Université De La Méditerranée Faculte De Médecine De Marseille École Doctorale Des Sciences De La Vie Et De La Santé Centre De Recherche En Cancérologie De Marseille

UNIVERSITÉ DE LA MÉDITERRANÉE FACULTE DE MÉDECINE DE MARSEILLE ÉCOLE DOCTORALE DES SCIENCES DE LA VIE ET DE LA SANTÉ CENTRE DE RECHERCHE EN CANCÉROLOGIE DE MARSEILLE

T H È S E Pour l’obtention du Diplôme de DOCTEUR de L’UNIVERSITÉ de la MÉDITERRANÉE SPÉCIALITÉ : Oncologie : Pharmacologie et Thérapeutique

Présentée et soutenue publiquement par Mme Laetitia STUHL-GOURMAND Le 30 Mars 2010

ROLE DE NACA ET DE SES PARTENAIRES MOLÉCULAIRES

DANS LA DIFFÉRENCIATION ÉRYTHROÏDE NORMALE

ET PATHOLOGIQUE DES SYNDROMES MYÉLODYSPLASIQUES

Directeur de Thèse : Dr Sophie GOMEZ

Membres du Jury de Thèse : Pr Daniel Olive Président Pr Catherine Lacombe Rapporteur Dr Dominique Duménil Rapporteur Dr Christian Chabannon Examinateur

1 A mes deux hommes, mes deux amours :

mon fils Anthony et mon mari Sébastien

2 REMERCIEMENTS

Je remercie les membres du jury d’avoir accepté de juger ce travail: les Pr Catherine Lacombe, Dr Christian Chabannon, Dr Dominique Duménil et le Pr Daniel Olive de présider ce jury. Je remercie Françoise Birg de m’avoir accueillie au centre de Recherche en Cancérologie de Marseille UMR891. Je remercie ma directrice de thèse Dr Sophie Gomez a qui je dois beaucoup. Merci de m’avoir toujours soutenue tout au long de cette thèse, et de m’avoir accompagné avec patience dans l’aboutissement de ce travail à mon rythme de jeune maman. Je remercie le Dr Patrice Dubreuil de m’avoir accueilli dans son équipe, d’avoir toujours été à l’écoute, et de m’avoir soutenu pour la finalisation de mon projet. Je remercie Véronique Gelsi-Boyer, Virginie Trouplin, Daniel Birnbaum et Norvert Vey, sans qui le projet MDS n’aurait pas existé. M’avoir permis d’aborder la pathologie dans mon travail de thèse a été un vrai plaisir. Je remercie tout particulièrement Véro et Virginie pour leur contribution dans ce projet au quotidien. Je remercie Stéphane Audebert, qui m’a initié aux joies de la protéomique ‘kératine free !’’. Je remercie Patrick Lécine pour son vecteur TAP-tag, certes, mais aussi pour sa bonne humeur et son ouverture d’esprit, en sciences bien sûr ! Je remercie également la collaboration de Daniel Isnardon, notre roi du confocal et de l’apotome pour son temps et son investissement en immunofluorescences. Je remercie le Dr Sophie Lopez pour tous ses bons conseils et ses bons protocoles. J’ai apprécié toutes nos discussions, aussi bien en sciences que sur d’autres sujets. Une personne de qualité telle que toi me manquera. Je remercie Eric Lecocq pour sa bonne humeur, son humour (parfois lourd) mais souvent rafraîchissant. Je remercie Sébastien Letard (alias Sébounet) non seulement de bonne compagnie, il regorge toujours de 1001 merveilles dans ces ampoules et tiroirs pour nous sauver. Je remercie Amandine Chaix pour nos bons moments de discussion et son franc parlé, courage toi aussi tu verras la lumière au bout du tunnel ! Je remercie Laurence Borge pour son investissement dans la fin du projet ERGIC. Je remercie également le reste de l’équipe pour juste avoir été là au quotidien Paulo, Coralie mais aussi Nadine, Nathalie, Katia, Gaëlle et ceux qui sont partis Magali, Edwige, Ying, Julie, Sarah, Carole ....

4 3

Je remercie tous les membres de ma famille : mon fils pour sa patience d’attendre sa maman le soir qui venait le chercher en retard chez sa nounou, mon mari de m’avoir toujours soutenu moralement et remotivé au quotidien, mon papa qui a accepté mes choix de carrière et de partir à 600 Km de la maison, ma petite sœur qui a dû apprendre à vivre sans moi et ma belle-maman, mon beau-frère, mes belles sœurs qui m’ont toujours soutenue avec fierté pour l’aboutissement de mes études.

5 - SOMMAIRE -

ABBREVATIONS...... 8

INTRODUCTION GENERALE...... 12

OBJECTIFS DE LA THESE ...... 12

I. NACA (ALPHA CHAIN OF NASCENT POLYPEPTIDE ASSOCIATED COMPLEX)...... 13

1. DESCRIPTION ...... 13 a. Gène NACA et ses isoformes...... 13 b. Structure de la protéine NACA ...... 14 2. LES FONCTIONS DE NACA...... 16 a. NACA dans le cytosol...... 16 NACA dans l’adressage des polypeptides naissants...... 16 NACA régulateur négatif de l’apoptose ...... 17 NACA interacteur des taxilines...... 20 b. NACA dans le noyau ...... 20 NACA co-facteur de transcription...... 20 c. NACA régule la prolifération et la différenciation des cellules T CD8+...... 22 d. NACA impliquée dans l’hématopoïèse...... 23 3. REFLEXIONS SUR LA PROTEINE NACA ...... 23

II. L’ERYTHROPOIESE...... 25

1. DEFINITION ET LIGNAGES ...... 25 2. MECANISMES MOLECULAIRES ASSOCIES A L ’ERYTHROPOÏESE ...... 26 a. Présentation des différents acteurs moléculaires au cours de la différenciation...... 26 b. Les voies de prolifération et différenciation...... 28 La voie SCF/KIT...... 28 La voie EPO/EPO-R...... 29 e. L’apoptose lors de l’érythropoïèse...... 36

III. MES TRAVAUX DE RECHERCHE ...... 37

ARTICLE 1 : NACA IS A POSITIVE REGULATOR OF HUMAN ERYTHROID -CELL DIFFERENTIATION ...... 38 Introduction...... 39 Article scientifique...... 40 Commentaires ...... 52 ARTICLE 2 : ERGIC-53 A NOVEL INTERACTOR OF NACA, PARTICIPATES TO EPO-R TRAFFICKING ...... 54 Introduction...... 55 Présentation de la technique de Tandem Affinity Purification ...... 55 Le transport et la maturation des protéines...... 58 Article scientifique...... 65

6 Résultats supplémentaires ...... 95 Mesure d’EPO-R à la surface cellulaire de cellules stimulées en EPO...... 95 Détermination de l’interaction entre EPO-R/ERGIC-53 et NACA ...... 96 Commentaires ...... 98

ARTICLE 3 : NACA RESCUE ERYTHROID DIFFERENTIATION OF EARLY STAGE MYELODYSPLASTIC SYNDROME - DERIVING PRECURSORS AND PREDICT RESPONSE TO EPO TREATMENT ...... 100 Introduction...... 101 Définition des Syndromes Myélodysplasiques...... 101 Classification...... 102 Mécanismes moléculaires défaillants des ES-MDS : l’apoptose...... 104 Article scientifique...... 106 Commentaires ...... 135 Evaluation de la réponse au traitement par rhEPO ...... 135 IPSS : International Prognostic Scoring et WPSS : WHO-based Prognostic Scoring ...... 136 The scandinavian-American response score...... 139 Dosage de l’EPO circulante...... 139 Profil d’expression génique des répondeurs et des non-répondeurs ...... 139 RESULTATS SUPPLEMENTAIRES...... 141 La partie C-terminale de NACA est impliquée dans la différenciation érythroïde...... 141 La partie C-terminale de NACA interagit avec FADD...... 142

CONCLUSIONS GENERALES ET PERSPECTIVES...... 143

3. ROLE D ’ERGIC-53 DANS LE TRANSPORT D ’EPO-R...... 144 4. NACA POURRAIT REGULER LE REPLIEMENT DES PROTEINES NOUVELLEMENT SYNTHETISEES TELLES QUE L’EPO-R...... 145 5. IMPLICATION DE NACA/FADD DANS LA DIFFERENCIATION ERYTHROÏDE NORMALE ET DES ES-MDS....148 6. RECHERCHE DES INTERACTEURS DE LA PARTIE C- TERMINALE DE NACA...... 150 7. TAUX DE TRANSCRITS DE NACA ET REPONSE AU TRAITEMENT PAR RHU EPO...... 151

BIBLIOGRAPHIE ...... 153

ABBREVATIONS

A AIF : Apoptosis-Inducing Factor Apaf-1 : Apoptosis Protease-Activating Factor-1 AR: Anémie Réfractaire ARS = RARS: Anémie Réfractaire avec Sidéroblastes en couronne ARS-t : Anémie Réfractaire avec sideroblastes en couronne et thrombocytose AREB: Anémie Réfractaire avec Excès de Blastes AREB-T: Anémie Réfractaire avec Excès de Blastes en Transformation AS-MDS: Advanced Stage of Myelodysplastic Syndrome

B Baf : Bafilomycin BFA : Brefeldin A Baso-EB: Erythroblaste Basophile BFU-E: Burst –Forming Units-Erythroid NAC : beta chain of Nascent polypeptide Associated Complex = BTF-3

C CBM : 1,3-cyclohexane-bis(methylamine) CD36 : Cluster of Differentiation 36 CFU-E: Colony –Forming Units-Erythroid COP I : type I Coat Protein complex COP II : type II Coat Protein complex CRDU: Cytopenie Réfractaire avec dysplasie uni-lignage CRDM : Cytopénie Réfractaire avec Myélodysplasie Multilignée CRDM-RS: Cytopénie Réfractaire avec Myélodysplasie Multilignée avec Sidéroblastes en couronne Cyt c : cytochrome c

8 D DAPI : 4’,6-DiAmidino-2-PhénylIndole DD : Death Domain DED : Death Effector Domain DISC : Death Inducing Signaling Complex DOG : Deoxyglucose

E EKLF: Erythroid Krüppel-like factor EPO : Erythropoïetine EPO-R : Erythropoïetine Receptor ER : Endoplasmic Reticulum ERGIC : ER-Golgi intermediate compartment ES-MDS: Early Stage of Myelodysplastic Syndrome

F FAB : Franco-Americano-Britannique FADD: Fas-associated death domain FADD-DN: FADD dominant négatif FasL: Fas Ligand FITC : Fluoresceine IsoThioCyanate FLIP: FLICE Inhibitory Protein FOG: Friend of GATA

G GATA-1: Globin transcription factor 1 GPA: Glycophorin A GSK3 ! : Glycogen Synthase Kinase 3 GM-CSF : Granulocyte Macrophage Colony Stimulating Factor

H HSC: pluripotent Hematopoietic Stem Cell Hsp : Heat Shock Proteins

9 I IGF-1: Insulin Growth Factor 1 IPSS : International Prognostic Scoring ILK : Intregrin linked kinase

J JAK2 : Janus family tyrosine Kinase 2

K KIT : SCF Receptor

L LMO2: Lim-domain partner of TAL1

M MAP-kinase : Mitogen Activated Protein Kinase MDS =Myelodysplastic syndromes MDS del5q-: Myelodysplastic syndromes with genetic deletion 5q- MDSi = Syndromes Myélodysplasiques inclassable (MDSu)

N NACA ou "NAC : alpha chain of the Nascent-polypetide- Associated- Complex NAC : Nascent polypeptide Associated Complex NDGA : Nordihydroguararetic Acid NR: Neutropénie Réfractaire

O OA : Okadaic Acid OMS : Organisation Mondiale de la Santé Ortho-EB: Erythroblaste Orthochromatique

P Poly-EB: Erythroblaste Polychromatophile Pro-EB: Proerythroblaste

10 Q,R RAEB: Refractory Anemia with Exces of Blasts RAEB-T: Refractory Anemia with Exces of Blasts Transformation RARS: Refractory Anemia with Ring Sideroblastes RARS-t : Refractory Anemia with Ring Sideroblastes and Thrombocytosis RB: Retinoblastoma Protein RBS: Erythrocyte RE: Réticulum Endoplasmique RET: Réticulocyte rhEPO : recombinant human erythropoietin

S SCF: Stem Cell Factor SDS : DodécylSulfate de Sodium SMD: Syndromes Myélodysplasiques STAT: Signal Transducer and Activator of Transcription SVF : Sérum de Veau Foetal

T TBS : Tris Buffer Saline TF1 : Cellules érythroleucémique humaines TR: Thrombocytopénie Réfractaire TRAIL: TNF-Related Apoptosis-Inducing Ligand

U U : Unités Ub : Ubiquitine UBA : Ubiquitin-Associated domain UPR : Unfolded Protein Response

V, W WHO : World Health Organization

WPSS : WHO-based Prognostic Scoring

11 INTRODUCTION GENERALE

L’érythropoïèse est un processus vital qui permet la production d’environ 100 milliards de globules rouges par jour (hématies ou érythrocytes) qui ont pour fonction le transport du dioxygène et du dioxyde de carbone entre les poumons et les différents organes du corps. Ainsi, ces cellules du sang ont pour mission l’oxygénation de tous les tissus du corps et l’élimination du dioxyde de carbone au niveau des poumons. L’érythropoïèse repose sur une balance entre la production de cellules érythroïdes et la destruction des globules rouges. Ainsi, le bon déroulement de l’érythropoïèse repose sur la régulation de la prolifération, de la différenciation, et de l’apoptose. La compréhension des mécanismes intracellulaires lors de l’érythropoïèse normale permet l’identification des différents acteurs moléculaires. Leur dérégulation est associée à différentes pathologies. Ainsi, l’étude des différents acteurs moléculaires sollicités lors de la différenciation érythroïde peut donner le moyen d'améliorer les traitements thérapeutiques de plusieurs pathologies associées à l'anémie. La protéine NACA n’avait jamais été décrite comme jouant un rôle dans l’hématopoïèse.

OBJECTIFS DE LA THESE

Mon projet de thèse a été initié par le travail mené par S. Baghdoyan qui a montré que le gène NACA est modulé lors de l’hématopoïèse. Etant donné que ses travaux n’ont pas abordé les fonctions de NACA dans la différenciation hématopoïétiques, j’ai entrepris ma thèse avec cet objectif. J’ai tout d’abord participé à un travail qui a abouti au premier article dans lequel il a été montré que NACA est un régulateur positif de la différenciation érythroïde humaine. La poursuite de mes travaux m’a conduit à l’étude des mécanismes moléculaires sollicités lors de la différenciation érythroïde médiée par NACA. Egalement, j’ai recherché si NACA, régulateur positif de la différenciation érythroïde, avait une influence sur l’érythropoïèse défaillante observée dans les Syndromes myélodysplasiques de bas risque.

I. NACA (alpha chain of nascent polypeptide associated complex)

1. Description

a. Gène NACA et ses isoformes

Le gène NACA comporte un domaine NAC très bien conservé de l’eucaryote à l’humain (Makarova et al., 1999). NACA est composé de 8 exons formant un transcrit de 900pb codant une protéine ubiquitaire de 35KDa (Moreau et al., 1998). Le gène NACA humain est localisé sur le chromosome 12 en position q23-q24. (Yotov and St-Arnaud, 1996b). Un deuxième transcrit du gène naca de 7000pb code pour la protéine skNAC de 220KDa (skeletal muscle NAC) spécifique du muscle squelettique et cardiaque. La protéine skNAC intervient dans l’organisation des myofibrilles chez la souris et zebrafish (Li et al., 2009; Yotov and St-Arnaud, 1996a). Le transcrit codant pour skNAC correspond au transcrit de NACA dans lequel un très long exon 3 (~6Kb) est inséré (voir figure 1). Chez l’humain, l’existence de skNAC n’a jamais été rapportée dans la littérature, mais une séquence prédictive existe dans les banques de données (NT_029419) ainsi que les résultats de travaux préliminaires effectués dans notre équipe ont permis de mettre en évidence le transcrit de cette forme longue dans les cellules de muscle squelettique et cardiaque (thèse de Sandrine Baghdoyan 2000).

13 GeneGène naca souris 338pb 70pb 5915pb 84pb 76pb 148 pb 127pb 121pb 143pb 1 2 3 4 5 6 7 8 9

Transcrits 1 2 4 5 6 7 8 9 ARNm NACA 1 2 3 4 5 6 7 8 9 ARNm skNAC

GeneGène NACA humain 22pb 71pb 1700pb 59pb 86pb 476pb 240pb 86pb 80pb 148 pb 132pb 123pb 117pb 1 2 3a 3b 3c 3d 3d’ 4 5 6 7 8 9

Transcrits 1 2 4 5 6 7 8 9 ARNm NACA

1 2 3d 3d’ 4 5 6 7 8 9 ARNm NT_029419

Figure 1 : Représentation schématique du gène naca de souris et du gène NACA humain et de leurs transcrits respectifs . La séquence NT_029419 est une séquence prédictive.

b. Structure de la protéine NACA

La protéine NACA (ou NAC : alpha chain of nascent polypeptide associated complex) est hautement conservée de la levure à l’humain (Shi et al., 1995). NACA est une protéine de 215 acides aminés, composée d’un domaine NAC (sur lequel !NAC interagit) et d’un domaine UBA (Ubiquitin Associated). La structure de la protéine NACA est révélée grâce à l’étude cristallographique de l’homologue aeNAC (archaeal NAC) issu de Methanothermobacter marbugensis (Spreter et al., 2005).

Figure 1 : Représentation schématique des domaines conservés de NACA et !NAC humain et de aeNAC

(Spreter et al., 2005).

Figure 2 : Structure cristallographique de 2 molécules aeNAC (Spreter et al., 2005)

L’étude cristallographique de Spreter et al, a permis de mettre en évidence que le domaine NAC est composé de 6 feuillets beta, qui en homodimère forment une sorte de ‘‘tonneau’’(Figure 2). Ces données suggèrent que l’association de NACA et !NAC via ce domaine NAC, forme cette structure en ‘‘tonneau’’, très certainement impliquée dans le guidage des polypeptides naissants. Ce travail a également permis de modéliser la structure du domaine UBA en une succession de 3 hélices alpha. Les domaines UBA sont trouvés dans un grand nombre de protéines de diverses fonctions impliquées dans l'ubiquitination, la réparation de l'ADN, et les voies de signalisation. Ces domaines interagissent avec l’ubiquitine (Ub) ce qui oriente les protéines dans la voie de dégradation (Mueller et al., 2004). Le domaine UBA de NACA interagit directement avec le protéasome, suggérant que NACA participe au contrôle qualité des protéines nouvellement synthétisées (Panasenko et al., 2009). Ce domaine UBA peut être ubiquitinilé in vitro par Not4p et E2 enzyme Ubc4p (Panasenko et al., 2006). L’ubiquitination du domaine UBA de NACA joue un rôle aussi bien dans la stabilité du complexe NAC, que celui formé avec le ribosome. Ces données suggèrent que le domaine UBA ubiquitinilé protège probablement NACA lui-même et son interacteur !NAC de la dégradation (Panasenko et al., 2006; Panasenko et al., 2009).

2. Les fonctions de NACA

La protéine NACA a été décrite dans plusieurs travaux, dans différents compartiments cellulaires et en interaction avec différentes protéines, lui conférant ainsi diverses fonctions. Dans le cytosol, NACA est impliquée dans l’adressage des polypeptides naissants, la régulation négative de l’apoptose, et interagit avec des protéines de la famille des taxilines. Dans le noyau des ostéoblastes, NACA joue le rôle d’un cofacteur de transcription, se lie avec l’ADN et régule l’expression de deux gènes indispensables pour la différenciation ostéoblastique.

a. NACA dans le cytosol

# NACA dans l’adressage des polypeptides naissants

Le complexe NAC (nascent polypeptide associated complex) est composé de deux protéines NACA et !NAC (beta chain of nascent polypeptide associated complex ou BTF-3 ) associées aux ribosomes (Wiedmann et al., 1994). La forme !NAC interagit directement avec le ribosome (la protéine ribosomale L23), et NACA interagit avec la chaîne peptidique naissante (Beatrix et al., 2000; Wegrzyn et al., 2006). Ce complexe NAC interagit aussi bien avec le ribosome que la chaîne peptidique naissante dans des proportions stœchiométriques 1:1 (Rospert et al., 2002; Wiedmann et al., 1994). Le complexe NAC a été décrit comme impliqué dans la spécificité d’orientation des polypeptides soit à la membrane du RE, soit vers le cytosol aussi bien dans un système mammifère (Lauring et al., 1995a; Lauring et al., 1995b) que dans la levure (Wiedmann and Prehn, 1999). En effet, NAC en association avec la protéine SRP (Signal Recognition Particule) oriente le polypeptide naissant (ayant la séquence ‘‘peptide signal’’ reconnu par SRP) dans le RE, tandis que NAC seule assure l’orientation du polypeptide naissant dans le cytosol. Le complexe NAC a également été caractérisé dans la régulation de l’importation des protéines à la mitochondrie en initiant l’interaction du ribosome à la surface mitochondriale (Funfschilling and Rospert, 1999; George et al., 1998; George et al., 2002). Sur le ribosome, on trouve également les protéines chaperonnes HSP40/HSP70 et TRIC/CTT impliquées dans le repliement des peptides nouvellement synthétisés (Funfschilling and Rospert, 1999; Plath and Rapoport, 2000; Rospert et al., 2002) (figure 3). L’homologue de

16 HSP70 chez E. coli (DnaK) a été copurifié avec GST-NACA (Beatrix et al., 2000), suggérant que NACA pourrait jouer un rôle dans le repliement des protéines naissantes.

Figure 3 : Représentation schématique de la machinerie de synthèse protéique ( d’après (Kramer et al., 2009): Le complexe NAC et le duo Hsp70L1/Mpp11 (membre des Hsp40) sont 3 recrutés sur le ribosome et interagissent avec le polypeptide naissant. Le repliement du polypeptide naissant s’opère par les chaperonnes cytosoliques TRIC/CCT (membre de la famille des HSP60) ou le système Hsp70/Hsp40 et le nucleotide-exchange factor (NEF). Le complexe prefoldin–GimC est impliqué dans le repliement de l’actine et la tubuline.

# NACA régulateur négatif de l’apoptose

Pour rappel, l’apoptose est gouvernée par deux voies principales d’activation (figure 4):

# une voie dite extrinsèque, impliquant des récepteurs membranaires appartenant à la superfamille des récepteurs au TNF (pour revue voir (Peter and Krammer, 2003).

# une voie dite intrinsèque mettant particulièrement en jeu la mitochondrie ; Cette voie est gouvernée par des protéines appartenant à la superfamille de Bcl-2 (pour revue voir (Cory and Adams, 2002).

Figure 4 : Schéma des voies intrinsèques et extrinsèques de l’apoptose d’après (Ashkenazi and Herbst, 2008) La voie extrinsèque :Un ligand tel que TRAIL ou FasL active par interaction, le récepteur de mort ancré dans la membrane plasmique de la cellule. Le récepteur activé recrute un complexe composé d'une molécule adaptatrice FADD (Fas Associated Death Domain) et de la procaspase-8. La formation de ce complexe entraîne le clivage de la caspase-8 qui est alors produite sous sa forme dimèrique active, puis la cascade d'activation séquentielle des différentes caspases parmi lesquelles la caspase-3 La voie intrinsèque : La phase effectrice de l'apoptose comporte l'ouverture des pores de transition de perméabilité des mitochondries. Ces pores sont des canaux oligo-protéiques constitués au niveau de la membrane externe par la porine (ou VDAC : Voltage Dependent Anion Channel), sur la membrane interne par l'ANT (Adenine Nucléotide Translocator). Suite à l’ouverture de ces pores, il y a libération de molécules pro- apoptotiques telles que le cytochrome c, les caspases 2, 3 et 9 ainsi que l’Apoptosis Inducing Factor (AIF).Cette phase de libération est sous le contrôle des membres de la famille Bcl-2. Ainsi, Bcl-2 est capable de bloquer la sortie du cytochrome c alors que Bax peut l'induire. Ainsi, en empêchant la libération du cytochrome c par la mitochondrie, Bcl-2 et Bcl-XL inhibent la formation du complexe APAF1/cytochrome c/caspase 9 nécessaire à l'apoptose. Bid est le lien entre les récepteurs de mort et la libération du cytochrome c. Bid est directement clivé par la caspase 8 et le fragment C-terminal produit permet la libération du cytochrome c.

NACA est un interacteur de la protéine apoptotique FADD (Fas-Associated Death Domain), et cette interaction régule négativement l’apoptose (Stilo et al., 2003). Cette régulation négative se fait en absence de ligand TNF . En présence de ligand TNF $ le complexe FADD/NACA se dissocie suggérant que NACA n’empêche pas l’apoptose médiée par TNF $ mais séquestre le FADD libre empêchant son oligomérisation et l’activation de la voie extrinsèque de façon ‘‘récepteur indépendant’’ (figure 5). De plus, l’association de NACA sur FADD n’empêche pas l’interaction d’un polypeptide codant pour DD (Death Domain) sur le DD de FADD, suggérant que le site d’interaction de NACA n’est pas sur le DD de FADD (Stilo et al., 2003). Cependant, le ou les domaines de NACA impliqués dans cette interaction n’ont pas pu être déterminés, suggérant que la molécule NACA entière serait nécessaire pour l’interaction avec FADD. L’étude de Stilo et al a permis d’attribuer à NACA la fonction d’une molécule anti-apoptotique.

Figure 5 : Représentation schématique de NACA dans la voie extrinsèque de l’apoptose : A gauche : En absence du ligand, NACA et cFLIP sont associés à FADD et l’empêche d’être recruté sur le domaine de mort (DD) du récepteur ancré dans la membrane plasmique de la cellule. A droite : En présence d’un ligand, le récepteur de mort est activé par interaction. Le récepteur activé recrute l’adaptateur FADD et la procaspase-8. La formation de ce complexe entraîne le clivage de la procaspase-8 qui est alors produite sous sa forme dimèrique active, puis la cascade d'activation séquentielle des différentes caspases vont cliver toutes les structures cellulaires entraînant la mort de la cellule.

19 # NACA interacteur des taxilines

NACA a été identifié lors de la recherche de nouveaux partenaires moléculaires des taxilines dans des cellules de mammifères dans le but de préciser le rôle des taxilines récemment découvertes (Yoshida et al., 2005). Les taxilines sont des protéines impliquées dans le transport vésiculaire vers la membrane plasmique. La famille des taxilines comprend l’ -taxiline (ubiquitaire), la !- taxiline (muscle squelettique) et la %-taxiline (ubiquitaire). Les taxilines interagissent avec les protéines de la famille des syntaxines ancrées dans la membrane plasmique (Fujimori et al., 2002; Nogami et al., 2003a; Nogami et al., 2003b; Nogami et al., 2004). L’interaction entre l’ -taxiline et NACA est inhibée en présence de la syntaxine-4 suggérant que NACA et la syntaxine ont le même site d’interaction sur l’ & taxiline. Cette étude a mis en évidence l’interaction entre NACA et les & , !& et %-taxilines, mais aussi l’interaction entre !NAC et l’ et %-taxiline par purification d’affinité GST (GST pull-down). Les auteurs de ce travail avancent l’hypothèse selon laquelle l’interaction de NACA avec les taxilines pourrait être impliquée dans le processus de traduction via le transport du ribosome en cours de traduction. Des études complémentaires sont nécessaires pour déterminer la réelle fonction des complexes NACA/taxilines.

b. NACA dans le noyau

# NACA co-facteur de transcription

Lors de la recherche de gènes régulés au cours de la minéralisation, NACA a été identifiée dans les ostéoblastes (Yotov et al., 1998). La protéine NACA a été décrite comme co-facteur de transcription dans un modèle de double hybride (Yotov et al., 1998). Dans le noyau des cellules ostéoblastiques, NACA est associée aux facteurs de la transcription, TBP (TATA Box-Binding Protein) et c-jun en homodimère, et stabilise la machinerie transcriptionnelle de c-jun sur sa séquence d’ADN (figure 6) (Moreau et al., 1998). Dans ce système, la région composée des acides aminés 89-129 de NACA interagit avec la partie N- terminale de c-jun (Quelo et al., 2002). Dans ce modèle ostéoblastique, NACA potentialise la transcription mediée par c-jun du gène de l’ostéocalcine et de l’ 1(I) collagène, ce qui favorise la minéralisation et la formation de l’os (Akhouayri et al., 2005; Meury et al., 2009).

20 L’interaction de NACA avec l’ADN a été caractérisée par ‘’shift-assay’’ et sa séquence d’ADN 5’-C/G C/G A C/G A C/G A N N N G-3’ a été identifiée comme étant un consensus de reconnaissance (Akhouayri et al., 2005; Yotov and St-Arnaud, 1996a).

Homodimère c-jun/c-jun

Figure 6 : Modèle d’interaction entre NACA, l’ homodimère de c-jun et la TBP (d’après (Moreau et al., 1998)

Un modèle de régulation de la transcription médiée par c-jun/NACA a été démontré, par translocation de NACA du cytosol vers le noyau et vice versa (figure 7). Dans le contexte qui favorise la transcription médiée par c-jun, la protéine ILK (Integrin-Linked Kinase) phosphoryle le résidu sérine 43 de NACA ce qui amorce son passage dans le noyau (Quelo et al., 2004b). A l’inverse, les protéines GSK3 !# (Glycogen synthase kinase 3 !) et CK2 (casein kinase II) sont responsables de l’export de NACA du noyau par phosphorylation (sur résidu thréonine 159 de NACA par GSK3 ! et sur plusieurs résidus de la partie N-terminale par CK2), ce qui oriente NACA dans la voie de dégradation du protéasome 26S (Quelo et al., 2004a; Quelo et al., 2005).

Figure 7 : Translocation de NACA du noyau au cytosol ILK : Intregrin-Linked Kinase ; GSK3 ! : Glycogen Synthase Kinase 3 beta ; TBP : TATA box Binding Protein ; DUB : DesUbiquitinating enzyme

c. NACA régule la prolifération et la différenciation des cellules T CD8+

NACA a été identifié lors d’un criblage des gènes différentiellement exprimés lors de la différenciation terminale des cellules humaines CD8+ (Al-Shanti et al., 2004). NACA est exprimé plus fortement dans les cellules aux stades non différenciées (CD57-) que dans les cellules différenciées (CD57+). La fonction de NACA dans la différenciation des CD8+ a été déterminée par extinction de la protéine par siRNA, ce qui a pour effet d’augmenter la prolifération, la différenciation et l’activité cytotoxique des cellules CD8+ (Al-Shanti and Aldahoodi, 2006). Le contrôle de la prolifération des cellules T a également été étudié par transduction de NACA dans des cellules stromales ganglionnaires (lymph node-derived stromal cells : LNS) (Endharti et al., 2005). La transduction de NACA dans des cellules stromales ganglionnaires induit la production d’un facteur soluble dans le milieu cellulaire : la Galectine-1 capable de maintenir la survie des cellules T sans induire la prolifération. Ces études proposent NACA comme un modérateur de la différenciation lymphocytaire, et suggèrent que NACA pourrait être une clé pour l’immunothérapie.

22 d. NACA impliquée dans l’hématopoïèse

Le gène NACA a été identifié par la technique de piégeage de gène dans les cellules érythroleucémiques humaines (TF-1) après induction au GM-CSF, lors de la recherche de gènes modulés lors de l’hématopoïèse (Baghdoyan et al., 2000). Ce résultat obtenu dans les cellules TF-1 fut confirmé dans les progéniteurs hématopoïétiques humains CD34+ après 4 heures de stimulation au GM-CSF. NACA n’est pas modulé par stimulation à l’IL3 ou à l’IL5 dans les TF-1 suggérant que l’augmentation du transcrit codant NACA est cytokine spécifique. Le GM-CSF, l’IL3 et l’IL5 ont un rôle central dans toutes les étapes de l’hématopoïèse en intervenant dans l’amplification d’un grand nombre de cellules progénitrices, puis en induisant leur différenciation jusqu’au stade mature et leur activation (Miyajima et al., 1993). Le GM-CSF régule particulièrement les progéniteurs myéloïdes (Jaffe et al., 1988; Metcalf et al., 1986; Quesenberry et al., 1985; Sieff et al., 1985; Tomonaga et al., 1986). Ainsi, l’identification du gène NACA, qui n’avait jamais été décrit comme impliqué dans l’hématopoïèse, pourrait être important pour maintenir les précurseurs myéloïdes dépendants du GM-CSF au stade prolifératif et empêcher leur différenciation.

3. Réflexions sur la protéine NACA

L’ensemble des données indique que la protéine NACA a de multiples fonctions dépendantes du compartiment cellulaire, et de ses partenaires moléculaires.

26S Protéasome 69-80 89-129 ILK GSK3 ! Ub c-jun CP 1 P NAC P UBA 215 T- 159 S- 43 !NAC 176-213 71-130

NAC domain UBiquitin Associated domain

Site de liaison à l’ ADN Ub Ubiquitine

Q/A rich domain CP Core Particle (protéasome) Acidic domain EF hand

Figure 8 : NACA, ses domaines et ses interacteurs

23 Toutes les fonctions décrites pour NACA sont ubiquitaires et requises pendant la différenciation hématopoïétique:

# Les protéines de la machinerie traductionnelle : des mutations des protéines d’assemblages ribosomales (RPS19, RPS24 et RPS17) causent la Diamond-Blackfan anemia et des mutations de la protéine SBDS (Shwachman-Bodian-Diamond syndrome) sont associées au Shwachman- Diamond syndrome (Aguissa-Toure et al., 2009; Cmejla et al., 2007; Da Costa et al., 2001; Draptchinskaia et al., 1999; Ganapathi and Shimamura, 2008; Gazda et al., 2006). Le gène codant pour la protéine ribosomale RPS14 est perdu dans les syndromes myélodysplasiques 5q-, et est sous exprimé dans 71% des syndromes myélodysplasiques non 5q- (Czibere et al., 2009; Ebert et al., 2008; Sohal et al., 2008).

# Les protéines de l’apoptose : L’apoptose est centrale pour le développement et l’homéostasie du système hématopoïétique. La dérégulation de l’apoptose perturbe la balance entre la prolifération cellulaire, la survie et la mort cellulaire. L’apoptose joue un rôle majeur dans le développement de maladies telles que les syndromes myélodysplasiques et la leucémie (Boudard et al., 2002; Claessens et al., 2002; Claessens et al., 2005; Fontenay-Roupie et al., 1999; Sawanobori et al., 2003; Tehranchi et al., 2003; Testa and Riccioni, 2007; Zang et al., 2001). Egalement, la résistance à l’apoptose est un facteur de malignité conduisant aux syndromes myéloprolifératifs (Tefferi, 2001).

# La transcription médiée par c-jun : c-jun (en association avec c-fos) est aussi bien un régulateur positif que négatif de la différenciation myéloïde (Elagib et al., 2004; Liebermann et al., 1998; Lord et al., 1993).

De plus, NACA n’avait jamais été étudiée dans le système hématopoïétique humain à ce jour.

24 II. L’ERYTHROPOIESE

1. Définition et lignages

L’érythropoïèse est un processus vital qui a lieu en partie dans la moelle osseuse et qui permet à une cellule souche hématopoïétique de former des globules rouges (appelés aussi hématies ou érythrocytes). Les cellules souches hématopoïétiques sont d'abord des cellules pluripotentes myéloïdes (CFU-GEMM : Colony- forming unit granulocyte erythroid macrophage mixed) qui s’engagent de façon irréversible vers la lignée érythroïde. Les précurseurs érythroïdes se nomment pro-érythroblastes, résident dans la moelle osseuse et se différencient successivement en érythroblastes basophiles, en érythroblastes polychromatophiles, en érythroblastes acidophiles (orthochromatophiliques ou normoblastes), puis enfin en réticulocytes. Le passage au stade réticulocyte est caractérisé par la perte du noyau par énucléation spontanée et le passage de cette cellule dans la circulation sanguine où elle atteint le stade final de sa différenciation et devient un érythrocyte (figure9). Les différents stades de différenciation érythroïde peuvent être facilement visualisés par coloration des cellules sanguines étalées sur une lame et colorées par May-Grunwad-Giemsa ou par bleu de méthylène pour le stade réticulocyte. L’étude morphologique des cellules traitées par cette coloration permet de mettre en évidence la diminution de la taille cellulaire au fur et à mesure de la différenciation érythroïde.

Figure 9 : Schéma des différents stades de différenciation érythroïde Cette représentation respecte l’apparence morphologique et la taille des différentes cellules érythroïdes après coloration MGG ou bleu de méthylène pour le réticulocyte.

25 2. Mécanismes moléculaires associés à l’érythropoïèse

a. Présentation des différents acteurs moléculaires au cours de la différenciation

Les mécanismes moléculaires de la différenciation érythroïde font intervenir une combinaison de cytokines à des stades ‘‘clés’’ de la maturation des cellules progénitrices. L’activation des récepteurs à cytokine entraîne une cascade de signalisations intracellulaires, et déclenche l’expression et la régulation d’un ensemble de protéines spécifiques du compartiment érythroïde. Les études des mécanismes moléculaires durant la différenciation érythroïde ont permises de comprendre les interventions d’un panel de protéines, et initiées la culture in vitro des progéniteurs hématopoïétiques CD34+ (et CD38+).

On peut distinguer 3 phases dans la maturation des cellules érythroïdes (voir Figure 10): # Phase 1 -la prolifération- : La cellule souche hématopoïétique est soumise à la combinaison de trois cytokines (IL3, SCF, et IGF1) qui déclenche la transduction du signal JAK2, PI3K et AKT, ce qui initie l’expansion des progéniteurs jusqu’au stade proérythroblaste. # Phase 2 -la différenciation- : La différenciation érythroïde est déclenchée au stade proérythroblaste par la voie EPO/EPO-R qui va contrôler non seulement l’expression de gènes spécifiques du compartiment érythroïde, mais également réprimer les molécules de l’apoptose. # Phase 3 -la restructuration- : Au stade érythroblaste acidophile, on note l’expression de quelques protéines apoptotiques (FasL, TRAIL, TNF ) qui induisent l’activation des caspases sans pour autant induire la mort de la cellule. Ce mécanisme est essentiel pour permettre la restructuration et l’énucléation de l’érythroblaste lors de la différenciation érythroïde terminale (Zermati et al., 2001).

Figure 10 : Les récepteurs à cytokines, les facteurs de transcription et les protéines sollicités et produits durant les étapes de l’érythropoïèse

27 b. Les voies de prolifération et différenciation

On distingue une cascade de signalisations partant d’une association d’un ligand de type cytokine avec son récepteur, qui recrute et active à son tour des protéines cytoplasmiques par phosphorylation, ce qui entraîne une régulation transcriptionnelle et d’autres voies métaboliques.

# La voie SCF/KIT

KIT est un récepteur à activité tyrosine kinase qui après association au SCF forme un homodimère qui s’autophosphoryle afin d’induire des signaux de survie et de prolifération sur les progéniteurs érythroïdes via un ensemble de protéines cytoplasmiques portant des résidus tyrosine (figure11).

Figure 11 : Schéma de la signalisation du SCF (extrait de l’article de (Munugalavadla and Kapur, 2005) PI3Kinase est impliquée dans plusieurs aspects de la signalisation cellulaire, tels que la synthèse d’ADN, la survie cellulaire, le remodelage membranaire, le chimiotactisme et le transport vésiculaire. PI3Kinase active la protéine AKT qui initie la voie de survie cellulaire via la signalisation anti-apoptotique (Lennartsson et al., 2005). PLC % hydrolyse PIP2 qui génère du DAG et IP3. DAG lie et active une nouvelle PKC tandis que IP3

28 entraîne le relargage du Ca2+. Ainsi, PLC % induit la survie et la prolifération. La protéine Ras est associée au GTP sous sa forme activable et est recrutée par Sos/Grb2. L’activation de Ras entraîne celle de la sérine/thréonine kinase Raf-1 et déclenche la voie MAPK impliquée dans la division cellulaire et la survie. La famille des Src kinases inclue 9 membres: Src, Yes, Fyn, and Fgr formant la « sous-famille SrcA », Lck, Hck, Blk, and Lyn dans la « sous-famille SrcB », and Frk qui lui seul forme une sous famille. Les Src kinases sont impliquées dans la progression dans le cycle cellulaire, l’internalisation de KIT induit par SCF (Broudy et al., 1999), la prolifération (Tan et al., 2003), le chimiotactisme, l’adhésion, la survie et le transport des protéines (Thomas and Brugge, 1997).

La transduction du signal par KIT à d’autres protéines passe par la phosphorylation de résidus tyrosines cytoplasmiques de la phospholipase-C % (PLC %), du phosphatidylinositol 3- kinase (PI3Kinase), de RasGTPase-activating protein, des SRC kinases, des adaptateurs moléculaires GRB2, GRB7 et de SHC. La régulation négative de KIT peut également passer par la déphosphorylation de résidus tyrosine par les SHP-1et SHP-2 phosphatases qui interfèrent dans l’activation de la voie des SRC kinases. Dans un contexte érythroïde, l’importance des différentes voies de signalisation activées par KIT a été étudiée en utilisant des mutants de KIT. Cette étude conclus que la voie de SRC kinases est une voie majeure dans la prolifération et la croissance des cellules érythroïdes avec coopération de la voie de l’érythropoïétine (EPO), tandis que GRB2 et PI3kinase semblent avoir une importance moindre (Tan et al., 2003).

# La voie EPO/EPO-R

Au stade proérythroblaste, s’ajoute une voie majeure de la différenciation érythroïde : la voie de l’EPO qui va déclencher un ensemble de signaux irréversibles pour la cellule et son engagement dans la différenciation érythroïde. Tandis que les voies du SCF et de IGF-1 s’arrête au stade polychromatophilique, la cellule reste stimulée par l’EPO jusqu’au stade acidophile. Au-delà de ce stade, il semble que la cellule soit indépendante de tous signaux externes, et que la machinerie intracellulaire est en marche pour faire maturer la cellule jusqu’au stade de l’hématie circulante. L’EPO est produit par les reins (Koury et al., 1988), et sa synthèse est régulée selon l’oxygénation ou l’hypoxie des cellules rénales (Maxwell et al., 1993). L’EPO circule dans le sang, et agit au niveau de la moelle osseuse, sur les cellules exprimant son récepteur (EPO-R). La protéine EPO-R est exprimée à la surface des progéniteurs érythroïdes dés le stade BFU-E matures. Son expression augmente au cours de la

29 différenciation des cellules et est maximale au stade CFU-E et proérythroblaste, puis diminue ensuite au stade de maturation terminale (Glass et al., 1975).

o Structure d’EPO-R

L’EPO-R comporte 508 acides aminés pour un poids moléculaire de 62 à 78 kDa. C’est un homodimère transmembranaire comportant deux sous-unités. Le domaine extracellulaire de EPO-R est composé d’un domaine hématopoïétique ou domaine cytokine, lui-même composé de 2 sous domaines D1 et D2. Les études cristallographiques ont démontré que le domaine extracellulaire d’EPO-R existe sous la forme dimèrique même en l’absence de l’EPO.

