Henriques, Lin, Niu, & Chua, 2006). Transgenic plants were screened by germination of seeds on ½ MS plates containing 100ug/ml of kanamycin. T3 homozygous lines were used for further analysis.
Transgenic plants expressing AtPUT5::OsPUT1 were generated by cloning and transforming, the 5’ upstream region (1 kb) of At3g19553 followed by the full-length coding sequence of OsPUT1 in pEG301 (Earley et al., 2006) using the same steps as described above.
These plants were selected by spraying with BASTA.
Phenotypic analysis
Seeds were surface sterilized, vernalized at 4°C for 3 days and planted in soil. Plants were grown in a growth chamber at 22°C and a relative humidity of 55%. Stem thickness was measured by using a vernier caliper (Fowler tools and instruments, Boston, USA). Leaf chlorophyll content was measured by a Fluorpen FP 100 (Photon System Instruments) (Woo,
58
Badger, & Pogson, 2008). Leaf area was measured by taking pictures of leaves from 4 week old plants and using ImageJ (Rasband, 2008).
GUS Analysis
The 5’ upstream region of At3g19553, 1 kb in length, was amplified by PCR. The amplified product cloned into the Gateway promoter analysis vector pBGWFS7 (Karimi, Inze, &
Depicker, 2002) by Gateway technology. The resulting construct was then transformed in A. thaliana (Col-0) by floral dip method (Zhang et al., 2006). Transformants were selected by using
BASTA (Sigma-Aldrich, St. Louis, MO). BASTA resistant seedlings were selected, transferred to soil and grown at 22ͼ C in a growth chamber.
Histochemical staining of GUS expression was performed by staining with X-Gluc buffer
(2 mMX-Gluc, 50 mM NaPO4 pH 7.0, Triton-X (0.5%), 0.5 mMK-ferricyanide, 0.5 mM K- ferrocyanide) (Jefferson, Kavanagh, & Bevan, 1987). After staining, chlorophyll was extracted from photosynthetic tissues with 70% ethanol. GUS staining was observed in young and old plants.
HPLC analysis of WT and transgenic plants
Reversed-phase HPLC was performed on Agilent technologies 1200 series HPLC and
Applied Biosciences 980 programmable fluorescence detector (excitation at 340nm, emission at
500nm). Dansylated polyamines were separated on a Gemini® 5 μm C18 110 Å, 250 × 4.6 mm
LC column.
Rosette leaves of WT and transgenic plants were collected at two, four and six weeks. Six replicates were made for wild type and each transgenic line.
Sample preparation was carried out according to the method of Marce et al., (1994) with some modifications. Leaves of Arabidopsis plants were extracted in 5% cold perchloric acid (PCA)
59
(300 mg fresh weight/ml) in an ice bath. After extraction, the samples were centrifuged at 27,000 g for 10 minutes. The supernatant, containing the free polyamines, was stored at -20oC until dansylation. The pellet was re-suspended in 1 M NaOH (300 mg fresh weight/ml) and stored at -
20oC until dansylation.
To determine the concentration of soluble and insoluble polyamine conjugates, a 300 μl aliquot of the supernatant or pellet was mixed with 300 μl of 12 M HCl into an injectible vial.
The vial was then sealed with a flame and heated at 100oC for 20 hours. The resulting mixture was then transferred to an eppendorf tube and dried in a vacuum. The dried material was re- dissolved in 300 μl of 5% PCA and stored at -20oC until dansylation.
The polyamines were derivatised according to the method of Marcé et al., (1994) with some modifications. First, 200 μl of the perchloric acid extracts were mixed with 40 μl of
0.05mM diamino heptane (HTD) as the internal standard. Next, 200 μl of a saturated solution of sodium carbonate and 400 μl of dansyl chloride (10 mg/ml acetone) were added. The resulting mixture was votexed briefly and incubated in the dark overnight. Then, 100 μl of a proline solution (100 mg/ml water) was added to react with excess dansyl chloride and votexed briefly.
The mixture was incubated in dark for 30 minutes. After incubation, the dansylated polyamines were extracted in toluene according to the method of Minocha et al., (2004) with some modifications. 350 μl of the aqueous solution was transferred to a separate microfuge tube and
500 μl of toluene was added. The tube was votexed for 1 minute and centrifuged at 13 500 g for
1 minute. After transfer of the first 350 μl of the aqueous solution, the remaining portion was also extracted with 500 μl of toluene in the same way. This extraction was repeated two times.
Then toluene was evaporated from each tube with a stream of air and the dry polyamines were dissolved in 500 μl of methanol. The tubes were vortexed for 1 minute to thoroughly dissolve the
60 polyamines. . Dansylated polyamines were extracted with toluene and transferred to a glass vial since in the aqueous phase they stick to the walls of the original microfuge tube in which the reaction was carried out and do not proportionately get transferred to the new tube. A blank sample was run using dansylated 5% PCA. 1 mM polyamine standard stock solutions were made in 5% PCA and they were also dansylated following the same procedure. Finally, the dansylated samples were filtered through a 0.45 μm pore size syringe filter and 50 μl were injected to the
HPLC.
Dansylated polyamines were separated with the HPLC method of Smith et al., (1985) with modifications. Samples were eluted from the column with a programmed water: methanol solvent gradient over 40 minutes. The initial conditions were 10% methanol and 90% water pumping at a flow rate of 0.75 ml/min. The methanol concentration was increased to 60% over 4 minutes and then up to 80% over 11 minutes. After that, the concentration of methanol was further increased to 95% over 17 minutes. These conditions were kept constant for 1 minute and then returned to initial conditions. After each cycle, the column was washed with 100% methanol for five minutes and re-equilibrated for five minutes.
Results
In our prior work, members of a diverse clade of transporters in the amino acid superfamily of plants were found to function as highly selective PUTs by heterologous expression in yeast mutants (Mulangi, Chibucos, Phuntumart, & Morris, 2012). While the yeast uptake experiments were consistent with the localization of this gene to the plasma membrane, full length constructs of OsPUT1-GFP that were transiently expressed in both onion epidermal cells and tobacco leaves showed it to be localized to vesicular compartments (Fig. 6). To determine whether the localization was a consequence of a mis-folding of the protein-GFP
61 complex we created half-transporter fusions of OsPUT1-GFp and examined their localization by agroinfiltration of N. benthiamana leaves, but it was not possible to determine the subcellular localization of the protein (Fig. 7).
Figure 6. Localization of full-length OsPUT1. (A) 35S::OsPUT1::GFP in onion epidermal cells, (B) BF image of onion epidermal cells, (C) 35S::OsPUT1::GFP in tobacco leaf tissue, (D) 35S::GFP in onion epidermal cells, (E) BF image of onion epidermal cells, (F) 35S::GFP in tobacco leaf tissue. BF= Bright Field, GFP = Green Fluorescence Protein.
62
Figure 7. Localization of half OsPUT1-GFP fusion protein (750 bp from the N-terminal of OsPUT1 was fused with GFP). (A) 35S::halfOsPUT1::GFP in tobacco leaf tissue, (B) Autofluorescence of chlorophyll, (C) Composite of A, B and bright field. In contrast, transient expression of AtPUT3–GFP fusions show that this gene is localized to the chloroplast (Fig. 8). This localization pattern supports software prediction programs that also indicate that this gene has a plastid targeting signal. However other work has shown that in transient expression of this gene in rice protoplasts indicate that the gene fusion is restricted to the Golgi (Li, Mu et al. 2013). In A thaliana, two PUTS were found to have predicted chloroplast transit peptides, and both were found to be localized to the plastid (Fig. 8).
63
Figure 8. AtPUT3 and AtPUT2 are localized to the chloroplast. GFP = Green Fluorescence Protein, CHL = Chlorophyll autofluoresence, and Overlay = Overlay of GFP and CHL fluorescence. To test the hypothesis that alterations in the activity of selective polyamine transporters would result in changes in the levels of polyamines and that these changes would alter the plant phenotype, we made stable transformants in A thaliana using the CaMv constitutive promoter to drive the expression of OsPUT1 and OsPUT3 Overexpression of OsPUT1 was hypothesized to potentially limit the export of PA from leaf tissues by reimporting PA that had been exported into the apoplast by other transporters. Overexpression of OSPUT3 was hypothesized to potentially change cytoplasmic levels of polyamines by importing more PAs into the plastid.
Overexpression of heterologous rather than native genes was used to avoid issues dealing with gene silencing.
Plants expressing OsPUT1 and OsPUT3 grew at the same rate as WT plants (Fig. 9A) but there
64 was a delay in the transition to flowering (Fig. 9B). At six weeks we noted transgenic plants had large leaves, thicker stems and produced almost twice as many siliques. In contrast to WT plants, maturation and senescence of siliques occurred very slowly (Figs. 10-13).
Figure 9. Transgenic plants overexpressing OsPUT1 and OsPUT3 are delayed in flowering. (A) Wildtype (WT) and transgenic plants at 3 weeks, (B) WT and transgenic plants at 4 weeks.
65
Figure 10. Transgenic plants with increased expression of OsPUT1 and OsPUT3 had larger leaves. (A) Photograph of WT and transgenic leaves, (B) Leaf area in cm2
Figure 11. Transgenic plants with increased expression of OsPUT3 had thicker stems. Stem thickness of WT and transgenic plants expressing 35S::OsPUT3 was measured using Vernier caliper. Plants were 4-5 weeks old.
66
Figure 12. Transgenic plants with increased expression of OsPUT3 had increased yield. Number of siliques in WT and transgenic plants expressing 35S::OsPUT3 were counted in 6 week old plants (n=4).
67
Figure 13. Transgenic plants with increased expression of OsPUT1 and OsPUT3 were delayed in senescence. (A) Arrows show green siliques in transgenic plants, (B) Leaf senescence was determined by measuring Fv/Fm values from leaves of ten WT and transgenic plants. Since the transition to flowering is controlled by transport of metabolite and floral signals from the leaf to the shoot apical meristem, we hypothesized that altered expression of a PUT that was primarily expressed in the leaf might also affect the transition to flowering. Microarray analysis of At3g19553 (AtPUT5) indicates that this gene shows highest expression in mature leaves, the cauline leaf, and the stem (Winter, Vinegar et al. 2007). To determine how increased expression of a PUT in these tissues might affect plant development, we fused the upstream promoter sequence of At3g19553 to GUS and OsPUT1 and transformed these two constructs into A. thaliana. Independent transformants were examined by GUS staining. The highest level
68 of expression was observed in leaves, vascular tissue and developing flowers (Fig. 14). To determine whether altered expression of PUT transporters affects flowering, transformants were grown alongside WT and homozygous SALK mutants in both continuous light and long days.
FluorPen measurements indicated no significant difference in growth rate of WT, KO or transformants expressing OsPUT1. However the transition to flowering occurred earliest in KOs, followed by WT, and pants expressing AtPUT5::OsPUT1. The transgenic plants were also considerably taller, had thicker stems, increased number of siliques and larger leaves relative to the WT plant (Figs. 15-19).
Figure 14. Gus expression of promoter region of AtPUT5 in A. thaliana
Polyamine levels of WT and transgenic plants were assessed at three intervals during the growth of plants at two weeks, four weeks and six weeks. At two weeks the wild type plants were at the early stages of development with no floral stem and at four weeks the plants were at the flowering stage with excessive flowering while the transgenics were at the beginning of the flowering stage with little flowering. At six weeks the wild type plants were in their seeds stage
69 with a large number of dried siliques, while the transgenics had fresh siliques.
Figure 15. Plants expressing AtPUT5::OsPUT1 were delayed in flowering.
70
Figure 16. Plants expressing AtPUT5::OsPUT1 were taller compared to WT and CS869507.
Figure 17. Plants expressing AtPUT5::OsPUT1 had larger leaves compared to WT and CS859607.
71
Figure 18. Expression of AtPUT5::OsPUT1 in A. thaliana resulted in increased silique production.
Figure 19. Plants expressing AtPUT5::OsPUT1 had thicker stems as compared to WT and CS859607.
72
Polyamine levels in leaves fluctuated during different developmental stages of the plant.
Polyamine titers decreased during the flowering and seed stage in all plants except in OsPUT1 over expressing plants (Fig. 20).
Figure 20. Levels of polyamines in WT, OsPUT1, and OsPUT3 plants before, during, and after flowering under continuous light. (A) Polyamine levels in WT plants at two, four and six weeks, (B) Polyamine levels in OsPUT1 plants at two, four and six weeks, (C) Polyamine levels in OsPUT3 plants at two, four and six weeks. Higher levels of polyamines, especially spermidine was observed in all the transgenic plants that showed a delay in flowering. During the early stages of development, OsPUT1 over expressing plants showed significantly higher levels of soluble (S) and hydrolysable soluble (HS spermidine compared to the wild type plants. During flowering and seed stages, all polyamine fractions remained higher except for those recovered by hydrolyzing the pellet. OsPUT3 over expressing plants showed significantly higher levels of (HS) HS-spermidine throughout the life span and HS-spermine during the seeds stage compared to the wild type plants (Fig. 20).
73
Transgenic plants over expressing OsPUT1 under the control of AtPUT5 promoter showed significantly higher levels of S-putrescine, S-spermidine, HS-spermidine, soluble and soluble conjugated spermine during early stages of development compared to the wild type and mutant plants. During the flowering stage, the transgenic plants showed significantly higher levels of HS-spermidine compared to the mutants. During the seeds stage, the transgenics had significantly higher levels of HP-spermidine compared to wild type plants. Overall, CS859607, mutant of OsPUT5 showed lower levels of polyamines compared to the over expressing plants and wild type plants (Figure 21).
Figure 21. Polyamine levels in CS859607, WT, and OX 19553 were assessed at two, four and six weeks.
74
Discussion
In this study we have shown that constitutive expression of a PUT transporter that is localized either to the chloroplast or the plasma membrane results in a delay of flowering.
Polyamines that are synthesized in the leaves are transported to the shoot apical meristem
(Caffaro, Antognoni et al. 1994). In a similar manner we have used a SALK KO line of AtPUT5 and a promoter fusion of this gene with OsPUT1 to show that altered expression of a leaf PUT also results in a delay of flowering. HPLC analysis indicated that prior to the onset of flowering, levels of spermidine and spermidine conjugates fell in the leaves. In contrast, we noted that when flowering was delayed, levels of spermidine and spermidine conjugates remained high.
In prior work, the inhibition of spermidine synthesis resulted in a delay of flowering in both in plants transitioning from short days (SD) to long days (LD) and under continuous LD
(Applewhite, Kaur-Sawhney et al. 2000). Since polyamine levels in the flowers were substantially higher than in other organs, the delay of flowering was attributed in part to the association of high levels of PAs in tissues undergoing high rates of mitotic activity. The addition of spermidine to the media promoted the rate of flowering under non-permissive conditions in both the Colombia ecotype and a late flowering mutant. In contrast under permissive LD conditions, the addition of spermidine to the media delayed the flowering of the
Columbia ecotype. Flowering was also delayed in transgenic lines overexpressing AtADC2
(Alcazar, Garcia-Martinez et al. 2005). The dwarf phenotype of those plants suggested that the phenotype might be caused by an inhibition of gibberellin biosynthesis. Down regulation of genes in the gibberellin biosynthetic pathway was reported and was rescued by gibberellin treatment. The inhibition of flowering that we described in the three different constructs is
75 correlated with the accumulation of spermidine and spermidine conjugates in the rosette leaves may also act by inhibiting the gibberellin response pathway in leaves, although other mechanisms are possible.
Polyamines have been previously shown to inhibit ethylene biosynthesis in a variety of plant tissues (Mattoo and Handa 2008). S-adenosylmethionine (SAM) is both a presursor for the synthesis of higher order polyamines as well as the entry substrate for ethylene biosynthesis
(Mehta, Cassol et al. 2002). Spermidine synthesis makes use of the substrates putrescine and the aminopropyl group produced by SAM decarboxylase to form spermidine and methylthioadenosine (MTA). Spermine synthase in turn uses the aminopropyl group and spermidine to form spermine and MTA. Ethylene synthesis is a two-step pathway that first uses
ACC synthase to convert SAM to 1-aminocyclopropane-1-carboxylic acid (ACC) and MTA. In the second step of the pathway ACC oxidase converts ACC to ethylene. Thus both pathways require SAM and produce the same byproduct MTA to be recycled. When the yeast SAMdc was introduced into tomato plants under the control or E8 a ripening specific promoter, the resulting plants had higher lycopene levels and prolonged shelf life as ripe tomatoes (Mehta, Cassol et al.