Figure 12 : Structure d’EPO-R extrait de (Richmond et al., 2005) Le domaine extracellulaire est composé de séquences répétées qui peuvent être divisée en deux sous-domaines, désignés par D1 (acides aminés 11-113) et D2 (acides aminés 118–218). Il existe 4 résidus cystéines dans le domaine D1 qui sont groupées 2 à 2 par deux ponts disulfures. Aucun résidu cystéine dans le domaine D2. Les résidus 208–212 forment la boite WSXWS. La séquence du domaine trans-membranaire (TM en vert clair) inclue L240 et L241, qui sont essentiels pour l’activation. La séquence juxtamembranaire est composée de la boite 1 (verte)(acides aminés 257–264) et de la boite 2 (acides aminés 302–312). Plusieurs résidus (L253, I257, W258 et D287) sont importants pour l’activation EPO-dependente de JAK2. Les acides aminés I257 et W258 dans la boite 1 sont indiquées en rouge.

o Régulation de l’EPO-R

La survie, la prolifération et la différenciation des progéniteurs et précurseurs érythroïdes passent par de fines régulations de l’EPO-R à différents niveaux : - transcriptionnelle - post-traductionnelle - après activation par l’EPO

30 Régulation transcriptionnelle de EPO-R Le promoteur du gène de l’EPO-R ne contient ni boite TATA ni CAAT, mais contient les sites d’interaction des facteurs de transcription GATA-1 et Sp1 (Chin et al., 1995). En effet, GATA-1 et EPO-R se régulent ‘‘mutuellement’’ : GATA-1 transactive le gène de l’EPO-R, et la transduction du signal via EPO-R amplifie l’expression du gène GATA-1 (Chiba et al., 1991). Ces résultats sont en accord avec les différentes étapes de la différenciation érythroïde : 1) GATA-1 est exprimée pendant le stade précoce de la différenciation érythroïde ; 2) GATA-1 transactive le gène codant EPO-R ; 3) EPO interagit avec EPO-R, ce qui transduit le signal pour amplifier l’expression du gène codant GATA-1 dans les progéniteurs érythroïdes ; et enfin 4) GATA-1 transactive les gènes de l’hémoglobine et des globines nécessaires à la cellule érythroïde mature. GATA-1 et Sp1 ne sont pas les seules facteurs régulant le gène de l’EPO-R, d’autres facteurs non identifiés interviennent (des ‘’Spl-like binding proteins’’) (Chin et al., 1995).

Régulation post-traductionnelle de EPO-R A peine traduite dans la lumière du RE, la protéine EPO-R est régulée. En effet, environ la moitié des molécules d’EPO-R nouvellement synthétisées est dégradée rapidement (t ½ ~ 40 à 60 min ) sans avoir acquis la résistance à l’endoH (dans le RE) (Neumann et al., 1993). L’autre moitié des molécules d’EPO-R est stockée dans le RE où elles s’associent à JAK2 et acquièrent une conformation plus repliée (Hilton et al., 1995; Huang et al., 2001; Sawyer and Hankins, 1993). Lors de la stimulation par EPO, la protéine EPO-R sort du RE transite par l’appareil de golgi, pour être exprimée à la membrane plasmique. Seul 5% des molécules d’EPO-R synthétisées sont exprimées à la surface cellulaire, le reste étant acheminé via des vésicules post-golgiennes dans les lysosomes où il est dégradé (D'Andrea and Zon, 1990; Neumann et al., 1993; Neumann et al., 1996; Supino-Rosin et al., 1999; Yoshimura et al., 1990).

Catabolisme de EPO/EPO-R Le catabolisme d’EPO-R a lieu rapidement après son activation. Une fois que la liaison de l’EPO au récepteur des progéniteurs érythroïdes a déclenché le signal via JAK2, la protéine STAT5 est phosphorylée et l’EPO-R expose son domaine intracytoplasmique phosphorylé sur les 3 résidus Y429, Y431, or Y479 (Sulahian et al., 2009). Celui-ci est ubiquitinilé par -Trcp et clivé par le complexe protéasome (Meyer et al., 2007; Sawyer et al.,

31 1987; Walrafen et al., 2005). L’ensemble formé par les domaines transmembranaire et extracytoplasmique du récepteur et par son ligand est alors internalisé dans des vésicules d’endocytose à clathrine. Une partie de ces vésicules fusionnent avec les lysosomes (Gross and Lodish, 2006; Sawyer et al., 1987). La protéine EPO-R est dès lors dégradée à l’intérieur du lysosome (Beckman et al., 1999; Levin et al., 1998; Neumann et al., 1993; Strous and Gent, 2002; Walrafen et al., 2005).

Figure 13 : Catabolisme de EPO/EPO-R par internalisation dans un lysosome extrait de (Rieu, 2008)

Ainsi, l’expression de surface d’EPO-R est réprimée par catabolisme après quelques minutes et est complète au bout de 15 à 30 minutes de stimulation à l’EPO (Verdier et al., 2000; Walrafen et al., 2005).

o Transduction du signal

Même si ce paragraphe n’a pas de lien avec le sujet de la thèse certains aspects importants sont développés ci-après.

L’activation de la voie EPO/EPO-R va être décisionnelle dans les choix de la cellule durant l’érythropoïèse, car elle entraîne l’activation de molécules impliquées dans la

32 prolifération et la différentiation érythroïde, ainsi que l’activation ou l’expression de molécules anti-apoptotiques (Gross and Lodish, 2006). Tout d’abord, EPO-R coopère avec le récepteur KIT pour réguler la prolifération des progéniteurs érythroïdes. Les études biochimiques ont permis de mettre en évidence 1) l’association physique de EPO-R et KIT entre leurs parties cytoplasmiques ; 2) que l’activation de KIT par SCF, entraîne la phosphorylation sur tyrosines du domaine cytoplasmique d’EPO-R (Wu et al., 1997; Wu et al., 1995). Cette coopération entre KIT et EPO-R requiert l’activation des SRC kinases (Hong et al., 2008; Li et al., 2003; Tan et al., 2003).

Figure 14 : Schéma de synergie entre les voies de EPO et celle du SCF extrait de l’article de (Munugalavadla and Kapur, 2005)

Cette synergie de la voie de l’EPO et du SCF active les MAP kinases (MAPK ERK1/2), contrôlant la prolifération cellulaire (Sui et al., 1998).

La voie EPO/EPO-R se trouve être le ‘‘chef d’orchestre’’ permettant l’engagement de la cellule dans la différenciation érythroïde par la mise en place des molécules spécifiques de l’érythroblaste.

Figure 15 : Schéma de la signalisation de l’EPO-R extrait de l’article de (Munugalavadla and Kapur, 2005) L’EPO se fixe sur EPO-R, ce qui entraîne l’homodimèrisation de ce récepteur et le recrutement des protéines à activité tyrosine kinase JAK2, qui a leur tour, phosphorylent le récepteur sur de multiples résidus tyrosine cytoplasmiques et ses substrats. La stimulation à l’EPO induit un changement de conformation de l’EPO-R qui permet le rapprochement de 2 molécules de JAK2, puis leur trans-phosphorylation. Les JAK2 activées phosphorylent EPO-R (Witthuhn et al., 1993) et entraîne l’activation des voies PI3Kinase, MAP kinases et STAT5. La voie STAT5 est exclusivement activée par EPO-R/JAK2, contrairement à celle des MAP kinases activées par la synergie de l’EPO et du SCF (Sui et al., 1998). La protéine phosphorylée STAT5 contrôle une grande quantité de gènes impliqués dans l’érythropoïèse, tels que GATA-1, hémoglobine !1, "A, "G et 1, CD36 et la GPB (Olthof et al., 2008); il n’est pas encore connu si ces gènes sont des cibles directes de STAT5. La protéine phosphorylée STAT5 agit en synergie avec le facteur de transcription GATA-1 pour le contrôle de l’expression du gène Bcl-XL ce qui a pour effet d’augmenté la survie cellulaire (Silva et al., 1999). Il a été également démontré que STAT5 régule l’absorption du fer par la cellule érythroïde et par conséquent la constitution de l’hême de l’hémoglobine, via l’expression de IRP-2 et de TfR-1 (Kerenyi et al., 2008). La voie PI3kinase/AKT est indispensable à la cellule érythroïde pour la prolifération et la protection contre l’apoptose (Bouscary et al., 2003). Il a été démontré que PI3kinase/AKT phosphoryle un résidu serine 310 de GATA-1 (Kadri et al., 2005; Zhao et al., 2006). GATA-1 est un facteur de transcription spécifique du compartiment érythroïde. Il contrôle et régule l’expression de nombreux gènes érythroïdes tels que tels la GPA, l’Hémoglobine et l’EPO-R, et il est par conséquent indispensable à la différentiation érythroïde. La voie MAPK n’est pas exclusivement activé par l’EPO-R seul, mais résulte de l’activation en synergie des voies de l’EPO et du SCF (Sui et al., 1998).

La voie EPO/EPO-R active un ensemble de voies aussi bien de différenciation érythroïde que anti-apoptotiques.

34 L’EPO a un effet protecteur contre l’apoptose, via 4 voies différentes :

A B C

(3)

(2) (1)

Figure 16 : Représentation des différentes voies anti-apoptotiques activées par l’EPO (Elliott et al., 2008) A. La voie d’activation de STAT5 contrôle l’expression du gène de la molécule anti-apoptotique Bcl-xL B. La voie PI3Kinase, phosphoryle PKB/Akt qui peut soit : (1) inactiver les molécules apoptotiques Bad, caspase9 ou GSK3 (2) phosphoryler le facteur de transcription FOXO TF, ce qui entraîne sa rétention dans le cytoplasme et empêche l’initiation de la transcription de gènes codant pour des protéines apoptotiques telles que FasL, Bim (3) activer le facteur de transcription NF- #B. C. La phosphorylation de I- #B permet la translocation de NF- #B dans le noyau, et lui permet d’initier l’expression de gènes anti-apoptotiques tel que XIAP et c-IAP2. D. L’activation de HSP70 entraîne l’inhibition de molécule apoptotiques telles que Apaf-1 et AIF, et assure aussi la protection du facteur de transcription GATA-1 du clivage des caspases pour la différenciation érythroïde terminale (voir ci-après).

35 Au stade érythroblaste acidophile, la voie EPO/EPO-R et son effet protecteur contre l’apoptose s’arrêtent ce qui alimente l’activation des caspases.

e. L’apoptose lors de l’érythropoïèse

Les mécanismes apoptotiques sont requis lors de la différenciation érythroïde pour aboutir à la maturation terminale des cellules. En effet, l’activation des caspases est essentielle pour permettre la restructuration et l’énucléation de l’érythroblaste lors de la différenciation érythroïde terminale (Zermati et al., 2001). Elles clivent la lamine B et acinus (une protéine activée par clivage), entraînant respectivement la condensation du noyau et de la chromatine des érythroblastes (Ribeil et al., 2005). Cependant, le facteur de transcription GATA-1 (qui active l’expression des gènes de différenciation et de survie de l’érythroblaste) n’est pas clivé par la caspase-3 au cours de la différenciation érythroïde terminale, grâce à l’effet protecteur de HSP70 (Ribeil et al., 2007; Vandekerckhove et al., 2008). Au cours de la différenciation érythroïde, la protéine HSP70 est exprimée de façon constitutive et se localise dans le noyau où elle interagit avec GATA-1. À ce niveau, elle protège ce facteur du clivage par la caspase- 3. D’ailleurs, le sevrage en EPO s’accompagne de la sortie nucléaire d’HSP70, ce qui permet alors à la caspase 3 de cliver GATA-1 et d’induire l’apoptose. Ainsi, l’EPO protège GATA-1 du clivage par la caspase-3 en assurant le maintien de la localisation nucléaire de HSP70, et permet aux cellules érythroïdes de poursuivre leur différenciation. Les mécanismes par lesquels l’EPO induit la rétention d’HSP70 dans le noyau ne sont pas encore élucidés, et pourquoi l’ADN n’est pas clivé au cours de la différenciation érythroïde. Ainsi, la différenciation érythroïde se sert des mécanismes apoptotiques sans aboutir à la mort cellulaire en protégeant le clivage du facteur de transcription GATA-1, essentiel à sa maturation.

36 III. MES TRAVAUX DE RECHERCHE

37 Article 1 : NACA is a positive regulator of human erythroid-cell differentiation

38 Introduction

Contexte scientifique et situation du projet

La compréhension des mécanismes intracellulaires passe par l’étude des différents acteurs moléculaires sollicités lors la différenciation érythroïde.

Le transcrit de NACA est modulé en présence de GM-CSF (Baghdoyan et al., 2000), suggérant que NACA pourrait être important pour maintenir les précurseurs myéloïdes dépendant au GM-CSF au stade prolifératif et réguler leur différenciation. Ce résultat a incité l’équipe à étudier in vitro la fonction de NACA dans la différenciation des différentes sous- classes de cellules myéloïdes (érythroïdes, granulocytaires et mégacaryocytaires).

39 Research Article 1595 NACA is a positive regulator of human erythroid-cell differentiation

Sophie Lopez 1, Laetitia Stuhl 1, Serge Fichelson 2, Anne Dubart-Kupperschmitt 2, René St Arnaud 3, Jean-Rémy Galindo 4, Anne Murati 4, Nicole Berda 5, Patrice Dubreuil 1 and Sophie Gomez 1, * 1UMR599 INSERM, 27 Blvd Leï Roure, 13009 Marseille, France 2Institut Cochin, INSERM U567, CNRS UMR 8104, Université Paris V, Département d’Hématologie, Maternité Port-Royal, 123 Blvd de Port-Royal, 75014 Paris, France 3Genetics Unit, Shriners Hospital, 1529 Cedar Avenue, Montreal, Quebec, H3G 1A6, Canada 4Institut Paoli Calmettes, 232 Blvd de Sainte Marguerite, 13273 Marseille Cedex 9, France 5Hopital fondation Saint-Joseph, Maternité Ste Monique, Blvd de Louvain, 13009 Marseille, France *Author for correspondence (e-mail: [email protected])

Accepted 31 January 2005 Journal of Cell Science 118, 1595-1605 Published by The Company of Biologists 2005 doi:10.1242/jcs.02295

Summary We have previously identiﬁed the transcript encoding Ectopic expression of NACA in CD34 + cells under culture NACA (the α chain of the nascent-polypeptide-associated conditions that induce erythroid-lineage differentiation complex ) as a cytokine-modulated speciﬁc transcript in the leads to a marked acceleration of erythroid-cell human TF-1 erythroleukemic cell line. This protein was differentiation. Moreover, ectopic expression of NACA already known to be a transcriptional co-activator that acts induces erythropoietin-independent differentiation of by potentiating AP-1 activity in osteoblasts, and is known TF-1 cells, whereas downregulation of NACA by RNA to be involved in the targeting of nascent polypeptides. In interference abolishes the induction of hemoglobin this study, we investigate the role of NACA in human production in these cells and diminishes glycophorin-A hematopoiesis. (GPA) expression by CD34 + progenitors cultured under Protein distribution analyses indicate that NACA is erythroid differentiation conditions. Altogether, these expressed in undifferentiated TF-1 cells and in human- results characterize NACA as a new factor involved in the cord-blood-derived CD34 + progenitor cells. Its expression positive regulation of human erythroid-cell differentiation. is maintained during in vitro erythroid differentiation but, in marked contrast, its expression is suppressed during Key words: Erythropoiesis, Cell differentiation, NACA, CD34 + cells,

฀฀฀ their megakaryocytic or granulocytic differentiation. Lentiviral transduction

Introduction factors such as caspases (Zermati et al., 2001) have been The molecular mechanisms that control determination, self- reported to be important for erythropoiesis. Further renewal and differentiation of hematopoietic cells are tightly identification of either novel molecules or complex sets of regulated through both extrinsic and intrinsic signals. One interactions between already-identified crucial transcription example that involves fine-tuned events concerns the factors and co-factors might help to elucidate the molecular differentiation of myeloid lineages. It has been clearly mechanisms that control the myeloid differentiation process. established that myeloid-cell-specific genes are regulated in Towards this end, we had previously performed a study in part by the combinatorial action of multiple crucial, specific the TF-1 human erythroleukemic cell line to identify novel transcription factors present in common hematopoietic specific cytokine-induced genes using a gene-trap strategy progenitor cells as well as by the participation of transcription (Baghdoyan et al., 2000). We thus identified the ubiquitous co-factors (Cantor and Orkin, 2002; Perry and Soreq, 2002; transcript α chain of nascent-polypeptide-associated complex Skalnik, 2002). However, understanding the mechanisms that (NACA) as one of those for which no biological function had direct myeloid-cell development and differentiation might been described so far in hematopoiesis. NACA was initially require further events linking external stimuli and gene- reported in yeast and higher eukaryotes as a heterodimeric expression cascades. As an example, in the erythroid-cell complex that binds newly synthesized polypeptides emerging lineage (a subclass of the myeloid lineages), in addition to the from ribosomes (Lauring et al., 1995; Wiedmann et al., 1994). well-established role of both the erythropoietin/erythropoietin- Further studies revealed that NACA functions as a receptor (Epo/Epo-R) pair and the GATA1 transcription factor, transcriptional co-activator in osteoblasts (Moreau et al., 1998; other extrinsic signaling molecules including Wnt/frizzled Yotov et al., 1998) through an interaction with phosphorylated (Van Den Berg et al., 1998), TGF β (Zermati et al., 2000), c-Jun, a member of the activator-protein-1 (AP-1) family. A fibroblast growth factors (Huber et al., 1998), growth-factor- recent study indicated that NACA also regulates the function independence 1B (Osawa et al., 2002), insulin and insulin-like of the adaptor protein Fas-associated death domain (FADD) growth factor (Miyagawa et al., 2000), and intrinsically acting (Stilo et al., 2003). In addition, it is a target for degradation

40 1596 Journal of Cell Science 118 (8)

mediated by the 26S proteasome GSK3 β (Quelo et al., 2004). (siRNA) sequence designed as described (Elbashir et al., 2001) These data suggest that NACA participates in several protein (purchased from Dharmacon Research). The oligonucleotide complexes playing a role in proliferation, apoptosis or sequence corresponds to residues 116-137 the coding region, degradation, depending on the cellular context and stimuli. relative to the first nucleotide of the start codon, and did match no Because the expression of NACA was modulated in the other genomic sequence except that of the NACA pseudogene presence of granulocyte-macrophage colony-stimulating factor identified in a BLAST search from the NCBI website (http://www.ncbi.nlm.nih.gov/). The irrelevant siRNA was a control (GM-CSF) (Baghdoyan et al., 2000), suggesting a role for (non-silencing) siRNA (Qiagen-Xeragon). Duplex RNA was NACA in the differentiation process of myeloid lineages, we introduced into either TF-1 or CD34 + cells using the transfection addressed the question of the potential role of NACA in the reagent Jet-si (Qbiogene) according to the manufacturer’s protocol. development and differentiation of human myeloid-cell After 3 days in culture conditions supporting erythroid differentiation, subclasses (i.e. erythroid, megakaryocytic and granulocytic TF-1 cells were harvested for either western-blot analysis or benzidine cells). To that end, we examined both the expression pattern staining and CD34 + cells for glycophorin-A (GPA) expression and the effect of NACA overexpression in such cells generated analysis. in vitro from human-cord-blood-derived CD34 + hematopoietic cells. We observed: (i) that NACA is maintained during in vitro Immunofluorescence analysis erythroid differentiation of these cells but that, in marked Cells were fixed with 3% paraformaldehyde on ice for 30 minutes, contrast, its expression is suppressed during their permeabilized in 0.1% saponin, stained for 1 hour at room megakaryocytic or granulocytic differentiation; (ii) that temperature with an anti-NACA antibody (Yotov et al., 1998) (1:1000 enforced expression of NACA in normal hematopoietic dilution), washed and then incubated for 30 minutes with a goat anti- progenitors results in an acceleration of erythroid-cell rabbit antibody conjugated to Texas Red (1:1000 dilution) (Beckman differentiation; and (iii) that, in the TF-1 cell line, a decrease Coulter, Marseille, France). Stained cells were viewed with a confocal of hemoglobin expression correlates with silencing of NACA microscope (Zeiss LSM2). Images were processed for presentation using RNA interference (RNAi). In conclusion, these results using NIH Image and Adobe Photoshop 4.0. suggest that NACA is involved in the positive regulation of human erythroid-cell differentiation. Enrichment of cord-blood CD34 + cells The human CD34 + cells were obtained from umbilical-cord-blood cells (CB) collected after normal full-term deliveries. CB samples Materials and Methods were separated on Ficoll density gradients (lymphocyte separation Culture cell lines and transfection of TF-1 cells medium; Eurobio, Les Ulis, France). Low-density cells were The human erythroleukemic TF-1 cell line was kindly provided by H. recovered and enriched for CD34 + cells using positive Gascan (Angers, France). It corresponds to a subclone of the original immunomagnetic selection with magnetic cell separation (MACS) cell line established by T. Kitamura et al. (Kitamura et al., 1989). technology according to the manufacturer’s recommendations Human myelomonocytic U937 and THP1 cell lines were obtained (Miltenyi Biotec, Bergish Gladbach, Germany). from the ATCC (Rockville, MD). Cells were cultured in RPMI 1640 containing 10% fetal calf serum

฀฀฀ (FCS) (Invitrogen, Life Technologies, Meylan, France), 2 mM L- Construction and production of lentiviral vectors glutamine, 200 IU ml –1 penicillin, and 100 µg ml –1 streptomycin at a The entire open reading frame of NACA was cloned in the lentiviral mean density of 3 ϫ10 5 cells ml –1 in the presence of 5 ng ml –1 TRIP ∆U3-EF1 α vector plasmid (Sirven et al., 2001) between the recombinant human GM-CSF (rhuGM-CSF; Sandoz, Rueil- Bam HI and Kpn I restriction sites, under the transcriptional control of Malmaison, France) for the TF-1 cell line or in the absence of cytokine the EF1 α ubiquitous promoter sequence, to generate the NACA- for U937 and THP1 cell lines. Cultures were maintained at 37°C in a lentiviral vector. Lentiviral particles were produced as described humidified 5% CO 2 atmosphere. (Sirven et al., 2001). Briefly, the vector plasmids (either NACA or Induction of TF-1-cell monocyte differentiation was performed by EGFP control) were introduced into 293-T cells, together with an a 24-hour exposure to 1 ng ml –1 rhuGM-CSF and 10 nmole l –1 phorbol encapsidation plasmid (p8.91) lacking the Vif, Vpr, Vpu and Nef 12-myristate acetate (PMA) (Sigma, Saint Quentin Fallavier, France). accessory HIV-1 proteins, and a vesicular stomatitis virus (VSV) The presence of hemoglobin in TF-1 cells that had differentiated protein-envelope-expression plasmid (pHCMV-G) by transient into erythroid cells was determined by benzidine staining according calcium-phosphate co-transfection. The concentrations of lentiviral to the technique described by Graham and Karnovsky (Graham and particles were normalized by measuring the p24 (HIV-1 capsid Karnovsky, 1966). protein) content of the supernatants. For transfection experiments, the entire open reading frame of NACA was cloned in the bicistronic retroviral LZRS vector plasmid + (Michiels et al., 2000) between the Bam HI and the Kpn I restriction Transduction of CD34 cells with lentiviral vectors sites to generate the NACA-IRES-EGFP LZRS vector, which was 10 6 CD34 + cells ml –1 were plated in 96-well plates in Iscove-modified used to transfect the cells using the DMRIE-C reagent according to Dulbecco medium (IMDM; BioWhittaker Europe, Belgium), the manufacturer’s recommendations (Invitrogen, Life Technologies, supplemented with 20% BIT 9500 [mixture of bovine serum albumin Meylan, France). Transfected cells were cultured for 48 hours in the (BSA), insulin and transferrin (Stem Cell Technologies, Meylan, presence of rhuGM-CSF, sorted by fluorescence-activated cell sorting France)], 2 mM L-glutamine, 200 IU ml –1 penicillin, and 100 µg ml –1 (FACS) on the basis of their enhanced green fluorescent protein streptomycin, 80 ng ml –1 recombinant human stem cell factor (EGFP) expression [EGFP positive (+) and EGFP negative (–)], and (rhuSCF; Amgen, Thousand Oaks, CA), 10 ng ml –1 thrombopoietin then cultured for 24 additional hours in the presence of GM-CSF. (TPO), pegylated recombinant human megakaryocyte growth and development factor (rhuPEG-MGDF) (Amgen), 100 ng ml–1 Flt3 ligand (rhuFlt3-L; DNAX, Palo Alto, CA) and 60 ng ml–1 recombinant NACA gene silencing by RNAi human interleukin-3 (rhuIL-3; R&D Systems Europe, UK). NACA suppression was performed using a small interfering RNA Transduction was performed with either NACA or EGFP lentiviral

41 NACA inﬂuences erythropoiesis 1597

vector particles added at a concentration corresponding to 2500 ng β2 microglobulin transcript was assessed using the forward primer 5 ′- p24 per ml (Amsellem et al., 2002). After 24 hours at 37°C, a second CCAGCAGAGAATGGAAAGTC-3 ′ (contained in the first exon of set of particles was added to the cultures. After an additional 48-hour the gene) and the reverse primer 5 ′-GATGCTGCTTACATGTCTCG- period, cells were harvested by centrifugation, washed and then 3′ (contained in the second exon of the gene). The size of the amplified cultured in conditions that support cell differentiation as described product was 268 bp. The products were electrophoresed on 1.2% below. agarose gel. For detection and relative quantification of mRNA levels of endogenous NACA, a LightCycler (Roche Diagnostics, Mannheim, + CD34 cell differentiation Germany) was used according to the manufacturer’s instructions, Erythroid cells were generated from CD34 + cells cultured in either mRNA encoding glyceraldehyde-3-phosphate dehydrogenase RTM (MABIO-International, Tourcoing, France) or IMDM, (GAPDH) served as an external control. PCR reactions were supplemented with 20% BIT 9500, 2 mM L-glutamine, 200 IU ml –1 performed with a LightCycler FastStart DNA Master SYBR Green penicillin, 100 µg ml –1 streptomycin, 10 ng ml –1 rhuIL-3, 25 ng ml –1 PCR Kit (Roche Diagnostics, Mannheim, Germany). PCR was carried rhuSCF and 10 ng ml –1 rhuIL-6. 2 IU ml –1 recombinant human out in a final volume of 20 µl, with each primer at 0.5 µM, 3 µM erythropoietin (rhuEpo) was added at day 7 and cultures were carried MgCl 2, 2 µl supplied enzyme mix containing the reaction buffer, on for 7 additional days to achieve terminal red-cell differentiation as FastStart Taq DNA polymerase and DNA double-strand-specific already described (Freyssinier et al., 1999). SYBR Green I dye in a LightCycler with a 10 minute preincubation at Megakaryocytic cells were generated from CD34 + cells cultured for 95°C, followed by 40 cycles of 15 seconds at 95°C, 28 seconds at up to 14 days in IMDM, 20% BIT 9500, 2 mM L-glutamine, 200 IU 60°C and 26 seconds at 72°C. The following primers were used: ml –1 penicillin, 100 µg ml –1 streptomycin containing TPO at a final GAPDH-specific forward primer 5 ′-GTCATCCCTGAGCTAGA- concentration of 50 ng ml –1 and 5 ng ml –1 rhuSCF. CGG-3 ′ and reverse primer 5 ′-GGGTCTTACTCCTTGGAGGC-3 ′; Granulocytic cells were generated from CD34 + cells cultured in NACA-specific forward primer 5 ′-GGTCTGGAACAGAATCT- RTM supplemented with 20% BIT 9500, 2 mM L-glutamine, 200 IU GACAGTGATGAATC-3 ′ and reverse primer 5 ′-AGCTGCAGT- ml –1 penicillin, 100 µg ml –1 streptomycin containing 10 ng ml –1 TACTCCTTTGAGACA-3 ′. Analyses of quantitative real-time PCR rhuIL-3, 10 ng ml –1 rhuSCF, 15 ng ml –1 recombinant human curves were performed by absolute quantification at 530 nm by the granulocyte colony-stimulating factor (rhuG-CSF; Neupogen, LightCycler 4.0 software. The GAPDH control reflected the amount Amgen) and 50 ng ml –1 rhuFlt3-L for 14 days. of target mRNA in each sample.

Cytochemistry Flow cytometry analysis

Cell cultures were maintained at 37°C in a humidified 5% CO 2 Cells were stained with a fluorescein-isothiocyanate (FITC)-coupled atmosphere at a mean density of 3 ϫ10 5 cells ml –1 . For microscope CD34 monoclonal antibody (mAb) (Beckman Coulter, Marseille, examination, cells were recovered, cytospun onto a slide glass and France) for the identification of progenitor cells, an anti-glycophorin- then subjected to May-Grunwald-Giemsa staining. A mAb coupled to phycoerythrin (GPA-PE) (Beckman Coulter, Marseille, France) for the identification of erythroid cells, an anti- CD42b-PE mAb or an anti-CD61 mAb coupled to cyanin-5 (Cy5) for PCR analysis of vector integration megakaryocytes (BD Biosciences, Heidelberg, Germany) and an anti- Integration of the vector into the cellular genome was analysed by CD15-PE mAb for granulocytic cells. Isotypic controls were

฀฀฀ PCR on genomic DNA extracted from cells cultured for 10 days under performed with the same sets of cells. Cells were then subjected to conditions that promote granulocytic differentiation. Amplification of FACS scanning analysis using a FACS Vantage (Becton Dickinson, genomic DNA was performed on whole-cell extracts with primers Mountain View, CA). Control cells were used to set the FACS gains that amplify part of the EF1 α sequence (5 ′-ATCCACTTT- and analysis gates. Cells were analysed according to side scatter, GGCTGATACGC-3 ′) as the forward primer and part of NACA (5 ′- forward scatter, FITC and PE characteristics. CTCGAGCCAGCACACTGGATCAGTTATC-3 ′) as the reverse primer. Amplification was performed for 35 cycles at an annealing temperature of 57°C, producing a 1200-bp PCR product. Western blot analysis Cells were harvested and resuspended in lysis buffer [1% NP-40, 50 mM Tris-HCl, pH 7.5, 150 mM sodium chloride, 2% v/v protease Detection of NACA transcript by reverse-transcription PCR inhibitor cocktail (0.02 mg ml –1 pancreas extract, 0.02 mg ml –1 For reverse-transcription PCR (RT-PCR), mRNA from cells cultured chymotrypsin, 5 ϫ10 –4 mg ml –1 thermolysin, 0.02 mg ml –1 trypsin, under granulocytic differentiation conditions for 10 days was 0.33 mg ml –1 papain) (Roche Diagnostics, Mannheim, Germany)]. extracted using the µMACS mRNA isolation kit (Miltenyi Biotec, Protein concentration of lysates was determined with a Bio-Rad Bergish Gladbach, Germany), treated with DNAse I (Boehringer protein assay kit (Bio-Rad, Marnes-la-Coquette, France) according to Mannheim, Roche Diagnostics, Meylan, France) and was reverse the manufacturer’s recommendations, using BSA as a standard. transcribed with the SuperScript II RNase H-Reverse Transcriptase 20 µg proteins from extracts (total lysate) were resolved by 10% (Life Technologies, Invitrogen, Cergy Pontoise, France) according to SDS-PAGE and transferred onto nitrocellulose membrane the manufacturer’s instructions, using a random primer poly-d(T) 12-18 (Amersham, Arlington Heights, IL). The membranes were probed (Amersham Pharmacia Biotech). For the S-tagged-NACA PCR, 5 µl with a rabbit anti-NACA immune serum (Yotov et al., 1998) followed cDNA were taken from the reverse transcription reaction and samples by an anti-rabbit immunoglobulin (Ig)-coupled to horseradish were submitted to 35 cycles of PCR in a Perkin-Elmer thermal cycler peroxidase (HRP) (Jackson ImmunoResearch Laboratories, (Perkin-Elmer, Norwalk, CT) using 30 seconds of denaturation at Baltimore, MD). Antigen detection was visualized by using the super 94°C, 30 seconds of annealing at 57°C and 1 minute of elongation at signal west pico chemiluminescence system (Perbio Science, Pierce, 72°C. A final elongation step was performed for 7 minutes at 72°C. France). The primers used were: 5 ′-AGATCTCGCGCTAGCTAAGCTTC- After signal extinction, membranes were probed again with a CACCATG-3 ′ (forward) and 5 ′-CTCGAGCCAGCACACTG- mouse anti-Grb2 or a rabbit anti-phosphoinositide-3-kinase-p85 GATCAGTTATC-3 ′ (reverse), amplifying a product of 1029 bp from immune serum (Santa Cruz Biotechnology, Heidelberg, Germany). the NACA-encoding gene. To monitor the efficiency of the reactions, For ectopic expression of S-tagged-NACA, 3 ϫ10 7 cells were lysed.

42 1598 Journal of Cell Science 118 (8)

Fig. 1. Selective persistence in NACA protein expression during erythroid versus mono/macrophagic differentiation of TF-1 cells. Western-blot analyses were performed on THP1 and U937 cells cultured under standard conditions or on TF-1 cells cultured either for 24 hours in the presence of PMA and GM-CSF or for 3-5 days in the presence of Epo. Cells were harvested at the indicated times of culture and cell extracts taken. 20 µg total protein extracts were separated by 9% SDS-PAGE and analysed by western blot. Membranes were probed with a polyclonal immune serum against NACA and then probed again with an antibody against the p85 subunit of the phosphoinositide-3-kinase.

Lysates were incubated for 2 hours with 10 µl protein-S-coated beads and retained proteins were resolved by 10% SDS-PAGE and then western blotted.

Results Expression of NACA in TF-1 cells cultured under either erythroid or monocytic differentiation conditions We had previously identiﬁed the NACA-encoding gene as a cytokine-modulated gene in the erythroleukemic TF-1 cell line. In order to investigate the regulation of NACA in hematopoietic cells, we examined the expression of NACA in the TF-1 cell line under various culture conditions. This cell line offers the advantage that it proliferates when cultured in the presence of GM-CSF and differentiates into hemoglobin- positive cells when cultured in the presence of Epo for several days. It also undergoes monocyte/macrophage differentiation when exposed to PMA (Kitamura et al., 1989; Hoang et al., 1996). We observed that, when exposed to PMA, TF-1 cells displayed a marked underexpression of NACA (Fig. 1) ฀฀฀ compared with the same cells cultured without PMA (basal expression). In addition, similar NACA expression could be detected in other monocyte/macrophage cell lines such as THP1 and U937 (Fig. 1). By contrast, when TF-1 cells were triggered to erythroid differentiation in the presence of Epo, NACA expression was maintained (or slightly enhanced) in the long term during the erythroid differentiation course (Fig. 1). These data indicate that NACA is preferentially maintained during erythrocytic differentiation of the TF-1 cells, whereas it is downregulated during monocyte/macrophage differentiation. Fig. 2. Enforced expression of NACA induces erythroid Enforced expression of NACA in TF-1 cells induces Epo- differentiation of TF-1 cells in the absence of Epo. TF-1 cells were transfected with NACA-IRES-EGFP vector plasmid and cultured for independent erythroid differentiation 48 hours in the presence of GM-CSF. Cells were then sorted by The effect of NACA in the TF-1 cells was also examined using FACS (10 5 EGFP-positive and EGFP-negative cells were collected) ectopic expression of the molecule. Cells cultured with GM-CSF and benzidine stained. (A) Fluorescence imaging showing 2% of the were transfected with a retroviral vector that drives the EGFP-positive cells obtained after transfection with the NACA- expression of both NACA and EGFP from a single bicistronic IRES-EGFP vector plasmid. (B) Benzidine staining of sorted cells transcript (Michiels et al., 2000). The efficiency of this (EGFP-positive and EGFP-negative) performed 24 hours after EGFP transfection was about 2% (Fig. 2A). EGFP-positive (+) cells sorting. Hemoglobinized cells stain dark blue. The proportion of (about 10 5 cells per transfection experiment) were selected by benzidine was quantiﬁed after counting 200 cells. 80% of the sorted cells were benzidine stained (mean from three different experiments). cell sorting then cultured in the presence of GM-CSF for 24 hours. Among such sorted NACA-transfected cells, 80% were benzidine stained, indicating hemoglobin production in an Epo- Silencing of NACA by RNAi results in a reduction of the independent manner (Fig. 2B). These data strongly argue in favor Epo-induced hemoglobin expression in TF-1 cells of a role for NACA in the erythroid differentiation of TF-1 cells. In order to examine whether silencing the NACA-encoding

43 NACA inﬂuences erythropoiesis 1599

Fig. 3. Effect of suppression of NACA by RNAi on hemoglobin expression in TF-1 cells. (A) Confocal pictures of cells grown in Epo either ฀฀฀ mock-treated or treated with a specific siRNA for NACA or an irrelevant siRNA, and then stained. (bottom right) Phase-contrast magnification of the cells treated with specific siRNA for NACA (top right). (B) SDS-PAGE western blots of TF-1 cells grown in Epo either mock-treated or treated with a siRNA specific for NACA or an irrelevant siRNA. Cell lysates were resolved by SDS-PAGE, transferred to nitrocellulose then probed with an antibody specific for NACA (bottom) or a monoclonal antibody specific for the p85 sub-unit of the PI3-kinase (top). (C) A benzidine-staining assay was performed on cells cultured for either 3 days or 7 days under various conditions. The pictures show representative microscope fields of benzidine-stained cells when mock-treated and then cultured for either 3 days or 7 days in the presence of Epo alone (no siRNA) or transfected in the presence of Epo with either an irrelevant siRNA (control siRNA) or a specific siRNA for NACA (NACA siRNA). Histogram represents the corresponding proportions (±s.d.) of benzidine-stained cells when mock-treated were then cultured in the presence of either Epo alone (1) or transfected in the presence of Epo and either an irrelevant siRNA (2) or a specific siRNA for NACA (3) obtained from three independent experiments. 200 total cells were counted in each of the three independent experiments.

gene would have an effect on erythroid-cell differentiation, we that synthesized hemoglobin compared with the number of performed gene-silencing experiments on TF-1 cells cultured cells that displayed unchanged level of NACA, when cultured in the presence of Epo. Confocal analysis (Fig. 3A) showed in the presence of Epo (3.8% vs 12%, respectively) (Fig. 3C). that NACA was no longer detectable within the cells After additional days of culture in the presence of Epo, the transfected with the siRNA duplexes chosen to selectively NACA siRNA effect was abolished and hemoglobin synthesis inhibit NACA expression. In addition, the proportion of TF-1 was restored in the treated cells. A maximum of 50% cells targeted with the siRNA duplexes was high as assessed hemoglobin-positive cells was reached at day 7 in treated and by the number of cells where NACA was no more detected. untreated cells (Fig. 3C, right). These results indicate that the Western-blotting analyses (Fig. 3B) clearly showed that a 3- downregulation of NACA impairs hemoglobin production by day treatment of these cells with a speciﬁc siRNA for NACA TF1 cells. caused a profound decrease in NACA protein production. In control groups, consisting of mock-transfected cells or cells transfected with an irrelevant siRNA, the NACA protein level Expression of NACA in human cord-blood cells is remained unchanged. The reduction of the level of NACA was restricted to CD34 + cells and to the erythroid-cell lineage accompanied by a dramatic drop in the number of TF-1 cells In order to examine the role of NACA in cord-blood-derived

44 1600 Journal of Cell Science 118 (8) ฀฀฀ Fig. 4. Selective persistence of NACA production during erythroid versus megakaryocytic or granulocytic differentiation of CD34 + cells. (A) Western-blot analyses were performed on CD34 + cells: (0) immediately after immunomagnetic purification; (2) after culture for 2 days; (6) after six days under expansion conditions. Alternatively, the western blot was performed after culture under conditions optimized for the cell growth and maturation of: erythroid (days 7+2, 7+5, 7+7, where day 7 corresponds to the end of the first Epo-free phase of the culture; Epo was added at day 7 and additional day numbers correspond to the duration of culture in the presence of Epo); megakaryocytic (days 6, 7, 10, 12, 14); granulocytic (days 6, 7, 14). Cells were harvested at the indicated times of culture. 20 µg total protein extracts were separated by 9% SDS- PAGE and analysed by western blot. Membranes were probed with a polyclonal immune serum against NACA and then probed again with an antibody against the ubiquitously expressed Grb2 adaptor. A result typical of those obtained from three different cell cultures is shown. Arrows indicate the molecular-weight markers. (B) Flow-cytometry analysis of CD34, GPA, CD42b, CD61 and CD15 surface-marker expression on cells either immediately following CD34 + purification (D0) or after 6 days of culture (D6) in expansion conditions, or after 10 days of culture in conditions optimized for erythroid, megakaryocytic or granulocytic growth and maturation, respectively. Bold profiles represent the fluorescence distribution of an isotype-matched control antibody. (C) Quantitative real-time RT-PCR analysis of NACA expression performed on mRNA from CD34 + cells either after 3 days or 6 days of culture under expansion conditions or after 10 days of culture under conditions optimized for erythroid, megakaryocytic and granulocytic growth and maturation, respectively. The expression of NACA transcript is expressed as a ratio relative to the expression of GAPDH.