2002). Because the transgenic fruits produced more ethylene than the non-transgenics during the ripening of the fruit the authors concluded that the availability of SAM was not limiting for either pathway. Over expression of the yeast spermidine synthase gene under the control of a
CaMv35S and the E8 fruit ripening promoter has also been used to alter polyamine levels in developing fruit of tomatoes (Nambeesan, Datsenka et al. 2010). In the CaMv35S lines constitutive expression of spermidine synthesis resulted in a delay of whole plant senescence.
The delay in senescence caused by increased levels of spermidine is similar to the pattern we observed in plants with constitutive expression of a PUT transporter. Importantly, the delay in
76 whole plant senescence in our transgenic lines was not observed when the AtPUT5 promoter was used to drive the expression of the rice OsPUT1.
A. thaliana and other plant species display a striking diversity of phenotypes that enable them to optimally adapt to different habitats across a wide geographical range. These changes in plant growth rates and architecture are the consequences of substantial changes in gene expression. Such changes must be mediated by different transcription factors. Developmental processes such as the timing of flowering and vascular development can be modulated by several interconnected regulatory pathways. Because of the complexity of these pathways our first assumption was that mutational changes in the expression of several key genes including transcription factors would be needed to enable a species to expand its geographical range. If several mutational changes were need to enable a species to successfully occupy a new environmental niche, then the expansion of geographical range by that species would likely be slow. The transgenic plants described in our experiments mirror phenotypes such as delayed flowering and larger size, which are seen in native populations of A. thaliana and other species.
While the phenotypic changes are due to reprogramming of several regulatory pathways, we did so here by altering the expression of polyamine transporters. In the simplest case, AtPUT5 driven overexpression of the rice gene OSPUT1 is equivalent to mutations occurring naturally that result in increased expression of AtPUT5. Because changes in polyamine levels appear to mediate their effects by activation of hormone responsive pathways (Marco, Alcazar et al. 2011,
Tiburcio, Altabella et al. 2014), we suggest that altered expression of polyamine transporters may be one of the strategies that different plants have used to delay flowering. How cells perceive a change in spermidine levels and how those changes result in changes in gene expression remains an open question. Thus far we have shown that we can generate significant
77 changes in plant phenotypes by altering the expression of different members one class of polyamine transporters. The number of different types of polyamine transporters is presently unknown, but in unpublished work in our lab, we have characterized three different classes of polyamine transporters.
78
References
Alcazar, R., J. L. Garcia-Martinez, J. C. Cuevas, A. F. Tiburcio and T. Altabella (2005).
"Overexpression of ADC2 in Arabidopsis induces dwarfism and late-flowering through
GA deficiency " Plant J 43(3): 425-436.
Alcazar, R., J. L. Garcia-Martinez, J. C. Cuevas, A. F. Tiburcio and T. Altabella (2005).
"Overexpression of ADC2 in Arabidopsis induces dwarfism and late-flowering through
GA deficiency " Plant J. 43(3): 425-436.
Alet, A. I., D. H. Sanchez, J. C. Cuevas, S. Del Valle, T. Altabella, A. F. Tiburcio, F. Marco, A.
Ferrando, F. D. Espasandin, M. E. Gonzalez, O. A. Ruiz and P. Carrasco (2011).
"Putrescine accumulation in Arabidopsis thaliana transgenic lines enhances tolerance to
dehydration and freezing stress." Plant Signal Behav 2:278-286(2).
Applewhite, P. B., R. Kaur-Sawhney and A. W. Galston (2000). "A role for spermidine in the
bolting and flowering of Arabidopsis." Physiologia Plant. 108(3): 314-320.
Baima, S., V. Forte, M. Possenti, A. Penalosa, G. Leoni, S. Salvi, B. Felici, I. Ruberti and G.
Morelli (2014). "Negative feedback regulation of auxin signaling by ATHB8/ACL5-
BUD2 transcription module." Mol Plant 7(6): 1006-1025.
Bassard, J. E., P. Ullmann, F. Bernier and D. Werck-Reichhart (2010). "Phenolamides: bridging
polyamines to the phenolic metabolism." Phytochemistry 71(16): 1808-1824.
Caffaro, S. V., F. Antognoni, S. Scaramagli and N. Bagni (1994). "Polyamine translocation
following photoperiodic flowering induction in soybean
." Physiologia Plant. 91(2): 251-256.
79
Capell, T., L. Bassie and P. Christou (2004). "Modulation of the polyamine biosynthetic pathway
in transgenic rice confers tolerance to drought stress." Proc Natl Acad Sci USA 101:
9909-9914.
Cheng, L., Y. Zou, S. Ding, J. Zhang, X. Yu, J. Cao and G. Lu (2009). "Polyamine accumulation
in transgenic tomato enhances the tolerance to high temperature stress." J Integr Plant
Biol 51(5): 489-499.
Cuevas, J., R. Lopez-Cobollo, R. Alcazar, X. Zarza, C. Koncz, T. Altabella, J. Salinas, A.
Tiburcio and A. Ferrando (2008). "Putrescine is involved in Arabidopsis freezing
tolerance and cold acclimation by regulating abscisic acid levels in response to low
temperature." Pl Physiol 148: 1094-1105.
Fujita, M., Y. Fujita, S. Iuchi, K. Yamada, Y. Kobayashi, K. Urano, M. Kobayashi, K.
Yamaguchi-Shinozaki and K. Shinozaki (2012). "Natural variation in a polyamine
transporter determines paraquat tolerance in Arabidopsis." Proceedings of the National
Academy of Sciences of the United States of America 109(16): 6343-6347.
Fujita, M. and K. Shinozaki (2014). "Identification of polyamine transporters in plants: paraquat
transport provides crucial clues." Plant Cell Physiol 55(5): 855-861.
Gill, S. S. and N. Tuteja (2010). "Polyamines and abiotic stress tolerance in plants." Plant Signal
Behav 5(1).
Havelange, A., P. Lejeune, G. Bernier, R. Kaur-Sawhney and A. W. Galston (1996). "Putrescine
export from leaves in relation to floral transition in Sinapis alba." Physiologia Plant. 96:
59-65.
80
Hazarika, P. and M. V. Rajam (2011). "Biotic and abiotic stress tolerance in transgenic tomatoes
by constitutive expression of S-adenosylmethionine decarboxylase gene." Physiol Mol
Biol Plants 17(2): 115-128.
Igarashi, K. and K. Kashiwagi (2010). "Modulation of cellular function by polyamines." Int J
Biochem Cell Biol 42(1): 39-51.
Imai, A., Y. Hanzawa, M. Komura, K. T. Yamamoto, Y. Komeda and T. Takahashi (2006). "The
dwarf phenotype of the Arabidopsis acl5 mutant is suppressed by a mutation in an
upstream ORF of a bHLH gene." Development 133(18): 3575-3585.
Krueger, S., P. Giavalisco, L. Krall, M. C. Steinhauser, D. Bussis, B. Usadel, U. I. Flugge, A. R.
Fernie, L. Willmitzer and D. Steinhauser (2011). "A topological map of the
compartmentalized Arabidopsis thaliana leaf metabolome." PLoS One 6(3): e17806.
Kusano, T., T. Berberich, C. Tateda and Y. Takahashi (2008). "Polyamines: essential factors for
growth and survival." Planta 228(3): 367-381.
Li, J. Y., J. Y. Mu, J. T. Bai, F. Y. Fu, T. T. Zou, F. Y. An, J. Zhang, H. W. Jing, Q. Wang, Z. Li,
S. H. Yang and J. R. Zuo (2013). "PARAQUAT RESISTANT1, a Golgi-Localized
Putative Transporter Protein, Is Involved in Intracellular Transport of
Paraquat(1[C][W])." Plant Physiology 162(1): 470-483.