normal cells, we studied the cell speciﬁcity of NACA observed NACA production in the primary human expression in human primary CD34 + progenitor cells expanded hematopoietic CD34 + progenitors and throughout the ex vivo and the same cells induced to differentiate along the successive stages of erythroid-cell differentiation, from erythroid, the megakaryocytic or the granulocytic lineage (Fig. progenitors (days 7 to 7+2) to mature erythroblasts and 4A). Growth and maturation of the cells were examined by erythrocytes (day 7+7). By contrast, NACA production was studying the cell-surface markers CD34 (hematopoietic abolished early during megakaryocytic and granulocytic progenitors), GPA (erythroid cells), CD42b and CD61 differentiation, whereas NACA-encoding transcript was still (megakaryocytic cells), and CD15 (granulocytic cells) (Fig. detected in these differentiated cells (Fig. 4C) after 10 days of 4B). Cell extracts were analysed for the presence of NACA culture. These results indicate that NACA production is tightly protein by western blotting. Under these conditions, we regulated during hematopoiesis. Its high production level,

45 NACA inﬂuences erythropoiesis 1601

Fig. 5. Detection of ectopic expression of either NACA (S-tagged-NACA) or EGFP proteins or transcripts in transduced CD34 + cells cultured under erythroid and granulocytic differentiation conditions. 72 hours after the initiation of the transduction with NACA or EGFP lentiviral vector, CD34 + progenitor cells were cultured for 10 days under conditions optimized for erythroid or granulocytic cell growth and maturation. ฀฀฀ Cells were then harvested and the presence of the proteins or transcripts was examined. (A) Ectopic expression of NACA or EGFP proteins. The proteins from cell lysates, either enriched on protein-S beads (for S-tagged-NACA protein detection) or not (for the EGFP protein detection) were detected by western-blot analysis with either an anti-NACA or an anti-EGFP immune serum. Lysates were tested for their total protein content using an antibody against the Grb2 adaptor protein. (B) Time-course analysis of EGFP expression during granulocytic differentiation of CD34 + infected cells. Cells were cultured for up to 10 days under conditions optimized for granulocytic growth and maturation. The EGFP expression was analysed at 3 days and 10 days of culture by ﬂow cytometry. Positive EGFP ﬂuorescence (gate M1) is set according to the untransduced control cells. ‘%’ indicates the proportion of EGFP-positive cells. (C) PCR Detection of genomic integrations of the lentiviral TRIP ∆U3-EF1 α-S-tagged-NACA vector in the granulocytic cells. PCR was performed on cells collected after 10 days of culture under conditions that encourage granulocytic growth and maturation using a sense primer in the EF1 α promoter and an antisense primer at the 3 ′ end of the NACA-encoding cDNA. (D) RT-PCR detection of the transcript encoding S-tagged-NACA in granulocytic cells. RT-PCR was performed on cDNA templates obtained from cells collected after 10 days of culture in conditions that encourage granulocytic growth and maturation using a sense primer in the S-tagged sequence and an antisense primer in the 3 ′ end of the NACA sequence. (C,D) Products were electrophoresed on 1.2% agarose gels and visualized by ethidium-bromide staining. ‘Mix’ represents the negative control without template. Gr, granulocytic cells.

present in hematopoietic progenitor cells, persists during at its N-terminus with an S-tag sequence. CD34 + cells were erythroid differentiation. transduced by this lentiviral vector or the EGFP control vector and then cultured under conditions that trigger either erythroid- or granulocytic-cell differentiation. These two cell lineages NACA overproduction in cord-blood CD34 + cells induces were chosen both for their distinct NACA expression and for acceleration of erythroid differentiation in vitro the high number of cells that can be obtained in liquid culture In order to explore further the putative role of NACA in the (by comparison with megakaryocyte culture). Transduction of behavior of normal progenitor cells, we looked at the effect of the cells by the S-tagged-NACA lentiviral vector was assessed NACA overproduction in human CD34 + cells. For that by western-blot detection of NACA after enrichment of the purpose, we engineered the lentiviral TRIP ∆U3-EF1 α-S- ectopic protein (Fig. 5A). Surprisingly, although the expression tagged-NACA vector (Sirven et al., 2001; Amsellem et al., of EGFP was maintained along the granulocytic differentiation 2002), which contains the coding sequence of NACA tagged process (Fig. 5A, middle, B), no ectopic S-tagged-NACA

46 1602 Journal of Cell Science 118 (8)

A yaD 5 yaD 7 yaD 9 Fig. 6. Flow-cytometry analysis of GPA surface expression in NACA- and EGFP- transduced CD34 + cells along differentiation of the erythroid lineage. 72 hours after the initiation of transduction, CD34 + cells were cultured under conditions optimized for erythroid-cell growth and maturation. Cell 1M 1M 1M suspensions were stained at the indicated days of culture [day 5 (D5), day 7 (D7) and day 9 (D9)] with an anti-GPA-PE mAb and analysed by flow cytometry for cell-surface expression of GPA. (A) Unfilled profiles EP-APG represent GPA expression by EGFP- transduced cells and filled profiles represent GPA expression by NACA-transduced cells. Isotype-matched control mAb was used in all )%( sllec EP-APG sllec )%( experiments to set the parameters for B analysis. Positive GPA fluorescence (gate 5 yaD 5 yaD 7 yaD 9 M1) is set according to the isotype-matched control mAb. One representative experiment lortnoC PFGE lortnoC 03 7.94 7.18 out of three performed is shown. (B) Results are expressed as the proportion of GPA cell- ACAN 5.17 8.67 8.78 surface-marker-positive cells present in the cell culture.

protein was detected in the granulocytic cells. Nevertheless, the revealed that NACA-transduced cells are characterized by a integrated S-tagged NACA gene was present in the genome higher number of mature erythroblasts (Fig. 7) in comparison (Fig. 5C) and was transcribed as shown in Fig. 5D using RT- with the GFP-transduced cells, which contain more immature PCR analysis of the mRNA of these cells. These results erythroblasts (i.e. 45% acidophilic erythroblasts versus 4%, indicate that the ectopic expression of NACA cannot be respectively) (Fig. 7). These results demonstrate that the maintained in the granulocytic cells, a cell lineage in which transduction of NACA both accelerates erythroid maturation of downregulation of the endogenous NACA protein is also cells and increases the number of erythroid-cell-specific GPA observed (Fig. 4). By contrast, the ectopic form of the protein molecules. was detected in cells grown under erythroid differentiation In the absence of Epo, transduction of NACA in CD34+ conditions (Fig. 5A, top). Transduction of NACA in CD34 + cultures had no effect on the expression of the GPA marker. ฀฀฀ cord-blood cells further cultured under erythroid The cells expressed similar level of GPA when transduced with differentiation conditions did not change their ability to either NACA or GFP and died after 7 days of culture (data not proliferate because the absolute number is similar by either shown). NACA or EGFP transduction (result not shown). Interestingly, an early effect of NACA was revealed by the number of cells that expressed the erythroid-cell- specific cell-surface marker GPA (Fig. 6A,B). Indeed, 5 days after transduction, the total number of GPA- positive cells was strongly enhanced (when compared with similar cultures initiated with control EGFP- transduced cells; 71.5% vs 30%) (Fig. 6B). The mean value of fluorescence intensity detected in these cells was twice as high, indicating an increased number of GPA molecules at the surface of the NACA-transduced cells (data not shown). In addition, cytological analysis

Fig. 7. Morphological characterization of either NACA- or EGFP-transduced CD34 + cells cultured in erythroid differentiation conditions. Pictures represent May-Grunwald- Giemsa staining of either EGFP- or NACA-transduced cells cultured for either 7 days or 12 days under erythroid differentiation conditions. The table indicates the proportion of proerythroblasts and basophilic, polychromatophilic and acidophilic erythroblasts in these transduced cells. Different cell types were quantiﬁed after counting a total of 200 cells per experiment (mean of three different experiments).

47 NACA inﬂuences erythropoiesis 1603

Ris on Ris NA NACA is R NA lortnoc is NR A

59.02 % 53.6 % 73.22 %

1R 1R 1R

GPA

Fig. 8. Effect of siRNA on the GPA cell-surface expression of CD34 + cells cultured in erythroid differentiation conditions. CD34 + progenitor cells were cultured for 3 days under conditions optimized for erythroid-cell growth and maturation in the presence of either an siRNA specific for NACA or an irrelevant siRNA. The GPA cell-surface marker was analysed by flow cytometry in the absence of siRNA duplexes (left), in the presence of an siRNA specific for NACA (center) and in the presence of an irrelevant siRNA (right). The numbers (insert) correspond to the proportion of GPA-positive cells.

Effect of NACA-specific RNAi on CD34 + cells cultured in reduces the extent of Epo-dependent hemoglobinization of TF- conditions that support erythroid differentiation 1 cells and the number of CD34 + progenitors that produce the The efficiency of siRNA transfection is low in CD34+ cells, Epo-dependent marker GPA. Altogether, we thus conclude making it difficult to analyse either the protein-extinction or that NACA is a crucial positive regulator of erythroid-cell the cytological characteristics of the cells after transfection. differentiation. However, CD34 + cells cultured under conditions that support Whether NACA is acting at the level of erythroid-cell- erythroid differentiation with an siRNA specific for NACA lineage determination or the level of maturation of already caused a significant threefold decrease in the number of cells committed cells remains an important question. The enforced expressing the erythroid marker GPA (6.35% vs 20.95%) (Fig. production of NACA did not affect the number of either 8) in comparison with untreated cells. These results suggest a erythroid cells or BFU-E (burst-forming unit-erythroid) ฀฀฀ functional correlation between the expression of NACA and generated by NACA- or EGFP-transduced CD34 + progenitor the erythroid marker GPA on CD34 + cells. cells grown (respectively) under erythroid or semi-solid- culture conditions. These results do not support a role for NACA in erythroid-cell-lineage determination of already Discussion committed cells but, by contrast, NACA-transduced cells in The rationale of this study was to investigate the putative role culture undergo accelerated erythroid differentiation processes. of NACA in hematopoietic-cell differentiation. NACA was This acceleration is evidenced by the higher GPA expression initially identified as being encoded by a cytokine-responsive levels as well as by the higher proportion of matured cells gene (Baghdoyan et al., 2000). In this study, we propose a new observed at early times of culture and a clear early role for NACA as a regulator of erythroid differentiation. First, hemoglobinization of the colonies derived from the NACA- we showed that the NACA production level is selectively transduced cells (data not shown). However, once maintained during erythroid-cell differentiation, whereas it is differentiated, mature erythroid cells generated in the presence downregulated during cell differentiation towards other or absence of enforced NACA production are morphologically lineages. This is observed both in the human TF-1 leukemic undistinguishable. Besides, although the enforced expression cells during erythroid versus granulocytic differentiation and of NACA appears to be sufficient to induce the Epo- in primary CD34 + human progenitor cells during erythroid independent differentiation of TF-1 cells, this is not the case versus megakaryocytic or granulocytic differentiation. In for native CD34 + multipotent progenitor cells, which still addition, the production of NACA is also maintained in MEL require the presence of Epo to differentiate towards the cells (a mouse erythroleukemic cell line) when cultured in erythroid lineage. This result favors the hypothesis that NACA erythroid conditions (result not shown) and downregulated in is acting at the level of erythroid-cell maturation rather than at monocyte/macrophage cell lines such as THP1 and U937. the level of erythroid-cell-lineage determination of already More importantly, functional studies showed that enforced committed cells. The Epo-dependence or -independence could expression of NACA is sufficient to induce the Epo- be explained by the fact that Epo-independent differentiation independent hemoglobinization of TF-1 cells, as well as to of TF-1 cells might be a consequence of the activation of an accelerate the Epo-dependent erythroid differentiation of alternative pathway because of a higher level of NACA CD34 + progenitors. Finally, we found that the use of RNAi produced via transfection of TF-1 cells than the level of NACA

48 1604 Journal of Cell Science 118 (8)

produced via lentiviral infection of normal CD34 + cells. to distinguish between these and other possible mechanisms to However, a reasonable hypothesis would also take into account understand the function of NACA in erythroid-cell maturation. the fact that TF-1 is a leukemia-derived cell line predisposed We believe that the identification of protein partners of NACA to the erythroid-cell lineage and that has probably already in erythroid cells will be a definitive step towards this goal. undergone erythroid-specific differentiation genetic events On the whole, this study demonstrates the unexpected during the leukemic process. By contrast, in normal cells, crucial role of NACA in erythroid-cell maturation. New NACA might be involved at a step that requires Epo for challenges are now to identify the upstream and downstream differentiation and/or maturation. Based on all these data, we pathways that are involved in this new function of NACA. conclude that NACA is a crucial limiting factor that is required for erythroid-cell maturation. We thank B. Izac for the production of lentiviral vector stocks, J.- Although the NACA-encoding transcript appeared to be M. Freyssinier, V. Forestier and C. Scifo for technical assistance, and slightly downregulated in the differentiated cells, they were N. Casadevall for generous gift of Epo. We also thank F. Morle and I. Dusanter for helpful discussion and comments, and all the team of detected in the three studied cell lineages, whereas NACA the Maternité Ste Monique for the cord-blood collection. S.L. is a protein was only detected in erythroid cells. Unexpectedly, recipient of a postdoctoral fellowship from the Ligue Nationale whereas exogenous NACA transcripts could be detected in Contre le Cancer. L.S. is a recipient of a predoctoral fellowship from both erythroid and granulocytic differentiated infected cells, the Ministère de l’Industrie et de la Recherche. This work was exogenous NACA protein could only be detected in erythroid supported in part by funds from INSERM (Institut National de la differentiated cells. Thus, in addition to the discovery of a new Santé et de la Recherche Médicale) and by the Ligue Nationale contre function of NACA in erythroid-cell maturation, this study also le Cancer (LNCC). demonstrates a strikingly different regulation of the NACA protein in erythroid versus granulocytic or megakaryocytic differentiated cells. The mechanism of this regulation References Amsellem, S., Ravet, E., Fichelson, S., Pflumio, F. and Dubart- might involve protein-protein interactions and/or protein Kupperschmitt, A. (2002). Maximal lentivirus-mediated gene transfer and modifications. Given the recent evidence for the involvement sustained transgene expression in human hematopoietic primitive cells and of GSK3 β kinase in the regulation of proteasomal degradation their progeny. Mol. Ther . 6, 673-677. of NACA (Quelo et al., 2004), it would be interesting to Baghdoyan, S., Dubreuil, P., Eberle, F. and Gomez, S. (2000). Capture of determine the importance of the proteasome-mediated cytokine-responsive genes (NACA and RBM3) using a gene trap approach. Blood 95 , 3750-3757. downregulation of NACA in granulocytic and megakaryocytic Brand, M., Ranish, J. A., Kummer, N. T., Hamilton, J., Igarashi, K., cells, and of its maintenance in erythroid cells. Francastel, C., Chi, T. H., Crabtree, G. R., Aebersold, R. and Groudine, In addition to this post-translational modification as a M. (2004). Dynamic changes in transcription factor complexes during possible molecular mechanism for the contribution of NACA erythroid differentiation revealed by quantitative proteomics. Nat. Struct. Mol. Biol . 11 , 73-80. in erythroid-cell differentiation, several possibilities arise from Cantor, A. B. and Orkin, S. H. (2002). Transcriptional regulation of the previously reported activities of NACA. As a subunit of the erythropoiesis: an affair involving multiple partners. Oncogene 21 , 3368- nascent-polypeptide-associated complex (NAC) (Lauring et 3376. al., 1995; Wiedmann et al., 1994), NACA influences the Elagib, K. E., Xiao, M., Hussaini, I. M., Delehanty, L. L., Palmer, L. A., ฀฀฀ targeting of polypeptides devoid of signal peptide. As a Racke, F. K., Birrer, M. J., Shanmugasundaram, G., McDevitt, M. A. and Goldfarb, A. N. (2004). Jun blockade of erythropoiesis: role for consequence of the association of NACA at the surface of the repression of GATA-1 by HERP2. Mol. Cell. Biol . 24 , 7779-7794. ribosomes, these proteins do not undergo rough-endothelial- Elbashir, S. M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K. and reticulum processing and therefore retain a cytosolic Tuschl, T. (2001). Duplexes of 21-nucleotide RNAs mediate RNA localization. Both Epo and Epo-R that exhibit a signal peptide interference in cultured mammalian cells. Nature 411 , 494-498. Fontenay-Roupie, M., Bouscary, D., Guesnu, M., Picard, F., Melle, J., should not be influenced by the presence of NACA. However, Lacombe, C., Gisselbrecht, S., Mayeux, P. and Dreyfus, F. (1999). the possibility cannot be excluded that this mechanism is Ineffective erythropoiesis in myelodysplastic syndromes: correlation with involved in the cytosolic retention of other factors important Fas expression but not with lack of erythropoietin receptor signal for erythroid cell maturation. NACA is also known as a co- transduction. Br. J. Haematol . 106 , 464-473. activator of c-JUN-mediated transcription in developing bone Freyssinier, J. M., Lecoq-Lafon, C., Amsellem, S., Picard, F., Ducrocq, R., Mayeux, P., Lacombe, C. and Fichelson, S. (1999). Purification, during embryogenesis (Moreau et al., 1998; Quelo et al., amplification and characterization of a population of human erythroid 2002). However, because c-JUN behaves as a negative progenitors. Br. J. Haematol . 106 , 912-922. regulator of erythropoiesis (Elagib et al., 2004), the positive Graham, R. C., Jr and Karnovsky, M. J. (1966). The early stages of effect of NACA on erythroid-cell maturation cannot be absorption of injected horseradish peroxidase in the proximal tubules of mouse kidney: ultrastructural cytochemistry by a new technique. J. explained by its c-JUN-mediated positive contribution. Histochem. Cytochem . 14 , 291-302. Intriguingly, a recent study reports the positive effect of the c- Hoang, T., Paradis, E., Brady, G., Billia, F., Nakahara, K., Iscove, N. N. JUN co-activator RNA helicase RHII/Gu α through its and Kirsch, I. R. (1996). Opposing effects of the basic helix-loop-helix association with MafK and other transcription factors that are transcription factor SCL on erythroid and monocytic differentiation. Blood essential for erythroid-cell-specific transcription (Brand et al., 87 , 102-111. Huber, T. L., Zhou, Y., Mead, P. E. and Zon, L. I. (1998). Cooperative effects 2004). Another interesting possibility is related to the recently of growth factors involved in the induction of hematopoietic mesoderm. described function of NACA as a negative regulator of Blood 92 , 4128-4137. apoptosis, through its interaction with FADD (Stilo et al., Kitamura, T., Tange, T., Terasawa, T., Chiba, S., Kuwaki, T., Miyagawa, 2003). It is notable that a deregulation of the FADD-dependent K., Piao, Y. F., Miyazono, K., Urabe, A. and Takaku, F. (1989). Establishment and characterization of a unique human cell line that pathway is reported to result in an ineffective erythropoiesis in proliferates dependently on GM-CSF, IL-3, or erythropoietin. J. Cell. some patients with myelodysplasic syndromes (Fontenay- Physiol . 140 , 323-334. Roupie et al., 1999). Further experiments are obviously needed Lauring, B., Sakai, H., Kreibich, G. and Wiedmann, M. (1995). Nascent

49 NACA inﬂuences erythropoiesis 1605

polypeptide-associated complex protein prevents mistargeting of nascent D., Pflumio, F. and Dubart-Kupperschmitt, A. (2001). Enhanced chains to the endoplasmic reticulum. Proc. Natl. Acad. Sci. USA 92 , 5411- transgene expression in cord blood CD34 +-derived hematopoietic cells, 5415. including developing T cells and NOD/SCID mouse repopulating cells, Michiels, F., van der Kammen, R. A., Janssen, L., Nolan, G. and Collard, following transduction with modified trip lentiviral vectors. Mol. Ther . 3, J. G. (2000). Expression of Rho GTPases using retroviral vectors. Methods 438-448. Enzymol. 325 , 295-302. Skalnik, D. G. (2002). Transcriptional mechanisms regulating myeloid- Miyagawa, S., Kobayashi, M., Konishi, N., Sato, T. and Ueda, K. (2000). specific genes. Gene 284 , 1-21. Insulin and insulin-like growth factor I support the proliferation of erythroid Stilo, R., Liguoro, D., di Jeso, B., Leonardi, A. and Vito, P. (2003). The progenitor cells in bone marrow through the sharing of receptors. Br. J. alpha-chain of the nascent polypeptide-associated complex binds to and Haematol . 109 , 555-562. regulates FADD function. Biochem. Biophys. Res. Commun . 303 , 1034- Moreau, A., Yotov, W. V., Glorieux, F. H. and St-Arnaud, R. (1998). Bone- 1041. specific expression of the alpha chain of the nascent polypeptide-associated Van den Berg, D. J., Sharma, A. K., Bruno, E. and Hoffman, R. (1998). complex, a coactivator potentiating c-Jun-mediated transcription. Mol. Cell. Role of members of the Wnt gene family in human hematopoiesis. Blood Biol . 18 , 1312-1321. 92 , 3189-3202. Osawa, M., Yamaguchi, T., Nakamura, Y., Kaneko, S., Onodera, M., Wiedmann, B., Sakai, H., Davis, T. A. and Wiedmann, M. (1994). A protein Sawada, K., Jegalian, A., Wu, H., Nakauchi, H. and Iwama, A. (2002). complex required for signal-sequence-specific sorting and translocation. Erythroid expansion mediated by the Gfi-1B zinc finger protein: role in Nature 370 , 434-440. normal hematopoiesis. Blood 100 , 2769-2777. Yotov, W. V., Moreau, A. and St-Arnaud, R. (1998). The alpha chain of the Perry, C. and Soreq, H. (2002). Transcriptional regulation of erythropoiesis. nascent polypeptide-associated complex functions as a transcriptional Fine tuning of combinatorial multi-domain elements. Eur. J. Biochem . 269 , coactivator. Mol. Cell. Biol . 18 , 1303-1311. 3607-3618. Zermati, Y., Fichelson, S., Valensi, F., Freyssinier, J. M., Rouyer-Fessard, Quelo, I., Hurtubise, M. and St-Arnaud, R. (2002). alphaNAC requires an P., Cramer, E., Guichard, J., Varet, B. and Hermine, O. (2000). interaction with c-Jun to exert its transcriptional coactivation. Gene Expr. Transforming growth factor inhibits erythropoiesis by blocking proliferation 10 , 255-262. and accelerating differentiation of erythroid progenitors. Exp. Hematol . 28 , Quelo, I., Akhouayri, O., Prud’homme, J. and St-Arnaud, R. (2004). GSK3 885-894. beta-dependent phosphorylation of the alpha NAC coactivator regulates its Zermati, Y., Garrido, C., Amsellem, S., Fishelson, S., Bouscary, D., nuclear translocation and proteasome-mediated degradation. Biochemistry Valensi, F., Varet, B., Solary, E. and Hermine, O. (2001). Caspase 43 , 2906-2914. activation is required for terminal erythroid differentiation. J. Exp. Med . 193 , Sirven, A., Ravet, E., Charneau, P., Zennou, V., Coulombel, L., Guetard, 247-254. ฀฀฀

50 Erreur : dans la discussion de l’article, il est dit : ‘‘As a subunit of the nascent-polypeptide- associated complex (NAC) (Lauring etal., 1995; Wiedmann et al., 1994), NACA influences the targeting of polypeptides devoid of signal peptide. As a consequence of the association of NACA at the surface of the ribosomes, these proteins do not undergo rough-endothelial reticulum processing and therefore retain a cytosolic localization. Both Epo and Epo-R that exhibit a signal peptide should not be influenced by the presence of NACA’’.

Pour rappel, le complexe NAC a été décrit comme impliqué dans la spécificité d’orientation des polypeptides soit à la membrane du RE, soit vers le cytosol (Lauring et al., 1995a; Lauring et al., 1995b; Wiedmann and Prehn, 1999). En effet, NAC en association avec la protéine SRP (Signal Recognition Particule) oriente le polypeptide naissant (ayant la séquence ‘‘peptide signal’’ reconnu par SRP) dans le RE, tandis que NAC seule assure l’orientation du polypeptide naissant dans le cytosol. Par conséquent, NACA pourrait aussi influencer l’orientation vers le RE de protéines contenant la séquence ‘‘peptide signal’’et importante dans la différenciation érythroïde comme l’EPO et EPO-R.

51 Commentaires

Notre étude montre que NACA est non seulement un potentiateur dans la maturation érythroïde des progéniteurs humains CD34+, mais également, qu’il est indispensable pour la différenciation érythroïde. Les mécanismes moléculaires impliquant NACA dans la différentiation érythroïde soulèvent encore des interrogations . En effet, NACA est une molécule capable de s’associer à plusieurs partenaires moléculaires (tels que BTF-3, c- jun/TBP, FADD et et !-taxiline) lui conférant diverses fonctions. Lors de la différenciation érythroïde :

- NACA pourrait intervenir dans sa fonction d’adressage des polypeptides naissants car des protéines ribosomales et des protéines associées au ribosome ont été décrites comme impliquées dans l’érythropoïèse : des mutations des protéines d’assemblages ribosomales (RPS19, RPS24 et RPS17) causent la Diamond-Blackfan anemia, RPS14 est perdu dans les syndromes myélodysplasiques 5q-, et est sous exprimé dans 71% des syndromes myélodysplasiques non 5q- (Czibere et al., 2009; Ebert et al., 2008; Sohal et al., 2008) et des mutations de la protéine SBDS sont associées au Shwachman-Diamond syndrome (Cmejla et al., 2007; Da Costa et al., 2001; Draptchinskaia et al., 1999; Ganapathi and Shimamura, 2008; Gazda et al., 2006).

- NACA ne peut pas jouer dans son rôle de co-facteur de transcription médiée par c- jun puisque 1) NACA est cytoplasmique dans les TF-1 et 2) c-Jun bloque la différentiation érythroïde des progéniteurs hématopoïétiques humains (Elagib et al., 2004). - La régulation négative de l’apoptose par NACA pourrait être requise dans une cellule érythroïde puisque la différenciation érythroïde ne s’accomplit que dans les conditions paradoxales ‘‘d’équilibre’’ entre l’apoptose et la différenciation. - NACA pourrait avoir une nouvelle fonction spécifique du compartiment érythroïde. En effet, le compartiment érythroïde comprends des protéines spécifiques et uniques à ce type cellulaire (Hb, GATA-1..), et dans ce contexte une protéine associée au ribosome peut avoir une fonction particulière (comme la protéine chaperonne HSP70, qui est une molécule anti-apoptotique induite sous l’EPO et protège GATA- 1 de la caspase-3 lors de la différenciation terminale (Ravagnan et al., 2001; Ribeil et al., 2007; Saleh et al., 2000; Zermati et al., 2001).

52 Ainsi, dans le but de comprendre les mécanismes moléculaires par lesquels NACA accélère la différenciation érythroïde, j’ai entrepris la recherche des partenaires moléculaires de NACA dans des cellules érythroleucémiques humaines (TF-1).

53 Article 2 : ERGIC-53 a novel interactor of NACA, participates to EPO-R trafficking

54 Introduction

Contexte scientifique et situation du projet

Nous avons mis en évidence que NACA est un régulateur positif de la différenciation érythroïde humaine. La compréhension de cette fonction de NACA nous amène à étudier son mécanisme moléculaire. La protéine NACA est décrite dans plusieurs fonctions, en interaction avec différentes molécules, dans différents types cellulaires. Cependant, la détection de NACA dans des cellules TF-1 nous indique que NACA est cytosolique, excluant par conséquent sa fonction nucléaire de co-facteur de transcription et sa liaison à l’ADN. Le mécanisme moléculaire de NACA dans la différenciation érythroïde humaine pourrait être révélé par la recherche d’interacteurs. Ses fonctions cytosoliques l’associent au tri et contrôle qualité des polypeptides naissants et à l’apoptose qui sont deux mécanismes ayant un intérêt dans la différenciation érythroïde. Nous aurions pu rechercher si la protéine NACA était associée à !NAC et FADD directement dans la cellule érythroïdes par des techniques d’immunoprécipitation ou pulldown. Cependant, NACA pourrait avoir une fonction spécifique dans la différenciation érythroïde comme le montre la protéine chaperonne HSP70, qui est une molécule anti- apoptotique et qui protège GATA-1 de la caspase-3 lors de la différenciation terminale (Ravagnan et al., 2001; Ribeil et al., 2007; Saleh et al., 2000; Zermati et al., 2001). Par conséquent, nous avons choisit d’élargir les perspectives du projet en recherchant de nouveaux partenaires moléculaires de NACA dans la différenciation érythroïde humaine par une étude protéomique. Nous avons choisit d’utiliser la technique de purification des complexes protéiques TAP-tag (Tandem Affinity Purification) qui en 2003 était la technique la plus inovante pour identifier de nouveaux partenaires moléculaires.

# Présentation de la technique de Tandem Affinity Purification

Principe

La technique de Tandem Affinity Purification (TAP) permet d’étudier les interactions protéine-protéine mais aussi de purifier les complexes protéiques et les protéines en association avec la chromatine. Pour cela, il est nécessaire de construire une protéine de fusion composée d’une séquence TAP qui peut être placée aussi bien en partie N-terminale

55 que C-terminale de la protéine d’intérêt. Cette construction est exprimée dans le modèle cellulaire choisi (cellules de mammifères, C. elegans , levures, bactéries, cellules végétales..), dans lequel la TAP-protéine se complexe avec ses interacteurs. L’étiquette ‘’TAP’’ permet l’enrichissement des ‘’TAP-protéines’’ sur des billes d’affinité et leur libération par clivage enzymatique ou par élution chimique.

Historique

Le premier module TAP était composé de deux domaines d’affinité aux IgG de Staphylococcus aureus protéine A et d’une séquence peptidique liant la calmoduline (CBP : Calmodulin Binding Peptide), séparés par un site de clivage de protéase TEV (Tabacco Etch Virus) (Puig et al., 2001).

Figure 17 : Représentation schématique des étapes de purification utilisant le TAP-tag extrait de (Puig et al., 2001): La protéine fusionnée avec le TAP s’accroche aux billes IgG. Puis, après élimination par lavages des protéines ‘’contaminantes’’, la protéine de fusion est libérée par clivage par l’enzyme TEV. Ces produits sont récupérés et mis en présence de billes de Calmoduline ce qui permet après lavage d’avoir éliminé la majorité des protéines ‘’contaminantes’’. Après élution par EGTA, la protéine d’intérêt encore en interaction avec ses partenaires moléculaires est récupérée. Puis, les partenaires moléculaires de la protéine d’intérêt peuvent être identifiés (après résolution sur SDS-PAGE) par spectrométrie de masse

L’efficacité de ce système a été démontrée lors de la recherche de nouveaux partenaires moléculaires dans les cellules de mammifères (Brajenovic et al., 2004; Holowaty et al., 2003; Knuesel et al., 2003; Obungu et al., 2003; Oshikawa et al., 2003; Taoka et al., 2003; Trinczek et al., 2004). Ce système présente l’avantage de purifier des protéines dans le contexte cellulaire d’intérêt, et ce, sans avoir d’anticorps spécifiques dirigés contre la protéine d’intérêt. De plus, la succession des 2 étapes de purification et le clivage permettent d’obtenir

56 la molécule (potentiellement en interaction avec ses partenaires protéiques) en minimisant les contaminations non spécifiques usuellement rencontrés avec les autres systèmes de co- purification (immunoprécipitation, pull down). En revanche ce système peut présenter des inconvénients : la séquence TAP peut stériquement bloquer un domaine de la protéine fusionnée et par conséquent gêner l’interaction de la TAP-protéine avec un ou plusieurs de ses interacteurs, modifier l’expression de la protéine dans la cellule ou altérer sa régulation. Ce concept de modules d’affinité successifs séparés par un site de clivage a initié l’élaboration d’une variété d’autres TAP-tag avec différentes séquences d’affinités (Flag, ProtG, 6His, streptavidin…) (Abu-Farha et al., 2009; Collins and Choudhary, 2008). Le TAP-tag ne cesse d’évoluer. Le TAP-tag peut contenir non seulement des modules de purification mais aussi une séquence fluorescente (GFP) permettant la localisation sub-cellulaire de la protéine in vivo (Cheeseman and Desai, 2005; Schaffer et al., 2010). Cette variante du TAP-tag est appelé LAP-ta g (Localization and Affinity Purification). Récemment, un petit TAP-tag de 4.6 kDa (au lieu de 21KDa) a été décrit (Gloeckner et al., 2007). Sa petite taille présente l’avantage de ne pas interférer avec la fonction de la protéine fusionnée. Ce SF-TAP-tag est composé de 2 copies de Strep-tag II et du module FLAG-tag. Ces modules présentent l’avantage de se dissocier des billes d’affinité par l’élution soit par la desthiobiotin pour le Strep-tag, soit par Flag octapeptide pour le Flag-tag.

TAP-NACA devient S-tagged NACA

Dans le laboratoire, le Dr Patrick Lécine a construit un vecteur contenant un module TAP-tag qui présentait l’innovation d’avoir deux sites de clivages.

S-ta g PP Calmodulin Binding Protein-tag TEV

MGS KETAAAKFERQHM GGSG LFQGP KRRWKKNFIAVSAANRFKKISSSGAL SGGSGEN LYFQG SDI

Figure 18 : Séquence peptidique du TAP-tag de Patrick Lécine : Cette séquence TAP-tag est composée successivement d’une séquence d’affinité S-tag, d’un site de clivage à la PP (PreScission Protéase), d’une séquence d’affinité CBP-tag (Calmodulin Binding Protein-tag) et d’un site de clivage à la TEV (Tabacco Etch Virus) que nous avons fusionné en partie N-terminale de NACA.

J’ai donc fusionné cette séquence TAP-tag en N-terminale de NACA. Cependant, mes tests ont révélé que le clivage à la PP n’était pas fonctionnel. L’hypothèse d’une non-

57 accessibilité du site de clivage PP due à la conformation du TAP-NACA a été proposée. De plus, l’enrichissement de TAP-NACA par le module CBP a un rendement moins performant que celui obtenu avec le S-tag. Par conséquent, nous avons décidé d’utiliser partiellement le TAP-tag : le S-tag pour la purification d’affinité et le clivage TEV pour l’élution. Ainsi, la molécule de fusion TAP-NACA fut renommée S-tagged NACA dans l’article ci-après afin de rester fidèle à l’utilisation. La protéine S-tagged NACA a été utilisée pour purifier les protéines complexées à NACA, et nous avons découvert ERGIC-53 comme nouvel interacteur de NACA.

ERGIC-53 est une protéine qui participe au transport des glycoprotéines au travers de la voie de sécrétion. Pour une meilleure compréhension de l’article 2 je décrirai ci-après brièvement les mécanismes de la voie de sécrétion.

# Le transport et la maturation des protéines

! Présentation générale de la voie de sécrétion

Une des caractéristiques de la cellule eucaryote est la présence de structures membranaires internes formant des compartiments appelés les organites ou organelles. Ces organites de la voie de sécrétion, sont le réticulum endoplasmique (RE), le compartiment ERGIC (Endoplasmic Reticulum Golgi Intermediate Compartment), l'appareil de Golgi, les endosomes, les lysosomes et les vésicules sécrétoires. L’échange des protéines s’opère entre ces compartiments et aussi avec l'extérieur de la cellule (par la voie d'endocytose et d'exocytose). C’est au travers de ces compartiments qu’ont lieu les processus de tri des protéines synthétisées et leur maturation.

Figure 19 : Représentation schématique des voies de sécrétion au travers des compartiments subcellulaires : Les compartiments communiquent entre eux grâce aux vésicules de transport. Dans la voie de sécrétion (flèches noires), les protéines sont transportées depuis le RE jusqu’à la membrane plasmique ou jusqu’aux lysosomes (via les endosomes). Les polypeptides naissants émergent des ribosomes associés à la membrane du RE, et sont libérés dans la lumière de ce compartiment où ils sont repliés et glycosylés. Ces protéines ayant atteint un premier degré de maturation sont : soit retenues dans le RE (pour la majorité) afin d’être biodisponible en cas de besoin, ou soit dirigées vers le ERGIC, le golgi puis la membrane plasmique. Ce transport est aussi rétrograde (flèches grises) et permet de : soit d’orienter les protéines dans les voies de dégradation, soit de les renvoyer dans un compartiment antérieur. Les protéines ancrées dans la membrane plasmique sont intégrées dans les vésicules (= endocytose) et sont livrées aux endosomes précoces, puis aux endosomes tardifs et enfin aux lysosomes. De nombreuses protéines endocytées sont « sauvées » de cette voie de dégradation au niveau des endosomes précoces et renvoyées à la surface cellulaire pour être réutilisées. De la même manière, certaines protéines retenues dans l’endosome tardif, sont renvoyées dans le golgi, d’autres du golgi sont renvoyées dans le ERGIC ou le RE. Ce transport rétrograde permet à la machinerie de maturation protéique de réguler post- traductionnellement les quantités de protéines selon les besoins, et de corriger les erreurs de repliement ou de glycosylation des protéines. En cas d’erreur de repliement au niveau du RE, la protéine nouvellement synthétisée sort de ce compartiment par un canal de translocation pour être dégradée par le protéasome.

59 Un système de tri et d'acheminement régule et contrôle la qualité des protéines nouvellement synthétisées.

! Tri et acheminement des protéines au niveau du RE

Généralité Les polypeptides naissants émergeant à peine du ribosome sont déjà pris en charge pour son orientation dans le RE. Les polypeptides naissants devant être glycosylés contiennent la séquence ‘‘peptide signal’’ reconnu par SRP (Signal Recognition Particule) qui en association avec le complexe NAC les orientent dans le RE (Lauring et al., 1995a; Lauring et al., 1995b; Wiedmann and Prehn, 1999).

Figure 20 : Représentation schématique de la machinerie de contrôle qualité dans le RE (Jonson et al., 2007). (1) Les polypetides naissants entrent dans le RE dans un état non replié par translocation au travers du canal formé par la protéine trans-membranaire Sec61. Le complexe Sec61 forme un canal trans-membranaire par lequel une protéine naissante est transloquée du cytsosol vers le RE, où (5) par lequel une protéine mal- repliée est exportée dans le cytosole pour être dégradée. (2) Les polypeptides naissants sont modifiés de façon covalente par attachement des mannoses. Cette N-glycosylation est effectuée par le complexe oligosaccharyltransferase. Dans le RE, le cœur glycan Glc3Man9GlcNAc2 est coupé par les glucosidases I et II et la mannosidase I (MANBAL and MANEAL) du RE. Puis, les glycoprotéines sont prises en charge par des protéines chaperonnes pour le repliement. (3) Si les glycoprotéines sont correctement repliées, elles sont aptes à quitter le compartiment RE via le bourgeonnement de vésicules de type COPII initié par les protéines Sec13/31. (4) Si les protéines sont repliées de façon incorrecte, elles sont soumises à la dégradation associée au RE ou à la

60 réponse des protéines non repliées. (5) Après dislocation des protéines par les pores Sec61, la protéine non repliée est prise en charge par le système ubiquitin-proteasome (6). Les protéines à doigt de zinc (RING finger proteins :RNFs) ont été montrées médier l’attachement de l’ubiquitine par ubiquitin-conjugating enzyme (UBE2). Les protéines polyubiquitinilées sont reconnues par le 26S protéasome, où l’ubiquitine est enlevée, et les protéines sont clivées en peptides par le complexe de la protéinase multicatalytique composé des activateurs et inhibiteurs du proteasome (PSMs).

NACA interagit directement avec le 26S protéasome, suggérant que NACA participe également au contrôle qualité des protéines nouvellement synthétisées (Panasenko et al., 2009).

61 Les lectines

Les lectines sont définies comme des protéines non-enzymatiques, capables de lier les sucres. Elles jouent un rôle important dans le contrôle qualité des glycoprotéines nouvellement synthétisées et leur export au travers des compartiments de la voie de sécrétion par des vésicules. Pendant et après la translocation dans le RE, les protéines nouvellement synthétisées acquièrent des modifications post-traductionnelles, telles que : la N-glycosylation, le repliement assisté par des chaperonnes qui donnent à cette protéine une conformation apte au transport. Deux lectines homologues participent au contrôle qualité dans le RE : la protéine membranaire de type 1 calnexine et la protéine soluble calréticuline (Chevet et al., 1999; Michalak et al., 1999; Trombetta and Helenius, 1998). Elles assistent le repliement de la protéine nouvellement synthétisée dans le RE en capturant ses oligosaccharides de type mannone monoglycosylés après l’action d’une glucosidase I (Helenius and Aebi, 2004; Kato and Kamiya, 2007; Parodi, 2000; Spiro, 2004; Williams, 2006). Après un repliement correct, les glycoprotéines sont transportées vers le golgi via le compartiment ERGIC par transport vésiculaire. L’export du RE d’un certain nombre des ces protéines est facilité par les récepteurs cargo ERGIC-53 (53-KDa membrane protein of the ER Golgi intermediate compartment), ERGL (ERGIC-53-like protein), VIP36 (vesicular integral membrane protein 36) et VIPL (VIP36-like protein) qui constituent la famille des lectines L- type (leguminous type) (Nufer et al., 2003). Les L-type lectines ont un domaine de reconnaissance des carbohydrates (carbohydrate recognition domain : CRD) qui lie les oligosaccharides de type mannose de manière Ca2+ dépendante (Appenzeller-Herzog et al., 2004; Kamiya et al., 2005; Yamaguchi et al., 2007). VIP36 est impliquée dans le cycle des glycoprotéines entre le compartiment ERGIC et l’appareil de Golgi (Fullekrug et al., 1999). ERGL qui est majoritairement dans le compartiment ERGIC et VIPL dans le RE semblent réguler ERGIC-53 (Hauri et al., 2000b; Hauri and Schweizer, 1992; Neve et al., 2003; Nufer et al., 2003; Nyfeler et al., 2008b). La lectine la mieux décrite est la lectine membranaire ERGIC-53 qui est un marqueur spécifique du compartiment ERGIC.

62 Présentation de ERGIC-53

ERGIC-53 est une lectine mannose spécifique du compartiment ERGIC (Hauri and Schweizer, 1992). Le compartiment ERGIC est composé de vésicules et de tubules situés entre le RE et le Golgi, par lequel transitent les complexes protéiques sortant du RE vers la voie de sécrétion (Appenzeller-Herzog and Hauri, 2006). Ce compartiment contribue à la concentration, le repliement et le contrôle qualité des protéines nouvellement synthétisées. ERGIC-53 est une protéine qui cycle entre les compartiments RE et ERGIC. Cette protéine forme un cargo qui exporte du RE un bon nombre de glycoprotéines (Appenzeller et al., 1999; Hauri et al., 2000b; Hauri et al., 2002; Nyfeler et al., 2006; Trombetta and Helenius, 1998; Zhang et al., 2009).

Figure 21 : Fonction et recyclage de ERGIC-53 extrait de (Hauri et al., 2000b) (1) Translocation du monomère ERGIC-53 nouvellement synthétisé dans la lumière du RE et ancré dans la membrane du RE. (2) Formation d’homo-oligomère lié par des ponts disulfures qui lient le Man9-N-glycans aux glycoprotéines correctement repliées en présence de Ca2+. (3) Recrutement du cargo ERGIC-53 sur le site de bourgeonnement par l’interaction directe entre le motif cytosolique FF et ce qui constitue la couche de COPII. (4) Bourgeonnement de vésicule COP II et du transport vésiculaire vers le ERGIC. (5) Largage du cargo dans le compartiment ERGIC. (6) Recrutement de ERGIC-53 libre sur le site de bourgeonnement de la vésicule COPI par interaction directe d’une séquence signale cytosolique di-lysine composé d’une couche de COPI. (7) Bourgeonnement d’une vésicule COPI et transport rétrograde vers le RE. (8) Fuite d’une sous-population de molécules ERGIC-53 vers le cis-Golgi. (9) Récupération de cette sous-population dans le ERGIC par les vésicules COPI. Les glycoprotéines repliées de manière incomplète se lient à la calnexine (CX) et/ou la calréticuline (CR) après l'enlèvement de deux résidus de glucose ultrapériphériques (Liu et al., 1999). Par la suite, ils sont clivés par la glucosidase II (Glc II) et, s’ils ne sont pas complètement repliée, ils sont reglucosylés avec du UDPglucose par la glycoprotéine glucosyltransférase (UGT). Après avoir été replié, la glycoprotéine peut se lier à ERGIC-53. Après un long moment, l’enzyme ER a1,2-mannosidase (ER Man I) agit au milieu de la chaîne de glycanes en enlevant un résidu mannose. Le Man 8 mono-glucosylé est le signal pour une retranslocation de la protéine partiellement repliée vers le cytosol suivi d’une potentielle dégradation due à une déglucosylation atténuée par Glc II (Chklovskaia et al., 1999; Cunningham et al., 2003; Lievens et al., 2008; Moussalli et al., 1999; Nyfeler et al., 2008c). Des inhibiteurs du trafic antérograde et rétrograde sont indiqués:

63 DOG :deoxyglucose; OA : okadaic acid; BFA : brefeldin A; Baf : bafilomycin; CBM : 1,3-cyclohexane- bis(methylamine); NDGA : nordihydroguararetic acid. Abréviations: COP I : type I coat protein complex; COP II : type II coat protein complex; ER : endoplasmic reticulum, ERGIC : ER-Golgi intermediate compartment, PM : plasma membrane; T : translocation channel; : mannose; G : glucose.

ERGIC-53 prend en charge les facteurs de coagulation V et VIII (Cunningham et al., 2003; Moussalli et al., 1999; Neerman-Arbez et al., 1999; Nichols et al., 1998), le FGFR3 (Lievens et al., 2008), alpha1-antitrypsin (Nyfeler et al., 2008c) et FL (Chklovskaia et al., 1999). ERGIC-53 forme un récepteur cargo avec MCFD2 pour prendre en charge le transport de la cathepsin-Z-related protein et le trafic intracellulaire de l’enzyme lysosomale cathepsin C (Vollenweider et al., 1998). Des mutations du gène codant pour ERGIC-53 (LMNA1) produisent une protéine tronquée voir absente, et par conséquent une déficience de sécrétion des facteurs de coagulation V et VIII (Neerman-Arbez et al., 1999; Nichols et al., 1998). La fréquence de mutations du gène d’ERGIC-53 concerne 74% des patients atteints d’hémorragie héréditaire liée à un défaut de sécrétion des facteurs de coagulation V et VIII. Les autres patients présentent des mutations dans d’autres gènes codant pour des protéines aux mêmes propriétés que ERGIC-53 tels que MCFD2 (Mohanty et al., 2005; Nyfeler et al., 2008a; Zhang et al., 2003). En effet, ERGIC-53 et MCFD2 forment un cargo récepteur et interagissent avec le facteur de coagulation VIII dans la voie précoce de sécrétion (Zhang et al., 2005). Le gène codant ERGIC53, a une grande fréquence de mutations dans les lignées cellulaires de cancers colorectaux microstatellites instables (MSI-H) (52%; 12/23), les carcinomes de cancers colorectaux MSI-H (45%; 72/161), et les adénomes de cancers colorectaux MSI-H (40%; 8 /20) (Roeckel et al., 2009). Les mutations du géne codant ERGIC-53 aboutissent à la perte d’expression de la protéine, ce qui in vitro altère la sécrétion d’alpha-1-antitrypsine qui est un facteur inhibant l’angiogénèse et la croissance tumorale.

J’ai donc entrepris la recherche de nouveaux partenaires moléculaires de NACA par purification d’affinité dans un contexte érythroïde. Pour cela, j’ai choisi de mener cette étude sur les cellules érythroleucémiques humaines TF-1 dont le clone utilisé répond à l’EPO pour la différenciation, exprime EPO-R sous sa forme native et dans laquelle la régulation de la différenciation érythroïde humaine a été démontrée.

64 ERGIC-53 a novel interactor of NACA, participates to EPO-R trafficking

Laetitia Stuhl, Magali Conesa, Eric lecocq, Laurence Borge, Julie Agopian, Stéphane Audebert,

Patrick Lécine, Patrice Dubreuil and Sophie Gomez.

Centre de Recherche en Cancérologie de Marseille. INSERM U 891, Institut Paoli-Calmettes, Université de la

Méditerranée, 27 bld Leï Roure, 13009 Marseille.

Summary

We have previously described NACA (alpha chain of the nascent polypeptide-associated complex) as a positive regulator of erythroid differentiation. Here, we searched whether novels interactors of NACA may explain NACA’s property in erythroid differentiation. We used a TRIP U3-EF1 !-S-tagged-NACA lentiviral vector for expression of S-tagged NACA at endogenous level and purified of the NACA complexes. Using mass spectrometry, we identified the mannose-specific lectin ERGIC-53 as a novel interactor of NACA. Since these molecules operate as a cargo receptor for the transport of glycoproteins (ERGIC-53) and for the folding of newly synthesized protein (NACA) respectively, we investigated whether they may participate in the trafficking of the erythropoietin receptor (EPO-R). We demonstrated the molecular interaction between EPO-R, ERGIC-53 and NACA, using immunoprecipitation. Interestingly, extinction of ERGIC-53 using inducible shRNA, results in significantly reduced expression of EPO-R at the cell surface while the expression of an immature form of EPO-R remains detectable intracellularly. In addition, the protein Janus

Kinase 2 (JAK2) that is required for Golgi processing and cell surface expression of EPO-R, co-immunoprecipitates with the immature form of EPO-R. These results suggest that ERGIC-

53 participates together with JAK2 in the processing of EPO-R to the cell surface. In addition, we found that ectopic expression of NACA enhance EPO-R cells surface expression .

65 Moreover, NACA also belongs to the JAK2/immature EPOR complex, in the absence of

ERGIC-53. These results suggest that NACA may participate in the folding of EPO-R and in consequence facilitates its exit out of the ER together with JAK2 and ERGIC-53. Together these findings characterize ERGIC-53 and NACA in EPO-R trafficking.

INTRODUCTION

Erythroid differentiation is a multistep process, finely regulated to ensure survival, proliferation, and differentiation of erythroid progenitor cells. Precursor red blood cells have an enormous demand for ribosomal and ribosomal associated proteins, due to the high number of cell divisions. The pivotal cellular role of ribosomal proteins in inherited bone marrow failure syndromes (Diamond-Blackfan anemia) has been recently highlighted for the ribosomal proteins RPS19, RPS24 and RPS17 [1-4]. Overexpression the eukaryote initiation factor 4E (eIF4E) in erythroid progenitors delays differentiation and enhances renewal divisions in the absence of SCF [5]. In addition, molecular chaperones that modulate the assembly, transport and folding of other protein also have key functions in erythropoiesis.

HSP70 initially described as a chaperone, also have a key function in protecting GATA-1 in nucleus from caspase-3-mediated proteolysis in erythroid precursors undergoing terminal differentiation [6]. The recent identification of the alpha chain of the nascent polypeptide- associated complex (NACA), a ribosomal associated protein, as a positive regulator of human erythroid-cells differentiation [7], lengthen the list of proteins from the protein-synthesis machinery that contribute to erythroid differentiation.

However, the molecular mechanism of NACA in erythropoiesis remained unknown. NACA is a highly conserved protein from yeast to human [8], that displays distinct functions dependant both on the cellular compartments and the protein complexes it belongs. NACA shuttle between the cytoplasm and the nucleus upon phosphorylation by Integrin-Linked Kinase

66 (ILK) and glycogen synthase kinase 3 " (GSK3 ") respectively. Within these cellular compartments, NACA associated with different partners. The formed complexes confers specific function to NACA [9,10].

NACA was first described in cytosol, to form a stable heterodimeric complex with "NAC

(BTF3) termed nascent-polypeptide associated complex (NAC). NAC associates with ribosomes and nascent polypeptide chains in a chaperone like manner and is required for protein sorting and translocation of nascent chain with signal peptide into the ER together with the signal recognition particle (SRP) [11-13]. NACA has further been described to complex with more proteins. First, NACA interact with the taxilin family proteins, suggesting a role for NACA in delivering NAC-mediated transport of the translating ribosome to restricted regions of the plasma membrane [14]. Moreover, this study demonstrated that - taxilin regulates the translocation of NACA from the cytosol to the nucleus. Upon phosphorylation at residue serine 43 by Integrin-Linked Kinase NACA is translocated to the nucleus of osteoblasts, where it acts as an AP-1 coactivator to increase osteocalcin gene transcription, accelerates mineralization and promotes bone formation [15-19]. However, this complex may be specific of ostegenesis. Although, c-jun-mediated contribution on the acceleration of NACA in erythroid-cell differentiation may be irrelevant since c-Jun blocks erythroid differentiation in primary human hematopoietic progenitors [20]. Moreover, it has been demonstrated that NACA is a negative regulator of apoptosis mediated by FADD through an interaction with NACA [21]. Finally, NACA induces the secretion of the soluble factor galectin-1 stromal cells of lymph nodes contributing in the maintenance of naive T cell survival without inducing cell proliferation [22-24].

So far, NACA display different functions depending on both on the cell type, the sub-cellular localization, and the interactors contracted. Together the results of these studies prompted us to evaluate whether novels interactors of NACA may reveal molecular mechanism by which

67 NACA play its role in erythroid differentiation. Using a tagged purification system of NACA protein complexes, we identified ERGIC-53 as a novel interactor of NACA together with

EPO-R. We propose that ERGIC-53 participates in EPO-R/JAK2 complex processing at the cell surface. In addition our data suggest that NACA may participate in the folding of EPO-R.

Our results characterize ERGIC-53 and NACA in EPO-R trafficking.

MATERIALS AND METHODS

Culture and transduction of TF-1 cells

The human erythroleukemic TF-1 cell line was kindly provided by H. Gascan (Angers,

France). It corresponds to a subclone of the original cell line established by T. Kitamura et al that exhibits characteristics of immaturity and can proliferate transiently or stable in presence of various cytokines : IL1 alpha, GM-CSF, SCF, IL3, IL-4, IL-5, TNFalpha, IL6, LIF and

EPO [25].

Cells were cultured in RPMI 1640 containing 10% fetal calf serum (FCS) (Invitrogen SARL,

France), 2 mM Lglutamine, 200 IU/ml penicillin, and 100 )g/ml streptomycin at a mean density of 3.10 5 cells/ml in the presence of 5 ng/ml recombinant human GM-CSF (rhuGM-

CSF Leukine®; Berlex Laboratories Inc, CA, USA) or with 2U/mL of recombinant human erythropoietin (rhuEPO) (gift by N. Casadevall). Cultures were maintained at 37°C in a humidified 5% CO2 atmosphere.

Transduction of TF-1 cells was performed with either S-tagged NACA or NACA or shERGIC-53 or shcontrol lentiviral particles to establish TF-1 NACA cells or TF-1 S-tagged

NACA cells, TF-1 shERGIC-53 cells and TF-1 shcontrol cells respectively.

The presence of hemoglobin in TF-1 cells was determined by benzidine staining according to the technique described by Graham and Karnovsky [26].

68 Construction of plasmids

Construction of TRIP U3-EF1 !-S-taggedNACA-IRES-GFP vector

The sequence that contains S-tag and Tobacco Each Virus (TEV) cleavage site was constructed by annealing of 6 oligonucleotides : Forward 1: 5’-CTAGCTAAGCTTCCACCA

TGGGTAGTAAAGAAACCGCTGCTGCGAAATTTGAACGCCAGCACATGGACTCGG

GTGGCAGT -3’ ; Forward 2 : 5’-GGGCTGGAAGTTCTGTTCCAGGGGCCGACCAAGC

GACGATGGAAAAAGAATTTCATAGCCGTCTCAGCAGCCAACCGCTT-3’; Forward 3

: 5’- TAAGAAAATCTCATCCTCCGGGGCACTTTCGGGTGGCAGTGGGGAAAACCTC

TACTTCCAGG -3’; Reverse 1: 5’- GATCCCTGGAAGTAGAGGTTTTCCCCACTGCCA

CCCGAAAGTGCCCCGGAGGATGAGATTTTCTTAAAGCGGTTGGCTGCTGAGAC -3’

; Reverse 2 : 5’- GGCTATGAAATTCTTTTTCCATCGTCGCTTGGTCGGCCCCTGGAAC

AGAACTTCCAGCCCACTGCCACCCGAGTCCATGT -3’ ; Reverse 3 : 5’- GCTGGCGTT

CAAATTTCGCAGCAGCGGTTTCTTTACTACCCATGGTGGAAGCTTAG-3’ (Invitrogen

SARL, France). This construct was cloned into phygro plasmid (clontech) between NheI and

BamHI restriction sites. Then, the phygro-S-tagged plasmid was converted with the

Gateway® Vector Conversion System using the Reading Frame Cassette A cloned into

EcoRV according to the manufacturer's manual (Invitrogen SARL, France).

The human NACA complementary DNA (cDNA) was adapted for Gateway cloning technology from Invitrogen by PCR-amplification using cDNA of TF-1 cells lines as template

(forward primer: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTT CCCCGGCGAAGC

CACAGAAAC-3’; reverse primer: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCC

AAGCTGCAGTTACTCCTTTGAGACACC-3’ (Invitrogen SARL, France)).

The amplified sequence was cloned into a Gateway-adapted pHygro-S-tagged vector. Then, the S-tagged NACA sequence was excised from the plasmid pHygro-S-tagged-NACA by

BglII/XhoI, and the 900 base-pair fragment was subcloned into the BamHI/XhoI sites of

69 TRIP U3-EF1 !-IRES-GFP [27] to generate the plasmid TRIP U3-EF1 !-S-tagged-NACA-

IRES-GFP.

Construction of TRIP U3-EF1 !- NACA-IRES-GFP vector

The human NACA complementary DNA (cDNA) was bordered by BamHI and XhoI restriction sites by PCR-amplification using cDNA of TF-1 cells lines as template (forward primer: 5’-GGATCCTCACCATGCCCGGCGAAGCCACAGAAAC-3’; reverse primer: 5’-

CTCGAGCCAAGCTGCAGTTACTCCTTTGAGACACC-3’(Invitrogen SARL, France).

The amplified sequence was cloned into pGEM-T easy vector plasmid (promega). NACA was excised from the plasmid pGEM-T-NACA with BamHI/XhoI, and subcloned into the

BamHI/XhoI sites of TRIP U3-EF1 !-IRES-GFP [27] to generate the plasmid TRIP U3-

EF1 !-NACA-IRES-GFP.

Construction of pLVCT-tTRKRAB-shERGIC-53 vector shRNA ERGIC-53 was designed using the siRNA target Finder website

(http://www.ambion.com/techlib/misc/siRNA_finder.html/) and cloning into an expression vector pLVCT-tTRKRAB according the protocol of TronoLab (http://tronolab.epfl.ch) using oligonucleotides 5’-CGCGTCCCCAGCCAAAGAGGCTCAGTGTTTCAAGAGAACACT

GAGCCTCTTTGGCTTTTTTTTGGAAAT-3’ and 5’-CGATTTCCAAAAAAAGCCAAAG

AGGCTCAGTGTTCTCTTGAAACACTGAGCCTCTTTGGCTGGGGA-3’ (Invitrogen

SARL, France). The sequence of shERGIC-53 was cloned into the plasmid pLVCT- tTRKRAB. Identification of a no functional mutated shERGIC-53 serves as shRNAcontrol.

70 Production of lentivirus expressing S-tagged NACA, NACA or shRNA

Lentiviral particles were produced as described in [27]. Briefly, the vector plasmids

(TRIP U3-EF1 !-S-taggedNACA-IRES-GFP or TRIP U3-EF1 !-NACA-IRES-GFP or pLVCT-tTRKRAB-shERGIC-53 or pLVCT-tTRKRAB-shcontrol) were introduced into 293-

T cells, together, with an encapsidation plasmid (p8.91) lacking the Vif, Vpr, Vpu and Nef accessory HIV-1 proteins, and a vesicular stomatitis virus (VSV) protein-envelope-expression plasmid (pHCMV-G) using 10 mM polyethylenimine (PEI) as transfection reagent (Sigma

Aldrich, Germany). The infectivity was determined transducing TF-1 cells based on the EGFP expression.

ERGIC-53 silencing

For ERGIC-53 silencing induction, TF-1 shERGIC-53 cells or TF-1 shcontrol were cultivated according TF1 cells culture conditions supplemented with 5µg/mL of doxycycline for five days.

S-tag purification

Two hundred millions of TF-1 cells and TF-1 S-tagged NACA cells were harvested and resuspended in 40mL of lysis buffer [0,1% NP-40, 50 mM Tris-HCl, pH 7.5, 150 mM sodium chloride, complete protein inhibitor (Roche Diagnostics, Mannheim, Germany)]. Proteins concentration was determined with a Bio-Rad protein assay kit (Bio-Rad, Marnes-la-

Coquette, France) according to the manufacturer’s recommendations, using BSA as a standard. Extracts were precleared with 400µL of sepharose beads (50% slurry) (Sigma

Aldrich, Germany) at 4°C for 1 hour and then were incubated with 200 µL of S-tag beads

(50% slurry) (Novagen, UK) at 4°C for 2 hours. Then, beads were washed and resuspended in

300µL of TEV cleavage buffer (10mM Tris-HCl pH8.0, 150mM NaCl, 0,1% NP40, 0,5mM

71 EDTA, 0,5mM DTT) and 100U of recombinant TEV enzyme (Invitrogen SARL, France) was added to the mixture. After rotation for 6 hours at 4°C, the TEV eluate was transfer in new tubes and precipitated with acetone [28]. Proteins precipitated were resuspended in 25µL of

Laemmli sample buffer [29] before loading onto NuPAGE gel 4-12% with MOPS running buffer (Invitrogen SARL, France). Proteins bands were excised from the silver stain-gel, and digested with trypsin (Promega, WI) [30]. Mass spectrometric analyses were performed using a MALDI-TOF instrument (Ultraflex; Bruker Daltonics, Bremen, Germany). The searches were made using the MASCOT search engine (http://www.matrixscience.com). The peptide masses were matched with the theoretical peptide masses of all proteins in the NCBI nonredundance database.

Generation of antibodies against NACA

GST-tagged NACA was produced according the protocol of Amersham Pharmacia Biotech.

Briefly, the human genes coding for human NACA was cloned into pGEX-4T-1 resulting in a fusion of the NACA genes to the glutathione S-transferase (GST) gene. The fusion genes were expressed in Escherichia coli BL21 (DE3), and GST-NACA was purified using glutathione-agarose according to the manufacturer's manual (Amersham Pharmacia Biotech).

The rabbit polyclonal antibody against NACA was produced by immunization of rabbit with a fusion GST-NACA according to standard procedures of Harlan, UK.

Protein analysis, immunoprecipitation and immunoblotting

For immunoprecipitation experiments, twenty millions of cells were harvested and resuspended in 1,5mL of lysis buffer. Immunoprecipitation of ERGIC-53 was performed with

5µg of mouse monoclonal anti-ERGIC-53 G1/93 (Alexis Biochemicals, San Diego, CA,

USA) incubated with protein G-sepharose (Amersham, Arlington Heights, IL) and TF-1 cell

72 lysate ON 4°C. Immunoprecipitation of EPO-R was performed with 3µg of rabbit anti-EPOR

M-20 (Santa Cruz Biotechnology, Germany) incubated with protein A-sepharose (Amersham,

Arlington Heights, IL) and TF-1 cell lysate ON 4°C. Immune’s complexes were washed three times with lysis buffer, then eluted by heating to 95°C for 5 minutes in Laemmli sample buffer [29].

For immunoblotting, immune’s complexes or 30 )g of proteins from total cells lysate, in

Laemmli sample buffer were resolved onto 10% SDS-PAGE and transferred to nitrocellulose membrane (Amersham, Arlington Heights, IL). Membranes were blocked either with 5% bovine serum albumin (BSA) (Sigma Aldrich, Germany) in TBS-T [Tris-Buffered Saline with

0.05% Tween 20] for 30 min (for detection of NACA, GRB2 and JAK2), or with 5% milk

TBS-T (for detection of EPO-R and ERGIC-53) for 1 hour at room temperature. The membranes were probed with either a rabbit anti-NACA immune serum (dilution 1:1000), or a rabbit anti-EPOR M-20 (1:200; Santa Cruz Biotechnology, Germany), or a rabbit anti-JAK2

(1:2000; Upstates, Lakes placid, NY) or a mouse monoclonal anti-ERGIC-53 G1/93 (1:500;

Alexis Biochemicals, San Diego, CA, USA) or a mouse anti-GRB2 (1:1000; Santa Cruz,

Germany). Lanes containning lysates were revealed either with an anti-rabbit immunoglobulin

(Ig)-coupled to horseradish peroxidase (HRP) (1:20000; Jackson ImmunoResearch

Laboratories, Baltimore, MD), or with an anti-mouse Ig-HRP (1:10000; Dako, Denmark) whereas lanes containing Immune’s complexes lanes were revealed with an anti-mouse IgG

Trueblot-HRP (1:1000; eBioscience, San Diego, CA, USA), or either protein A-HRP

(1:20000; Amersham, Arlington Heights, IL). Antigen detection was visualized by using the super signal west pico chemiluminescence system (Perbio Science, Pierce, France).

73 Flow cytometry analysis

Cell surface EPO-R expression was assessed by flow cytometry using phycoerythrin- conjugated mouse monoclonal EpoR antibody (FAB307P; R&D Systems Wiesbaden,

Germany) and matching isotype-negative control mouse IgG2b-PE (BD Pharmingen, San

Diego, CA). Cell staining was performed according to the manufacturer’s protocol.

Cell surface KIT expression was assessed by flow cytometry with anti-KIT monoclonal antibody MAB332 (R&D Systems, Wiesbaden, Germany) followed with anti-mouse-PE

(Immunotech Beckman Coulter, France) and matching isotype-negative control IgG1-PE

(Immunotech Beckman Coulter, France) according manufacture’s protocol. Cells were then subjected to FACS scanning analysis using a FACS Vantage (Becton Dickinson, Mountain

View, CA) and analyzed both using a CellQuest software (Becton Dickinson, Mountain View,

CA) and FlowJo software (Treestar, Ashland, OR, USA).

Immunofluorescence Analysis

For cell surface immunofluorescence, cells were washed once in PBS and then incubated with a mouse monoclonal anti-EPO-R MAB307 (dilution 1:100, R&D Systems, Wiesbaden,

Germany) in PBS 0,5% BSA, 4% Human FcR Blocking (Miltenyi Biotec, Bergist Gladbach,

Germany) 30 minutes at 4°C, washed and then incubated with an Alexa 547-conjugated goat anti-mouse antibody (dilution 1:500, Invitrogen SARL, France) 30min at 4°C. Washed cells in PBS were platted onto Labteck Slides (Nunc, VWR, France) initially coated with poly-L- lysine (100 µg/ml ) Sigma Aldrich, Germany) and then fixed with 1% paraformaldehyde for

20 minutes at room temperature.

74 RESULTS

The fusion protein S-tagged NACA display the same property than NACA.

In order to search for novel molecular partners of NACA that may explain its role of positive regulator of erythroid differentiation, we used an S-tag affinity purification system. It is composed of an affinity sequence S-tag in fusion with NACA separated by a cleavage site for the TEV protease (Tobacco each virus) (Fig. 1A). We chose the S-tagged NACA lentiviral vector to express the S-tagged NACA protein into the TF1 cells line, to allow ectopic expression of the exogenous S-tagged NACA at levels close to those of endogenous NACA.

The exogenous S-tagged NACA protein from TF-1 cells lysates migrates at 47KDa apparent molecular height and is express equivalent amount of endogenous NACA (35KDa) (Fig. 1 B).

Such expression level should favor the identification of specific complexes rather than non- specific due to large amount of ectopic expressed protein. To comfort the use of the S-tagged

NACA for the enrichment of NACA’s molecular partners that may be pertinent in erythropoiesis, we first verify the properties of S-tagged NACA. The functionality of S- tagged NACA in erythroid differentiation was tested through the presence of hemoglobin in

TF-1 cells transduced with a S-tagged NACA lentivirus vector cultured in the presence of

EPO for several days, compared to TF1 cells transduced with a NACA lentivirus vector cultured in similar condition (Fig. 1C). The proportion of Benzidine positive cells in either the

TF-1 NACA or the TF-1 S-tagged NACA cells are equivalent (5 to 34% versus 7 to 36% from day 0 to day 4 respectively), and is nearly twice than for TF-1 cells (3% to 20 % from day 0 to day 4 respectively). This result indicates that S-tagged sequence do not affect the function of

NACA in erythroid differentiation. Both the property and the amount of ectopic S-tagged-

NACA are favorable for both the next steps of complexes enrichment and the search novels

75 partners of NACA. We search novels partners of NACA in TF-1 cells transduced with a S- tagged NACA lentivirus vector.

Identification of ERGIC-53 as a novel interactor of NACA.

The enriched S-tagged NACA migrated at 39KDa after TEV cleavage when subjected to a

SDS-Page electrophoresis (fig 2A). Western blot analysis demonstrates that purification of the S-tagged-NACA with S-tagged beads allows to concentrate about 10 times the S-tagged

NACA proteins, and the totality of the protein is eluted after TEV cleavage (Fig. 2A). This result demonstrates that an appropriate enrichment of S-tagged NACA was recovered after these two steps of purification for identifying protein complexes. To identify the partners complexed to the S-tagged NACA fusion protein we compared the sliver stained bands obtained after loading of the enriched products from either TF1-NACA or TF1-S-tagged-

NACA cells onto gel Nu-PAGE. Differentially detected bands migrated at 22kDa, 39KDa,

53KDa, 57KDa, 58KDa, 61KDa, 71KDa, 83KDa apparent molecular weight (Fig. 2B). Mass spectrometry analyses of these bands and comparison of the peptide sequences with protein databases MASCOT search engine identified several proteins belonging to a complex associated with ribosome and newly synthesized polypeptides already described in ribosomal complex : "NAC (BTF-3), HSP40, TCP1, HSP60, HSP70 and HSP90 proteins [31-34] . This result comforts that the affinity purification system used favors purification of specific interacting proteins. Interestingly, among the enriched proteins, one of them was identified as

ERGIC-53 based on alignment of 11 peptides on sequence P49257 (Fig. 2C). The interaction between ERGIC-53 and endogenous NACA was confirmed by the detection of NACA co- immunoprecipitated with ERGIC-53 (Fig. 2D). These results identify ERGIC-53 as a novel interactor of NACA.

76 EPO-R interact with ERGIC-53 and NACA

ERGIC-53, is a protein involved in the shuttle of glycoproteins between ER and ERGIC compartment [35,36]. It is involved in the delivery of a limited set of cell surface glycoproteins such the coagulation factor V and VIII [37] or FLT3 ligand (FL)[38]. These newly biosynthesized proteins remain retained in the ER and do not undergo golgi processing when ERGIC-53 is either mutated [39] or when the ERGIC compartment is destroyed respectively [38]. Storage and delivery of newly biosynthesized EPO-R out from the ER compartment is regulated through both EPO-R folding property and the JAK2 interaction [40-

42]. We explored whether EPO-R trafficking may involve ERGIC-53.

We first studied whether EPO-R belongs to the identified ERGIC-53/NACA complex by co- immunoprecipitation followed by EPO-R western blotting detection. We detected two proteins migrating with an apparent weight of 65kDa and 64KDa respectively, that were previously described as the mature and immature form of EPO-R in TF-1 cells (Fig. 3) [43-

47]. This result indicates the existence of the complex EPO-R/ERGIC-53/NACA in TF-1 cells.

Lack of ERGIC-53 disrupt the expression of EPO-R on the cell surface

To obtain insights in the role of EPO-R/ERGIC-53/NACA complex, we investigate the effect of silencing ERGIC-53 using a doxycyclin inducible shRNA in TF-1 cells on the composition of the complexes. The silencing of ERGIC-53 was verified by Western blot analysis using

ERGIC-53 specific antibodies. The amount of ERGIC-53 (53KDa) is underexpressed in the

TF1 cells both transduced with a shERGIC-53 lentiviral vector and treated with 5µg/mL of doxycyclin for 5 days, in comparison with the detected amount of ERGIC 53 in the TF-1 cells transduced with a shcontrol lentiviral vector either with or without doxycyclin treatment (Fig

77 4A). This result indicates that doxycyclin inducible shERGIC-53 used repressed the expression of ERGIC-53.

Co-immunoprecipitation experiments in ERGIC-53 shRNA silenced cells, revealed that only the immature form of EPO-R, suggesting that in the absence of ERGIC-53, EPO-R do not undergoes golgi processing and is retained in the ER compartment. Since, it has been described that JAK2 is required for EPO-R exit out of the ER, we investigated whether JAK2 was part of the complex in the absence of ERGIC-53. We found that JAK2 co- immunoprecipitate with the immature form EPO-R, in the absence of ERGIC-53 (Fig 4B).

These results indicate that ERGIC-53 has no influence in the formation of the

NACA/JAK2/EPO-R complex. Since several studies suggest that NACA may assist folding during the proteins ongoing synthesis [32,48], it is possible that NACA participates in the folding of EPO-R together with JAK2. In addition, in absence of ERGIC-53 the complex contains the immature form of EPO-R (Fig. 4B, upper panel), suggesting that JAK2 is not sufficient to export EPO-R out of the ER compartment or before golgi mature receptors processing. ERGIC-53 probably participates in this processing. Further studies of EPO-R expression at the cells surface by flow cytometry analysis showed that about 16% of TF1 express EPO-R at their cell surface, whereas only 3% of EPO-R is detected in TF1 cells both transduced with the shERGIC-53 lentiviral vector and treated with doxycycline (Fig. 4C). The reduction of the number cells expressing EPO-R at the cell surface was confirmed by immunofluorescence experiments (Fig. 4D). These results indicate that the silencing of

ERGIC-53 reduced of 5 fold the number of immunostained cells, and suggest that ERGIC-53 promotes EPO-R cell surface expression. Interestingly ERGIC-53 is not involved in the cell surface expression of another hematopoetic receptor KIT. As indicated Fig 4C, the number of cells expressing the KIT receptor is identical in the TF1 cells silenced for ERGIC-53 either treated with or without doxycycline. Together, these results reinforces that ERGIC-53 is not

78 an ubiquitously cargo required for cell surface processing of receptors, but for a specific set of glycoproteins.

Overexpression of NACA favors EPO-R cells surface expression

Since the complex contains not only EPO-R/JAK2/ERGIC-53, but also NACA, we investigated the effect of ectopic expression of NACA, on the expression of EPO-R at the cell surface by flow cytometry analysis. Histogram plot analysis show that 14% of TF1 cells express EPO-R at the cell surface while twice more TF1 cells transduced with a NACA lentiviral vector express EPO-R (29%) (Fig 5). This result suggests that NACA enhance EPO-

R cells surface expression. This effect is probably due to the known function of NACA in protein folding [11,12,32,33], that is necessary for the EPO-R trafficking [41].

DISCUSSION

NACA is involved in many functions such as targeting and translocation of nascent polypeptides [12,49], co-factor of transcription in bone differentiation [17] and negative regulator of apoptosis [21]. We have recently characterized NACA as a positive regulator of human erythroid-cells differentiation. However, the molecular mechanism of NACA in erythropoiesis remained unknown.

Here, we identified with NACA, several proteins belonging to a complex associated with ribosome and newly synthesized polypeptides already described [31-34,50,51]: the "# subunit of Nascent polypeptide-Associated Complex (BTF-3), the tailless complex polypeptide 1 beta (TCP1 "$# and the Heat Shock Protein HSP70. These proteins are known to associate transiently with ribosomes and ensure folding assistance as either the HSP70/HSP40/HSP90 system or the TCP1 ring complex containing TCP1 (TRiC/CCT) and HSP60, [33,52-54]. The finding of these proteins together at the final purification step of the NACA associated protein

79 is thus not surprising. This finding suggest that the use of the S-tag and the TEV cleavage tools successively make them valid steps to favor purification of specific NACA interacting proteins. Interestingly, in addition to the above described proteins, we purified the lectin ER

Golgi intermediate compartment 53-kD protein (ERGIC-53) as an interactor of NACA. This protein operates as cargo receptor for a limited set of glycoproteins between ER and ERGIC compartment [35,36]. The link between the existence of the protein complex NACA/ ERGIC-

53 and acceleration of erythroid differentiation mediated by NACA was proposed by the finding of EPO-R in immune complexes with NACA and ERGIC-53. Since delivery of newly biosynthesized EPO-R that are retained in the ER requires proper folding, we speculate that

NACA may assist folding during the proteins ongoing synthesis. This concept is supported both by presence of the immature form of EPO-R in the NACA complex and by an additional processing of EPO-R to the cell surface due to excess of NACA. The majority of newly made

EPO-R subunits retained in the ER are destined for degradation [40-42,45]. NAC protects about 30 C-terminal residues of nascent chains against proteolytic attack [55], supporting the hypothesis that excess of NACA may protect EPO-R of the degradation. Furthermore, the excess of NACA may participate in the control of EPO-R trafficking by accelerating the folding of EPO-R required for its cell surface expression. Acceleration of folding of EPO-R has been described with the mutant A234E of EPO-R that is processed to the cell surface more efficiently than wild type receptor, due to an higher efficiency in the folding of receptor within the ER [41].We hypothesizes that the excess of NACA may fold part of the bulk of newly constitutively biosynthesized EPO-R stored in the ER. Another observation supporting this hypothesis is that NACA interacts with the immature form of EPO-R together with JAK2.

It has been hypothesized that JAK2 is involved in the proper folding of the EPO-R cytosolic domain and only an EPO-R/JAK2 complex is allowed to transit to the Golgi or escape

80 retention to the ER from the golgi [42]. NACA together with JAK2 may be essential for promoting EPO-R out of the ER and cell surface expression by enhancing EPO-R folding.

Kinetic studies are needed to define whether NACA and JAK2 act successively or sequentially.

Although, once folded properly, neither JAK2 nor EPO-R contains an ER export signal sequence. Here we demonstrate that in the absence of ERGIC-53, the immature form of EPO-

R remains complexed to NACA and JAK2 but lack of reaching the cell surface. 75% of EPO-

R were unrecovered at the surface of cells knock down for ERGIC-53. It is uncertain that the lack of cell surface EPO-R result from its recycling into endosomal vesicles for degradation since only the immature form of EPO-R is recovered in the absence of ERGIC-53. In addition, ERGIC-53 is a protein that acts a the cargo receptor for a limited set of glycoproteins between ER and ERGIC compartment [35,36]. Furthermore, in the presence of

ERGIC-53 cells express the mature form of EPO-R. These results suggest that both transport of EPO-R from the ER could be mediated by the mannose-specific membrane lectin cargo receptor ERGIC-53 and that ERGIC-53 participates in the transport of EPO-R to the cell surface. This result lengthens the list of the cargo receptor complexes ERGIC-53 mediated.

Studies on both cathepsin-Z/ERGIC-53 [56] and alpha 1–antitrypsin/ERGIC-53 [57] complexes formation revealed that such interaction is both carbohydrate and conformation- dependent. Further studies need to done to evaluate the mechanism required in the ability of

ERGIC-53 to select for EPO-R as well as to examine whether retrograde and anterograde transport of EPO-R through ERGIC-53 may be part of the regulation of storage and delivery of EPO-R from the ER. In this study, we have described ERGIC-53 as a novel interactor of

NACA, that together with NACA participate in events occurring in the early phase of the

EPO-R biosynthesis. NACA may assist folding of EPO-R together with JAK2 during the

81 proteins ongoing synthesis while ERGIC-53 escort newly made EPO-R from the translational machinery to the early step of secretion pathway.

Acknowledgement :

We thank Daniel Isnardon for his technical assistance, N. Casadevall for generous gift of

EPO. Laetitia Stuhl is a recipient of a doctoral fellowship from the Ministère de l’Industrie et de la Recherche and from the Ligue Nationale Contre le Cancer (LNNC). Magali Conesa is a recipient of a post-doctoral fellowship from the Association pour la Recherche contre le

Cancer (ARC). This work was supported in part by funds from INSERM (Institut National de la Santé et de la Recherche Médicale) and by the Ligue Nationale contre le Cancer (LNCC).

References

1. Da Costa L, Willig TN, Fixler J, Mohandas N, Tchernia G: Diamond-Blackfan anemia .

Curr Opin Pediatr 2001, 13 :10-15.

2. Draptchinskaia N, Gustavsson P, Andersson B, Pettersson M, Willig TN, Dianzani I, Ball

S, Tchernia G, Klar J, Matsson H, et al.: The gene encoding ribosomal protein S19

is mutated in Diamond-Blackfan anaemia . Nat Genet 1999, 21 :169-175.

3. Gazda HT, Grabowska A, Merida-Long LB, Latawiec E, Schneider HE, Lipton JM,

Vlachos A, Atsidaftos E, Ball SE, Orfali KA, et al.: Ribosomal protein S24 gene is

mutated in Diamond-Blackfan anemia . Am J Hum Genet 2006, 79 :1110-1118.

4. Cmejla R, Cmejlova J, Handrkova H, Petrak J, Pospisilova D: Ribosomal protein S17

gene (RPS17) is mutated in Diamond-Blackfan anemia . Hum Mutat 2007, 28 :1178-

1182.

82 5. Blazquez-Domingo M, Grech G, von Lindern M: Translation initiation factor 4E

inhibits differentiation of erythroid progenitors . Mol Cell Biol 2005, 25 :8496-8506.

6. Ribeil JA, Zermati Y, Vandekerckhove J, Cathelin S, Kersual J, Dussiot M, Coulon S,

Moura IC, Zeuner A, Kirkegaard-Sorensen T, et al.: Hsp70 regulates erythropoiesis

by preventing caspase-3-mediated cleavage of GATA-1. Nature 2007, 445 :102-

105.

7. Lopez S, Stuhl L, Fichelson S, Dubart-Kupperschmitt A, St Arnaud R, Galindo JR, Murati

A, Berda N, Dubreuil P, Gomez S: NACA is a positive regulator of human

erythroid-cell differentiation . J Cell Sci 2005, 118 :1595-1605.

8. Makarova KS, Aravind L, Galperin MY, Grishin NV, Tatusov RL, Wolf YI, Koonin EV:

Comparative genomics of the Archaea (Euryarchaeota): evolution of conserved

protein families, the stable core, and the variable shell . Genome Res 1999, 9:608-

628.

9. Quelo I, Akhouayri O, Prud'homme J, St-Arnaud R: GSK3 beta-dependent

phosphorylation of the alpha NAC coactivator regulates its nuclear translocation

and proteasome-mediated degradation . Biochemistry 2004, 43 :2906-2914.

10. Quelo I, Gauthier C, Hannigan GE, Dedhar S, St-Arnaud R: Integrin-linked kinase

regulates the nuclear entry of the c-Jun coactivator alpha-NAC and its

coactivation potency . J Biol Chem 2004, 279 :43893-43899.

11. Lauring B, Kreibich G, Weidmann M: The intrinsic ability of ribosomes to bind to

endoplasmic reticulum membranes is regulated by signal recognition particle and

nascent-polypeptide-associated complex . Proc Natl Acad Sci U S A 1995, 92 :9435-

9439.

83 12. Lauring B, Sakai H, Kreibich G, Wiedmann M: Nascent polypeptide-associated

complex protein prevents mistargeting of nascent chains to the endoplasmic

reticulum . Proc Natl Acad Sci U S A 1995, 92 :5411-5415.

13. Moller I, Beatrix B, Kreibich G, Sakai H, Lauring B, Wiedmann M: Unregulated

exposure of the ribosomal M-site caused by NAC depletion results in delivery of

non-secretory polypeptides to the Sec61 complex . FEBS Lett 1998, 441 :1-5.

14. Yoshida K, Nogami S, Satoh S, Tanaka-Nakadate S, Hiraishi H, Terano A, Shirataki H:

Interaction of the taxilin family with the nascent polypeptide-associated complex

that is involved in the transcriptional and translational processes . Genes Cells

2005, 10 :465-476.

15. Yotov WV, Moreau A, St-Arnaud R: The alpha chain of the nascent polypeptide-

associated complex functions as a transcriptional coactivator . Mol Cell Biol 1998,

18 :1303-1311.

16. Moreau A, Yotov WV, Glorieux FH, St-Arnaud R: Bone-specific expression of the

alpha chain of the nascent polypeptide-associated complex, a coactivator

potentiating c-Jun-mediated transcription . Mol Cell Biol 1998, 18 :1312-1321.

17. Quelo I, Hurtubise M, St-Arnaud R: alphaNAC requires an interaction with c-Jun to

exert its transcriptional coactivation . Gene Expr 2002, 10 :255-262.

18. Meury T, Akhouayri O, Jafarov T, Mandic V, St-Arnaud R: Nuclear {alpha}NAC

influences bone matrix mineralization and osteoblast maturation in vivo . Mol Cell

Biol 2009.

19. Akhouayri O, Quelo I, St-Arnaud R: Sequence-specific DNA binding by the alphaNAC

coactivator is required for potentiation of c-Jun-dependent transcription of the

osteocalcin gene . Mol Cell Biol 2005, 25 :3452-3460.