Marco, F., R. Alcazar, A. F. Tiburcio and P. Carrasco (2011). "Interactions between polyamines
and abiotic stress pathway responses unraveled by transcriptome analysis of polyamine
overproducers." OMICS 15(11): 775-781.
Marco, F., R. Alcazar, A. F. Tiburcio and P. Carrasco (2011). "Interactions between polyamines
and abiotic stress pathway responses unraveled by transcriptome analysis of polyamine
overproducers." OMICS 15(11): DOI: 10.1089/omi.2011.0084.
81
Mattoo, A. K. and A. K. Handa (2008). "Higher polyamines restore and enhance metabolic
memory in ripening fruit." Plant Science 174(4): 386-393.
Mehta, R. A., T. Cassol, N. Li, N. Ali, A. K. Handa and A. K. Mattoo (2002). "Engineered
polyamine accumulation in tomato enhances phytonutrient content, juice quality, and
vine life." Nat Biotechnol 20(6): 613-618.
Milhinhos, A., J. Prestele, B. Bollhoner, A. Matos, F. Vera-Sirera, J. L. Rambla, K. Ljung, J.
Carbonell, M. A. Blazquez, H. Tuominen and C. M. Miguel (2013). "Thermospermine
levels are controlled by an auxin-dependent feedback loop mechanism in Populus
xylem." Plant Journal 75(4): 685-698.
Mulangi, V., M. C. Chibucos, V. Phuntumart and P. F. Morris (2012). "Kinetic and phylogenetic
analysis of plant polyamine uptake transporters." Planta 264: 1261-1273.
Mulangi, V., V. Phuntumart, M. Aouida, D. Ramotar and P. Morris (2012). "Functional analysis
of OsPUT1, a rice polyamine uptake transporter." Planta 235(1): 1-11.
Muñiz, L., E. Minguet, S. Singh, E. Pesquet, F. Vera-Sirera, C. Moreau-Courtois, J. Carbonell,
M. Blázquez and H. Tuominen (2008). "ACAULIS5 controls Arabidopsis xylem
specification through the prevention of premature cell death." Development 135.
Naka, Y., K. Watanabe, G. H. Sagor, M. Niitsu, M. A. Pillai, T. Kusano and Y. Takahashi
(2010). "Quantitative analysis of plant polyamines including thermospermine during
growth and salinity stress." Plant Physiol Biochem 48(7): 527-533.
Nambeesan, S., T. Datsenka, M. G. Ferruzzi, A. Malladi, A. K. Mattoo and A. K. Handa (2010).
"Overexpression of yeast spermidine synthase impacts ripening, senescence and decay
symptoms in tomato." Plant J 63(5): 836-847.
82
Ortiz-Lopez, A., H.-C. Chang and D. R. Bush (2000). "Amino acid transporters in plants."
Biochimica et Biophysica Acta Biomembranes 1465: 275-280.
Park, M. H., K. Nishimura, C. F. Zanelli and S. R. Valentini (2010). "Functional significance of
eIF5A and its hypusine modification in eukaryotes." Amino Acids 38(2): 491-500.
Paschalidis, K. A. and K. A. Roubelakis-Angelakis (2005). "Spatial and temporal distribution of
polyamine levels and polyamine anabolism in different organs/tissues of the tobacco
plant. Correlations with age, cell division/expansion, and differentiation." Plant Physiol
138(1): 142-152.
Roy, M. and R. Wu (2001). "Arginine decarboxylase transgene expression and analysis of
environmental stress tolerance in transgenic rice." Plant Sci 160(5): 869-875.
Roy, M. and R. Wu (2002). "Overexpression of S-adenosylmethionine decarboxylase gene in
rice increases polyamine level and enhances sodium chloride-stress tolerance." plant Sci
163(5): 987-992.
Sagor, G., T. Berberich, Y. Takahashi, M. Niitsu and T. Kusano (2013). "The polyamine
spermine protects Arabidopsis from heat stress-induced damage by increasing expression
of heat shock-related genes." Transgenic Res 22: 595-605.
Sagor, G. H., T. Berberich, Y. Takahashi, M. Niitsu and T. Kusano (2013). "The polyamine
spermine protects Arabidopsis from heat stress-induced damage by increasing expression
of heat shock-related genes." Transgenic Res 22(3): 595-605.
Takano, A., J. Kakehi and T. Takahashi (2012). "Thermospermine is not a minor polyamine in
the plant kingdom." Plant Cell Physiol 53(4): 606-616.
Tiburcio, A. F., T. Altabella, M. Bitrian and R. Alcazar (2014). "The roles of polyamines during
the lifespan of plants: from development to stress." Planta.
83
Wallace, H., A. V. Fraser and A. Hughes (2003). "A perspective of polyamine metabolism."
Biochemical Journal 376: 1-14.
Winter, D., B. Vinegar, H. Nahal, R. Ammar, G. V. Wilson and N. J. Provart (2007). "An
"Electronic Fluorescent Pictograph" browser for exploring and analyzing large-scale
biological data sets." PLoS One 2(1): e718.
Yoshimoto, K., Y. Noutoshi, K. Hayashi, K. Shirasu, T. Takahashi and H. Motose (2012).
"Thermospermine suppresses auxin-inducible xylem differentiation in Arabidopsis
thaliana." Plant Signal Behav 7(8): 937-939.
84
CHAPTER 3: OVEREXPRESSION OF OSPUT3 CONFERS DROUGHT TOLERANCE IN
ARABIDOPSIS THALIANA
Introduction
Crops in field environments experience a variety of biotic and abiotic stresses during their development that limit their productivity. When plants experience unfavorable growth conditions, there is a yield gap, which results in yields that are significantly lower than the maximum yield potential (Lobell, Cassman, & Field, 2009). In the main growing areas of the world, the yield gaps for three major cereals maize, rice, and wheat are 30, 75 and 40% respectively (Fischer, Byerlee, & Edmeades, 2009). Abiotic stresses are responsible for almost
50% of crop yield reductions each year (Wang, Vinocur, & Altman, 2003). Drought stress is one of the most economically important abiotic stresses that affects the performance and yield of plants (Fujita et al., 2006). The change in the hydrological cycle will result in reduced plant productivity because of drought and reduced soil moisture in the drier regions (Schmidhuber &
Tubiello, 2007). Thus, there is an urgent need for developing plants that are resistant to drought stress while maintaining high yield.
Stress tolerance in plants depends on the genetic make-up of a plant and their ability to reprogram gene expression and metabolism (Fujita et al., 2006). Recent studies suggest that amino acid and polyamine (PA) metabolism play key roles in plant response to abiotic stresses
(G. Liu et al., 2010; Marina et al., 2008; Moschou et al., 2008; Zeier, 2013). Plants exposed to environmental stresses such as drought, salinity, chilling, heat, hypoxia, ozone, UV, and heavy metals display increased levels of PA (Alcazar et al., 2010; Gill & Tuteja, 2010). Changes in PA levels are mainly produced by alterations in PA homeostasis by change in PA biosynthesis, PA oxidation, and/or crosstalk between other pathways in response to stress (Tiburcio et al., 2014).
85
Differential regulation of PA biosynthetic genes under abiotic stress has been revealed by transcriptomic studies (Alcázar et al., 2006). Overexpression of PA biosynthetic genes from different organisms in rice, tobacco and tomato induced tolerance to many stresses, and the enhanced tolerance to these stresses was correlated with increases in PA concentration (Alcázar et al., 2010; Gill & Tuteja, 2010). Increase in PA levels during stress conditions is often accompanied by an increase in PA oxidation (Tiburcio et al., 2014). Arabidopsis AtCuAO1 mutants are hypo sensitive to osmotic stress (wimalasekera 2011). These observations suggest that PA homeostasis plays a significant role in plant stress responses.