84 20. Elagib KE, Xiao M, Hussaini IM, Delehanty LL, Palmer LA, Racke FK, Birrer MJ,

Shanmugasundaram G, McDevitt MA, Goldfarb AN: Jun blockade of

erythropoiesis: role for repression of GATA-1 by HERP2 . Mol Cell Biol 2004,

24 :7779-7794.

21. Stilo R, Liguoro D, di Jeso B, Leonardi A, Vito P: The alpha-chain of the nascent

polypeptide-associated complex binds to and regulates FADD function . Biochem

Biophys Res Commun 2003, 303 :1034-1041.

22. Endharti AT, Zhou YW, Nakashima I, Suzuki H: Galectin-1 supports survival of naive

T cells without promoting cell proliferation . Eur J Immunol 2005, 35 :86-97.

23. Al-Shanti N, Aldahoodi Z: Inhibition of alpha nascent polypeptide associated complex

protein may induce proliferation, differentiation and enhance the cytotoxic

activity of human CD8+ T cells . J Clin Immunol 2006, 26 :457-464.

24. Al-Shanti N, Steward CG, Garland RJ, Rowbottom AW: Investigation of alpha nascent

polypeptide-associated complex functions in a human CD8(+) T cell ex vivo

expansion model using antisense oligonucleotides . Immunology 2004, 112 :397-403.

25. Kitamura T, Tange T, Terasawa T, Chiba S, Kuwaki T, Miyagawa K, Piao YF, Miyazono

K, Urabe A, Takaku F: Establishment and characterization of a unique human cell

line that proliferates dependently on GM-CSF, IL-3, or erythropoietin . J Cell

Physiol 1989, 140 :323-334.

26. Graham RC, Jr., Karnovsky MJ: The early stages of absorption of injected horseradish

peroxidase in the proximal tubules of mouse kidney: ultrastructural

cytochemistry by a new technique . J Histochem Cytochem 1966, 14 :291-302.

27. Sirven A, Ravet E, Charneau P, Zennou V, Coulombel L, Guetard D, Pflumio F, Dubart-

Kupperschmitt A: Enhanced transgene expression in cord blood CD34(+)-derived

hematopoietic cells, including developing T cells and NOD/SCID mouse

85 repopulating cells, following transduction with modified trip lentiviral vectors .

Mol Ther 2001, 3:438-448.

28. Jiang L, He L, Fountoulakis M: Comparison of protein precipitation methods for

sample preparation prior to proteomic analysis . Journal of Chromatography A

2004, 1023 :317-320.

29. Laemmli UK: Cleavage of structural proteins during the assembly of the head of

bacteriophage T4 . Nature 1970, 227 :680-685.

30. Shevchenko A, Loboda A, Ens W, Schraven B, Standing KG: Archived polyacrylamide

gels as a resource for proteome characterization by mass spectrometry .

Electrophoresis 2001, 22 :1194-1203.

31. Frydman J, Nimmesgern E, Ohtsuka K, Hartl FU: Folding of nascent polypeptide chains

in a high molecular mass assembly with molecular chaperones . Nature 1994,

370 :111-117.

32. Wiedmann B, Sakai H, Davis TA, Wiedmann M: A protein complex required for

signal-sequence-specific sorting and translocation . Nature 1994, 370 :434-440.

33. Plath K, Rapoport TA: Spontaneous release of cytosolic proteins from

posttranslational substrates before their transport into the endoplasmic

reticulum . J Cell Biol 2000, 151 :167-178.

34. Gebauer M, Melki R, Gehring U: The chaperone cofactor Hop/p60 interacts with the

cytosolic chaperonin-containing TCP-1 and affects its nucleotide exchange and

protein folding activities . J Biol Chem 1998, 273 :29475-29480.

35. Hauri HP, Kappeler F, Andersson H, Appenzeller C: ERGIC-53 and traffic in the

secretory pathway . J Cell Sci 2000, 113 ( Pt 4) :587-596.

36. Appenzeller C, Andersson H, Kappeler F, Hauri HP: The lectin ERGIC-53 is a cargo

transport receptor for glycoproteins . Nat Cell Biol 1999, 1:330-334.

86 37. Nichols WC, Seligsohn U, Zivelin A, Terry VH, Hertel CE, Wheatley MA, Moussalli MJ,

Hauri HP, Ciavarella N, Kaufman RJ, et al.: Mutations in the ER-Golgi

intermediate compartment protein ERGIC-53 cause combined deficiency of

coagulation factors V and VIII . Cell 1998, 93 :61-70.

38. Chklovskaia E, Jansen W, Nissen C, Lyman SD, Rahner C, Landmann L, Wodnar-

Filipowicz A: Mechanism of flt3 ligand expression in bone marrow failure:

translocation from intracellular stores to the surface of T lymphocytes after

chemotherapy-induced suppression of hematopoiesis . Blood 1999, 93 :2595-2604.

39. Moussalli M, Pipe SW, Hauri HP, Nichols WC, Ginsburg D, Kaufman RJ: Mannose-

dependent endoplasmic reticulum (ER)-Golgi intermediate compartment-53-

mediated ER to Golgi trafficking of coagulation factors V and VIII . J Biol Chem

1999, 274 :32539-32542.

40. Sawyer ST, Hankins WD: The functional form of the erythropoietin receptor is a 78-

kDa protein: correlation with cell surface expression, endocytosis, and

phosphorylation . Proc Natl Acad Sci U S A 1993, 90 :6849-6853.

41. Hilton DJ, Watowich SS, Murray PJ, Lodish HF: Increased cell surface expression and

enhanced folding in the endoplasmic reticulum of a mutant erythropoietin

receptor . Proc Natl Acad Sci U S A 1995, 92 :190-194.

42. Huang LJ, Constantinescu SN, Lodish HF: The N-terminal domain of Janus kinase 2 is

required for Golgi processing and cell surface expression of erythropoietin

receptor . Mol Cell 2001, 8:1327-1338.

43. D'Andrea AD, Zon LI: Erythropoietin receptor. Subunit structure and activation . J

Clin Invest 1990, 86 :681-687.

44. Neumann D, Yuk MH, Lodish HF, Lederkremer GZ: Blocking intracellular

degradation of the erythropoietin and asialoglycoprotein receptors by calpain

87 inhibitors does not result in the same increase in the levels of their membrane

and secreted forms . Biochem J 1996, 313 ( Pt 2) :391-399.

45. Neumann D, Wikstrom L, Watowich SS, Lodish HF: Intermediates in degradation of

the erythropoietin receptor accumulate and are degraded in lysosomes . J Biol

Chem 1993, 268 :13639-13649.

46. Supino-Rosin L, Yoshimura A, Altaratz H, Neumann D: A cytosolic domain of the

erythropoietin receptor contributes to endoplasmic reticulum-associated

degradation . Eur J Biochem 1999, 263 :410-419.

47. Yoshimura A, D'Andrea AD, Lodish HF: Friend spleen focus-forming virus

glycoprotein gp55 interacts with the erythropoietin receptor in the endoplasmic

reticulum and affects receptor metabolism . Proc Natl Acad Sci U S A 1990,

87 :4139-4143.

48. Wegrzyn RD, Hofmann D, Merz F, Nikolay R, Rauch T, Graf C, Deuerling E: A

conserved motif is prerequisite for the interaction of NAC with ribosomal protein

L23 and nascent chains . J Biol Chem 2006, 281 :2847-2857.

49. Wiedmann B, Prehn S: The nascent polypeptide-associated complex (NAC) of yeast

functions in the targeting process of ribosomes to the ER membrane . FEBS Lett

1999, 458 :51-54.

50. Rassow J, Pfanner N: Protein biogenesis: chaperones for nascent polypeptides . Curr

Biol 1996, 6:115-118.

51. Beatrix B, Sakai H, Wiedmann M: The alpha and beta subunit of the nascent

polypeptide-associated complex have distinct functions . J Biol Chem 2000,

275 :37838-37845.

52. Pfund C, Lopez-Hoyo N, Ziegelhoffer T, Schilke BA, Lopez-Buesa P, Walter WA,

Wiedmann M, Craig EA: The molecular chaperone Ssb from Saccharomyces

88 cerevisiae is a component of the ribosome-nascent chain complex . Embo J 1998,

17 :3981-3989.

53. Bukau B, Deuerling E, Pfund C, Craig EA: Getting newly synthesized proteins into

shape . Cell 2000, 101 :119-122.

54. Kramer G, Boehringer D, Ban N, Bukau B: The ribosome as a platform for co-

translational processing, folding and targeting of newly synthesized proteins . Nat

Struct Mol Biol 2009, 16 :589-597.

55. Wang S, Sakai H, Wiedmann M: NAC covers ribosome-associated nascent chains

thereby forming a protective environment for regions of nascent chains just

emerging from the peptidyl transferase center . J Cell Biol 1995, 130 :519-528.

56. Vollenweider F, Kappeler F, Itin C, Hauri HP: Mistargeting of the lectin ERGIC-53 to

the endoplasmic reticulum of HeLa cells impairs the secretion of a lysosomal

enzyme . J Cell Biol 1998, 142 :377-389.

57. Nyfeler B, Reiterer V, Wendeler MW, Stefan E, Zhang B, Michnick SW, Hauri HP:

Identification of ERGIC-53 as an intracellular transport receptor of alpha1-

antitrypsin . J Cell Biol 2008, 180 :705-712.

89 A TEV cleavage site S-tag

EF1- LTR 18pb ! promoter NAC A LTR U3 !U3 216pb

TF-1 TF-1 S-tagged NACA

47.5 kDa S-tagged-NACA

32.5 kDa Endogenous NACA

WB NACA

C D0 D1 D2 D3 40 TF-1

30 3% 5% 14% 20% TF-1 NACA 20

5% 10% 20% 34%

10 TF-1

TF-1 %of benzidine-positive cells S-tagged cells positives benzidines of % TF-1 NACA NACA TF-1 S-tagged NACA 7% 12% 24% 36% 0 D0 D1 D2 D3 Days of culture with EPO

Figure 1 . Construction of fusion protein S-tagged NACA and validation of it function in erythroid differentiation: A . Schematic representation of lentiviral construct with S-tagged NACA composed with TEV cleavage site between S-tag and NACA. B. Western blot analysis of NACA in TF-1 and TF-1 S-tagged NACA total cells lysate. C. Benzidine staining of TF-1, TF-1 NACA and TF-1 S-tagged NACA cultivated with EPO. Graphic representation of results of benzidine assays ±SD of 3 independents experiences. Graphic representation of results of Benzidine assays of TF-1, TF-1 NACA and TF-1 S-tagged NAC A cultivated with GM-CSF ±SD of 3 independent experiences.

90 A S-beads Lysate S-beads TEV Cleava ge

S-tagged NACA + + - + - + 47.5 kDa S-tagged NACA S-tagged NACA (cleaved)

Expo 5’ Expo 1’

WB NACA

B S-tagged NACA Protein identity MW Score No of - + Mascot Peptides matched

HSP90 83 57 13 200 HSP70 71 65 8 116.3 97.4 HSP90 HSP60 61 47 8 66.3 HSP70 HSP60 TCP1 beta 58 54 10 55.4 TCP1b HSP40 ERGIC-53 HSP40 57 82 16 36.5 NACA 31 ERGIC-53 53 72 14 21.5 NACA 23 32 6 14.4 BTF3 BTF3 22 67 7

1597.781 C D

3 5 IC G RG Ig E Lysate IP IP 62kDa WB ERGIC-53 47kDa 47kDa WB NACA 32.5kDa

1 MAGSRQRGLR ARVRPLFCAL LLSLGRFVRG DGVGGDPAVA LPHRRFEYKY 51 SFK GPHLVQS DGTVPFWAHA GNAIPSSDQI R VAPSLKSQR GSVWTKTK AA 101 FENWEVEVTF R VTGRGRIGA DGLAIWYAEN QGLEGPVFGS ADLWNGVGIF 151 FDSFDNDGKK NNPAIVIIGN NGQIHYDHQN DGASQALASC QRDFR NKPYP 201 VR AKITYYQN TLTVMINNGF TPDKNDYEFC AKVENMIIPA QGHFGISAAT 251 GGLADDHDVL SFLTFQLTEP GKEPPTPDKE ISEKEKEK YQ EEFEHFQQEL 301 DK KKEEFQK G HPDLQGQPAE EIFESVGDR E LR QVFEGQNR IHLEIKQLNR 351 QLDMILDEQR RYVSSLTEEI SKR GAGMPGQ HGQITQQELD TVVKTQHEIL 401 R QVNEMKNSM SETVR LVSGM QHPGSAGGVY ETTQHFIDIK EHLHIVKR DI 451 DNLVQR NMPS NEKPKCPELP PFPSCLSTVH FIIFVVVQTV LFIGYIMYRS 501 QQEAAAKKFF

Figure 2 . Identification of ERGIC-53 as novel interactor of NACA : A . Western blot analysis o f steps of purification of S-tagged NACA by binding on S-beads, followed of TEV cleavage in TF1 cells lysate without (-) or with (+) S-tagged NACA. B. Proteins purified with S-tagged-NACA were resolved on an SDS–polyacrylamide gel and silver stained. The identity of 8 bands determined by MALDI-TOF- MS peptide finder printing. The searches were made using the MASCOT search engine (http://www.matrixscience.com). The peptide masses were matched with the theoretical peptide masses of al proteins in the NCBI nonredundance database. C. Spectrum of the 53 kDa protein band as ERGIC-53 by mass spectrometry. The identity of bands determined by MALDI-TOF-MS peptide finder printing. The searches were made using the MASCOT search engine (http://www.matrixscience.com). The peptide masses were matched with the theoretical peptide masses of proteins in the NCBI nonredundance database. Peptide sequence of ERGIC-53 showing the peptide coverage (bold sequence) from the mass spectrometry analysis. D . Co- immunoprecipitation of NACA (down panel) with ERGIC-53 (upper panel) in TF-1 cells.

91 Lysate. IP EPO-R . TF-1 Ctrl TF-1

WB EPO-R 62 KDa

WB ERGIC-53 47 KDa

32 KDa WB NACA

Figure 3 . EPO-R interacts with ERGIC-53 and NACA: Co-immunoprecipitation of EPO-R with ERGIC-53 and NACA in TF-1 cells. COS serve as negative control.

A B IP EPO-R . shcontrol shERGIC-53 Lysate Ctrl shERGIC . TF1 + - dox Dox + - + - 62KDa WB EPO-R 47 kDa WB ERGIC-53 WB JAK2 WB GRB2 83KDa 25 kDa 32.5 KDa WB NACA

C 25

shcontrol shERGIC-53 s + Dox - Dox + Dox - Dox 20 15

5 Counts 16% Counts 14% Counts 3% Counts 17% % of EPO-R positive cell EPO-R %positive of 0 Dox + - + - sh sh , , EPO-R-PE control ERGIC53 100

80 Counts 97%Counts 96%Counts 96% Counts 93% 60

20 % of KIT positive cells positive KIT % of 0 Dox KIT-PE + - + - sh,sh , D control ERGIC53 shERGIC-53 +dox -dox 1.2 1 0.8 EPO-R 0.6 0.4 0.2 0 ratio of EPO-R positive cells DIC dox + -

Figure 4. Lack of ERGIC-53 alters EPO-R expression on cells surface : A. Western blot analysis o f ERGIC-53 in TF-1 cell lines transduced by shERGIC-53 or shcontrol, induce (+ dox) or not induced (-dox) b y doxycyclin during five days. B. Co-immunoprecipitation of EPO-R with JAK2 and NACA, in doxycyclin inducible TF1 shERGIC-53 cells lysate. C. Cytometry analysis of EPO-R and KIT in TF-1 cells surface transduced by doxycyclin inducible shERGIC-53 or shcontrol. Histogram plot show IgG2b-PE or IgG1-PE in overlay, and EPO-R-PE or KIT-PE in grey pic. Graphic representation is ±SD of 5 experiments. D. Confocal analysis of membrane EPO-R (MAB307) labeling by immunofluorescence on TF-1 shERGIC-53 cells induced (+dox) or not induced (-dox) by doxycyclin. DIC Differential Interference Contrast microscopy. Graphic representation of ratio of EPO-R positive cells is based on counting of about 100 cells by picture ±SD of 3 pictures.

93 TF-1 TF-1 NAC A 35 30 25 20 14% 29% 15 10 5 %of EPO-R positive cells 0 EPO-R-PE TF-1 TF-1 NACA

Figure 5. NACA enhance EPO-R cells surface expression . Representative results of detection o f EPO-R at the cell surface, in TF-1 or TF-1 NACA cultivated with GM-CSF. Histogram plot show IgG2b- PE in overlay pic, and EPOR-PE in grey pic. Graphic representation ±SD of 3 experiences.

94 Résultats supplémentaires ! Mesure d’EPO-R à la surface cellulaire de cellules stimulées en EPO

Dans la figure 4C de l’article, la mesure d’EPO-R par cytométrie de flux à la surface des cellules TF-1 cultivées en GM-CSF (shcontrol et shERGIC-53) met en évident un pourcentage moyennant les 15% de cellules EPO-R positives avec une MFI très basse. Ce résultat suggère que 1) les cellules TF-1 ont peu de molécules d’EPO-R à leur surface cellulaire lorsqu’elles sont cultivées en GM-CSF ; 2) l’outil sérologique n’est pas très sensible. Nos cellules transduites par le vecteur shRNA sont GFP positive ce qui restreint le choix de l’outil sérologique à l’EPO-R-PE de R&D ( le seul commercialisé directement couplé à un fluorochrome phycoérythrine). Ainsi, le seul paramètre sur lequel il est possible de jouer est d’augmenter le nombre de molécules d’EPO-R à la surface cellulaire, autrement dit de mesurer l’EPO-R de cellules cultivées en EPO. J’ai donc effectué la mesure de l’EPO-R à la surface cellulaire par cytométrie de flux sur des cellules cultivées 5 jours en présence de doxycycline et 24h en présence d’EPO.

shcontrol shERGIC-53 50 45 + Dox - Dox + Dox - Dox 40 35 30 25 20 15 10 Counts Counts Counts Counts 44% 44% 16% 45% 5 % of EPO-R positive cells EPO-R % positive of 0 Dox + - + - sh sh , , control ERGIC53 EPO-R-PE

Figure 22 : Lack of ERGIC-53 alters EPO-R expression on cells surface Cytometry analysis of EPO-R in TF-1 cells surface transduced by doxycyclin inducible shERGIC-53 or shcontrol and cultivated with EPO during 24h. Histogram plot show IgG2b-PE in overlay, and EPO-R-PE in grey pic. Ce résultat est préliminaire, car l’expérience ne fut réalisée qu’une seule fois. Il permet toutefois de mettre en évidence que 44% des cellules sont EPO-R positives au bout de 24h d’EPO et seulement 16% lorsque ERGIC-53 est réprimée. De plus, la MFI est augmentée. Ce résultat confirme que la protéine ERGIC-53 participe au transport d’EPO-R vers la surface cellulaire. Afin de valider ce résultat, il sera nécessaire de le reproduire, voir même de l’améliorer en testant le jour le plus adapté pour la stimulation par EPO des cellules. Il sera

95 également intéressant d’étudier biochimiquement les complexes associés à EPO-R des cellules sous EPO, et la phosphorylation de JAK2 qui théoriquement devrait être réduite dans les cellules réprimées en ERGIC-53.

! Détermination de l’interaction entre EPO-R/ERGIC-53 et NACA

L’interaction entre EPO-R, ERGIC-53 et NACA a été démontré par des expériences de co-immunopitation d’EPO-R avec un anticorps spécifique anti-EPO-R M-20 de Santa- cruz, avec NACA et ERGIC-53 (voir figure 3 de l’article). Dans le but de confirmer ces interactions, nous avons également procédés à la co-immunoprecipitation des ces molécules en utilisant d’autres anticorps spécifiques : l’anti-ERGIC-53 et l’anti-EPO-R c-236 (généreusement donné par P. Mayeux).

3 A 5 IC G RG Ig E Lysate IP IP

WB EPO-R 62 kDa

B Lysate IP EPOR C-236 . TF-1 COS TF-1

62 kDa WB EPO-R 32 kDa WB NACA

Figure 23 : EPO-R interacts with ERGIC-53 and NACA : A : Co-immunoprecipitation of ERGIC-53 with EPO-R in TF-1 cells. Immunoprecipitation with IgG1 antibodies serve as negative control. B : Co-immunoprecipitation of EPO-R (with EPO-R c-236 antibodies) with NACA in TF-1 cells. COS serve as negative control.

Ces résultats confirment ceux figurant en figure 3 de l’article. Cependant, la résolution de gel SDS-PAGE utilisée pour l’expérience en A ne permet pas de distinguer le doublet d’EPO-R. Cette expérience devrait donc être refaite dans des conditions de séparation permettant de visualiser les deux formes de la molécule EPO-R. En figure B, l’immunoblot NACA contient un bruit de fond qui interfère avec une bonne lisibilité de la protéine NACA. Cette expérience devrait être refaite en utilisant des anticorps secondaires minimisant les interférences produites par les Ig de l’immunoprécipitation telles que la protéine A-HRP utilisée dans l’expérience de la figure 3 de l’article. Il serait complémentaire de rechercher la

96 protéine ERGIC-53 co-immunoprécipitée par l’anti-EPO-R c-236. Ces expériences ont été réalisées à partir de lysat de cellules TF-1 cultivées en GM-CSF. La mise en évidence de ces interactions de NACA/EPO-R/ERGIC-53 dans des TF-1 EPO pourrait être déterminée.

97 Commentaires

L’identification des chaperonnes, de NAC et de ERGIC-53 comme interacteurs de NACA permet de placer NACA dans la machinerie traductionnelle et le contrôle qualité des protéines nouvellement synthétisées dans les cellules TF-1 (Rassow and Pfanner, 1996; Saibil, 2008). Ainsi, NACA est trouvé dans la machinerie traductionnel de la levure (Wegrzyn et al., 2006; Wiedmann and Prehn, 1999), des cellules de cerveau bovin (Beatrix et al., 2000; Wiedmann et al., 1994), des réticulocytes (Plath and Rapoport, 2000) et des cellules érythroleucémiques humaines. Ces données soutiennent l’hypothèse selon laquelle NACA pourrait être ubiquitairement impliquée dans le tri des protéines naissantes excepté dans les ostéoblastes (Quelo et al., 2002).

Dans la cellule érythroleucémique humaine TF-1, la protéine NACA est donc associée aux polypeptides naissants. Les données précédantes n’ont pas permis de déterminer quand NACA se dissocie du polypeptide naissant à destination du RE. Cependant, la découverte d’ERGIC-53 comme nouvel interacteur de NACA suggère que NACA reste associé à la protéine nouvellement synthétisé au moins jusqu’à son association avec ERGIC-53 sur la membrane du RE. Il est possible alors que NACA reste associée jusqu’à cette étape afin de protéger cette nouvelle protéine du clivage protéolytique (Wang et al., 1995). En effet, la protéine NACA pourrait être une sorte de signal protégeant les protéines nouvellement synthétisées de la dégradation. NACA comporte un domaine UBA (Ubiquitin associated) sur sa partie C-terminale (voir figure 1 et 2 ) (Spreter et al., 2005), qui est trouvé sur diverses protéines impliquées dans la voie ubiquitine-protéasome pour la dégradation des protéines, le contrôle du cycle cellulaire et de la réparation de l’ADN. Chez la levure, l’ubiquination de NACA et NAC a pour fonction la stabilisation du complexe NAC au ribosome et le protège de la dégradation (Panasenko et al., 2009). De plus, NACA a une interaction directe avec l’unité 20S CP (core particle) du protéasome qui aurait hypothétiquement pour fonction de répondre aux dommages traductionnels causés aux protéines nouvellement synthétisées.

En conclusion, la protéine NACA pourrait être le coordinateur entre la synthèse des protéines et leur dégradation.

98 Protéasome (2) A NAC TRIC/ HSP40 CTT (1) HSP70 P R (3) A S NAC BiP NAC AAAAAA

Réticulum Endoplasmique CR (4) CX N N A A C C A A (5)

(6)

NANA

C C

A A

ERGIC

CR Calréticuline Glycoprotéine Ribosome ERGIC-53 CX Calnexine

Figure 24 : Représentation schématique des étapes précoces de la voie de sécrétion. (1) la protéine en cours de traduction s’associe à NACA et NAC. La protéine SRP reconnaît la séquence signale sur la protéine naissante et l’oriente dans la membrane du RE. (2) la protéine est repliée par les chaperonnes. (3) la protéine mal repliée est transloquée hors du RE et dégradée par le protéasome. (4) la protéine repliée correctement est glycosylée, controlée par la calréticuline et la calnexine (5) puis s’associe avec ERGIC-53. (6) L’association avec ERGIC- 53 permet à la glycoprotéine d’être exportée du RE. Il n’est pas encore clair si l’association de NACA avec ERGIC-53 existe sur le compartiment ERGIC.

99 Article 3 : NACA rescue erythroid differentiation of early stage myelodysplastic syndrome-deriving precursors and predict response to EPO treatment.

100 Introduction

" Définition des Syndromes Myélodysplasiques

Les syndromes myélodysplasiques (SMD) sont des maladies de la moelle osseuse touchant la cellule souche hématopoïétique totipotente (Greenberg, 1983; Greenberg and Mara, 1979; Linman and Bagby, 1978; Saarni and Linman, 1973). Cette affection clonale de la cellule souche hématopoïétique est caractérisée par : – une hématopoïèse inefficace – des cytopénies progressives – une moelle généralement riche – une dysplasie de 1 ou plusieurs lignées – un % de blastes variables Les SMD comprend les anémies réfractaires qui se manifestent de façon prédominante par une insuffisance de l’érythropoïèse de type qualitative (présence de signes de dysérythropoïèse puis avortement intramédullaire des érythroblastes et érythropoïèse inefficace) L’analyse hématologique met en évidence les diminutions de une ou de plusieurs lignées mégacaryocytaire, érythrocytaire, granuleuse, et permet de diagnostiquer l’anémie normochrome normocytaire ou macrocytaire non régénérative, souvent accompagnée d’une neutropénie avec baisse parallèle des monocytes, et une thrombopénie dans 50% des cas. Généralement, les SMD touchent les personnes âgées, la majorité des patients ayant plus de 65 ans. Les SMD n'abrègent pas forcément l'espérance de vie. En effet, la moelle osseuse défectueuse suit une évolution très progressive, et les personnes âgées meurent souvent d'autres maladies que de leur SMD. De plus, un SMD peut évoluer dans 30% des cas environ vers une Leucémie Aiguë Myéloïde (LAM). Les causes des SMD sont males connues. Il semblerait que certaines personnes soient prédisposées aux SMD. La radiothérapie et la chimiothérapie peuvent jouer un rôle déclencheur. Les patients qui suivent un traitement par chimiothérapie pour certains cancers risquent de contracter des SMD pendant les dix ans qui suivent le traitement. L'exposition à certains produits chimiques présents dans l'environnement peut aussi être un déclencheur. Cependant, à part le benzène (maintenant très largement éliminé de notre environnement), on ignore précisément quels sont les produits chimiques concernés. On fait donc une distinction entre les SMD primaires (sans cause connue, très majoritaires) et les SMD secondaires

101 (associés à un agent causal). Dans ce dernier cas, on trouve plus souvent des anomalies chromosomiques dans la moelle osseuse, et la maladie évolue plus souvent vers la LAM.

" Classification

Les syndromes myélodysplasiques (SMD) regroupent des syndromes extrêmement hétérogènes caractérisés par une ou plusieurs cytopénies diversement associées, et dus à des anomalies de la cellule souche hématopoïétique.

Il existe 2 classifications officielles conventionnellement utilisées : FAB et WHO FAB : Franco-Americano-Britannique établit en 1976 et révisé en 1982 par des médecins français, américains et britanniques, dans le but d’évaluer les risques potentiels et évolutifs des SMD (Bennett et al., 1976; Bennett et al., 1982).

Blastes Blastes Sidéroblastes Monocytes Type médullaires sanguins médullaires sanguins AR <5% <1% - (<15%) <1 x 10(9)/l ARS <5% <1% + (>15%) <1 x 10(9)/l AREB 5-20% <5% + / - <1 x 10(9)/l LMMC 5-20% <5% - >1 x 10(9)/l AREB-T 21-29% <30% + / - <1 x 10(9)/l Anémie Réfractaire (AR) Anémie Réfractaire avec sidéroblastes en couronne (ARS) Anémie Réfractaire avec excès de blastes (AREB) Anémie Réfractaire excès de blastes en transformation (AREB-T) Leucémie chronique myélomonocytique (LMMC)

102 WHO : World Health Organization en 2001, a introduit quelques modifications à la classification FAB (Harris et al., 1999; Harris et al., 2000; Vardiman et al., 2002). Une actualisation de cette classification a été publiée en 2008 (Bennett, 2009; Mufti et al., 2008).

Types Blastes médullaires Blastes sanguins CRDU : AR NR <5% <1% TR RARS <5% + sidéroblastes en courronne <1% <5% + sidéroblastes en courronne et RARS-t <1% thrombocytose CRDM <5% <1% CRDM-RS <5% + sidéroblastes en courronne <1% AREB1 5-9% <5% AREB2 10-20% <5% MDS del5q- Dysmégacaryopoièse <5% <5% MDSi <5% (CRDU) Cytopenie Réfractaire avec dysplasie uni-lignage (Anémie Réfractaire (AR), Neutropénie Réfractaire (NR) et Thrombocytopénie Réfractaire (TR)) (AR) Anémie Réfractaire avec sidéroblastes en couronne (RARS) Refractory anemia with ring sideroblastes en couronne et thrombocytose (RARS-t) Cytopénie Réfractaire avec Myélodysplasie Multilignée (CRDM) Cytopénie Réfractaire avec Myélodysplasie Multilignée avec sidéroblastes en couronne (CRDM-RS) Anémie Réfractaire avec excès de blastes (AREB) Syndromes Myélodysplasiques avec délétion génétique 5q- (MDS del5q-) Syndromes Myélodysplasiques inclassable (MDSi)

Ces deux classifications organisent les types de pathologies en fonction du pourcentage de blastes médullaires, des caractéristiques morphologiques dysplasiques des cellules du sang et de la moelle osseuse. La classification actuelle (WHO-2008) tient compte (i) du nombre de cytopénies périphériques, (ii) du pourcentage de blastes circulants et médullaires, (iii) de la présence de sidéroblastes en couronne (> 15 %), (iv) de la présence éventuelle de corps d’Auer, et (v) d’une anomalie cytogénétique, la délétion 5q isolée. Les SMD se classent également selon leur risque d’évolution en LAM: les SMD de bas risques ou ES-MDS (Early stage of myelodysplastic syndrome) (< 9% de blastes) et les SMD de haut risque AS-MDS (Advanced stage of myelodysplastic syndrome) (>10% de blastes). Ces 2 sous-groupes ne présentent pas les mêmes défaillances : les ES-MDS sont caractérisés par l’apoptose accrue de leur progéniteurs hématopoïétiques, tandis que les AS-MDS présentent un caractère myéloprolifératif.

103

Figure 25 : Représentation schématique du désordre clonal chez les 2 sous-groupes de MDS (extrait du site : http://www.md.ucl.ac.be/entites/mint/intr/hainaut/dossierprojet/ dossierdocsem/myelodysplasie/myelodysplasie.html)

" Mécanismes moléculaires défaillants des ES-MDS : l’apoptose

Il existe une augmentation de l’apoptose dans les progéniteurs hématopoïétiques des patients atteints de SMD de bas risque (ES-MDS), qui se traduit par des cytopénies du sang périphérique (Parker and Mufti, 2004). Cette apoptose est déclenchée aussi bien par des dérégulations de la voie extrinsèque que de la voie intrinsèque. Les récepteurs de mort tels que Fas, TNF # et TRAIL ainsi que la molécule adaptatrice FADD sont surexprimées chez un ensemble de patients atteints de ES-MDS (Claessens et al., 2002; Claessens et al., 2005; Fontenay-Roupie et al., 1999; Sawanobori et al., 2003; Zang et al., 2001). Un autre travail rapporte que l’apoptose médiée par Fas est plus importante pour les cellules de SMD ayant une trisomie 8, que pour les autres anomalies cytogénétiques (Sloand et al., 2002). L’implication de la voie extrinsèque de l’apoptose dans cette pathologie est responsable de la mort des progéniteurs érythroïdes des ES-MDS, ce qui a incité deux études à l’exploiter en une potentielle cible thérapeutique. La première étude a montré que l’expression ectopique d’un dominant négatif de FADD (FADD-DN) dans des progéniteurs hématopoïétiques issus de patients atteints de ES-MDS, rétablit la production de colonies BFU-E (Claessens et al.,

104 2005). La deuxième étude, bloqua la voie Fas par utilisation d’anticorps spécifiques, ce qui malheureusement, ne sauva pas les cellules de patients atteints de RARS de l’apoptose (Hellstrom-Lindberg et al., 2001). Les facteurs pro-apoptotiques tels que Bad, Bak, and Bcl-xS sont surexprimés dans un certain nombre de ES-MDS (Boudard et al., 2002). Il a été rapporté pour des patients atteints d’ARS, une fuite de cytochrome c qui entraîne l’activation des caspases (Tehranchi et al., 2003).

Contexte scientifique et situation du projet

Nous avons démontré précédemment que NACA est régulateur positif de la différenciation érythroïde humaine ‘‘normal’’(Lopez et al., 2005). Il a été démontré que FADD (qui est interacteur de NACA) est surexprimée chez les patients atteints de syndrome myélodysplasiques de bas risque (ES-MDS) ce qui induit l’apoptose accrue des progéniteurs érythroïdes (Claessens et al., 2005). De façon intéressante, NACA régule négativement FADD (Stilo et al., 2003). Etant donnée que NACA est impliquée dans l’apoptose ainsi que dans la différenciation érythroïde, nous avons étudié le rôle de NACA dans la différenciation érythroïde des syndromes myélodysplasiques de bas risque.

105 NACA rescues erythroid differentiation of early stage myelodysplasic syndrome-derived precursors and is an indicator of the response to EPO treatment.

Laetitia Stuhl, Véronique Gelsi-Boyer §, Virginie Trouplin §, Daniel Birnbaum, Norbert Vey §, Patrice

Dubreuil and Sophie Gomez.

Centre de Recherche en Cancérologie de Marseille, INSERM UMR891, 27 Bld Leï Roure, 13009 Marseille, France

§ Institut Paoli Calmettes, 232 Bld de Sainte Marguerite, 13273 Marseille Cedex 9, France

Summary (178 words)

We previously identified NACA (the alpha chain of the nascent polypeptide-associated complex) as a positive regulator of erythroid differentiation. Here, we report an investigation of the effects of NACA on the defective erythroid differentiation characteristic of Early Stage

Myelodysplastic syndromes (ES-MDS). The proportion of mature erythroid cells after culture of ES-MDS progenitor CD34+ cells transduced with a lentiviral vector encoding NACA and cultured in vitro in erythroid differentiation cell culture conditions was up to 3.5 fold greater following transduction with a lentiviral vector encoding NACA. Clonogenic analysis revealed that ectopic expression of NACA increases the number of BFU-E by up to 3 fold suggesting that NACA favors the survival of ES-MDS erythroid progenitors. These results indicate that ectopic expression of NACA inhibits the commitment to death and contributes to the survival and the differentiation of ES-MDS erythroid progenitor cells. We assayed NACA mRNA by

RT-qPCR in progenitor CD34+ cells from control subject and both ES-MDS and AS-MDS

(advanced stage-MDS) patients. There was no significant difference between the three cells types; however, the values for NACA mRNA abundance in ES-MDS CD34+ cells were

106 dispersed. We compared this dispersion to clinical characteristics and found significant correlation between NACA mRNA abundance and the response to rhuEPO treatment.

Introduction

Early stage myelodysplastic syndromes (ES-MDS) are a subgroup of myelodysplastic syndromes (MDS) characterized by clonal disorder of hematopoietic stem cells. Ineffective hematopoiesis is associated with various degrees of anemia, leukopenia, and thrombocytopenia related to dysplasia of one or more cell lineages [1-5]. Ineffective erythropoiesis of ES-MDS early progenitor CD34+ cells has been described and correlates with histological evidence of increased apoptosis of morphologically recognizable marrow cells [6-8].

Apoptosis of hematopoietic progenitor cells in the bone marrow of ES-MDS patients correlates with the deregulation of the two main pathways leading to apoptotic cell death: the extrinsic and the intrinsic apoptosis pathways. The intrinsic apoptosis pathway is activated during metabolic changes, resulting in depolarization of mitochondrial control by the Bcl2 family proteins, and release of mitochondrial proteins, including cytochrome c, leading to caspase-9 activation and apoptotic cell death (for a review, see [9]). The extrinsic apoptosis pathway involves cell surface death receptors, for example Fas, the tumor necrosis factor alpha (TNF ! , and the TNF-related apoptosis-inducing ligand (TRAIL); these factors recruit adapter proteins such as the Fas-associated death domain (FADD) and the TNF receptor- associated death domain (TRADD) (for a review, see [10]). The adapter proteins bind procaspase-8, resulting in autocatalytic cleavage and activation of the initiator caspase-8 in a so- called death-inducing signaling complex (DISC). This activation is regulated via the protein c-FLIP (FLICE-like inhibitory protein), a potent inhibitor of procaspase-8. Cross-talk between extrinsic and intrinsic apoptotic pathways occurs through proteins of the the caspase family.

107 Several studies of ES-MDS have reported abnormal spontaneous release of cytochrome c from mitochondria [11], overexpression of pro-apoptotic factors, particularly Bcl-2 family proteins (Bax and Bad) [12-14], and overexpression of the death receptors Fas, TNF , TRAIL and the adapter FADD [15-19]. Blocking the extrinsic apoptosis pathway in primary CD34+ progenitor cells from ES-MDS patient bone marrow by transduction with a dominant-negative mutant of FADD (FADDdn) inhibits caspase activity and cell death and rescues erythroid cell production [16]. This suggests that negative regulation of apoptotic pathways in ES-MDS erythroid progenitor cells is abnormal.

Interestingly, negative regulation of apoptosis has been described to be associated with the interaction between FADD and free NACA (the alpha chain of the nascent polypeptide- associated complex) in the cytosol [20].

NACA was first described in cytosol, where it forms a stable heterodimeric complex (called

NAC) with "NAC (BTF3) [21]. NAC is found in yeast and in mammalian cells, and is part of a larger complex associated with peptides emerging from ribosomes at the membrane of the endoplasmic reticulum (ER) [22-24]. NACA is also found in the nucleus as a transcriptional coactivator of c-Jun (transcription factor of the AP1 family leucine zipper) and TATAbox binding protein (TBP) in osteoblastic cells [25-27]. NACA can bind DNA specifically, and this DNA-binding capacity is required to potentiate the expression of both the AP-1-mediated osteocalcin and the type I collagen genes in osteoblasts during mineralization and bone formation [28,29]. NACA shuttles between the cytosol and the nucleus under the control of phosphorylation by either GSK3 " or ILK resulting in 26S proteasome degradation of NACA or in nuclear accumulation, respectively [30,31]. NACA regulates the survival of human

CD8+ T cells by acting as a negative regulator of their proliferation, differentiation and cytotoxic activity [32,33]. These various observations highlight the importance of NACA in survival and differentiation processes.

108 We previously reported that NACA is a positive regulator of erythroid differentiation [34].

The involvement of NACA in processes linked to apoptosis and erythroid differentiation prompted us to investigate the role of NACA in erythroid differentiation of ES-MDS cells.

We studied the effect of NACA overexpression in MDS hematopoietic progenitor cells from human bone marrow. We found that NACA rescues erythroid differentiation of ES-MDS cells in vitro. We then investigated whether NACA is deregulated in various categories of MDS disease, by assaying of NACA mRNA in CD34+ cells from 21 ES-MDS patients, 10 AS-

MDS patients and six healthy subjects. The expression of NACA was not deregulated in MDS

CD34+ cells, but the abundance of NACA mRNA in ES-MDS CD34+ cells differed between patients. Comparison of the abundance of NACA mRNA and clinical characteristics indicated that the level of NACA mRNA may be a predictive marker for the response of ES-MDS to rhuEPO treatment.

Materials and Methods

Patients samples

Thirty-one patients (21 ES-MDS patients and 10 AS-MDS (advanced stage-MDS) patients) and six control donors (undergoing BM aspiration because of peripheral neutropenia, which proved to be non-pathological upon morphological BM examination) attending the Institut

Paoli Calmettes (Marseille, France) were recruited and gave their written, informed consent to be included in this study. Bone marrow cells were collected freshly from all the subjects.

These patients were not receiving medical treatment at the time of bone marrow cell collection (except for two patients). Clinical and cytological characteristics were assessed, and pathology diagnosed, in the hematology/cytology unit of the Institut Paoli Calmettes

(Marseille), according to the new World Health Organization (WHO 2008) classification [35-

109 39] (Table 1). Patients with MDS were classified into two groups: ES-MDS (less than 9% medullary blasts), and AS-MDS (between 10 and 20% medullary blasts).

The subjects included: 21 ES-MDS patients (2 MDSu, 1 RA, 10 RARS and 8 RAEB1 with less than 9% medullary blasts) and 10 AS-MDS patients (10 RAEB2). On the basis of the

International Prognostic Scoring System (IPSS), ES-MDS patients were classified in the low

(n=9), intermediate-1 (n=6) intermediate-2 (n=4) risk groups (score not determined for n=2) and AS-MDS patients were classified in the intermediate-2 (n=5) and high (n=4) risk groups

(score not determined for n=1). The mean age was 73 years and 72 years for ES-MDS and

AS-MDS patients, respectively. The mean age of the six control subjects was 67 years (Table

1).

Karyotypic abnormalities were detected by conventional analysis in about 26% of ES-MDS and 67% of AS-MDS patients.

Eleven patients were treated with rhEPO: after bone marrow cell collection, seven received rhEPO alone and two received both G-CSF and rhEPO; two patients received both G-CSF and rhEPO treatment starting at least 12 months before bone marrow cell collection.

Responsiveness to treatment was evaluated according to IWG 2006 criteria [40].

Enrichment of CD34+ cells and cells culture

Bone marrow samples were collected from patients and control subjects by iliac aspiration.