The role of PAs in protection against osmotic or drought stress has been demonstrated in many plant species (Kusano, Yamaguchi, Berberich, & Takahashi, 2007; Takahashi & Kakehi,
2010a; Urano et al., 2004). Overexpression of ADC2, a PA biosynthesis enzyme confers drought stress tolerance in Arabidopsis, these plants accumulated putrescine but spermidine and spermine levels were not changed (Alcazar et al., 2010). A loss of function mutation in Arabidopsis of
ADC2 resulted in plants that were hypersensitive to osmotic stress (Urano et al., 2004). Increased putrescine levels and drought tolerance was also observed in rice plants overexpressing ADC
(Capell, Bassie, & Christou, 2004). In a study that measured the change of free, conjugated and bound PAs in vetiver grass adaptation in response to PEG induced water stress it was observed that vetiver grass accumulated more PAs in leaves in response to drought stress (Zhou & Yu,
2010). Alcázar et al. (2011) discovered that in contrast to Arabidopsis, Craterostigma plantagineum accumulates high spermine levels which associate with drought tolerance.
Together these results indicate that increased levels of PAs correlate with drought stress tolerance.
86
PAs are considered as plant growth regulators and secondary messengers in signaling pathways (Davies, 1995; Kusano, Berberich, Tateda, & Takahashi, 2008a; J. Liu et al., 2007).
Apart from plant stress responses, PAs play a major role in plant growth and development
(Tiburcio et al., 2014). Exogenous treatment of maize genotype Bashaier with PAs, along with drought stress, resulted in increased leaf area and number of grains per ear (Shaddad, El-Samad,
& Mohammed, 2011). Determination of PA contents at different stages of plant growth and development indicates that there is a correlation between PAs and flowering, cell division, senescence and other developmental processes. There are multiple reports of crosstalk between
PAs and hormones such as ABA, auxins, brassinosteroids, cytokinins, gibberelins, jasmonates, salicylic acid, and ethylene but the intrinsic mechanisms underlying such interactions are not completely understood (Anwar, Mattoo, & Handa, 2015; Marco, Alcázar, Tiburcio, & Carrasco,
2011). PAs play a major role in plant growth and development, but the mechanism by which they do so has not been unraveled yet.
Transgenic approaches in recent years have been mainly focused on changing PA biosynthesis or catabolism, but PA transport in plants have not been exploited as a strategy to alter PA homeostasis. As a matter of fact, knowledge of PA transport between plant tissues is very limited. Recently, a rice gene, OsPUT1, was identified as the first polyamine transporter, by our lab (Mulangi, Phuntumart, Aouida, Ramotar, & Morris, 2012b). Five additional transporters from Arabidopsis and rice that cluster in the same clade as OsPUT1 have also been reported
(Mulangi et al., 2012). An Arabidopsis L-type amino acid transporter (LAT) family transporter, named RMV1 was also identified as a polyamine/paraquat transporter (Fujita et al., 2012). In this study the effects of overexpression of OsPUT3, one of the rice Polyamine Uptake Transporters
(PUTs), on growth, development and drought stress response in Arabidopsis were evaluated.
87
Materials and Methods
Plant material and growth conditions
Arabidopsis thaliana ecotype Columbia (Col-0) was used for gene transformations and phenotypic analysis. Seeds were surface sterilized with 70% alcohol for 2 minutes and 10% bleach solution for 10 minutes, rinsed five times with sterile distilled water and sown onto ½ MS plates for germination or planted on soil directly. Plants were grown in a growth chamber at
22°C with relative humidity of 55% under long-day conditions (16 h light/8 h dark).
Subcellular localization analysis
Rice clone OsPUT3 was obtained from the Rice Genome Resource Center
(http://www.rgrc.dna.affrc.go.jp/index.html). Full-length cDNA of OsPUT3 was amplified (see
Appendix for primer sequences) and cloned into pENTR/D-TOPO cloning vector (Invitrogen,
Carlsbad, USA) according to the supplier’s protocol. Subsequently, the target gene was transferred to a destination/expression vector, pGWB6 by LR recombination reaction
(Invitrogen, Carlsbad, USA) to generate a construct (pGwB6- OsPUT3) containing the cDNA flanked with N-terminal GFP under the control of CaMV 35S promoter. pGwB6- OsPUT3 was then transformed into Agrobacterium strain GV3101 and infiltrated into tobacco (Nicotiana benthamiana) leaves (Sparkes et al., 2006). The GFP fluorescence was visualized and photographed with a laser scanning confocal microscope (TCS SP5 multi-photon laser scanning confocal microscope - Leica Microsystems). Overlay of GFP and chlorophyll autofluorescence was created using ImageJ (Rasband, 2008).
88
Generation of transgenic Arabidopsis plants
The full-length coding sequence of OsPUT3 was cloned into pENTR/D-TOPO cloning vector (Invitrogen, Carlsbad, USA) according to the supplier’s protocol. The resulting plasmid was used to mobilize OsPUT3 into plant expression vector, pGWB2, to generate pGWB2-
OsPUT3 by LR recombination reaction (Invitrogen, Carlsbad, USA). pGWB2-OsPUT3 was transformed into Agrobacterium strain GV3101 and then transformed into Arabidopsis Col-0 plants using the floral dip method (X. Zhang et al., 2006). Transgenic plants were screened by germination of seeds on ½ MS plates containing 100ug/ml of kanamycin. T3 homozygous lines were used for further analysis.
Phenotypic analysis
Seeds were surface sterilized, vernalized at 4°C for 3 days and planted in soil. Plants were grown in a growth chamber at 22°C and a relative humidity of 55%. Stem thickness was measured by using a vernier caliper (Fowler tools and instruments, Boston, USA). Leaf chlorophyll content was measured by a Flourpen FP 100 (Photon System Instruments) (Woo et al., 2008). Leaf area was measured by taking pictures of leaves from 4 week old plants and using
ImageJ (Rasband, 2008).
Drought stress tolerance assay
For drought stress tolerance assay, Arabidopsis Col-0 and OsPUT3/OsPUT1 transgenic plants were planted in soil in same pots (Verslues, Agarwal, Katiyar-Agarwal, Zhu, & Zhu,
2006). Plants were grown in a growth chamber at 22°C and a relative humidity of 55% for four weeks. Water was withheld until the plants displayed evident drought-stresses phenotypes, then the plants were re-watered. Leaf chlorophyll content was measured before withholding the water
89 and after the drought treatment by using a Flourpen FP 100 (Photon System Instruments) (Woo et al., 2008).
Results
Subcellular localization of OSPUT3
Prior to our work, the subcellular localization of OsPUT3 had not been established. An attempt to localize OsPUT3 showed that when expressed in rice protoplasts OsPUT3-GFP fusion was trapped in the golgi (J. Li et al., 2013). However, TargetP (Emanuelsson, Nielsen, Brunak,
& von Heijne, 2000) an online subcellular localization tool, predicts that OsPUT3 contains a chloroplast transit peptide. To confirm that OsPUT3 is localized to the chloroplast,
35S::OsPUT3::GFP fusion protein was transiently expressed in tobacco leaves. Confocal analysis of the tobacco leaves showed that OsPUT3 is localized to the chloroplast (Fig. 25).
Samples were observed at early, and late stages of transient expression, we did not observe the evidence of the protein being trapped in the golgi of tobacco leaf tissue.
Overexpression of OSPUT3 in Arabidopsis increases leaf and stem size
PAs are involved in regulating plant growth and development, and many of these effects are because of a change in PA homeostasis. To test the hypothesis that a change in expression of
PA transporters can alter plant growth and development, OsPUT3 was overexpressed in
Arabidopsis. Plants expressing OsPUT3 under the control of CaMV 35S promoter were taller, with larger leaves and had thicker stems compared to the Arabidopsis wild type plants (Chapter
II). Plants overexpressing OsPUT3 had twice the leaf area and three times thicker stems as compared to the wild type Arabidopsis plants. In addition, plants overexpressing OsPUT3 were visibly bigger, with more and bigger leaves compared to the wild type (Chapter II).
90
In addition, to increase in size, Arabidopsis plants overexpressing OsPUT3 showed a significant increase in number of siliques compared to the wild type. At the end of the growth cycle, there was a 200% increase in the number of siliques in plants overexpressing OsPUT3 compared to the wild type. However, maturation and senescence of siliques occurred very slowly in plants overexpressing OsPUT3. Additionally, leaf and stem senescence were also delayed along with a delay in flowering (Chapter II).