CD34+ cells were purified by magnetic cell separation (MACS) technology according to the manufacturer’s recommendations (Miltenyi Biotech, Bergish Gladbach, Germany). Expansion of purified CD34+ cells was performed in Iscove's Modified Dulbecco's Media (IMDM) containing 20% BIT 9500 [mixture of bovine serum albumin (BSA), insulin and transferrin

(Stem Cell Technologies, Meylan, France)], 2 mM/L glutamine, 200 IU/ml penicillin, and 100

)g/ml streptomycin, 80 ng/ml recombinant human stem cell factor (rhuSCF; Amgen,

110 Thousand Oaks, CA), 10 ng/ml thrombopoietin (TPO), 100 ng/ml Flt3 ligand (rhuFlt3-L;

DNAX, Palo Alto, CA) and 60 ng/ml recombinant human interleukin-3 (rhuIL-3; R&D

Systems Europe, UK). Erythroid cells were generated from CD34+ cells cultured in IMDM medium containing 20% BIT 9500, 2 mM/L glutamine, 200 IU/ml penicillin, 100 )g/ml streptomycin, 10 ng/ml rhuIL-3, 25 ng/ml rhuSCF, 10 ng/ml rhuIL-6, and 2 IU/ml recombinant human erythropoietin (rhuEpo) (gift by N. Casadevall) for 11 days to promote red-cell differentiation as previously described [42]. Aliquots of at least 3x10 4 cells were cytospun onto glass slides, and stained using May-Grunwald-Giemsa (MGG) methodology.

Production of lentivirus and cell transduction

Lentiviral particles were produced with the TRIP U3-EF1 -IRES vector as previously described [34,43]. CD34+ cells were cultured under expansion conditions for 24h or 48h and then transduced with either NACA or EGFP lentiviral vector particles added to a concentration corresponding to 2500 ng p24/ml [44]. After 24 hours at 37°C, a second aliquot of vector particles was added to the cultures. After an additional 24-hour incubation, the cells were harvested by centrifugation, washed and cultured under erythroid cell differentiation conditions.

Clonogenic progenitor assays

Cells harvested from the expansion culture were seeded at 2x10 3 cells/ml in Methyl Cult

H4230 (StemCell) containing 3 IU/ml rhuEpo, 50 ng/ml rhuSCF, 10ng/ml rhuIL-3, and 10 ng/ml granulocyte-macrophage colony-stimulating factor (rhuGM-CSF Leukine®; Berlex

Laboratories Inc, CA, USA). Erythroid burst-forming unit (BFU-E)–derived erythroid colonies were counted 17 days later under an inverted microscope.

111

RNA extraction and quantitative RT-PCR

Total RNA was isolated from fresh CD34+ cells using NucleoSpin® RNA/DNA Buffer Set kits (Macherey-Nagel, Düren, Germany) according the manufacturer’s instructions. Total

RNA was assessed for quality by electrophoresis on a Bioanalyzer 2100 (Agilent

Technologies, Waldbronn, Germany) and quantified by measuring optical density (260 nm).

Reverse-transcription PCR (RT-PCR) was performed with SuperScript II RNase H-Reverse

Transcriptase (Life Technologies, Invitrogen, Cergy Pontoise, France) according to the manufacturer’s instructions, using a poly-d(T) random primer (Amersham Pharmacia

Biotech) and 25ng of total RNA. Detection and relative quantification of endogenous NACA mRNA was performed with a LightCycler (Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s instructions. Glyceraldehyde-3-phosphate dehydrogenase

(GAPDH) mRNA was used as an internal standard for the amount of mRNA in each sample.

PCR reactions were performed with a LightCycler FastStart DNA Master plus SYBR Green I

PCR Kit (Roche Diagnostics, Mannheim, Germany). PCR was carried out in a final volume of

20 )l, with each primer at 0.5 )M, 4 )l of Master mix containing the reaction buffer, FastStart

Taq DNA polymerase and double-strand DNA-specific SYBR Green I dye in a LightCycler with a 10-minute preincubation at 95°C, followed by 40 cycles of 15 seconds at 95°C, 5 seconds at 60°C and 14 seconds for GAPDH or 26 seconds for NACA at 72°C. The following primers were used: GAPDH-specific forward primer 5 a-GTCATCCCTGAGCTAGACGG-3 a and reverse primer 5 a-GGGTCTTACTCCTTGGAGGC-3 a; NACA-specific forward primer 5 a-

GGTCTGGAACAGAATCTGACAGTGATGAATC-3 a and reverse primer 5 a-

CCAAGCTGCAGTTACTCCTTTGACACACC-3 a. LightCycler 4.0 software and absolute quantification at 530 nm were used for analyses of quantitative real-time PCR curves. Each transcript was similarly quantified in TF-1 cells for calibration.

112

Statistical analysis

The nonparametric Mann-Whitney test, with Prism software (GraphPad Software, San Diego,

CA), was used to compare amounts of NACA mRNA between groups. P-values < 0.05 for differences between medians were considered significant.

Results

Overexpression of NACA rescues erythroid differentiation in ES-MDS

We investigated whether NACA is involved in ineffective erythroid differentiation of ES-

MDS. CD34+ progenitor cells from bone marrow from patients with MDS were transduced with lentiviral particles expressing NACA and cultured under erythroid differentiation conditions. Fresh bone marrow cells, classified both according to diagnosis and CD34+ enrichment, were used. The number of samples in each group containing enough cells for

RNA extraction, efficient transduction, clonogenic assay and morphological analysis was limited. We thus used 21 ES-MDS and ten AS-MDS samples for RNA extraction, and five

ES-MDS and four AS-MDS samples for erythroid differentiation assays.

Samples with a sufficient number of cells (3x10 4 ±1.4x10 4 cells) for in vitro culture were transduced with lentiviral particles expressing NACA as described in [45]. EGFP expression analysis revealed an efficiency of transduction of 73% ( 16%) after 48h of infection. The expression of EGFP, in EGFP-transduced cells remained constant until the end of the culture

(11 days), indicating that both transduction and culture conditions were appropriate. ES-MDS cell samples transduced with NACA contained more mature erythroblasts and fewer immature erythroblasts than the control EGFP-transduced cells samples as assessed by morphological analysis based on MGG staining (Fig 1; 16% versus 3% acidophilic erythroblasts, 25% versus

6% polychromatophilic erythroblasts and 29% versus 13% basophilic erythroblasts, for

113 NACA- and GFP-transduced cells samples, respectively). However, NACA transduction of

AS-MDS samples did not have this erythroid maturation effect (Fig. 1). As ES-MDS stem cells undergo apoptosis and blast cells from AS-MDS are resistant to apoptosis, our findings suggest that NACA may inhibit the apoptosis of ES-MDS cells. This experiment demonstrates that transduction with NACA rescues erythroid maturation of ES-MDS CD34+ cells in vitro.

Overexpression of NACA enhances survival of ES-MDS erythroid progenitor cells

Defective or abnormal erythroid colony formation progenitors (BFU-E, CFUE) are a common feature of MDS [15,16,46,47]. We performed standard clonogenic assays with NACA- transduced ES-MDS CD34+ cells to test the differentiation potential of NACA on erythroid progenitors. The number of BFU-E-derived colonies recovered was 5-fold higher for NACA- transduced cells than for EGFP-transduced cells (Fig 2). This suggests that NACA maintains survival of ES-MDS primary CD34+ progenitor cells.

NACA mRNA is not deregulated in ES-MDS

To explore further the role of ectopic expression of NACA in survival and differentiation of we investigated NACA mRNA in ES-MDS CD34+ progenitor cells. We assayed NACA mRNA in CD34+ progenitor cells from 21 ES-MDS patients, ten AS-MDS patients and six control subjects by RT-qPCR. Values for NACA mRNA were normalized to those for

GAPDH (Fig 3) and glucuronidase (GUS) (data not shown) also assayed by RT-qPCR in each sample. Similar results were obtained for these two housekeeping genes. Values for NACA mRNA abundance are reported relative to that in TF1 cells arbitrarily defined as 1.

The abundance of NACA mRNA in CD34+ cells from the six control subjects was between

1.12 and 2.03 (median: 1.54); values for the 21 ES-MDS patients were between 0.87 and 3.41

114 (median 1.48), and those for the ten AS-MDS were between 1.26 and 3.22 (median 2.06).

Values for NACA mRNA abundance did not differ significantly between ES-MDS and other groups (Mann-Whitney p = 0.62 for control versus ES-MDS and p = 0.49 for ES-MDS versus

AS-MDS). This suggests that the expression of NACA is not deregulated in MDS CD34+ cells (Fig 3). However, there was substantial interindividual variability in the amounts of

NACA mRNA in ES-MDS CD34+ cells (0.87 to 3.4).

NACA mRNA abundance is predictive of response to rhuEPO treatment

We investigated whether this dispersion correlated with the clinical characteristics of the patients. We used the Mann Whitney test and several clinical characteristics of patients previously used [48,49] for the development of a prognostic scoring system for MDS patients: age, sex, IPSS, Hb level and response to recombinant human erythropoietin (rhuEPO) treatment (Table 2). Eleven of the patients were treated with rhuEPO (nine after diagnosis, and two before). The analysis identified a significant link between NACA mRNA abundance and the response of ES-MDS patients to rhuEPO treatment. There was a significant difference in the expression of NACA in CD34+ cells between the five non-responders (median 1.44; range 0.78 – 1.79) and five of the six responders (median 2.63; range 2.45 – 3.41, the other one patient: 1.37) to rhuEPO treatment (Fig 4). This suggests that the level of NACA expression may define EPO-responsive and non-responsive sub groups of ES-MDS. Indeed, both patients treated with rhuEPO before sample collection were non-responders to the treatment, and interestingly their NACA mRNA values were 0.78 and 1.79. Our findings suggest that assaying NACA mRNA in CD34+ cells at diagnosis of ES-MDS may be useful to predict the response to rhuEPO treatment.

115 Discussion

Apoptosis of hematopoietic progenitor cells contributes to the ineffective erythroid differentiation that is a feature of ES-MDS. NACA has been described as both a positive regulator of erythroid differentiation and a negative regulator of apoptosis. We investigated the role of NACA in erythroid differentiation of ES-MDS CD34+ cells.

We demonstrate that transduction with NACA rescues erythroid maturation and survival of

ES-MDS erythroid progenitor cells. This finding is consistent with the recent report that

NACA negatively regulates apoptosis by interacting with the mediator FADD [20]. NACA inhibits FADD oligomerization and thereby prevents induction of FADD-dependent apoptosis. NACA may act similarly to the regulatory protein c-FLIP (FLICE-like inhibitory protein) that competes with the procaspase-8 site interacting with FADD [50]. As NACA can associate with FADD and this association negatively regulates apoptosis it is possible that exess of NACA in ES-MDS CD34+ cells may sequester excess free FADD in the cytosol, competing with the death receptor and thereby inhibits cell death. However, other molecular mechanisms for the anti-apoptotic effect of NACA in ES-MDS erythroid differentiation cannot be excluded. In specialized osteoblast cells during bone differentiation, NACA is translocated from the cytosol to the nucleus as a co-factor that enhances transcription mediated by c-jun. c-jun regulates proliferation and differentiation of erythroid cells and protects them from apoptosis [51,52]. Note that no abnormality of the c-jun transcription machinery has been reported in ES-MDS, so there is currently no evidence implicating

NACA as co-factor of transcription mediated by c-jun in ES-MDS. We believe that it is more likely that NACA acts in the cytosol to bind excess FADD in ES-MDS bone marrow cells; however, further studies are required to determine whether the NACA/FADD interaction contributes to correcting ineffective erythroid differentiation in ES-MDS bone marrow.

Preliminary results (not shown) indicate that the C-terminus part of NACA interacts with

116 FADD. In addition, it is responsible for NACA function in erythropoiesis. Introducing this fragment into ES-MDS CD34+ cells and examining whether it rescues erythropoiesis should confirm whether the correction of erythroid differentiation by NACA involves FADD. The ineffective erythropoiesis in cases of ES-MDS did not correlate with the abundance of endogenous NACA transcript. In our study, the levels of NACA mRNA did not differ significantly between the 21 ES-MDS patients and either the six control subjects or the ten

AS-MDS patients. These findings suggest that endogenous NACA, which is not in excess, is unable to regulate apoptosis negatively.

Despite the absence of significant difference between the amounts of NACA mRNA in the three groups of subjects, we identified a relationship between NACA mRNA abundance and the response to rhuEPO treatment among ES-MDS patients (median NACA mRNA value of

2.63 for responders vs. 1.44 of for the non-responders). Thus, NACA mRNA may serve as a predictive marker of the response of ES-MDS to rhuEPO treatment. RhuEPO treatment is beneficial because it increases hemoglobin levels and reduces the need for blood transfusions, but is also associated with side-effects including an increase in the risk of thrombo-embolic events, chronic renal failure and systemic hypertension that may contribute to reduce the survival of patients [53]. Several studies seeking new criteria for predicting the response to rhuEPO treatment have been initiated. Currently, various prognostic factors such as serum concentrations of EPO [54,55], number of transfusions [56], type of MDS, platelet counts and the International Prognostic Scoring System (IPSS) [49,57,58] are being used to try to predict the response of patients with MDS to rhuEPO treatment. However, these criteria remain unsatisfactory and there continue to be patients treated with rhuEPO who do not respond

[48,56,57,59-62]. Recently, an analysis of expression patterns of genes in ES-MDS patients identified thirty-seven genes differentially expressed between five responders and five non- responders to treatment with rhuEPO [62]. Unfortunately, the NACA gene was not included

117 in the array used in the study. However, both this previous study and ours support the view that quantification of biological markers is likely to help define new ES-MDS subtypes and thereby clarify classification. In our study, NACA mRNA abundance in 10/11 patients (90%) was a good predictive marker of the response to rhuEPO.

Our findings indicate that NACA, a protein of the cell machinery, may be involved in pathology, as has been recently found for ribosomal assembly proteins that cause Diamond-

Blackfan anemia [63-66]. NACA protected CD34+ progenitor cells from death and rescued their erythroid differentiation. In addition, we show that assaying the NACA transcript at diagnosis may allow identification of a subgroup of patients responsive to rhuEPO treatment.

Acknowledgements :

We thank N. Casadevall for the generous gift of Epo. Laetitia Stuhl is a recipient of a doctoral fellowship from the Ministère de l’Enseignement Supérieur et de la Recherche and from the

Ligue Nationale Contre le Cancer (LNNC). This work was supported by grants from the

Institut National de la Santé et de la Recherche Médicale, the Ligue Nationale Contre le

Cancer (LNCC) and Cent pour Sang la Vie (CpSlV)

Bibliography

1. Parker JE, Mufti GJ: The myelodysplastic syndromes: a matter of life or death . Acta

Haematol 2004, 111 :78-99.

2. Saarni MI, Linman JW: Preleukemia. The hematologic syndrome preceding acute

leukemia . Am J Med 1973, 55 :38-48.

3. Linman JW, Bagby GC, Jr.: The preleukemic syndrome (hemopoietic dysplasia) .

Cancer 1978, 42 :854-864.

118 4. Greenberg PL, Mara B: The preleukemic syndrome: correlation of in vitro parameters

of granulopoiesis with clinical features . Am J Med 1979, 66 :951-958.

5. Greenberg PL: The smoldering myeloid leukemic states: clinical and biologic features .

Blood 1983, 61 :1035-1044.

6. Raza A, Gezer S, Mundle S, Gao XZ, Alvi S, Borok R, Rifkin S, Iftikhar A, Shetty V,

Parcharidou A, et al.: Apoptosis in bone marrow biopsy samples involving stromal

and hematopoietic cells in 50 patients with myelodysplastic syndromes . Blood

1995, 86 :268-276.

7. Bouscary D, De Vos J, Guesnu M, Jondeau K, Viguier F, Melle J, Picard F, Dreyfus F,

Fontenay-Roupie M: Fas/Apo-1 (CD95) expression and apoptosis in patients with

myelodysplastic syndromes . Leukemia 1997, 11 :839-845.

8. Mundle S, Venugopal P, Shetty V, Ali A, Chopra H, Handa H, Rose S, Mativi BY,

Gregory SA, Preisler HD, et al.: The relative extent and propensity of CD34+ vs.

CD34- cells to undergo apoptosis in myelodysplastic marrows. Int J Hematol 1999,

69 :152-159.

9. Cory S, Adams JM: The Bcl2 family: regulators of the cellular life-or-death switch . Nat

Rev Cancer 2002, 2:647-656.

10. Peter ME, Krammer PH: The CD95(APO-1/Fas) DISC and beyond . Cell Death Differ

2003, 10 :26-35.

11. Tehranchi R, Fadeel B, Forsblom AM, Christensson B, Samuelsson J, Zhivotovsky B,

Hellstrom-Lindberg E: Granulocyte colony-stimulating factor inhibits spontaneous

cytochrome c release and mitochondria-dependent apoptosis of myelodysplastic

syndrome hematopoietic progenitors . Blood 2003, 101 :1080-1086.

12. Parker JE, Mufti GJ, Rasool F, Mijovic A, Devereux S, Pagliuca A: The role of

apoptosis, proliferation, and the Bcl-2-related proteins in the myelodysplastic

119 syndromes and acute myeloid leukemia secondary to MDS . Blood 2000, 96 :3932-

3938.

13. Boudard D, Vasselon C, Bertheas MF, Jaubert J, Mounier C, Reynaud J, Viallet A,

Chautard S, Guyotat D, Campos L: Expression and prognostic significance of Bcl-2

family proteins in myelodysplastic syndromes . Am J Hematol 2002, 70 :115-125.

14. Parker JE, Fishlock KL, Mijovic A, Czepulkowski B, Pagliuca A, Mufti GJ: 'Low-risk'

myelodysplastic syndrome is associated with excessive apoptosis and an increased

ratio of pro- versus anti-apoptotic bcl-2-related proteins. Br J Haematol 1998,

103 :1075-1082.

15. Fontenay-Roupie M, Bouscary D, Guesnu M, Picard F, Melle J, Lacombe C, Gisselbrecht

S, Mayeux P, Dreyfus F: Ineffective erythropoiesis in myelodysplastic syndromes:

correlation with Fas expression but not with lack of erythropoietin receptor

signal transduction . Br J Haematol 1999, 106 :464-473.

16. Claessens YE, Park S, Dubart-Kupperschmitt A, Mariot V, Garrido C, Chretien S,

Dreyfus F, Lacombe C, Mayeux P, Fontenay M: Rescue of early-stage

myelodysplastic syndrome-deriving erythroid precursors by the ectopic

expression of a dominant-negative form of FADD . Blood 2005, 105 :4035-4042.

17. Claessens YE, Bouscary D, Dupont JM, Picard F, Melle J, Gisselbrecht S, Lacombe C,

Dreyfus F, Mayeux P, Fontenay-Roupie M: In vitro proliferation and

differentiation of erythroid progenitors from patients with myelodysplastic

syndromes: evidence for Fas-dependent apoptosis . Blood 2002, 99 :1594-1601.

18. Zang DY, Goodwin RG, Loken MR, Bryant E, Deeg HJ: Expression of tumor necrosis

factor-related apoptosis-inducing ligand, Apo2L, and its receptors in

myelodysplastic syndrome: effects on in vitro hemopoiesis. Blood 2001, 98 :3058-

3065.

120 19. Sawanobori M, Yamaguchi S, Hasegawa M, Inoue M, Suzuki K, Kamiyama R, Hirokawa

K, Kitagawa M: Expression of TNF receptors and related signaling molecules in

the bone marrow from patients with myelodysplastic syndromes . Leuk Res 2003,

27 :583-591.

20. Stilo R, Liguoro D, di Jeso B, Leonardi A, Vito P: The alpha-chain of the nascent

polypeptide-associated complex binds to and regulates FADD function . Biochem

Biophys Res Commun 2003, 303 :1034-1041.

21. Beatrix B, Sakai H, Wiedmann M: The alpha and beta subunit of the nascent

polypeptide-associated complex have distinct functions . J Biol Chem 2000,

275 :37838-37845.

22. Wiedmann B, Sakai H, Davis TA, Wiedmann M: A protein complex required for

signal-sequence-specific sorting and translocation . Nature 1994, 370 :434-440.

23. Lauring B, Kreibich G, Weidmann M: The intrinsic ability of ribosomes to bind to

endoplasmic reticulum membranes is regulated by signal recognition particle and

nascent-polypeptide-associated complex . Proc Natl Acad Sci U S A 1995, 92 :9435-

9439.

24. Plath K, Rapoport TA: Spontaneous release of cytosolic proteins from

posttranslational substrates before their transport into the endoplasmic

reticulum . J Cell Biol 2000, 151 :167-178.

25. Yotov WV, Moreau A, St-Arnaud R: The alpha chain of the nascent polypeptide-

associated complex functions as a transcriptional coactivator . Mol Cell Biol 1998,

18 :1303-1311.

26. Moreau A, Yotov WV, Glorieux FH, St-Arnaud R: Bone-specific expression of the

alpha chain of the nascent polypeptide-associated complex, a coactivator

potentiating c-Jun-mediated transcription . Mol Cell Biol 1998, 18 :1312-1321.

121 27. Quelo I, Hurtubise M, St-Arnaud R: alphaNAC requires an interaction with c-Jun to

exert its transcriptional coactivation . Gene Expr 2002, 10 :255-262.

28. Meury T, Akhouayri O, Jafarov T, Mandic V, St-Arnaud R: Nuclear {alpha}NAC

influences bone matrix mineralization and osteoblast maturation in vivo . Mol Cell

Biol 2009.

29. Akhouayri O, Quelo I, St-Arnaud R: Sequence-specific DNA binding by the alphaNAC

coactivator is required for potentiation of c-Jun-dependent transcription of the

osteocalcin gene . Mol Cell Biol 2005, 25 :3452-3460.

30. Quelo I, Akhouayri O, Prud'homme J, St-Arnaud R: GSK3 beta-dependent

phosphorylation of the alpha NAC coactivator regulates its nuclear translocation

and proteasome-mediated degradation . Biochemistry 2004, 43 :2906-2914.

31. Quelo I, Gauthier C, Hannigan GE, Dedhar S, St-Arnaud R: Integrin-linked kinase

regulates the nuclear entry of the c-Jun coactivator alpha-NAC and its

coactivation potency . J Biol Chem 2004, 279 :43893-43899.

32. Al-Shanti N, Aldahoodi Z: Inhibition of alpha nascent polypeptide associated complex

protein may induce proliferation, differentiation and enhance the cytotoxic

activity of human CD8+ T cells . J Clin Immunol 2006, 26 :457-464.

33. Al-Shanti N, Steward CG, Garland RJ, Rowbottom AW: Investigation of alpha nascent

polypeptide-associated complex functions in a human CD8(+) T cell ex vivo

expansion model using antisense oligonucleotides . Immunology 2004, 112 :397-403.

34. Lopez S, Stuhl L, Fichelson S, Dubart-Kupperschmitt A, St Arnaud R, Galindo JR, Murati

A, Berda N, Dubreuil P, Gomez S: NACA is a positive regulator of human

erythroid-cell differentiation . J Cell Sci 2005, 118 :1595-1605.

35. Vardiman JW, Harris NL, Brunning RD: The World Health Organization (WHO)

classification of the myeloid neoplasms . Blood 2002, 100 :2292-2302.

122 36. Harris NL, Jaffe ES, Diebold J, Flandrin G, Muller-Hermelink HK, Vardiman J, Lister

TA, Bloomfield CD: World Health Organization classification of neoplastic

diseases of the hematopoietic and lymphoid tissues: report of the Clinical

Advisory Committee meeting-Airlie House, Virginia, November 1997 . J Clin

Oncol 1999, 17 :3835-3849.

37. Harris NL, Jaffe ES, Diebold J, Flandrin G, Muller-Hermelink HK, Vardiman J, Lister

TA, Bloomfield CD: The World Health Organization classification of

hematological malignancies report of the Clinical Advisory Committee Meeting,

Airlie House, Virginia, November 1997 . Mod Pathol 2000, 13 :193-207.

38. Bennett JM: 10 Myelodysplastic syndromes: update on classification . Leukemia

Research

Abstracts of the 10th International Symposium on Myelodysplastic Syndromes 2009, 33 :S6-

S8.

39. Mufti GJ, Bennett JM, Goasguen J, Bain BJ, Baumann I, Brunning R, Cazzola M, Fenaux

P, Germing U, Hellstrom-Lindberg E, et al.: Diagnosis and classification of

myelodysplastic syndrome: International Working Group on Morphology of

myelodysplastic syndrome (IWGM-MDS) consensus proposals for the definition

and enumeration of myeloblasts and ring sideroblasts . Haematologica 2008,

93 :1712-1717.

40. Cheson BD, Greenberg PL, Bennett JM, Lowenberg B, Wijermans PW, Nimer SD, Pinto

A, Beran M, de Witte TM, Stone RM, et al.: Clinical application and proposal for

modification of the International Working Group (IWG) response criteria in

myelodysplasia . Blood 2006, 108 :419-425.

123 41. Cao H, Ge Z, Zhang Q, Liu X, Sun L, Zhang X, Ding Q: [Cloning and permanent

expression in eukaryotic cells of rhTpo] . Zhonghua Xue Ye Xue Za Zhi 1997,

18 :302-304.

42. Freyssinier JM, Lecoq-Lafon C, Amsellem S, Picard F, Ducrocq R, Mayeux P, Lacombe

C, Fichelson S: Purification, amplification and characterization of a population of

human erythroid progenitors . Br J Haematol 1999, 106 :912-922.

43. Sirven A, Ravet E, Charneau P, Zennou V, Coulombel L, Guetard D, Pflumio F, Dubart-

Kupperschmitt A: Enhanced transgene expression in cord blood CD34(+)-derived

hematopoietic cells, including developing T cells and NOD/SCID mouse

repopulating cells, following transduction with modified trip lentiviral vectors .

Mol Ther 2001, 3:438-448.

44. Amsellem S, Ravet E, Fichelson S, Pflumio F, Dubart-Kupperschmitt A: Maximal

lentivirus-mediated gene transfer and sustained transgene expression in human

hematopoietic primitive cells and their progeny . Mol Ther 2002, 6:673-677.

45. Matthes TW, Kindler V, Leuba F, French LE, Chapuis B, Beris P, Piguet V: Optimized

lentiviral transduction of erythroid precursors from healthy adults and patients

with myelodysplastic syndromes . Leukemia 2002, 16 :1319-1323.

46. Backx B, Broeders L, Touw I, Lowenberg B: Blast colony-forming cells in

myelodysplastic syndrome: decreased potential to generate erythroid precursors .

Leukemia 1993, 7:75-79.

47. Juvonen E, Aimolahti A, Volin L, Ruutu T: The prognostic value of in vitro cultures of

erythroid and megakaryocyte progenitors in myelodysplastic syndromes . Leuk

Res 1999, 23 :889-894.

124 48. Greenberg P, Cox C, LeBeau MM, Fenaux P, Morel P, Sanz G, Sanz M, Vallespi T,

Hamblin T, Oscier D, et al.: International scoring system for evaluating prognosis

in myelodysplastic syndromes . Blood 1997, 89 :2079-2088.

49. Park S, Grabar S, Kelaidi C, Beyne-Rauzy O, Picard F, Bardet V, Coiteux V, Leroux G,

Lepelley P, Daniel MT, et al.: Predictive factors of response and survival in

myelodysplastic syndrome treated with erythropoietin and G-CSF: the GFM

experience . Blood 2008, 111 :574-582.

50. Muzio M, Chinnaiyan AM, Kischkel FC, O'Rourke K, Shevchenko A, Ni J, Scaffidi C,

Bretz JD, Zhang M, Gentz R, et al.: FLICE, a novel FADD-homologous ICE/CED-

3-like protease, is recruited to the CD95 (Fas/APO-1) death--inducing signaling

complex . Cell 1996, 85 :817-827.

51. Jacobs-Helber SM, Wickrema A, Birrer MJ, Sawyer ST: AP1 regulation of proliferation

and initiation of apoptosis in erythropoietin-dependent erythroid cells . Mol Cell

Biol 1998, 18 :3699-3707.

52. Patel HR, Sytkowski AJ: Erythropoietin activation of AP1 (Fos/Jun) . Exp Hematol

1995, 23 :619-625.

53. Bohlius J, Wilson J, Seidenfeld J, Piper M, Schwarzer G, Sandercock J, Trelle S,

Weingart O, Bayliss S, Djulbegovic B, et al.: Recombinant human erythropoietins

and cancer patients: updated meta-analysis of 57 studies including 9353 patients .

J Natl Cancer Inst 2006, 98 :708-714.

54. Wallvik J, Stenke L, Bernell P, Nordahl G, Hippe E, Hast R: Serum erythropoietin

(EPO) levels correlate with survival and independently predict response to EPO

treatment in patients with myelodysplastic syndromes . Eur J Haematol 2002,

68 :180-185.

125 55. Cazzola M, Mercuriali F, Brugnara C: Use of recombinant human erythropoietin

outside the setting of uremia . Blood 1997, 89 :4248-4267.

56. Hellstrom-Lindberg E, Negrin R, Stein R, Krantz S, Lindberg G, Vardiman J, Ost A,

Greenberg P: Erythroid response to treatment with G-CSF plus erythropoietin for

the anaemia of patients with myelodysplastic syndromes: proposal for a

predictive model . Br J Haematol 1997, 99 :344-351.

57. Jadersten M, Montgomery SM, Dybedal I, Porwit-MacDonald A, Hellstrom-Lindberg E:

Long-term outcome of treatment of anemia in MDS with erythropoietin and G-

CSF . Blood 2005, 106 :803-811.

58. Hellstrom-Lindberg E: Efficacy of erythropoietin in the myelodysplastic syndromes: a

meta-analysis of 205 patients from 17 studies . Br J Haematol 1995, 89 :67-71.

59. Malcovati L, Germing U, Kuendgen A, Della Porta MG, Pascutto C, Invernizzi R,

Giagounidis A, Hildebrandt B, Bernasconi P, Knipp S, et al.: Time-dependent

prognostic scoring system for predicting survival and leukemic evolution in

myelodysplastic syndromes . J Clin Oncol 2007, 25 :3503-3510.

60. Remacha AF, Arrizabalaga B, Villegas A, Manteiga R, Calvo T, Julia A, Fernandez

Fuertes I, Gonzalez FA, Font L, Junca J, et al.: Erythropoietin plus granulocyte

colony-stimulating factor in the treatment of myelodysplastic syndromes.

Identification of a subgroup of responders. The Spanish Erythropathology

Group . Haematologica 1999, 84 :1058-1064.

61. Pfeilstocker M, Reisner R, Nosslinger T, Gruner H, Nowotny H, Tuchler H, Schlogl E,

Pittermann E, Heinz R: Cross-validation of prognostic scores in myelodysplastic

syndromes on 386 patients from a single institution confirms importance of

cytogenetics . Br J Haematol 1999, 106 :455-463.

126 62. Cortelezzi A, Colombo G, Pellegrini C, Silvestris I, Moronetti Mazzeo L, Bosari S,

Lambertenghi Deliliers G, Fracchiolla NS: Bone marrow glycophorin-positive

erythroid cells of myelodysplastic patients responding to high-dose rHuEPO

therapy have a different gene expression pattern from those of nonresponders .

Am J Hematol 2008, 83 :531-539.

63. Da Costa L, Willig TN, Fixler J, Mohandas N, Tchernia G: Diamond-Blackfan anemia .

Curr Opin Pediatr 2001, 13 :10-15.

64. Draptchinskaia N, Gustavsson P, Andersson B, Pettersson M, Willig TN, Dianzani I, Ball

S, Tchernia G, Klar J, Matsson H, et al.: The gene encoding ribosomal protein S19

is mutated in Diamond-Blackfan anaemia . Nat Genet 1999, 21 :169-175.

65. Gazda HT, Grabowska A, Merida-Long LB, Latawiec E, Schneider HE, Lipton JM,

Vlachos A, Atsidaftos E, Ball SE, Orfali KA, et al.: Ribosomal protein S24 gene is

mutated in Diamond-Blackfan anemia . Am J Hum Genet 2006, 79 :1110-1118.

66. Cmejla R, Cmejlova J, Handrkova H, Petrak J, Pospisilova D: Ribosomal protein S17

gene (RPS17) is mutated in Diamond-Blackfan anemia . Hum Mutat 2007, 28 :1178-

1182.

127 Bone WBC Platelet Sex Means marrow Hb level count count WHO subtype Karyotype IPSS ratio age y blasts % g/dL MGV fl x10 9/l x10 9/l Patients (M/F) (range) (range) (range) (range) (range) (range)

Control 0.5 65 ± 11 2.5% ± 1.4 12.8 ± 2.0 90.5± 5.4 5.0 ± 1.0 193 ± 68 Normal (5) (n=6) (2/4) (45-77) (1- 4%) (10 -14.7) (83-95) (3.9- 6.1) (101-289) ND (1)

Normal (14) ES-MDS 1.1 72 ± 9 MDSu(2) 4.2% ± 2.4 9.9 ± 3.0 101± 16 4.8 ± 2.0 206 ± 158 Score 0 (9) delY (1) (n=21) (11/10) (56-86) RA (1) (1- 9%) (6.8 – 14.5) (82-159) (1.6- 8.2) (41-662) Score 0.5-1 (6) intermediate (1) RARS (10) Score 1.5-2 (4) ND (2) RAEB1 (8) Complex (3) ND (2) Normal (3) AS-MDS 1.5 72 ±7 13.6% ± 2.8 9.7 ±1.8 119 ± 59 4.0 ± 2.5 143 ± 163 Score 1.5 - 2 (5) intermediate (2) (n=10) (6/4) (63-83) RAEB2 (10) (10-18%) (6.9-12.3) (86-263) (1 -9.4) (70 -511) Score up to 2 (4) Complex (4) ND (1) ND (1)

Table 1: Characteristics of patients with m yelod ysplastic s yndromes and control subjects . Reported values are means ±SD (range). For the IPSS value, 0 indicates low, between 0.5 and 1 intermediate-1, between 1.5 and 2 intermediate-2 and over 2 high risk. MGV indicates mean globular volume; WBC, white blood cell; ND, not done

128 ES-MDS AS-MDS n=4 n=5 GFP GFP

NACA NACA

0% 50% 100% 0% 50% 100%

PE BE PC AE

PE GFP GFP PE

PE PC PE NACA NACA BE

AE Magnification x100 Magnification x100

Figure1 : Effect of NACA on the differentiation of MDS erythroid precursors. Mea n percentages of each type of erythroblasts are shown graphically with data from ES-MDS (n=5) and AS-MDS (n=4). ( PE: ProErythroblasts, BE: Basophilic Erythrobasts, PC: Polychromatophilic Erythroblasts, AE: Acidophilic Erythroblasts). Standard Deviation fo r values for ES-MDS GFP and NACA, respectively: PE (± 22% and 21%); BE (± 19% an d 16%); PC (± 12% and 7%); AE (± 16% and 5.5%). SD for values for AS-MDS GFP and NACA respectively: PE (± 0% and 0%). Pictures of a representative morphological characterizatio n after May-Grunwald-Giemsa staining of CD34+ from ES-MDS and AS-MDS patients transduced with NACA or EGFP, and cultured in erythroid differentiation conditions for 11 days.

129 20

5 Number of BFU-E of Number

0 GFP NACA GFP NACA

Magnification x4

Figure 2 : Effect of NACA on production of BFU-E-derived colonies from ES-MDS er ythroid precursors. Clonogenic assay on day 17 of NACA- or EGFP-transduced CD34+ cells from ES-MDS patients. Quantification of BFU-E is shown graphically as the mean ± SD of three assays. Representative pictures of clonogenic assays on day 17 of NACA- or EGFP-transduced CD34+ fro m one patient.

130 of NACA mRNA NACA of Relative abundance

Figure 3 : Relative abundance of NACA mRNA in MDS CD34+ cells. Quantification by RTq- PCR of NACA mRNA is reported relative to the value for GAPDH mRNA; values for six controls, and 21 ES-MDS and ten AS-MDS patients are given. The horizontal line indicates the median value for each group: 1.54 for controls, 1.48 for ES-MDS and 2.06 for AS-MDS.

131 Variable criteria N Median p-value

Sex M 11 1.48

F 10 1.68 0.9719

Age (years) < 70 y 8 1.62

>70 y 13 1.58 0.3653

Bone marrow blasts (%) 1% to 4% 13 1.72

5% to 10% 8 1.37 0.6377

Hb level (g/dl) <10 g/dl 11 1.58

>10 g/dl 10 1.62 0.5731

WPSS 0-1 12 1.65

2-5 7 1.44 0.8991

Response to rhuEPO treatment Non-responders 5 1.44

Responders 6 2.63 0.0303

Table 2: Statistical analysis of NACA mRNA abundance according various ES-MDS characteristics. The Mann-Whitney test was used for statistical analysis: P-values<0.05 are considered to be significant. N is the number of patients included in the test.

132 Bone Sex Means marrow Hb level Treatment rhuEPO ratio age y WHO blasts % g/dL Transfusion Post- treatment (M/F) (range) subtype (range) (range) Post-sampling sampling Karyotype IPSS

Score 0 (3) Responders 1 71 ± 10 RA (1) 4.3% ± 2.6 10.0 ± 1.1 Yes (1) EPO (5) Normal (4) n=6 Score 0.5 (1) (3/3) (58-84) RARS (2) (1-7%) (8.3-11) No (5) EPO + G-CSF (1) Complex (1) Score 2 (1) RAEB1 (3) ND (1) ND (1) Score 0 (2) Non-responders 1.5 70 ± 5 RARS (4) 4% ± 2.9 8.2 ± 1.2 Yes (4) EPO (5) Normal (3) n=5 Score 0.5 (1) (3/2) (61-74) RAEB1(1) (2-9%) (6.8-10.2) No (1) EPO + G-CSF (3) Complex (1) Score 2 (1) ND (1) ND (1)

p-value 0.9166 1.0000 0.0547 Mann-whitne y

Table 3: Comparison of the Clinical Characteristics of Responders and Non-responders to rhuEPO treatment. Reported values are means ±SD (range). P-values for the comparisons between responders and non-responders are given. For the IPSS value, 0 indicates low, betwee n 0.5 and 1 intermediate-1, between 1.5 and 2 intermediate-2 and over 2 high risk. MGV indicates mean of globular volume; WBC, white blood cell; ND, not done

133 of NACA mRNA of NACA Relative Relative abundance

Non-responders Responders to EPO treatment

Figure 4 : NACA mRNA abundance in CD34+ cells from Non-responders and Responders to rhuEPO treatment. Quantification by RTq-PCR of NACA mRNA normalized to the value for GAPDH mRNA. Values for five ES-MDS patients classified as non-responders and six as responders to rhuEPO treatment are shown. The horizontal line indicates the median value for each group: 1.44 for non-responders and 2.63 for responders.

134 Commentaires

Les patients atteints de SMD de bas risque et ayant une anémie reçoivent un traitement par rhEPO (Stone, 2009). La réponse à ce traitement à été définit conformément aux critères décrits ci-après.

! Evaluation de la réponse au traitement par rhEPO

Les critères de réponses à un traitement par rhEPO ont été définis par ‘’The Nordic and French MDS Groups’’(Hellstrom-Lindberg et al., 1997) et ‘’The International working Group’’(IWG) (Cheson et al., 2000).

Les critères de réponse ‘’ Nordic’’

- la réponse érythroïde complète se traduit par l’augmentation des taux Hb au moins de 11,5g/dl, sans transfusion. - La réponse érythroïde partielle se définie par l’arrêt total du besoin de transfusion et une augmentation du taux d’Hb de +1,5g/dl

Les critères de réponse érythroïde du IWG

- la réponse érythroïde majeure chez un patients qui a moins de 11g/dl d’Hb, se traduit par l’augmentation des taux d’au moins +2g/dl de Hb, et une indépendance à la transfusion de globules rouges. - La réponse érythroïde mineure chez un patient qui a moins de 11g/dl d’Hb, se définit par l’augmentation des taux de 1 à 2g/dl de Hb, et par la diminution de 50% des besoins en transfusion de globules rouges.

La durée médiane de réponse au traitement par rhEPO + G-CSF est de 23 mois, voir de 29 mois chez les patients qui atteignent un taux d'hémoglobine normal, et 12 mois pour ceux qui ont une réponse partielle. Quelques patients maintiennent une réponse sur plus de 10 ans (Jadersten et al., 2008; Jadersten et al., 2005).

135 Ce traitement par rhEPO est généralement bien toléré mais n’a pas que des bénéfices. Il présente quelques risques de type thrombo-embolique (thrombose des veines, embolie pulmonaire, infarctus du myocarde), défaillance rénale chronique et l'hypertension systémique qui contribue à réduire la survie des patients (Bohlius et al., 2006). De plus, bon nombre de patients sont non-répondeurs au traitement par rhEPO. Par conséquent, la prédiction de la réponse hématopoïétique aux traitements thérapeutiques tels que rhEPO a fait l’objet d’une succession de travaux publiés ces 15 dernières années. Ces études ont tenté d’établir un modèle prédictif en fonction d’un ensemble de critères cliniques et biologiques: dosage de l’EPO dans le sérum, nombre de transfusions de globules rouges, type de SMD, dénombrement des plaquettes….

Ainsi, de nombreux travaux de recherche ont élaboré des scores pronostiques dans le but d’aider les médecins dans la décision de traitements et ainsi d’apporter aux patients atteints de SMD une solution thérapeutique adaptée à chaque cas.

Ci-après, je discuterai des différents modèles prédictifs de réponse à rhEPO proposés par la littérature.

! IPSS : International Prognostic Scoring et WPSS : WHO-based Prognostic Scoring

Un indice de pronostique international (IPSS : International Prognostic Scoring) a été mis au point pour évaluer la gravité des SMD (Greenberg et al., 1997). L'IPSS classe la maladie en fonction des risques, notamment celui d'évolution vers la LAM et a été pris en compte pour orienter la décision d’administration du traitement par rhEPO. Le score total obtenu est la somme de trois éléments : le pourcentage de blastes dans la moelle osseuse, le résultat de l'étude cytogénétique, et le nombre de cellules sanguines.