Overexpression of OsPUT3 in Arabidopsis enhances drought stress tolerance along with an
increase in yield and biomass.
Accumulation of PAs in plants by either exogenous application or increase in PA biosynthesis results in enhanced stress tolerance (Shi & Chan, 2014b). OsPUT3 plants accumulated more soluble and soluble conjugated spermidine as compared to wild type
(Ariyaratne, 2014). To test the hypothesis that OsPUT3 plants would show enhanced drought stress tolerance, plants overexpressing OsPUT1, OsPUT3 and wild type Arabidopsis plants were grown for four weeks and exposed to drought stress by withholding water for five days. After five days of drought stress OsPUT3 plants were greenest and displayed the highest ratio of variable (Fv) to maximum fluorescence (Fm), followed by OsPUT1 and WT. Fv/FM ratio has been widely used for assessing plant physiological status and the state of Photosystem II (PSII)
(Muilu-Mäkelä et al., 2015). After five days of drought stress, the Fv/Fm ratio in OsPUT3 plants was almost the same as before drought stress, while in WT the Fv/Fm ratio was reduced to 0.2 compared to 0.8 before drought stress (Fig. 22).
We prolonged the drought stress to seven days and observed the response of plants after rehydrating them for seven days. For this assay, only WT and OsPUT3 plants were used, water was withheld for seven days and the plants were allowed to recover for seven days. After seven
91 days of drought stress, the OsPUT3 plants were greener as compared to WT plants (Fig. 23. B).
Post recovery fresh weight, number of siliques, number of branches bearing inflorescences, number of rosette leaves and length of plants was measured. OsPUT3 plants were ~17cms taller than the WT plants. OsPUT3 plants had 576% higher fresh weight and had 521% more yield compared to WT plants. The number of rosette leaves was higher by 244% and the number of branches bearing inflorescences was higher by 285% in OsPUT3 compared to WT plants. A slight increase in weight and length of siliques was also observed in OsPUT3 plants compared to
WT plants (Fig. 24).
Figure 22. Overexpression of OsPUT3 in Arabidopsis enhances drought stress tolerance Four weeks old wild type (WT), and plants overexpressing OsPUT3 and OsPUT1 were exposed to drought stress. Water was withheld for five days, Fv/Fm was measured using FluorPen FP 100 (n=3). A photograph of all three plants before drought is shown in (A). A picture of all three plants after drought is shown in (B). Fv/Fm measurements for OsPUT3 and WT are shown in (C).
92
Figure 23. Plants overexpressing OsPUT3 are taller as compared to WT and have increased silique length. Four weeks old wild type and OsPUT3 plants were exposed to drought stress. Water was withheld for seven days and plants were rehydrated for seven days after the drought treatment. Pictures of WT and OsPUT3 before drought stress, after drought stress and after recovery are shown in A, B and C respectively. The plant on the left is OsPUT3 and the one on the right is WT. Fig. 23. D depicts a picture of WT (right) and OsPUT3 (left) after recovery; plants were clipped from the root-shoot junction. Siliques of WT (top) and OsPUT3 (bottom) after recovery are depicted in (E).
93
Figure 24. Overexpression of OsPUT3 in Arabidopsis leads to 5 fold increase in yield as compared to wild type Length of plants in cm (A). Weight of 30 siliques in mg (B). Number of branches bearing inflorescences (C). Number of siliques per plant (D). Fresh weight of plants in gm (E). Number of rosette leaves (F). Length of siliques in cm (G). All measurements were done in plants that were rehydrated for seven days after drought stress. (n=2).
94
Figure 25. OsPUT3 is localized to the chloroplast. BF= Bright Field, GFP = Green fluorescence protein, CHL = Chlorophyll Autofluorescence, Merge = Overlay of bright field, GFP and CHL. OsPUT3-GFP fusion protein was transiently expressed in tobacco leaves and observed by confocal microscopy. The GFP signal was co-localized with chlorophyll autofluorescence.
95
Discussion
Drought has a profound effect on plant physiology, and adaptation of plants to water stress can influence the survival and yield of plants. PAs play important roles in plant development and stress responses (Tiburcio et al., 2014). Overexpression of ADC2, polyamine biosynthesis enzyme, in Arabidopsis results in drought tolerance but induces dwarfism in the transgenic plants (Alcázar et al., 2005). Drought tolerance was also observed in Arabidopsis plants overexpressing spermidine synthase from Cucurbita ficifolia (Kasukabe et al., 2004). This study shows that overexpression of OsPUT3, a spermidine uptake transporter, results in enhanced drought stress tolerance and increased yield.
OsPUT3 is a spermidine uptake transporter (Vaishali Mulangi, 2011) and plants overexpressing OsPUT3 accumulate higher amounts of soluble as well as soluble conjugated spermidine as compared to wild type Arabidopsis plants (Ariyaratne, 2014). Plants overexpressing OsPUT3 display increased drought stress tolerance (Fig. 22). Exogenous application of spermidine results in increased concentrations of endogenous PAs and confers drought tolerance in creeping bentgrass (Z. Li et al., ). Arabidopsis mutant plant that is deficient in producing spermine was hypersensitive to drought stress (Yamaguchi et al., 2007b).
Spermidine plays a role as intermediate by indirectly maintaining high spermine levels under abiotic stress, but accumulated spermidine might also get converted to putrescine in plants
(Peremarti, Bassie, Christou, & Capell, 2009; Roychoudhury, Basu, & Sengupta, 2011).
Putrescine can alter the partitioning of proton motive force in Arabidopsis, optimizing the balance between energy transduction and dissipation under a variety of stress conditions
(Ioannidis, Cruz, Kotzabasis, & Kramer, 2012). Since OsPUT3 is localized to the chloroplast and
96 is highly specific for spermidine uptake, the plants overexpressing OsPUT3 may be able to tolerate drought stress by compartmentation and conversion of spermidine.
In addition to enhanced drought tolerance plants overexpressing OsPUT3 also exhibit a significant increase in plant height, number of siliques per plant, number of branches bearing inflorescences per plant, fresh weight and a slight increase in silique length and weight compared to wild type (Figs. 23&24). The results shown in our experiments parallel observations that others have made, in which PA levels have been increased by modifying PA homeostasis or exogenous applications. Exogenous application of spermidine (100mg/l) during the vegetative stage of chamomile plants improved plant height, number of branches and fresh weight (Abd
EA, 2004). External application of 0.75mM spermidine and putrescine increased biomass and enhanced growth in Beta vulgaris (Beet) and Tagetes patula (French marigold) (Bais et al.,
2000). Plants that were sprayed for seven days with 1mM spermidine before being exposed to salt stress displayed a 62% increase in yield in Oryza sativa L. ssp. ‘indica’ as compared to control plants (Saleethong, Sanitchon, Kong-Ngern, & Theerakulpisut, 2013). Exogenous application of spermidine on 12-15 years old Citrus sinensis L. Osbeck (‘Blood Red” sweet orange) significantly increased initial fruit set, yield/tree, and production of grade-l fruit (Saleem,
Malik, Anwar, & and Farooq, 2008). Yang et al. (2010) reported that exogenous application of polyamines enhance growth in Nepeta cataria. Spraying of putrescine on Comice pear increased yield and improved fruit set, crop density, fruit size, and seed content (Sugar, 1988). Application of spermine and spermidine mitigated the deleterious effects of waste water stress in wheat and resulted in increased kernel weight, grain yield/plant, and straw yield/plant (Aldesuquy, Haroun,
Abo-Hamed, & El-Saied, 2014). Thus, the phenotypic changes observed by overexpression of
97
OsPUT3 in Arabidopsis are similar to the ones that can be achieved by an increase in PA concentrations via exogenous applications or modifying PA homeostasis.
In conclusion, this study confirmed that accumulation of spermidine in Arabidopsis can enhance drought stress tolerance. It is not necessary to alter PA biosynthesis directly to change
PA concentrations, change in expression of a PA transporter is sufficient. Increased expression of OsPUT3 also resulted in increased yield and biomass. This study also provides a marker
(expression levels of polyamine transporters) to identify potential drought stress tolerant plants.
However, further research is necessary to understand the underlying mechanisms of the stress response and phenotypic changes.
98
References
Abd EA, K. M. (2004). Stimulation effect of spermidine and stigmasterol on growth, flowering,
biochemical constituents and essential oil of chamomile plant (chamomilla recutita L.,
rausch). Bulg. J. Plant Physiol, 30, 48.
Alcázar, R., Altabella, T., Marco, F., Bortolotti, C., Reymond, M., Koncz, C., . . . Tiburcio, A. F.
(2010). Polyamines: Molecules with regulatory functions in plant abiotic stress tolerance.
Planta, 231(6), 1237-1249.
Alcázar, R., GarcíaǦMartínez, J. L., Cuevas, J. C., Tiburcio, A. F., & Altabella, T. (2005).
Overexpression of ADC2 in arabidopsis induces dwarfism and lateǦflowering through GA
deficiency. The Plant Journal, 43(3), 425-436.
Alcázar, R., Marco, F., Cuevas, J. C., Patron, M., Ferrando, A., Carrasco, P., . . . Altabella, T.
(2006). Involvement of polyamines in plant response to abiotic stress. Biotechnology
Letters, 28(23), 1867-1876.
Alcázar, R., Planas, J., Saxena, T., Zarza, X., Bortolotti, C., Cuevas, J., . . . Altabella, T. (2010).
Putrescine accumulation confers drought tolerance in transgenic arabidopsis plants over-
expressing the homologous arginine decarboxylase 2 gene. Plant Physiology and
Biochemistry, 48(7), 547-552.
Alcazar, R., Altabella, T., Marco, F., Bortolotti, C., Reymond, M., Koncz, C., . . . Tiburcio, A. F.
(2010). Polyamines: Molecules with regulatory functions in plant abiotic stress tolerance.
99
Planta, 231(6), 1237-1249. Retrieved from
http://www.hubmed.org/display.cgi?uids=20221631
Aldesuquy, H., Haroun, S., Abo-Hamed, S., & El-Saied, A. (2014). Involvement of spermine and
spermidine in the control of productivity and biochemical aspects of yielded grains of wheat
plants irrigated with waste water. Egyptian Journal of Basic and Applied Sciences, 1(1), 16-
28.
Anwar, R., Mattoo, A. K., & Handa, A. K. (2015). Polyamine interactions with plant hormones:
Crosstalk at several levels. Polyamines (pp. 267-302) Springer.
Ariyaratne, M. M. (2014). HPLC Analysis of Polyamines in Arabidopsis Thaliana Lines Altered
in the Expression of Polyamine Transport,
Capell, T., Bassie, L., & Christou, P. (2004). Modulation of the polyamine biosynthetic pathway
in transgenic rice confers tolerance to drought stress. Proc Natl Acad Sci U S A, 101(26),
9909-9914. Retrieved from http://www.hubmed.org/display.cgi?uids=15197268
Davies, P. J. (1995). The plant hormones: Their nature, occurrence, and functions. Plant
hormones (pp. 1-12) Springer.
Emanuelsson, O., Nielsen, H., Brunak, S., & von Heijne, G. (2000). Predicting subcellular
localization of proteins based on their N-terminal amino acid sequence. J Mol Biol, 300(4),
1005-1016. Retrieved from http://www.hubmed.org/display.cgi?uids=10891285
100
Fischer, R., Byerlee, D., & Edmeades, G. O. (2009). Can technology deliver on the yield
challenge to 2050. Paper presented at the Expert Meeting on how to Feed the World In, ,
2050 46.
Fujita, M., Fujita, Y., Noutoshi, Y., Takahashi, F., Narusaka, Y., Yamaguchi-Shinozaki, K., &
Shinozaki, K. (2006). Crosstalk between abiotic and biotic stress responses: A current view
from the points of convergence in the stress signaling networks. Current Opinion in Plant
Biology, 9(4), 436-442.
Fujita, M., Fujita, Y., Iuchi, S., Yamada, K., Kobayashi, Y., Urano, K., . . . Shinozaki, K. (2012).
Natural variation in a polyamine transporter determines paraquat tolerance in arabidopsis.
Proceedings of the National Academy of Sciences of the United States of America, 109(16),
6343-6347. doi:10.1073/pnas.1121406109 [doi]
Gill, S. S., & Tuteja, N. (2010). Polyamines and abiotic stress tolerance in plants. Plant
Signaling & Behavior, 5(1), 26-33.
Ioannidis, N. E., Cruz, J. A., Kotzabasis, K., & Kramer, D. M. (2012). Evidence that putrescine
modulates the higher plant photosynthetic proton circuit. PloS One, 7(1), e29864.
Kasukabe, Y., He, L., Nada, K., Misawa, S., Ihara, I., & Tachibana, S. (2004). Overexpression of
spermidine synthase enhances tolerance to multiple environmental stresses and up-regulates
the expression of various stress-regulated genes in transgenic arabidopsis thaliana. Plant
Cell Physiol, 45(6), 712-722. Retrieved from
http://www.hubmed.org/display.cgi?uids=15215506
101
Kusano, T., Berberich, T., Tateda, C., & Takahashi, Y. (2008). Polyamines: Essential factors for
growth and survival. Planta, 228(3), 367-381.
Kusano, T., Yamaguchi, K., Berberich, T., & Takahashi, Y. (2007). Advances in polyamine
research in 2007. J Plant Res, 120(3), 345-350. Retrieved from
http://www.hubmed.org/display.cgi?uids=17351711
Li, Z., Zhou, H., Peng, Y., Zhang, X., Ma, X., Huang, L., & Yan, Y.Exogenously applied
spermidine improves drought tolerance in creeping bentgrass associated with changes in
antioxidant defense, endogenous polyamines and phytohormones. Plant Growth Regulation,
, 1-12.
Li, J., Mu, J., Bai, J., Fu, F., Zou, T., An, F., . . . Zuo, J. (2013). Paraquat Resistant1, a golgi-
localized putative transporter protein, is involved in intracellular transport of paraquat. Plant
Physiology, 162(1), 470-483. doi:10.1104/pp.113.213892 [doi]
Liu, J., Kitashiba, H., Wang, J., Ban, Y., & Moriguchi, T. (2007). Polyamines and their ability to
provide environmental stress tolerance to plants. Plant Biotechnology, 24(1), 117-126.
Liu, G., Ji, Y., Bhuiyan, N. H., Pilot, G., Selvaraj, G., Zou, J., & Wei, Y. (2010). Amino acid
homeostasis modulates salicylic acid-associated redox status and defense responses in
arabidopsis. The Plant Cell, 22(11), 3845-3863. doi:10.1105/tpc.110.079392 [doi]
Lobell, D. B., Cassman, K. G., & Field, C. B. (2009). Crop yield gaps: Their importance,
magnitudes, and causes. Annual Review of Environment and Resources, 34(1), 179.
102
Marco, F., Alcázar, R., Tiburcio, A. F., & Carrasco, P. (2011). Interactions between polyamines
and abiotic stress pathway responses unraveled by transcriptome analysis of polyamine
overproducers. Omics: A Journal of Integrative Biology, 15(11), 775-781.
Marina, M., Maiale, S. J., Rossi, F. R., Romero, M. F., Rivas, E. I., Garriz, A., . . . Pieckenstain,
F. L. (2008). Apoplastic polyamine oxidation plays different roles in local responses of
tobacco to infection by the necrotrophic fungus sclerotinia sclerotiorum and the biotrophic
bacterium pseudomonas viridiflava. Plant Physiology, 147(4), 2164-2178.
doi:10.1104/pp.108.122614 [doi]
Moschou, P. N., Paschalidis, K. A., & Roubelakis-Angelakis, K. A. (2008). Plant polyamine
catabolism: The state of the art. Plant Signal Behav, 3(12), 1061-1066. Retrieved from
http://www.hubmed.org/display.cgi?uids=19513239
Muilu-Mäkelä, R., Vuosku, J., Läärä, E., Saarinen, M., Heiskanen, J., Häggman, H., & Sarjala,
T. (2015). Water availability influences morphology, mycorrhizal associations, PSII
efficiency and polyamine metabolism at early growth phase of scots pine seedlings. Plant
Physiology and Biochemistry, 88, 70-81.