136

Score 0 0,5 1 1,5 % de blastes <5% 5 à 10% 11 à 20% Etude cytogénétique Favorable 1 Intermédiaire 2 Grave 3 Nombre de cytopénie* 0 ou 1 2 ou 3 1 (caryotype normal ou del 5q- ou del20q- ou delY) 2 (une autre anomalie génétique) 3 (caryotype complexe = 3 anomalies ou anomalies du chromosome 7) *(Neutrophiles < 1800/mm3 ; Hémoglobine < 10g/dl ; Plaquettes < 100 000/mm3)

Selon le total obtenu, le patient se classe dans un des groupes suivants :

Mediane de survie pour 25% LAM evolution Groupes score sujets >60ans (ans) (ans) Faible risque 0 5,7 9,4 Risque intermédiaire-1 0,5 à 1,0 3,5 3,3 Risque intermédiaire-2 1,5 à 2,0 1,2 1,1 Haut risque 2,5 et + 0,4 0,2

L’utilisation de l’IPSS pour prédire la réponse au traitement par rhEPO à été évaluée par plusieurs études : une étude évalue que l’utilisation de l’IPSS est inefficace pour prédire la réponse au traitement par rhEPO (Wallvik et al., 2002), tandis que deux autres études expliquent que cet indice pronostique peut être considéré pour prédire la réponse au traitement à l’EPO : les catégories à faible/intermediaire-1 risques répondent mieux à rhEPO que les hauts risques (Jadersten et al., 2005; Park et al., 2008)..

L’IPSS a été actualisé sous le sigle WPSS (WHO-based Prognostic Scoring System) afin de mieux prédire la survie et les risques d’évolution leucémique de la maladie (Malcovati et al., 2007). Le WPSS permet comme l’IPSS de prédire la survie et la progression leucémique, en prenant en considération le fait que la transfusion de globule rouge influence le pronostique pour les patients. Le score total obtenu est la somme de trois éléments : le résultat de l'étude cytogénétique, la catégorie pathologique selon la classification de WHO, l’administration de transfusion de globules rouges.

137

Score 0 1 2 3 Etude cytogénétique Favorable 1 Intermédiaire 2 Grave 3

Pathologie (WHO) RA, ARS, MDS5q- CRDM, CRDM-RS AREB1 AREB2 Transfusion Absence Administration 1 (caryotype normal ou del 5q- ou del20q- ou delY) 2 (une autre anomalie génétique) 3 (caryotype complexe = 3 anomalies ou anomalies du chromosome 7)

Les critères cytogénétiques pris en compte sont les mêmes que pour l’IPSS, cependant les scores du WPSS sont supérieurs à ceux de l’IPSS pour les caryotypes dit ‘’ intermédiaire ‘’ ou ‘’plus grave’’ Selon le total obtenu, le patient se classe dans un des groupes suivants :

Groupes score Mediane de survie (ans) Très faible risque 0 11,3 Faible risque 1 5,5 Risque intermédiaire 2 3,7 Haut risque 3 1,6 Très haut risque 4 0,7

Le risque évolutif augmente avec le score.

Aujourd’hui, aucune étude ne corrèle le WPSS avec la réponse au traitement par rhEPO. Cependant, le WPSS considère les types de pathologies (selon WHO) qui est un facteur pronostic de réponse au traitement par rhEPO : les patients avec une dysplasie uni-lignage répondent mieux au traitement par rhEPO que les patients atteints de dysplasie multi-lignage (Howe et al., 2004; Park et al., 2008). Ainsi, on suit la même logique que pour l’IPSS, les groupes avec un score WPSS à faible risque devraient être meilleurs répondeurs au traitement par rhEPO que les hauts risques (seule une étude pourra le prouver).

138 ! The scandinavian-American response score

‘‘The scandinavian-American response’’ score est un score prédictif de réponse au traitement par rhEPO basé sur les taux d’EPO dans le sérum et la considération d’une transfusion sanguine (Hellstrom-Lindberg et al., 1997).

Variable Valeur Score Besoin transfusionnel <2 U 0 (globules rouges/mois) >2U 1 <500 U/L 0 [EPO] dans le sérum >500 U/L 1

Le score total obtenu ( la somme) définit 3 groupes de populations : le premier (score 0) a la plus forte probabilité de répondre (74%), le deuxième (score 1) est intermédiaire (23%) et le troisième groupe (score 2) répond peu à rhEPO (7%). L’utilisation de ce score fut recommandée par d’autres études (Hellstrom-Lindberg et al., 2003; Remacha et al., 1999) .

! Dosage de l’EPO circulante

Le dosage de l’EPO (seul) dans le sérum de patients atteints de SMD fut annoncé comme corrélé avec la survie des patients et également prédictif pour une réponse à rhEPO (Bowen et al., 1991; Jacobs et al., 1991; Wallvik et al., 2002). Les patients ayant un taux d’EPO sérique <200U ont de grande chance d’être répondeurs (45% de répondeurs) tandis que ceux ayant un taux d’EPO sérique >200U sont en majorité des non répondeurs (95% de non répondeurs) (Greenberg et al., 2009; Park et al., 2008).

! Profil d’expression génique des répondeurs et des non-répondeurs

L’utilisation des différences de profils d’expression de gènes entre les répondeurs et les non répondeurs au traitement par rhEPO a récemment fait l’objet d’une étude (Cortelezzi et al., 2008). Trente sept gènes ont été trouvés différentiellement exprimés dans les cellules érythroïdes GPA+ issues de moelles osseuses de 5 patients ES-MDS répondeurs à rhEPO comparés à 5 patients non-répondeurs à rhEPO. On trouve notamment parmi les gènes

139 identifiés dans cette étude, des gènes responsables de la prolifération/différenciation, de la stabilité et de la réparation de l’ADN, du cycle cellulaire, de la transcription, de la traduction des protéines et de la transduction du signal. Cette étude, ainsi que la notre mettent en évidence qu’il existe de réelles différences biologiques entre les patients répondeurs et non répondeurs à rhEPO et que ces différences devraient être étudiées sur un plus grand nombre de patients pour établir des marqueurs biologiques prédictifs de réponse à rhEPO.

Les informations actuellement utilisées pour prédire la réponse à la rhEPO sont incomplètes. L’étude la plus prometteuse est celle ayant établi des profils géniques différents entre les répondeurs et le non-répondeurs au traitement par rhEPO (sous réserve de validation sur un plus grand nombre de patients).

Notre travail propose la quantification du transcrit de NACA dans les cellules CD34+ en tant que facteur prédictif de réponse à rhEPO. Le transcrit de NACA semble un bon marqueur puisqu’il est prédictif pour 10 patients sur 11, mais ne sera valide, bien entendu, qu’après avoir été éprouvé sur une population plus grande de patients ES-MDS traités par rhEPO.

140 RESULTATS SUPPLEMENTAIRES

! La partie C-terminale de NACA est impliquée dans la différenciation érythroïde

Nous avions entrepris de déterminer le domaine de NACA impliqué dans la regulation de la différenciation érythroïde. Nous disposons de 7 mutants de délétion de NACA (collaboration de R. St-Arnaud, Montréal Canada)

A NAC domain UBA 1 215 NACA 1 178 " 178-215 1 150 " 150-215 1 3 46 215

"!4-45 1 3 62 215 "!4-61 1 68 81 215 "!69-80 1 130 149 215 " 130-149

Figure 26 : Map of mutants of NACA

Nous avons mené une expérience d’expression ectopique de 2 mutants de délétion NACA dans des progéniteurs hématopoïétiques cultivés en conditions de différenciation érythroïde (en collaboration avec Sophie Lopez).

C Control NACA NACA " 150-215 NACA "! 69-80 2,5

250 14.1 250 21.6 250 12.4 250 18.2 14,1% 21,6% 12,4% 18,2% 2 200 200 200 200

150 150 150 150 1,5

100 100 100 100 1 SSC-H: SSC-Height SSC-H: SSC-Height SSC-H: SSC-Height SSC-H: SSC-Height 50 50 50 50 0,5

0 0 0 0 1 10 100 1000 10000 1 10 100 1000 10000 1 10 100 1000 10000 1 10 100 1000 10000 FL2-H: FL2-Height FL2-H: FL2-Height FL2-H: FL2-Height FL2-H: FL2-Height positive ofGPA ratio cells 0 r t 5 80 t 1 - c W 2215 - 69 0 GPA-PE 5 " 151 "

Figure 27 : Determination of NACA’s domain which plays in erythroid regulation

Flow-cytometry analysis of GPA cells surface expression in contrôle, NACA, NACA "150-215 and NACA "69- 80 transduced CD34+ cells after 3 days of culture in erythroid differentiation conditions. Positive GPA fluorescence (gate in circle) is set according to the isotype-matched contrôle mAb. One representative experiment out of 3 performed is shown. Graphic representation of GPA positive cells ±SD of 3 experiments.

141

Ce résultat préliminaire indique que le mutant de NACA délété de 65 acides aminés en partie C-terminale perd sa fonction de régulateur positif de l’érythropoïèse, révélé par la détection de la GPA à la surface cellulaire par cytométrie de flux. Nos données suggèrent que le domaine C-terminal de NACA est impliqué dans la différentiation érythroïde.

! La partie C-terminale de NACA interagit avec FADD

Afin de déterminer le domaine de NACA impliqué dans l’interaction avec FADD, nous avions mené des expériences de co-immunoprécipitation dans un système de co- expression ectopiques des mutants de délétions de NACA avec FADD.

Lysate

" " " B 1 1 " 1 7 50 " " 30 8- - 4 4 69 - W 2 2 -4 -6 - 1 t 15 15 5 1 80 49

WB : flag M2 32

32 WB : FADD 25

IP Flag

" " " 1 15 1 78 0 " " " 30 - - 4 4 69 -1 2 2 - - - C W 1 1 45 61 8 4 tr 5 5 0 9 l t

WB : flag M2 32 25

WB : FADD 32 25 Figure 28 : Mapping of NACA’s domain which intercat with FADD Detection of co-expression of several mutants of NACA-tagged flag and FADD in COS cells that had been transiently cotransfected as indicated (Hight panel). Co-immunoprecipitation experiments performed with these cell lysate and analyzed by Western blot (Low panel) .

Nos résultats indiquent que les mutants de NACA délétés en partie C-terminale (de 37 et 65 acides aminés) n’interagissent plus avec FADD alors que les mutants délétés de la partie N-terminale gardent l’interaction avec FADD.

142 CONCLUSIONS GENERALES ET PERSPECTIVES

Notre travail suggère que NACA favorise la différenciation érythroïde suivant deux de ces fonctions biologiques :

- coordinateur entre la synthèse des protéines et leur dégradation (contrôle qualité)

- régulateur négatif de l’apotose

EPO EPO-R Récepteur de mort

JAK2 JAK2

Membrane DD DD JAK2 DD FADD plasmique NACA DED

Golgi Différenciation

JAK2 Apoptose

JAK2

ERGIC

JAK2 Protéasome

NACA NACA

JAK2

Réticulum NACA

Endoplasmique NACA #NAC

AAAAAA

EPO-R Ribosome ERGIC-53

Figure 29 : Représentation schématique des fonctions de NACA dans une cellule érythroïde.

Dans la fonction qui relie NACA à la machinerie de synthèse des protéines et à leur contröle qualité, il n’est pas encore bien défini la fonction exacte de NACA. Ainsi, il est possible que NACA participe à la régulation d’EPO-R en participant au contrôle qualité des protéines : NACA tri les molécules d’EPO-R mal-repliées (destinées à la dégradation par le protéasome), des molécules d’EPO-R prêtes pour l’exportation (associées à JAK2). A cette étape, les protéines EPO-R/JAK2 encore associées à NACA, recrutent le récepteur cargo

143 ERGIC-53 pour être exporté. L’étape à laquelle la protéine NACA se dissocie d’EPO-R, n’est pas encore défini.

Nos résultats ont permis de démontrer que l’absence d’ERGIC-53 altére le transport d’EPO-R vers la surface des les cellules TF-1. Ces données alimentent la question sur érythropoïèse des patients présentants des mutations pour le gène codant ERGIC-53. En effet, théoriquement les mutations du gène codant pour ERGIC-53 (LMNA1) produisent une protéine tronquée voir absente (Neerman-Arbez et al., 1999; Nichols et al., 1998), et devrait par conséquent entrainer un défaut d’expression EPO-R à la surface des cellules et par conséquent un dysfonctionnement de la différenciation érythroïde. Aujourd’hui, aucun anomalie de l’érythropoïèse n’a été rapportée chez les patients mutés pour ERGIC-53, et devrait faire l’objet d’une étude. Si aucun défaut de l’expression d’EPO-R à la surface cellulaire n’est constaté, il serait intéressant d’identifier la protéine ‘‘remplaçante’’ de ERGIC-53 chez ces patients.

3. Rôle d’ERGIC-53 dans le transport d’EPO-R

Nos résultats ont permis d’identifier la fonction d’ERGIC-53 dans le transport d’EPO-R sans pour autant en expliquer le mécanisme intra-cellulaire. Nous ne savons pas si ERGIC-53 pourrait aussi prendre en charge le transport rétrograde d’EPO-R, ce qui contribuerait à sa régulation. Afin de rechecher si ERGIC-53 est requit pour le transport rétrograde de l’EPO-R, nous pourrions évaluer l’effet des inhibiteurs du transport retrogarde (brefeldin A; bafilomycin; 1,3-cyclohexane-bis (methylamine); nordihydroguararetic acid) (Hauri et al., 2000a) sur la localisation d’EPO-R dans les TF-1 cultivées en GM-CSF et en EPO. La littérature décrit EPO-R soit stockée dans le RE (Hilton et al., 1995; Huang et al., 2001; Sawyer and Hankins, 1993), soit dégradée rapidement (Neumann et al., 1993). Cependant nous ne connaissons pas les conséquences de l’absence d’ERGIC-53 sur cette molécule. En effet, est ce qu’en absence d’ERGIC-53, les molécules d’EPO-R restent stockées dans le RE ? Sont-elles orientées dans le protéasome ou le lysosome ? Afin de localiser EPO-R dans les compartiments sub-cellulaire en absence de ERGIC-53, nous utiliserions la technique de co-immunofluorescence.

144 4. NACA pourrait réguler le repliement des protéines nouvellement synthétisées telles que l’EPO-R

La protéine NACA fut décrite pour l’orientation des polypeptides naissants vers le cytosol ou vers le RE (Lauring et al., 1995a; Lauring et al., 1995b; Wiedmann and Prehn, 1999), et sa protection des polypeptides naissants contre la protéolyse (Wang et al., 1995). La réelle fonction de NACA au sein de la machinerie traductionelle est encore énigmatique, ce qui a amèner plusieurs travaux à poser l’hypothèse selon laquelle NACA pourrait être impliquée dans le repliement des polypeptides naissants.

Nos résultats placent NACA dans la machinerie générale de traduction en compagnie de NAC, des chaperonnes HSP40, HSP60, HSP70, HSP90, TCP1 . Ces données soutiennent le fait que NACA pourrait être impliquées dans le repliement des polypeptides naissants tel que l’EPO-R dans la différenciation érythroïde. Cependant, aujourd’hui la fonction de NACA dans le repliement des protéines nouvellement synthétisées n’est qu’hypothétique et fondée que par son association avec le ribosome et le polypeptide naissant.

La réelle fonction de NACA dans la machinerie traductionnelle reste encore énigmatique, il serait intéressant de rechercher si NACA prend en charge le repliement des polypeptides naissants par des expériences mesurant la ‘‘Unfolded protein Response’’ (UPR) après extinction de NACA par siRNA. La UPR est une voie de signalisation intracellulaire qui se caractérise par une accumulation de protéines non repliées ou mal-repliées dans le RE ce qui entraîne le stress du RE, un ralentissement de la traduction causant une accumulation des transcrits et un arrêt du cycle cellulaire (Sidrauski et al., 1998). Aujourd’hui, 3 effecteurs de l’UPR (IRE1, PERK and ATF6) et un régulateur majeur (BiP) furent identifiés comme impliqués dans ce processus (Zhang and Kaufman, 2004).

145 (1)

(2A ) (2B ) (2C )

(3A ) (3B ) (3C )

Figure 30 : Représentation schématique des 3 voies majeures de la UPR (Naidoo, 2009). (1) L’accumulation de protéines non-repliées ou mal-repliées est titrée par BiP qui va induire 3 effecteurs du stress du RE: PERK (2A), IRE-1 (2B) et ATF6 (2C). (3A) PERK activée phosphoryle eIF2 ! pour ralentir la traduction des protéines et phosphoryle NRF-2 pour sur-réguler la réponse anti-oxydante. (3C) ATF6 activées et clivées entraîne la transcription de gènes codant des chaperonnes telles que BiP, PDI, GRP94, etc. (3B) L’activation de IRE-1 entraîne l’épissage de XBP-1, l’activation transcriptionnelle des chaperonnes et la stimulation de la dégradation des protéines.

Les connaissances actuelles permettent donc de mesurer la UPR par une série d’expériences : la détection de la phosphorylation de PERK et eIF2 par immunoblot avec des anticorps phospho-spécifiques, la mesure des transcrits des chaperonnes telles que BiP et la détection de l’épissage de XBP1 par RTq-PCR, la quantification de la diminution de la synthèse protéique par marquage [S 35 ]méthionine (pulse-chase) qui peut également être utilisé pour déterminer la non-glycosylation et la dégradation des protéines.

L’utilisation de ces données permettrait de déterminer si l’extinction de NACA peut entraîner la UPR. A savoir, il a déjà été déterminé que l’inhibition de NACA par siRNA entraîne le stress du RE (par mesure de la phosphorylation de PERK et de eIF2) dans les cellules Hela (Hotokezaka et al., 2009). Ces données soutiennent notre hypothèse selon laquelle NACA pourrait prendre en charge le repliement des polypeptides naissants. Afin de le déterminer, nous pourrions étudier l’effet de l’extinction de NACA par siRNA sur le

146 repliement de deux protéines interagissant avec le complexe NACA : la luciférase (Lauring et al., 1995a) et EPO-R dans les cellules érythroleucémiques humaines TF-1. Etant donnée que la luciférase non-repliée n’émet pas de luminescence, nous pourrions mettre au point un test simple basé sur la mesure de la luminescence. Ce test consisterait à réprimer NACA par siRNA dans des cellules exprimant la luciférase de façon stable, puis de mesurer la luminescence à 24h, 48h et 72h après l’application du siRNA NACA. La luciférase ayant un temps de ½ vie de 4h, son accumulation après extinction de NACA devrait être rapidement éliminée.

L’effet de l’extinction de NACA sur la synthèse de la Luciférase et d’EPO-R, leur dégradation et l’accumulation de leurs transcrits devront également être étudié dans les cellules érythroleucémiques humaines TF-1 par pusle-chase et RTq-PCR respectivement.

La glycosylation d’EPO-R en absence de NACA pourrait être déterminée (puisque EPO-R non-glycosylé a un poids moléculaire de 62KDa que l’on peut distinguer des formes glycosylées de 64KDa (N-glycosylé) et 66KDa (mature)) après séparation sur SDS-PAGE des protéines marquées par [S 35 ]méthionine suivi d’une immunoprécipitation d’EPO-R (Yoshimura et al., 1990). Il n’est pas certain que l’absence de NACA perturbe la glycosylation d’EPO-R qui a lieu dans la lumière du RE, puisque théoriquement NACA interagit avec la partie C-terminale des polypeptides naissants (Wang et al., 1995), soit la partie cytosolique de EPO-R.

Le complexe NAC a été décrit comme impliqué dans l’orientation des polypeptides naissants vers le RE. Par conséquent, il est légitime de se demander si l’extinction de NACA pourrait avoir des conséquences sur la translocation d’EPO-R dans le RE. D’après Lauring et al, 1995a, l’absence de NAC n’affecte pas l’orientation d’un polypeptide à ‘‘signal peptide’’ dans la membrane du RE. Cependant, il est important de vérifier que l’extinction de NACA n’a pas d’effet sur la fidelité de translocation dans le RE pour EPO-R et dans un contexte cellulaire de TF-1 par immunofluorescence.

L’ensemble de ces tests déterminera si NACA est impliquée dans le repliement, la dégradation et l’orientation des protéines nouvellement synthétisées (la luciférase et l’EPO- R).

147 5. Implication de NACA/FADD dans la différenciation érythroïde normale et des ES-MDS

L’article 3 souligne que l’expression ectopique de NACA dans les progéniteurs CD34+ de patients atteints de ES-MDS rétablit la différenciation érythroïde et augmente la survie des progéniteurs érythroïdes, mais n’explique pas par quel mécanisme moléculaire cela s’effectue.

La régulation de la protéine FADD nous paraît l’hypothèse la plus évidente. En effet, 1) il a été démontré que FADD est surexprimée chez les patients atteints de syndrome myélodysplasiques de bas risque (ES-MDS) ce qui induit l’apoptose accrue des progéniteurs érythroïdes (Claessens et al., 2005), 2) NACA régule négativement FADD (Stilo et al., 2003).

Ainsi, nous avions commencé à rechercher si le complexe FADD/NACA est responsable de la restauration de la différenciation érythroïde des cellules de patients ES- MDS.

Il est évident que l’identification du complexe FADD/NACA dans des progéniteurs hématopoïétiques CD34+ de patients atteints de ES-MDS par immunoprécipitation aurait été la stratégie la plus simple. Cependant, cette expérience est irréalisable : nous n’avons jamais recueilli plus d’un millions de CD34+ lors du tri cellulaire de moelle osseuse des ces patients, alors qu’au moins 30 millions de cellules auraient été nécessaires.

Nous avons donc recherché une manière détournée de répondre à cette question. La stratégie consistait à 1) déterminer le domaine de NACA qui interagissait avec FADD ; 2) déterminer le domaine de NACA qui joue le rôle de régulateur positif de la différenciation érythroïde ; Si les mêmes domaines étaient impliqués, la corrélation pourrait être faite.

Nos résultats suggèrent que la partie C-terminale de NACA est impliquée dans l’interaction de NACA avec FADD (figure 26), ainsi que dans la régulation de la différenciation érythroïde (figure 25).

Le domaine C-terminal de NACA contient un domaine UBA et est décrit comme interagissant avec des protéines impliquées dans la dégradation (Panasenko et al., 2009; Quelo et al., 2004a).

148 26S Protéasome Core GSK3 Ub CP Particle NAC P UBA 1 215 T- 159 FADD

En effet, la partie C-terminale de NACA interagit avec l’ubiquitine et le ‘‘core particle’’ du 26S protéasome qui joue un rôle aussi bien dans la stabilité du complexe NAC, que celui formé avec le ribosome, suggérant que NACA participe au contrôle qualité des protéines nouvellement synthétisées (Panasenko et al., 2009). Ce domaine C-terminal de NACA contient le site de phosphorylation de GSK3 . La phosphorylation de NACA par GSK3 entraîne NACA dans la voie de dégradation du 26S protéasome (Quelo et al., 2004a). Toutes ces données indiquent que la partie C-terminale de NACA est étroitement liée au protéasome et au contrôle qualité des protéines. Il est alors possible que NACA titre l’excès de FADD et l’oriente dans la dégradation du 26S protéasome. Cette hypothèse pourrait se vérifier en mesurant les quantités de la protéine FADD par immunoblot dans des progéniteurs CD34+ cultivées en condition de différenciation érythroïde transduits par NACA comparé au contrôle transduit GFP.

Nos résultats préliminaires obtenus dans le but d’identifier le domaine de NACA jouant la fonction de régulateur positif de la différenciation érythroïde, doivent être complétées pour définir si la partie C-terminale serait seule suffisante pour jouer le rôle de NACA dans la différenciation érythroïde. Pour cela, il faudrait construire deux mutants de NACA contenant les acides aminés de 150-215 et 178-215 respectivement, vérifier que leur interaction avec FADD est conservée, et les transduire dans des CD34+ sains et de patients atteints de ES-MDS. Si ces mutants sont capables de réguler positivement la différenciation érythroïde humaine (que l’on pourra évaluer en mesurant le marqueur de surface GPA par cytométrie de flux), on pourra affirmer que la partie C-terminale de NACA est impliqué dans la différenciation érythroïde.

Cependant, cette stratégie ne permet pas d’exclure la possibilité qu’un interacteur autre que FADD soit capable d’interagir avec la partie C-terminale de NACA et impliquée pour rétablir la différenciation érythroïde des ES-MDS.

149 L’interaction entre NACA est FADD pourrait être mise en évidence par la nouvelle technologie ‘‘Antibody pair in situ PLA’’ récemment proposé par Abnova. Cette technique permet de visualiser par immunofluorescence les interactions protéine-protéine in situ.

(http://www.tebu-bio.com/upload/cms/Abnova_in_situ_PLA_Protein_Protein_Interaction_Ab_Pair.pdf)

Cette technologie ressemble à l’immunofluorescence classique mais avec l’utilisation d’anticorps secondaires spécifiques couplés à un oligo d’ADN. Lorsque les deux anticorps secondaires sont à proximité, ils permettent l’amplification de l’ADN et l’hybridation de sondes couplées à un fluorochrome. Ainsi, la fluorescence émise est visualisable au microscope confocal. Si cette technique tient ses promesses, elle pourrait être utilisée pour détecter l’interaction entre FADD et NACA directement dans les progéniteurs CD34+ issus de patients atteints de ES-MDS, et également dans des cellules CD34+ d’individus sains. En effet, le complexe FADD/NACA pourrait exister également lors de la différenciation érythroïde humaine normale qui est un processus où siège un équilibre paradoxal entre l’activation des voies de différentiation et celles de l’apoptose.

Dans le cas où l’interaction entre FADD et NACA n’est pas mise en évidence dans les cellules érythroïdes humaines normales et de ES-MDS, la recherche d’interacteur de la partie C-terminale de NACA pourrait être envisagée.

6. Recherche des interacteurs de la partie C-terminale de NACA

Avant toute chose, cette perspective ne pourra être envisagée que si le domaine C- terminal de NACA est suffisant pour réguler la différenciation érythroïde humaine.

La première hypothèse est de rechercher si ERGIC-53 interagit avec la partie C- terminale de NACA par co-immunoprécipitation dans un système de co-expression ectopiques des mutants de délétions de NACA avec ERGIC-53.

Dans le cas où ERGIC-53 n’est pas un intéracteur de la partie C-terminale de NACA, il est possible qu’un intéracteur de la partie C-terminale de NACA non encore identifié soit impliqué. Nous pourrions alors rechercher de nouveaux intéracteurs de la partie C-terminale de NACA par une étude protéomique.

La recherche d’interacteurs de la partie C-terminale de NACA pourra être réalisée dans les cellules érythroleucémiques humaines TF-1, par TAP-tag. En effet la purification

150 d’affinité est une technique efficace qui nous a permis d’identifier de nouveaux partenaires moléculaires de NACA. Cependant, le TAP-tag utilisé dans nos expériences n’a pas donné entière satisfaction puisque le site de clivage à la PP n’est pas fonctionnel et le module CBP n’a pas de bon rendement de purification. De plus, la taille de ce TAP-tag est de 15KDa, autrement dit ce TAP-tag est trop grand pour être fusionné à une partie de NACA dont le poids moléculaire n’excédera pas les 10 KDa. Par conséquent, l’utilisation d’un TAP-tag de très petite taille (4,6KDa) (Gloeckner et al., 2007) devrait être adapté pour minimiser les problèmes d’encombrement stérique, et permettre la purification de complexes protéiques interagissant avec le domaine C-terminal de NACA.

7. Taux de transcrits de NACA et réponse au traitement par rhuEPO

Notre étude (article 3) a permis de mettre en évidence une corrélation entre les taux d’ARNm de NACA et la réponse au traitement par rhuEPO des patients atteints de ES-MDS. Ces résultats ont été obtenus sur 11 patients seulement. Par conséquent, la mesure du transcrit de NACA devra être effectuée sur une population plus grande de patients afin d’être validé comme test permettant de prédire la réponse des patients à rhuEPO. Ainsi, la mesure du transcrit de NACA comme un marqueur de réponse au traitement par rhuEPO pourrait devenir un test diagnostique permettant d’orienter les médecins dans leurs choix de thérapies.

Cette corrélation entre NACA et la réponse à rhuEPO, nous laisse spéculer sur les raisons biologiques qui lie NACA et EPO. L’hypothèse la plus évidente, est que NACA favorise l’expression d’EPO-R à la surface cellulaire (article 2), ce qui certainement augmente la sensibilité des cellules à l’EPO. Cependant, les études ayant mesurées les quantités d’EPO- R à la surface des cellules de patients ES-MDS, semblent partagées sur la question. Une première étude a mis en évidence que les taux d’EPO-R dans les cellules de moelle osseuse de patients atteints d’anémie réfractaire sont inférieurs à ceux des cellules de moelle osseuse normale (Takeshita et al., 2002). Une deuxième étude ne décèle aucun défaut d’expression d’EPO-R à la surface cellulaire des patients atteints de ES-MDS (Backx et al., 1996). Malgré ces résultats, nous pouvons être critique sur l’interprétation de ce travail qui considère peu de patients ES-MDS et qui n’est en aucun cas comparatif entre des répondeurs et des non répondeurs à rhuEPO. Une autre étude concernant l’analyse génétique du gène epo-r de patients ES-MDS rapporte 1 cas (sur 8) avec une mutation d’EPO-R (Mittelman et al., 1996), suggérant que des anomalies d’EPO-R pourrait être responsables d’une absence de réponse au

151 traitement par rhuEPO. En conclusion, la recherche des anomalies d’expression ou des mutations de l’EPO-R chez les patients non répondeurs au traitement par rhuEPO semble être une piste à exploiter. Aujourd’hui, à l’université de Utah, le Dr Josef Prchal a lancé une campagne pour recruter des participants afin de rechercher si des mutations d’EPO-R sont diagnostiquées sur des patients atteints de SMD et d’évaluer leurs conséquences sur la signalisation cellulaire de la voie EPO/EPO-R (http://clinicaltrials.gov/ct2/show/NCT00723112). Cette étude pourrait faire avancer les données sur ce sujet.

Pour conclure, notre étude a permis de mettre en évidence l’intérêt de la protéine NACA dans la régulation de la différenciation érythroïde humaine normale et pathologique des syndrômes myélodysplasiques de bas risque. Nos résultats démontrent que des molécules de la machinerie générale de la synthèse protéique telles que NACA peuvent réguler des protéines spécifiques (EPO-R) et importantes pour la différenciation érythroïde, et ainsi maintenir l’équilibre paradoxal entre les voies de différenciation et celles de l’apoptose.

152 BIBLIOGRAPHIE

Italian Cooperative Study Group for rHuEpo Abu-Farha, M., Elisma, F., Zhou, H., Tian, R., Asmer, M.S. and Figeys, D. (2009) Proteomics: from technology developments to biological applications. Anal Chem , 81 , 4585-4599. Aguissa-Toure, A.H., Da Costa, L., Leblanc, T., Tchernia, G., Fribourg, S. and Gleizes, P.E. (2009) [Diamond- Blackfan anemia reveals the dark side of ribosome biogenesis]. Med Sci (Paris) , 25 , 69-76. Akhouayri, O., Quelo, I. and St-Arnaud, R. (2005) Sequence-specific DNA binding by the alphaNAC coactivator is required for potentiation of c-Jun-dependent transcription of the osteocalcin gene. Mol Cell Biol , 25 , 3452-3460. Al-Shanti, N. and Aldahoodi, Z. (2006) Inhibition of alpha nascent polypeptide associated complex protein may induce proliferation, differentiation and enhance the cytotoxic activity of human CD8+ T cells. J Clin Immunol , 26 , 457-464. Al-Shanti, N., Steward, C.G., Garland, R.J. and Rowbottom, A.W. (2004) Investigation of alpha nascent polypeptide-associated complex functions in a human CD8(+) T cell ex vivo expansion model using antisense oligonucleotides. Immunology , 112 , 397-403. Appenzeller, C., Andersson, H., Kappeler, F. and Hauri, H.P. (1999) The lectin ERGIC-53 is a cargo transport receptor for glycoproteins. Nat Cell Biol , 1, 330-334. Appenzeller-Herzog, C. and Hauri, H.P. (2006) The ER-Golgi intermediate compartment (ERGIC): in search of its identity and function. J Cell Sci , 119 , 2173-2183. Appenzeller-Herzog, C., Roche, A.C., Nufer, O. and Hauri, H.P. (2004) pH-induced conversion of the transport lectin ERGIC-53 triggers glycoprotein release. J Biol Chem , 279 , 12943-12950. Ashkenazi, A. and Herbst, R.S. (2008) To kill a tumor cell: the potential of proapoptotic receptor agonists. J Clin Invest , 118 , 1979-1990. Backx, B., Broeders, L., Hoefsloot, L.H., Wognum, B. and Lowenberg, B. (1996) Erythropoiesis in myelodysplastic syndrome: expression of receptors for erythropoietin and kit ligand. Leukemia , 10 , 466-472. Baghdoyan, S., Dubreuil, P., Eberle, F. and Gomez, S. (2000) Capture of cytokine-responsive genes (NACA and RBM3) using a gene trap approach. Blood , 95 , 3750-3757. Beatrix, B., Sakai, H. and Wiedmann, M. (2000) The alpha and beta subunit of the nascent polypeptide- associated complex have distinct functions. J Biol Chem , 275 , 37838-37845. Beckman, D.L., Lin, L.L., Quinones, M.E. and Longmore, G.D. (1999) Activation of the erythropoietin receptor is not required for internalization of bound erythropoietin. Blood , 94 , 2667-2675. Bennett, J.M. (2009) 10 Myelodysplastic syndromes: update on classification. Leukemia Research, Abstracts of the 10th International Symposium on Myelodysplastic Syndromes , 33 , S6-S8. Bennett, J.M., Catovsky, D., Daniel, M.T., Flandrin, G., Galton, D.A., Gralnick, H.R. and Sultan, C. (1976) Proposals for the classification of the acute leukaemias. French-American-British (FAB) co-operative group. Br J Haematol , 33 , 451-458. Bennett, J.M., Catovsky, D., Daniel, M.T., Flandrin, G., Galton, D.A., Gralnick, H.R. and Sultan, C. (1982) Proposals for the classification of the myelodysplastic syndromes. Br J Haematol , 51 , 189-199. Bohlius, J., Wilson, J., Seidenfeld, J., Piper, M., Schwarzer, G., Sandercock, J., Trelle, S., Weingart, O., Bayliss, S., Djulbegovic, B., Bennett, C.L., Langensiepen, S., Hyde, C. and Engert, A. (2006) Recombinant human erythropoietins and cancer patients: updated meta-analysis of 57 studies including 9353 patients. J Natl Cancer Inst , 98 , 708-714. Boudard, D., Vasselon, C., Bertheas, M.F., Jaubert, J., Mounier, C., Reynaud, J., Viallet, A., Chautard, S., Guyotat, D. and Campos, L. (2002) Expression and prognostic significance of Bcl-2 family proteins in myelodysplastic syndromes. Am J Hematol , 70 , 115-125. Bouscary, D., Pene, F., Claessens, Y.E., Muller, O., Chretien, S., Fontenay-Roupie, M., Gisselbrecht, S., Mayeux, P. and Lacombe, C. (2003) Critical role for PI 3-kinase in the control of erythropoietin- induced erythroid progenitor proliferation. Blood , 101 , 3436-3443. Bowen, D., Culligan, D. and Jacobs, A. (1991) The treatment of anaemia in the myelodysplastic syndromes with recombinant human erythropoietin. Br J Haematol , 77 , 419-423. Brajenovic, M., Joberty, G., Kuster, B., Bouwmeester, T. and Drewes, G. (2004) Comprehensive proteomic analysis of human Par protein complexes reveals an interconnected protein network. J Biol Chem , 279 , 12804-12811. Broudy, V.C., Lin, N.L., Liles, W.C., Corey, S.J., O'Laughlin, B., Mou, S. and Linnekin, D. (1999) Signaling via Src family kinases is required for normal internalization of the receptor c-Kit. Blood , 94 , 1979-1986. Cheeseman, I.M. and Desai, A. (2005) A combined approach for the localization and tandem affinity purification of protein complexes from metazoans. Sci STKE , 2005 , pl1.

153 Cheson, B.D., Bennett, J.M., Kantarjian, H., Pinto, A., Schiffer, C.A., Nimer, S.D., Lowenberg, B., Beran, M., de Witte, T.M., Stone, R.M., Mittelman, M., Sanz, G.F., Wijermans, P.W., Gore, S. and Greenberg, P.L. (2000) Report of an international working group to standardize response criteria for myelodysplastic syndromes. Blood , 96 , 3671-3674. Chevet, E., Jakob, C.A., Thomas, D.Y. and Bergeron, J.J. (1999) Calnexin family members as modulators of genetic diseases. Semin Cell Dev Biol , 10 , 473-480. Chiba, T., Ikawa, Y. and Todokoro, K. (1991) GATA-1 transactivates erythropoietin receptor gene, and erythropoietin receptor-mediated signals enhance GATA-1 gene expression. Nucleic Acids Res , 19 , 3843-3848. Chin, K., Oda, N., Shen, K. and Noguchi, C.T. (1995) Regulation of transcription of the human erythropoietin receptor gene by proteins binding to GATA-1 and Sp1 motifs. Nucleic Acids Res , 23 , 3041-3049. Chklovskaia, E., Jansen, W., Nissen, C., Lyman, S.D., Rahner, C., Landmann, L. and Wodnar-Filipowicz, A. (1999) Mechanism of flt3 ligand expression in bone marrow failure: translocation from intracellular stores to the surface of T lymphocytes after chemotherapy-induced suppression of hematopoiesis. Blood , 93 , 2595-2604. Claessens, Y.E., Bouscary, D., Dupont, J.M., Picard, F., Melle, J., Gisselbrecht, S., Lacombe, C., Dreyfus, F., Mayeux, P. and Fontenay-Roupie, M. (2002) In vitro proliferation and differentiation of erythroid progenitors from patients with myelodysplastic syndromes: evidence for Fas-dependent apoptosis. Blood , 99 , 1594-1601. Claessens, Y.E., Park, S., Dubart-Kupperschmitt, A., Mariot, V., Garrido, C., Chretien, S., Dreyfus, F., Lacombe, C., Mayeux, P. and Fontenay, M. (2005) Rescue of early-stage myelodysplastic syndrome- deriving erythroid precursors by the ectopic expression of a dominant-negative form of FADD. Blood , 105 , 4035-4042. Cmejla, R., Cmejlova, J., Handrkova, H., Petrak, J. and Pospisilova, D. (2007) Ribosomal protein S17 gene (RPS17) is mutated in Diamond-Blackfan anemia. Hum Mutat , 28 , 1178-1182. Collins, M.O. and Choudhary, J.S. (2008) Mapping multiprotein complexes by affinity purification and mass spectrometry. Curr Opin Biotechnol , 19 , 324-330. Cortelezzi, A., Colombo, G., Pellegrini, C., Silvestris, I., Moronetti Mazzeo, L., Bosari, S., Lambertenghi Deliliers, G. and Fracchiolla, N.S. (2008) Bone marrow glycophorin-positive erythroid cells of myelodysplastic patients responding to high-dose rHuEPO therapy have a different gene expression pattern from those of nonresponders. Am J Hematol , 83 , 531-539. Cory, S. and Adams, J.M. (2002) The Bcl2 family: regulators of the cellular life-or-death switch. Nat Rev Cancer , 2, 647-656. Cunningham, M.A., Pipe, S.W., Zhang, B., Hauri, H.P., Ginsburg, D. and Kaufman, R.J. (2003) LMAN1 is a molecular chaperone for the secretion of coagulation factor VIII. J Thromb Haemost , 1, 2360-2367. Czibere, A., Bruns, I., Junge, B., Singh, R., Kobbe, G., Haas, R. and Germing, U. (2009) Low RPS14 expression is common in myelodysplastic syndromes without 5q- aberration and defines a subgroup of patients with prolonged survival. Haematologica , 94 , 1453-1455. Da Costa, L., Willig, T.N., Fixler, J., Mohandas, N. and Tchernia, G. (2001) Diamond-Blackfan anemia. Curr Opin Pediatr , 13 , 10-15. D'Andrea, A.D. and Zon, L.I. (1990) Erythropoietin receptor. Subunit structure and activation. J Clin Invest , 86 , 681-687. Draptchinskaia, N., Gustavsson, P., Andersson, B., Pettersson, M., Willig, T.N., Dianzani, I., Ball, S., Tchernia, G., Klar, J., Matsson, H., Tentler, D., Mohandas, N., Carlsson, B. and Dahl, N. (1999) The gene encoding ribosomal protein S19 is mutated in Diamond-Blackfan anaemia. Nat Genet , 21 , 169-175. Ebert, B.L., Pretz, J., Bosco, J., Chang, C.Y., Tamayo, P., Galili, N., Raza, A., Root, D.E., Attar, E., Ellis, S.R. and Golub, T.R. (2008) Identification of RPS14 as a 5q- syndrome gene by RNA interference screen. Nature , 451 , 335-339. Elagib, K.E., Xiao, M., Hussaini, I.M., Delehanty, L.L., Palmer, L.A., Racke, F.K., Birrer, M.J., Shanmugasundaram, G., McDevitt, M.A. and Goldfarb, A.N. (2004) Jun blockade of erythropoiesis: role for repression of GATA-1 by HERP2. Mol Cell Biol , 24 , 7779-7794. Elliott, S., Pham, E. and Macdougall, I.C. (2008) Erythropoietins: a common mechanism of action. Exp Hematol , 36 , 1573-1584. Endharti, A.T., Zhou, Y.W., Nakashima, I. and Suzuki, H. (2005) Galectin-1 supports survival of naive T cells without promoting cell proliferation. Eur J Immunol , 35 , 86-97. Fontenay-Roupie, M., Bouscary, D., Guesnu, M., Picard, F., Melle, J., Lacombe, C., Gisselbrecht, S., Mayeux, P. and Dreyfus, F. (1999) Ineffective erythropoiesis in myelodysplastic syndromes: correlation with Fas expression but not with lack of erythropoietin receptor signal transduction. Br J Haematol , 106 , 464- 473.

154 Fujimori, K.E., Uyeda, A. and Taguchi, T. (2002) Regulatory expression of MDP77 protein in the skeletal and cardiac muscles. FEBS Lett , 529 , 303-308. Fullekrug, J., Scheiffele, P. and Simons, K. (1999) VIP36 localisation to the early secretory pathway. J Cell Sci , 112 ( Pt 17) , 2813-2821. Funfschilling, U. and Rospert, S. (1999) Nascent polypeptide-associated complex stimulates protein import into yeast mitochondria. Mol Biol Cell , 10 , 3289-3299. Ganapathi, K.A. and Shimamura, A. (2008) Ribosomal dysfunction and inherited marrow failure. Br J Haematol , 141 , 376-387. Gazda, H.T., Grabowska, A., Merida-Long, L.B., Latawiec, E., Schneider, H.E., Lipton, J.M., Vlachos, A., Atsidaftos, E., Ball, S.E., Orfali, K.A., Niewiadomska, E., Da Costa, L., Tchernia, G., Niemeyer, C., Meerpohl, J.J., Stahl, J., Schratt, G., Glader, B., Backer, K., Wong, C., Nathan, D.G., Beggs, A.H. and Sieff, C.A. (2006) Ribosomal protein S24 gene is mutated in Diamond-Blackfan anemia. Am J Hum Genet , 79 , 1110-1118. George, R., Beddoe, T., Landl, K. and Lithgow, T. (1998) The yeast nascent polypeptide-associated complex initiates protein targeting to mitochondria in vivo. Proc Natl Acad Sci U S A , 95 , 2296-2301. George, R., Walsh, P., Beddoe, T. and Lithgow, T. (2002) The nascent polypeptide-associated complex (NAC) promotes interaction of ribosomes with the mitochondrial surface in vivo. FEBS Lett , 516 , 213-216. Glass, J., Lavidor, L.M. and Robinson, S.H. (1975) Use of cell separation and short-term culture techniques to study erythroid cell development. Blood , 46 , 705-711. Gloeckner, C.J., Boldt, K., Schumacher, A., Roepman, R. and Ueffing, M. (2007) A novel tandem affinity purification strategy for the efficient isolation and characterisation of native protein complexes. Proteomics , 7, 4228-4234. Greenberg, P., Cox, C., LeBeau, M.M., Fenaux, P., Morel, P., Sanz, G., Sanz, M., Vallespi, T., Hamblin, T., Oscier, D., Ohyashiki, K., Toyama, K., Aul, C., Mufti, G. and Bennett, J. (1997) International scoring system for evaluating prognosis in myelodysplastic syndromes. Blood , 89 , 2079-2088. Greenberg, P.L. (1983) The smoldering myeloid leukemic states: clinical and biologic features. Blood , 61 , 1035- 1044. Greenberg, P.L. and Mara, B. (1979) The preleukemic syndrome: correlation of in vitro parameters of granulopoiesis with clinical features. Am J Med , 66 , 951-958. Greenberg, P.L., Sun, Z., Miller, K.B., Bennett, J.M., Tallman, M.S., Dewald, G., Paietta, E., van der Jagt, R., Houston, J., Thomas, M.L., Cella, D. and Rowe, J.M. (2009) Treatment of myelodysplastic syndrome patients with erythropoietin with or without granulocyte colony-stimulating factor: results of a prospective randomized phase 3 trial by the Eastern Cooperative Oncology Group (E1996). Blood , 114 , 2393-2400. Gross, A.W. and Lodish, H.F. (2006) Cellular trafficking and degradation of erythropoietin and novel erythropoiesis stimulating protein (NESP). J Biol Chem , 281 , 2024-2032. Harris, N.L., Jaffe, E.S., Diebold, J., Flandrin, G., Muller-Herm elink, H.K., Vardiman, J., Lister, T.A. and Bloomfield, C.D. (1999) World Health Organization classification of neoplastic diseases of the hematopoietic and lymphoid tissues: report of the Clinical Advisory Committee meeting-Airlie House, Virginia, November 1997. J Clin Oncol , 17 , 3835-3849. Harris, N.L., Jaffe, E.S., Diebold, J., Flandrin, G., Muller-Hermelink, H.K., Vardiman, J., Lister, T.A. and Bloomfield, C.D. (2000) The World Health Organization classification of hematological malignancies report of the Clinical Advisory Committee Meeting, Airlie House, Virginia, November 1997. Mod Pathol , 13 , 193-207. Hauri, H., Appenzeller, C., Kuhn, F. and Nufer, O. (2000a) Lectins and traffic in the secretory pathway. FEBS Lett , 476 , 32-37. Hauri, H.P., Kappeler, F., Andersson, H. and Appenzeller, C. (2000b) ERGIC-53 and traffic in the secretory pathway. J Cell Sci , 113 ( Pt 4) , 587-596. Hauri, H.P., Nufer, O., Breuza, L., Tekaya, H.B. and Liang, L. (2002) Lectins and protein traffic early in the secretory pathway. Biochem Soc Symp , 73-82. Hauri, H.P. and Schweizer, A. (1992) The endoplasmic reticulum-Golgi intermediate compartment. Curr Opin Cell Biol , 4, 600-608. Helenius, A. and Aebi, M. (2004) Roles of N-linked glycans in the endoplasmic reticulum. Annu Rev Biochem , 73 , 1019-1049. Hellstrom-Lindberg, E., Gulbrandsen, N., Lindberg, G., Ahlgren, T., Dahl, I.M., Dybedal, I., Grimfors, G., Hesse-Sundin, E., Hjorth, M., Kanter-Lewensohn, L., Linder, O., Luthman, M., Lofvenberg, E., Oberg, G., Porwit-MacDonald, A., Radlund, A., Samuelsson, J., Tangen, J.M., Winquist, I. and Wisloff, F. (2003) A validated decision model for treating the anaemia of myelodysplastic syndromes with erythropoietin + granulocyte colony-stimulating factor: significant effects on quality of life. Br J Haematol , 120 , 1037-1046.

155 Hellstrom-Lindberg, E., Negrin, R., Stein, R., Krantz, S., Lindberg, G., Vardiman, J., Ost, A. and Greenberg, P. (1997) Erythroid response to treatment with G-CSF plus erythropoietin for the anaemia of patients with myelodysplastic syndromes: proposal for a predictive model. Br J Haematol , 99 , 344-351. Hellstrom-Lindberg, E., Schmidt-Mende, J., Forsblom, A.M., Christensson, B., Fadeel, B. and Zhivotovsky, B. (2001) Apoptosis in refractory anaemia with ringed sideroblasts is initiated at the stem cell level and associated with increased activation of caspases. Br J Haematol , 112 , 714-726. Hilton, D.J., Watowich, S.S., Murray, P.J. and Lodish, H.F. (1995) Increased cell surface expression and enhanced folding in the endoplasmic reticulum of a mutant erythropoietin receptor. Proc Natl Acad Sci U S A , 92 , 190-194. Holowaty, M.N., Sheng, Y., Nguyen, T., Arrowsmith, C. and Frappier, L. (2003) Protein interaction domains of the ubiquitin-specific protease, USP7/HAUSP. J Biol Chem , 278 , 47753-47761. Hong, L., Ramdas, B., Chen, J., Harris, C., Wojchowski, D.M. and Kapur, R. (2008) KIT associated intracellular tyrosines play an essential role in EpoR co-signaling. Cell Signal , 20 , 1513-1520. Hotokezaka, Y., van Leyen, K., Lo, E.H., Beatrix, B., Katayama, I., Jin, G. and Nakamura, T. (2009) alphaNAC depletion as an initiator of ER stress-induced apoptosis in hypoxia. Cell Death Differ , 16 , 1505-1514. Howe, R.B., Porwit-MacDonald, A., Wanat, R., Tehranchi, R. and Hellstrom-Lindberg, E. (2004) The WHO classification of MDS does make a difference. Blood , 103 , 3265-3270. Huang, L.J., Constantinescu, S.N. and Lodish, H.F. (2001) The N-terminal domain of Janus kinase 2 is required for Golgi processing and cell surface expression of erythropoietin receptor. Mol Cell , 8, 1327-1338. Jacobs, A., Culligan, D. and Bowen, D. (1991) Erythropoietin and the myelodysplastic syndrome. Contrib Nephrol , 88 , 266-270. Jadersten, M., Malcovati, L., Dybedal, I., Della Porta, M.G., Invernizzi, R., Montgomery, S.M., Pascutto, C., Porwit, A., Cazzola, M. and Hellstrom-Lindberg, E. (2008) Erythropoietin and granulocyte-colony stimulating factor treatment associated with improved survival in myelodysplastic syndrome. J Clin Oncol , 26 , 3607-3613. Jadersten, M., Montgomery, S.M., Dybedal, I., Porwit-MacDonald, A. and Hellstrom-Lindberg, E. (2005) Long- term outcome of treatment of anemia in MDS with erythropoietin and G-CSF. Blood , 106 , 803-811. Jaffe, B.D., Sabath, D.E., Johnson, G.D., Moscinski, L.C., Johnson, K.R., Rovera, G., Nauseef, W.M. and Prystowsky, M.B. (1988) Myeloperoxidase and oncogene expression in GM-CSF induced bone marrow differentiation. Oncogene , 2, 167-174. Jonson, L., Vikesaa, J., Krogh, A., Nielsen, L.K., Hansen, T., Borup, R., Johnsen, A.H., Christiansen, J. and Nielsen, F.C. (2007) Molecular composition of IMP1 ribonucleoprotein granules. Mol Cell Proteomics , 6, 798-811. Kadri , Z., M aouche-Chretien, L., Rooke, H.M., Orkin, S.H., Romeo, P.H., Mayeux, P., Leboulch, P. and Chretien, S. (2005) Phosphatidylinositol 3-kinase/Akt induced by erythropoietin renders the erythroid differentiation factor GATA-1 competent for TIMP-1 gene transactivation. Mol Cell Biol , 25 , 7412- 7422. Kamiya, Y., Yamaguchi, Y., Takahashi, N., Arata, Y., Kasai, K., Ihara, Y., Matsuo, I., Ito, Y., Yamamoto, K. and Kato, K. (2005) Sugar-binding properties of VIP36, an intracellular animal lectin operating as a cargo receptor. J Biol Chem , 280 , 37178-37182. Kato, K. and Kamiya, Y. (2007) Structural views of glycoprotein-fate determination in cells. Glycobiology , 17 , 1031-1044. Kerenyi, M.A., Grebien, F., Gehart, H., Schifrer, M., Artaker, M., Kovacic, B., Beug, H., Moriggl, R. and Mullner, E.W. (2008) Stat5 regulates cellular iron uptake of erythroid cells via IRP-2 and TfR-1. Blood , 112 , 3878-3888. Knuesel, M., Wan, Y., Xiao, Z., Holinger, E., Lowe, N., Wang, W. and Liu, X. (2003) Identification of novel protein-protein interactions using a versatile mammalian tandem affinity purification expression system. Mol Cell Proteomics , 2, 1225-1233. Koury, S.T., Bondurant, M.C. and Koury, M.J. (1988) Localization of erythropoietin synthesizing cells in murine kidneys by in situ hybridization. Blood , 71 , 524-527. Kramer, G., Boehringer, D., Ban, N. and Bukau, B. (2009) The ribosome as a platform for co-translational processing, folding and targeting of newly synthesized proteins. Nat Struct Mol Biol , 16 , 589-597. Lauring, B., Kreibich, G. and Weidmann, M. (1995a) The intrinsic ability of ribosomes to bind to endoplasmic reticulum membranes is regulated by signal recognition particle and nascent-polypeptide-associated complex. Proc Natl Acad Sci U S A , 92 , 9435-9439. Lauring, B., Sakai, H., Kreibich, G. and Wiedmann, M. (1995b) Nascent polypeptide-associated complex protein prevents mistargeting of nascent chains to the endoplasmic reticulum. Proc Natl Acad Sci U S A , 92 , 5411-5415. Lennartsson, J., Jelacic, T., Linnekin, D. and Shivakrupa, R. (2005) Normal and oncogenic forms of the receptor tyrosine kinase kit. Stem Cells , 23 , 16-43.

156 Levin, I., Cohen, J., Supino-Rosin, L., Yoshimura, A., Watowich, S.S. and Neumann, D. (1998) Identification of a cytoplasmic motif in the erythropoietin receptor required for receptor internalization. FEBS Lett , 427 , 164-170. Li, H., Randall, W.R. and Du, S.J. (2009) skNAC (skeletal Naca), a muscle-specific isoform of Naca (nascent polypeptide-associated complex alpha), is required for myofibril organization. Faseb J , 23 , 1988-2000. Li, K., Miller, C., Hegde, S. and Wojchowski, D. (2003) Roles for an Epo receptor Tyr-343 Stat5 pathway in proliferative co-signaling with kit. J Biol Chem , 278 , 40702-40709. Liebermann, D.A., Gregory, B. and Hoffman, B. (1998) AP-1 (Fos/Jun) transcription factors in hematopoietic differentiation and apoptosis. Int J Oncol , 12 , 685-700. Lievens, P.M., De Servi, B., Garofalo, S., Lunstrum, G.P., Horton, W.A. and Liboi, E. (2008) Transient dimerization and interaction with ERGIC-53 occur in the fibroblast growth factor receptor 3 early secretory pathway. Int J Biochem Cell Biol , 40 , 2649-2659. Linman, J.W. and Bagby, G.C., Jr. (1978) The preleukemic syndrome (hemopoietic dysplasia). Cancer , 42 , 854- 864. Liu, Y., Choudhury, P., Cabral, C.M. and Sifers, R.N. (1999) Oligosaccharide modification in the early secretory pathway directs the selection of a misfolded glycoprotein for degradation by the proteasome. J Biol Chem , 274 , 5861-5867. Lopez, S., Stuhl, L., Fichelson, S., Dubart-Kupperschmitt, A., St Arnaud, R., Galindo, J.R., Murati, A., Berda, N., Dubreuil, P. and Gomez, S. (2005) NACA is a positive regulator of human erythroid-cell differentiation. J Cell Sci , 118 , 1595-1605. Lord, K.A., Abdollahi, A., Hoffman-Liebermann, B. and Liebermann, D.A. (1993) Proto-oncogenes of the fos/jun family of transcription factors are positive regulators of myeloid differentiation. Mol Cell Biol , 13 , 841-851. Makarova, K.S., Aravind, L., Galperin, M.Y., Grishin, N.V., Tatusov, R.L., Wolf, Y.I. and Koonin, E.V. (1999) Comparative genomics of the Archaea (Euryarchaeota): evolution of conserved protein families, the stable core, and the variable shell. Genome Res , 9, 608-628. Malcovati, L., Germing, U., Kuendgen, A., Della Porta, M.G., Pascutto, C., Invernizzi, R., Giagounidis, A., Hildebrandt, B., Bernasconi, P., Knipp, S., Strupp, C., Lazzarino, M., Aul, C. and Cazzola, M. (2007) Time-dependent prognostic scoring system for predicting survival and leukemic evolution in myelodysplastic syndromes. J Clin Oncol , 25 , 3503-3510. Maxwell, P.H., Osmond, M.K., Pugh, C.W., Heryet, A., Nicholls, L.G., Tan, C.C., Doe, B.G., Ferguson, D.J., Johnson, M.H. and Ratcliffe, P.J. (1993) Identification of the renal erythropoietin-producing cells using transgenic mice. Kidney Int , 44 , 1149-1162. Metcalf, D., Begley, C.G., Johnson, G.R., Nicola, N.A., Vadas, M.A., Lopez, A.F., Williamson, D.J., Wong, G.G., Clark, S.C. and Wang, E.A. (1986) Biologic properties in vitro of a recombinant human granul ocy te-macrophage colony-stimulating factor. Blood , 67 , 37-45. Meury, T., Akhouayri, O., Jafarov, T., Mandic, V. and St-Arnaud, R. (2009) Nuclear {alpha}NAC influences bone matrix mineralization and osteoblast maturation in vivo. Mol Cell Biol . Meyer, L., Deau, B., Forejtnikova, H., Dumenil, D., Margottin-Goguet, F., Lacombe, C., Mayeux, P. and Verdier, F. (2007) beta-Trcp mediates ubiquitination and degradation of the erythropoietin receptor and controls cell proliferation. Blood , 109 , 5215-5222. Michalak, M., Corbett, E.F., Mesaeli, N., Nakamura, K. and Opas, M. (1999) Calreticulin: one protein, one gene, many functions. Biochem J , 344 Pt 2 , 281-292. Mittelman, M., Gardyn, J., Carmel, M., Malovani, H., Barak, Y. and Nir, U. (1996) Analysis of the erythropoietin receptor gene in patients with myeloproliferative and myelodysplastic syndromes. Leuk Res , 20 , 459-466. Miyajima, A., Mui, A.L., Ogorochi, T. and Sakamaki, K. (1993) Receptors for granulocyte-macrophage colony- stimulating factor, interleukin-3, and interleukin-5. Blood , 82 , 1960-1974. Mohanty, D., Ghosh, K., Shetty, S., Spreafico, M., Garagiola, I. and Peyvandi, F. (2005) Mutations in the MCFD2 gene and a novel mutation in the LMAN1 gene in Indian families with combined deficiency of factor V and VIII. Am J Hematol , 79 , 262-266. Moreau, A., Yotov, W.V., Glorieux, F.H. and St-Arnaud, R. (1998) Bone-specific expression of the alpha chain of the nascent polypeptide-associated complex, a coactivator potentiating c-Jun-mediated transcription. Mol Cell Biol , 18 , 1312-1321. Moussalli, M., Pipe, S.W., Hauri, H.P., Nichols, W.C., Ginsburg, D. and Kaufman, R.J. (1999) Mannose- dependent endoplasmic reticulum (ER)-Golgi intermediate compartment-53-mediated ER to Golgi trafficking of coagulation factors V and VIII. J Biol Chem , 274 , 32539-32542. Mueller, T.D., Kamionka, M. and Feigon, J. (2004) Specificity of the interaction between ubiquitin-associated domains and ubiquitin. J Biol Chem , 279 , 11926-11936.

157 Mufti, G.J., Bennett, J.M., Goasguen, J., Bain, B.J., Baumann, I., Brunning, R., Cazzola, M., Fenaux, P., Germing, U., Hellstrom-Lindberg, E., Jinnai, I., Manabe, A., Matsuda, A., Niemeyer, C.M., Sanz, G., Tomonaga, M., Vallespi, T. and Yoshimi, A. (2008) Diagnosis and classification of myelodysplastic syndrome: International Working Group on Morphology of myelodysplastic syndrome (IWGM-MDS) consensus proposals for the definition and enumeration of myeloblasts and ring sideroblasts. Haematologica , 93 , 1712-1717. Munugalavadla, V. and Kapur, R. (2005) Role of c-Kit and erythropoietin receptor in erythropoiesis. Crit Rev Oncol Hematol , 54 , 63-75. Naidoo, N. (2009) ER and aging-Protein folding and the ER stress response. Ageing Res Rev , 8, 150-159. Neerman-Arbez, M., Johnson, K.M., Morris, M.A., McVey, J.H., Peyvandi, F., Nichols, W.C., Ginsburg, D., Rossier, C., Antonarakis, S.E. and Tuddenham, E.G. (1999) Molecular analysis of the ERGIC-53 gene in 35 families with combined factor V-factor VIII deficiency. Blood , 93 , 2253-2260. Neumann, D., Wikstrom, L., Watowich, S.S. and Lodish, H.F. (1993) Intermediates in degradation of the erythropoietin receptor accumulate and are degraded in lysosomes. J Biol Chem , 268 , 13639-13649. Neumann, D., Yuk, M.H., Lodish, H.F. and Lederkremer, G.Z. (1996) Blocking intracellular degradation of the erythropoietin and asialoglycoprotein receptors by calpain inhibitors does not result in the same increase in the levels of their membrane and secreted forms. Biochem J , 313 ( Pt 2) , 391-399. Neve, E.P., Svensson, K., Fuxe, J. and Pettersson, R.F. (2003) VIPL, a VIP36-like membrane protein with a putative function in the export of glycoproteins from the endoplasmic reticulum. Exp Cell Res , 288 , 70- 83. Nichols, W.C., Seligsohn, U., Zivelin, A., Terry, V.H., Hertel, C.E., Wheatley, M.A., Moussalli, M.J., Hauri, H.P., Ciavarella, N., Kaufman, R.J. and Ginsburg, D. (1998) Mutations in the ER-Golgi intermediate compartment protein ERGIC-53 cause combined deficiency of coagulation factors V and VIII. Cell , 93 , 61-70. Nogami, S., Satoh, S., Nakano, M., Shimizu, H., Fukushima, H., Maruyama, A., Terano, A. and Shirataki, H. (2003a) Taxilin; a novel syntaxin-binding protein that is involved in Ca2+-dependent exocytosis in neuroendocrine cells. Genes Cells , 8, 17-28. Nogami, S., Satoh, S., Nakano, M., Terano, A. and Shirataki, H. (2003b) Interaction of taxilin with syntaxin which does not form the SNARE complex. Biochem Biophys Res Commun , 311 , 797-802. Nogami, S., Satoh, S., Tanaka-Nakadate, S., Yoshida, K., Nakano, M., Terano, A. and Shirataki, H. (2004) Identification and characterization of taxilin isoforms. Biochem Biophys Res Commun , 319 , 936-943. Nufer, O., Mitrovic, S. and Hauri, H.P. (2003) Profile-based data base scanning for animal L-type lectins and characterization of VIPL, a novel VIP36-like endoplasmic reticulum protein. J Biol Chem , 278 , 15886- 15896. Nyfeler, B., Kam iya, Y., Boehlen, F., Yamamoto, K., Kato, K., de Moerloose, P., Hauri, H.P. and Neerman- Arbez, M. (2008a) Deletion of 3 residues from the C-terminus of MCFD2 affects binding to ERGIC-53 and causes combined factor V and factor VIII deficiency. Blood , 111 , 1299-1301. Nyfeler, B., Koegler, E., Reiterer, V. and Hauri, H.P. (2008b) Luminal lectins . Nyfeler, B., Reiterer, V., Wendeler, M.W., Stefan, E., Zhang, B., Michnick, S.W. and Hauri, H.P. (2008c) Identification of ERGIC-53 as an intracellular transport receptor of alpha1-antitrypsin. J Cell Biol , 180 , 705-712. Nyfeler, B., Zhang, B., Ginsburg, D., Kaufman, R.J. and Hauri, H.P. (2006) Cargo selectivity of the ERGIC- 53/MCFD2 transport receptor complex. Traffic , 7, 1473-1481. Obungu, V.H., Lee Burns, A., Agarwal, S.K., Chandrasekharapa, S.C., Adelstein, R.S. and Marx, S.J. (2003) Menin, a tumor suppressor, associates with nonmuscle myosin II-A heavy chain. Oncogene , 22 , 6347- 6358. Olthof, S.G., Fatrai, S., Drayer, A.L., Tyl, M.R., Vellenga, E. and Schuringa, J.J. (2008) Downregulation of signal transducer and activator of transcription 5 (STAT5) in CD34+ cells promotes megakaryocytic development, whereas activation of STAT5 drives erythropoiesis. Stem Cells , 26 , 1732-1742. Oshikawa, K., Matsumoto, M., Yada, M., Kamura, T., Hatakeyama, S. and Nakayama, K.I. (2003) Preferential interaction of TIP120A with Cul1 that is not modified by NEDD8 and not associated with Skp1. Biochem Biophys Res Commun , 303 , 1209-1216. Panasenko, O., Landrieux, E., Feuermann, M., Finka, A., Paquet, N. and Collart, M.A. (2006) The yeast Ccr4- Not complex controls ubiquitination of the nascent-associated polypeptide (NAC-EGD) complex. J Biol Chem , 281 , 31389-31398. Panasenko, O.O., David, F.P. and Collart, M.A. (2009) Ribosome association and stability of the nascent polypeptide-associated complex is dependent upon its own ubiquitination. Genetics , 181 , 447-460. Park, S., Grabar, S., Kelaidi, C., Beyne-Rauzy, O., Picard, F., Bardet, V., Coiteux, V., Leroux, G., Lepelley, P., Daniel, M.T., Cheze, S., Mahe, B., Ferrant, A., Ravoet, C., Escoffre-Barbe, M., Ades, L., Vey, N., Aljassem, L., Stamatoullas, A., Mannone, L., Dombret, H., Bourgeois, K., Greenberg, P., Fenaux, P.

158 and Dreyfus, F. (2008) Predictive factors of response and survival in myelodysplastic syndrome treated with erythropoietin and G-CSF: the GFM experience. Blood , 111 , 574-582. Parker, J.E. and Mufti, G.J. (2004) The myelodysplastic syndromes: a matter of life or death. Acta Haematol , 111 , 78-99. Parodi, A.J. (2000) Protein glucosylation and its role in protein folding. Annu Rev Biochem , 69 , 69-93. Peter, M.E. and Krammer, P.H. (2003) The CD95(APO-1/Fas) DISC and beyond. Cell Death Differ , 10 , 26-35. Plath, K. and Rapoport, T.A. (2000) Spontaneous release of cytosolic proteins from posttranslational substrates before their transport into the endoplasmic reticulum. J Cell Biol , 151 , 167-178. Puig, O., Caspary, F., Rigaut, G., Rutz, B., Bouveret, E., Bragado-Nilsson, E., Wilm, M. and Seraphin, B. (2001) The tandem affinity purification (TAP) method: a general procedure of protein complex purification. Methods , 24 , 218-229. Quelo, I., Akhouayri, O., Prud'homme, J. and St-Arnaud, R. (2004a) GSK3 beta-dependent phosphorylation of the alpha NAC coactivator regulates its nuclear translocation and proteasome-mediated degradation. Biochemistry , 43 , 2906-2914. Quelo, I., Gauthier, C., Hannigan, G.E., Dedhar, S. and St-Arnaud, R. (2004b) Integrin-linked kinase regulates the nuclear entry of the c-Jun coactivator alpha-NAC and its coactivation potency. J Biol Chem , 279 , 43893-43899. Quelo, I., Gauthier, C. and St-Arnaud, R. (2005) Casein kinase II phosphorylation regulates alphaNAC subcellular localization and transcriptional coactivating activity. Gene Expr , 12 , 151-163. Quelo, I., Hurtubise, M. and St-Arnaud, R. (2002) alphaNAC requires an interaction with c-Jun to exert its transcriptional coactivation. Gene Expr , 10 , 255-262. Quesenberry, P.J., Ihle, J.N. and McGrath, E. (1985) The effect of interleukin 3 and GM-CSA-2 on megakaryocyte and myeloid clonal colony formation. Blood , 65 , 214-217. Rassow, J. and Pfanner, N. (1996) Protein biogenesis: chaperones for nascent polypeptides. Curr Biol , 6, 115- 118. Ravagnan, L., Gurbuxani, S., Susin, S.A., Maisse, C., Daugas, E., Zamzami, N., Mak, T., Jaattela, M., Penninger, J.M., Garrido, C. and Kroemer, G. (2001) Heat-shock protein 70 antagonizes apoptosis- inducing factor. Nat Cell Biol , 3, 839-843. Remacha, A.F., Arrizabalaga, B., Villegas, A., Manteiga, R., Calvo, T., Julia, A., Fernandez Fuertes, I., Gonzalez, F.A., Font, L., Junca, J., del Arco, A., Malcorra, J.J., Equiza, E.P., de Mendiguren, B.P. and Romero, M. (1999) Erythropoietin plus granulocyte colony-stimulating factor in the treatment of myelodysplastic syndromes. Identification of a subgroup of responders. The Spanish Erythropathology Group. Haematologica , 84 , 1058-1064. Ribeil, J.A., Zermati, Y., Vandekerckhove, J., Cathelin, S., Kersual, J., Dussiot, M., Coulon, S., Moura, I.C., Zeuner, A., Kirkegaard-Sorensen, T., Varet, B., Solary, E., Garrido, C. and Hermine, O. (2007) Hsp70 regulates erythropoiesis by preventing caspase-3-mediated cleavage of GATA-1. Nature , 445 , 102-105. Ribeil, J.A., Zermati, Y., Vandekerckhove, J., Dussiot, M., Kersual, J. and Hermine, O. (2005) [Erythropoiesis: a paradigm for the role of caspases in cell death and differentiation]. J Soc Biol , 199 , 219-231. Richmond, T.D., Chohan, M. and Barber, D.L. (2005) Turning cells red: signal transduction mediated by erythropoietin. Trends Cell Biol , 15 , 146-155. Rieu, P. (2008) [Erythropoietin: receptor of stimulating agents of erythropoiesis]. Nephrol Ther , 4 Spec No 2 , 17-22. Roeckel, N., Woerner, S.M., Kloor, M., Yuan, Y.P., Patsos, G., Gromes, R., Kopitz, J. and Gebert, J. (2009) High frequency of LMAN1 abnormalities in colorectal tumors with microsatellite instability. Cancer Res , 69 , 292-299. Rospert, S., Dubaquie, Y. and Gautschi, M. (2002) Nascent-polypeptide-associated complex. Cell Mol Life Sci , 59 , 1632-1639. Saarni, M.I. and Linman, J.W. (1973) Preleukemia. The hematologic syndrome preceding acute leukemia. Am J Med , 55 , 38-48. Saibil, H.R. (2008) Chaperone machines in action. Curr Opin Struct Biol , 18 , 35-42. Saleh, A., Srinivasula, S.M., Balkir, L., Robbins, P.D. and Alnemri, E.S. (2000) Negative regulation of the Apaf- 1 apoptosome by Hsp70. Nat Cell Biol , 2, 476-483. Sawanobori, M., Yamaguchi, S., Hasegawa, M., Inoue, M., Suzuki, K., Kamiyama, R., Hirokawa, K. and Kitagawa, M. (2003) Expression of TNF receptors and related signaling molecules in the bone marrow from patients with myelodysplastic syndromes. Leuk Res , 27 , 583-591. Sawyer, S.T. and Hankins, W.D. (1993) The functional form of the erythropoietin receptor is a 78-kDa protein: correlation with cell surface expression, endocytosis, and phosphorylation. Proc Natl Acad Sci U S A , 90 , 6849-6853. Sawyer, S.T., Krantz, S.B. and Goldwasser, E. (1987) Binding and receptor-mediated endocytosis of erythropoietin in Friend virus-infected erythroid cells. J Biol Chem , 262 , 5554-5562.

159 Schaffer, U., Schlosser, A., Muller, K.M., Schafer, A., Katava, N., Baumeister, R. and Schulze, E. (2010) SnAvi - a new tandem tag for high-affinity protein-complex purification. Nucleic Acids Res . Shi, X., Parthun, M.R. and Jaehning, J.A. (1995) The yeast EGD2 gene encodes a homologue of the alpha NAC subunit of the human nascent-polypeptide-associated complex. Gene , 165 , 199-202. Sidrauski, C., Chapman, R. and Walter, P. (1998) The unfolded protein response: an intracellular signalling pathway with many surprising features. Trends Cell Biol , 8, 245-249. Sieff, C.A., Emerson, S.G., Donahue, R.E., Nathan, D.G., Wang, E.A., Wong, G.G. and Clark, S.C. (1985) Human recombinant granulocyte-macrophage colony-stimulating factor: a multilineage hematopoietin. Science , 230 , 1171-1173. Silva, M., Benito, A., Sanz, C., Prosper, F., Ekhterae, D., Nunez, G. and Fernandez-Luna, J.L. (1999) Erythropoietin can induce the expression of bcl-x(L) through Stat5 in erythropoietin-dependent progenitor cell lines. J Biol Chem , 274 , 22165-22169. Sloand, E.M., Kim, S., Fuhrer, M., Risitano, A.M., Nakamura, R., Maciejewski, J.P., Barrett, A.J. and Young, N.S. (2002) Fas-mediated apoptosis is important in regulating cell replication and death in trisomy 8 hematopoietic cells but not in cells with other cytogenetic abnormalities. Blood , 100 , 4427-4432. Sohal, D.P., Pellagati, A., Zhou, L., Mo, Y., Opalinska, J.B., Alencar, C., Heuck, C., Wickrema, A., Friedman, E., Greally, J., Ebert, B.L., Warner, J., Boultwood, J. and Verma, A. (2008) Downregulation of Ribosomal Proteins Is Seen in Non 5q- MDS. ASH Annual Meeting Abstracts , 112 , 854-. Spiro, R.G. (2004) Role of N-linked polymannose oligosaccharides in targeting glycoproteins for endoplasmic reticulum-associated degradation. Cell Mol Life Sci , 61 , 1025-1041. Spreter, T., Pech, M. and Beatrix, B. (2005) The crystal structure of archaeal nascent polypeptide-associated complex (NAC) reveals a unique fold and the presence of a ubiquitin-associated domain. J Biol Chem , 280 , 15849-15854. Stilo, R., Liguoro, D., di Jeso, B., Leonardi, A. and Vito, P. (2003) The alpha-chain of the nascent polypeptide- associated complex binds to and regulates FADD function. Biochem Biophys Res Commun , 303 , 1034- 1041. Stone, R.M. (2009) How I treat patients with myelodysplastic syndromes. Blood , 113 , 6296-6303. Strous, G.J. and Gent, J. (2002) Dimerization, ubiquitylation and endocytosis go together in growth hormone receptor function. FEBS Lett , 529 , 102-109. Sui, X., Krantz, S.B., You, M. and Zhao, Z. (1998) Synergistic activation of MAP kinase (ERK1/2) by erythropoietin and stem cell factor is essential for expanded erythropoiesis. Blood , 92 , 1142-1149. Sulahian, R., Cleaver, O. and Huang, L.J. (2009) Ligand-induced EpoR internalization is mediated by JAK2 and p85 and is impaired by mutations responsible for primary familial and congenital polycythemia. Blood , 113 , 5287-5297. Supi no-R osin, L., Yoshimura, A., Altaratz, H. and Neumann, D. (1999) A cytosolic domain of the erythropoietin receptor contributes to endoplasmic reticulum-associated degradation. Eur J Biochem , 263 , 410-419. Takeshita, A., Shinjo, K., Naito, K., Ohnishi, K., Higuchi, M. and Ohno, R. (2002) Erythropoietin receptor in myelodysplastic syndrome and leukemia. Leuk Lymphoma , 43 , 261-264. Tan, B.L., Hong, L., Munugalavadla, V. and Kapur, R. (2003) Functional and biochemical consequences of abrogating the activation of multiple diverse early signaling pathways in Kit. Role for Src kinase pathway in Kit-induced cooperation with erythropoietin receptor. J Biol Chem , 278 , 11686-11695. Taoka, M., Ichimura, T., Wakamiya-Tsuruta, A., Kubota, Y., Araki, T., Obinata, T. and Isobe, T. (2003) V-1, a protein expressed transiently during murine cerebellar development, regulates actin polymerization via interaction with capping protein. J Biol Chem , 278 , 5864-5870. Tefferi, A. (2001) The pathogenesis of chronic myeloproliferative diseases. Int J Hematol , 73 , 170-176. Tehranchi, R., Fadeel, B., Forsblom, A.M., Christensson, B., Samuelsson, J., Zhivotovsky, B. and Hellstrom- Lindberg, E. (2003) Granulocyte colony-stimulating factor inhibits spontaneous cytochrome c release and mitochondria-dependent apoptosis of myelodysplastic syndrome hematopoietic progenitors. Blood , 101 , 1080-1086. Testa, U. and Riccioni, R. (2007) Deregulation of apoptosis in acute myeloid leukemia. Haematologica , 92 , 81- 94. Thomas, S.M. and Brugge, J.S. (1997) Cellular functions regulated by Src family kinases. Annu Rev Cell Dev Biol , 13 , 513-609. Tomonaga, M., Golde, D.W. and Gasson, J.C. (1986) Biosynthetic (recombinant) human granulocyte- macrophage colony-stimulating factor: effect on normal bone marrow and leukemia cell lines. Blood , 67 , 31-36. Trinczek, B., Brajenovic, M., Ebneth, A. and Drewes, G. (2004) MARK4 is a novel microtubule-associated proteins/microtubule affinity-regulating kinase that binds to the cellular microtubule network and to centrosomes. J Biol Chem , 279 , 5915-5923.

160 Trombetta, E.S. and Helenius, A. (1998) Lectins as chaperones in glycoprotein folding. Curr Opin Struct Biol , 8, 587-592. Vandekerckhove, J., Ribeil, J.A., Zermati, Y., Garrido, C., Courtois, G., Solary, E. and Hermine, O. (2008) [Hsp 70, guardian angel of GATA-1 during erythroid differentiation]. Med Sci (Paris) , 24 , 37-40. Vardiman, J.W., Harris, N.L. and Brunning, R.D. (2002) The World Health Organization (WHO) classification of the myeloid neoplasms. Blood , 100 , 2292-2302. Verdier, F., Walrafen, P., Hubert, N., Chretien, S., Gisselbrecht, S., Lacombe, C. and Mayeux, P. (2000) Proteasomes regulate the duration of erythropoietin receptor activation by controlling down-regulation of cell surface receptors. J Biol Chem , 275 , 18375-18381. Vollenweider, F., Kappeler, F., Itin, C. and Hauri, H.P. (1998) Mistargeting of the lectin ERGIC-53 to the endoplasmic reticulum of HeLa cells impairs the secretion of a lysosomal enzyme. J Cell Biol , 142 , 377-389. Wallvik, J., Stenke, L., Bernell, P., Nordahl, G., Hippe, E. and Hast, R. (2002) Serum erythropoietin (EPO) levels correlate with survival and independently predict response to EPO treatment in patients with myelodysplastic syndromes. Eur J Haematol , 68 , 180-185. Walrafen, P., Verdier, F., Kadri, Z., Chretien, S., Lacombe, C. and Mayeux, P. (2005) Both proteasomes and lysosomes degrade the activated erythropoietin receptor. Blood , 105 , 600-608. Wang, S., Sakai, H. and Wiedmann, M. (1995) NAC covers ribosome-associated nascent chains thereby forming a protective environment for regions of nascent chains just emerging from the peptidyl transferase center. J Cell Biol , 130 , 519-528. Wegrzyn, R.D., Hofmann, D., Merz, F., Nikolay, R., Rauch, T., Graf, C. and Deuerling, E. (2006) A conserved motif is prerequisite for the interaction of NAC with ribosomal protein L23 and nascent chains. J Biol Chem , 281 , 2847-2857. Wiedmann, B. and Prehn, S. (1999) The nascent polypeptide-associated complex (NAC) of yeast functions in the targeting process of ribosomes to the ER membrane. FEBS Lett , 458 , 51-54. Wiedmann, B., Sakai, H., Davis, T.A. and Wiedmann, M. (1994) A protein complex required for signal- sequence-specific sorting and translocation. Nature , 370 , 434-440. Williams, D.B. (2006) Beyond lectins: the calnexin/calreticulin chaperone system of the endoplasmic reticulum. J Cell Sci , 119 , 615-623. Witthuhn, B.A., Quelle, F.W., Silvennoinen, O., Yi, T., Tang, B., Miura, O. and Ihle, J.N. (1993) JAK2 associates with the erythropoietin receptor and is tyrosine phosphorylated and activated following stimulation with erythropoietin. Cell , 74 , 227-236. Wu, H., Klingmuller, U., Acurio, A., Hsiao, J.G. and Lodish, H.F. (1997) Functional interaction of erythropoietin and stem cell factor receptors is essential for erythroid colony form ation. Proc N atl Acad Sci U S A , 94 , 1806-1810. Wu, H., Klingmuller, U., Besmer, P. and Lodish, H.F. (1995) Interaction of the erythropoietin and stem-cell- factor receptors. Nature , 377 , 242-246. Yamaguchi, D., Kawasaki, N., Matsuo, I., Totani, K., Tozawa, H., Matsumoto, N., Ito, Y. and Yamamoto, K. (2007) VIPL has sugar-binding activity specific for high-mannose-type N-glycans, and glucosylation of the alpha1,2 mannotriosyl branch blocks its binding. Glycobiology , 17 , 1061-1069. Yoshida, K., Nogami, S., Satoh, S., Tanaka-Nakadate, S., Hiraishi, H., Terano, A. and Shirataki, H. (2005) Interaction of the taxilin family with the nascent polypeptide-associated complex that is involved in the transcriptional and translational processes. Genes Cells , 10 , 465-476. Yoshimura, A., D'Andrea, A.D. and Lodish, H.F. (1990) Friend spleen focus-forming virus glycoprotein gp55 interacts with the erythropoietin receptor in the endoplasmic reticulum and affects receptor metabolism. Proc Natl Acad Sci U S A , 87 , 4139-4143. Yotov, W.V., Moreau, A. and St-Arnaud, R. (1998) The alpha chain of the nascent polypeptide-associated complex functions as a transcriptional coactivator. Mol Cell Biol , 18 , 1303-1311. Yotov, W.V. and St-Arnaud, R. (1996a) Differential splicing-in of a proline-rich exon converts alphaNAC into a muscle-specific transcription factor. Genes Dev , 10 , 1763-1772. Yotov, W.V. and St-Arnaud, R. (1996b) Mapping of the human gene for the alpha-NAC/1.9.2 (NACA/1.9.2) transcriptional coactivator to Chromosome 12q23-24.1. Mamm Genome , 7, 163-164. Zang, D.Y., Goodwin, R.G., Loken, M.R., Bryant, E. and Deeg, H.J. (2001) Expression of tumor necrosis factor- related apoptosis-inducing ligand, Apo2L, and its receptors in myelodysplastic syndrome: effects on in vitro hemopoiesis. Blood , 98 , 3058-3065. Zermati, Y., Garrido, C., Amsellem, S., Fishelson, S., Bouscary, D., Valensi, F., Varet, B., Solary, E. and Hermine, O. (2001) Caspase activation is required for terminal erythroid differentiation. J Exp Med , 193 , 247-254. Zhang, B., Cunningham, M.A., Nichols, W.C., Bernat, J.A., Seligsohn, U., Pipe, S.W., McVey, J.H., Schulte- Overberg, U., de Bosch, N.B., Ruiz-Saez, A., White, G.C., Tuddenham, E.G., Kaufman, R.J. and

161 Ginsburg, D. (2003) Bleeding due to disruption of a cargo-specific ER-to-Golgi transport complex. Nat Genet , 34 , 220-225. Zhang, B., Kaufman, R.J. and Ginsburg, D. (2005) LMAN1 and MCFD2 form a cargo receptor complex and interact with coagulation factor VIII in the early secretory pathway. J Biol Chem , 280 , 25881-25886. Zhang, K. and Kaufman, R.J. (2004) Signaling the unfolded protein response from the endoplasmic reticulum. J Biol Chem , 279 , 25935-25938. Zhang, Y.C., Zhou, Y., Yang, C.Z. and Xiong, D.S. (2009) A review of ERGIC-53: its structure, functions, regulation and relations with diseases. Histol Histopathol , 24 , 1193-1204. Zhao, W., Kitidis, C., Fleming, M.D., Lodish, H.F. and Ghaffari, S. (2006) Erythropoietin stimulates phosphorylation and activation of GATA-1 via the PI3-kinase/AKT signaling pathway. Blood , 107 , 907-915.

162