Mulangi, V., Chibucos, M. C., Phuntumart, V., & Morris, P. F. (2012). Kinetic and phylogenetic
analysis of plant polyamine uptake transporters. Planta, 236(4), 1261-1273.
Mulangi, V., Phuntumart, V., Aouida, M., Ramotar, D., & Morris, P. (2012). Functional analysis
of OsPUT1, a rice polyamine uptake transporter. Planta, 235(1), 1-11.
103
Peremarti, A., Bassie, L., Christou, P., & Capell, T. (2009). Spermine facilitates recovery from
drought but does not confer drought tolerance in transgenic rice plants expressing datura
stramonium S-adenosylmethionine decarboxylase. Plant Molecular Biology, 70(3), 253-
264.
Rasband, W. S. (2008). ImageJ. Http://Rsbweb.Nih.Gov/Ij/,
Roychoudhury, A., Basu, S., & Sengupta, D. N. (2011). Amelioration of salinity stress by
exogenously applied spermidine or spermine in three varieties of indica rice differing in
their level of salt tolerance. Journal of Plant Physiology, 168(4), 317-328.
Saleem, B., Malik, A., Anwar, R., & and Farooq, M. (2008). EXOGENOUS APPLICATION OF
POLYAMINES IMPROVES FRUIT SET, YIELD AND QUALITY OF SWEET
ORANGES. . Acta Hort. (ISHS), 774, 187.
Saleethong, P., Sanitchon, J., Kong-Ngern, K., & Theerakulpisut, P. (2013). Effects of
exogenous spermidine (spd) on yield, yield-related parameters and mineral composition of
rice ('oryza sativa'L. ssp.'indica') grains under salt stress.
Schmidhuber, J., & Tubiello, F. N. (2007). Global food security under climate change.
Proceedings of the National Academy of Sciences of the United States of America, 104(50),
19703-19708. doi:0701976104 [pii]
Shaddad, M., El-Samad, M. H. A., & Mohammed, H. (2011). Interactive effects of drought stress
and phytohormones or polyamines on growth and yield of two M (zea maize L) genotypes.
American Journal of Plant Sciences, 2(06), 790.
104
Shi, H., & Chan, Z. (2014). Improvement of plant abiotic stress tolerance through modulation of
the polyamine pathway. Journal of Integrative Plant Biology, 56(2), 114-121.
Sparkes, I. A., Runions, J., Kearns, A., & Hawes, C. (2006). Rapid, transient expression of
fluorescent fusion proteins in tobacco plants and generation of stably transformed plants.
Nature Protocols, 1(4), 2019-2025.
Sugar, D. (1988). Effect of putrescine sprays at anthesis on'comice'pear yield components.
QRUNFLEH MM, SUWWAN MA-Response of Three Summer Annuals to Paclobu, , 27.
Takahashi, T., & Kakehi, J. (2010). Polyamines: Ubiquitous polycations with unique roles in
growth and stress responses. Annals of Botany, 105(1), 1-6. doi:10.1093/aob/mcp259 [doi]
Tiburcio, A. F., Altabella, T., Bitrián, M., & Alcázar, R. (2014a). The roles of polyamines during
the lifespan of plants: From development to stress. Planta, 240(1), 1-18.
Tiburcio, A. F., Altabella, T., Bitrián, M., & Alcázar, R. (2014b). The roles of polyamines during
the lifespan of plants: From development to stress. Planta, 240(1), 1-18.
Urano, K., Yoshiba, Y., Nanjo, T., Ito, T., Yamaguchi-Shinozaki, K., & Shinozaki, K. (2004).
Arabidopsis stress-inducible gene for arginine decarboxylase AtADC2 is required for
accumulation of putrescine in salt tolerance. Biochem Biophys Res Commun, 313(2), 369-
375. Retrieved from http://www.hubmed.org/display.cgi?uids=14684170
Vaishali Mulangi, G. R. (2011). Characterization of polyamine transporters from rice and
arabidopsis Retrieved from http://rave.ohiolink.edu/etdc/view?acc_num=bgsu1303231265
105
Verslues, P. E., Agarwal, M., Katiyar-Agarwal, S., Zhu, J., & Zhu, J. (2006). Methods and
concepts in quantifying resistance to drought, salt and freezing, abiotic stresses that affect
plant water status. The Plant Journal, 45(4), 523-539. doi:10.1111/j.1365-
313X.2005.02593.x
Wang, W., Vinocur, B., & Altman, A. (2003). Plant responses to drought, salinity and extreme
temperatures: Towards genetic engineering for stress tolerance. Planta, 218(1), 1-14.
Woo, N. S., Badger, M. R., & Pogson, B. J. (2008). A rapid, non-invasive procedure for
quantitative assessment of drought survival using chlorophyll fluorescence. Plant Methods,
4, 27-4811-4-27. doi:10.1186/1746-4811-4-27 [doi]
Yamaguchi, K., Takahashi, Y., Berberich, T., Imai, A., Takahashi, T., Michael, A. J., & Kusano,
T. (2007). A protective role for the polyamine spermine against drought stress in
arabidopsis. Biochem Biophys Res Commun, 352(2), 486-490. Retrieved from
http://www.hubmed.org/display.cgi?uids=17118338
Zeier, J. (2013). New insights into the regulation of plant immunity by amino acid metabolic
pathways. Plant, Cell & Environment, 36(12), 2085-2103.
Zhang, X., Henriques, R., Lin, S., Niu, Q., & Chua, N. (2006). Agrobacterium-mediated
transformation of arabidopsis thaliana using the floral dip method. Nature Protocols, 1(2),
641-646.
106
Zhou, Q., & Yu, B. (2010). Changes in content of free, conjugated and bound polyamines and
osmotic adjustment in adaptation of vetiver grass to water deficit. Plant Physiology and
Biochemistry, 48(6), 417-425.
107
SUMMARY
This study set out to explore the role of polyamine transport on growth, development and stress responses in Arabidopsis thaliana. The approach taken in this study was to localize key enzymes known to be associated with polyamine biosynthesis and transport, as well as test the importance of polyamine transport in polyamine homeostasis. The importance of polyamine transport was evaluated by generating transgenic plants overexpressing polyamine uptake transport localized to the chloroplast or plasma membrane.
In Arabidopsis thaliana it has been assumed that there is only one pathway for putrescine biosynthesis although there are two genes in A. thaliana that code for arginine decarboxylase
(ADC). Our research shows that one of the ADCs (ADC2) is localized to the chloroplast and can synthesize putrescine in conjunction with agmatinase, an enzyme that we have localized to the chloroplast. We have also shown that this pathway exists in Glycine max (soybeans). Soybeans also have a second ADC and agmatinase. Furthermore, conservation of key residues in arginases from soybean, Arabidopsis, and poplar indicates that arginases from these plants may be able to function as agmatinases if they have access to the right substrate (agmatine). There are several studies that preceded our work in which they manipulated biosynthesis of polyamines and observed altered plant stress responses. Recognition of the agmatinase pathway in plants provides insights that will be helpful in designing future experiments where polyamine levels are manipulated.
Our research has shown for the first time that polyamine transport is critical for polyamine homeostasis in plants. Change in expression of polyamine transport changed phenotype in
Arabidopsis. This change may be due to crosstalk between polyamines and plant hormones.
108
Auxins are involved in stem elongation, gibberellins are involved in flowering, cytokinins play a role in seed development and ethylene is involved in plant ripening. We observed a delay in flowering, increase in plant height, increased yield, delayed senescence and enhanced drought tolerance in our transgenic plants. Comparison of common and specific gene networks that are affected by increased levels of polyamines have suggested that polyamines participate in drought stress signaling via crosstalk with abscisic acid. The phenotypes that we observed in our transgenic plants establish a role for polyamines as signaling compounds that control plant developmental processes. Our constructs provide a tool to help identify how polyamine levels are sensed and served to activate pathways involved in plant development and stress responses.