By Tom This is the House that Jack1 Built
Kendall
out of 10763 words
Department of Architecture 2013
1 Pre-Text - a note on this edition
Tom This is the House that Jack Built footnotes 3
out of 10763 words red is used to highlight something of import, like a title or an alteration, addition, or important note on / in the text.
By Thomas Kendall Blue is used for words that are more personal or explinatory.
Published and bound by Thomas Kendall Department of Architecture Marginalia. Royal College of Art 2013 This essay contains various pieces of marginalia. They are often First Edition an analysis of the main text, so should be read only if you want to interrupt your flow.
This space is not just for my marginalia but for yours also, please feel free to indulge in the joy of writing in the margins.
1 ‘Sous Rature is a strategic philosophical device originally developed by Martin Heidegger. Usually translated as ‘under erasure’, it involves the crossing out of a word within a text, but allowing it to remain legible and in place. Used extensively by Jaques Derrida, it signifies that a word is “inadequate yet necessary”.’(ref – Madan Sarup, 3 It is important to note from the outset that footnotes are an important part of this An Introductory Guide to Post-Structuralism and Postmodernism p.33). - http:// essay. “I am very fond of footnotes at the bottom of the page, even if I don’t have anything in en.wikipedia.org/wiki/Sous_rature particular to clarify there.” (Perec, Species of Space, 11).
2 3 CONTENTS
Cover ...... 1 Afterword ...... 117 Pre-text ...... 3 Epilogue ...... 119 Contents ...... 4 Acknowledgement ...... 8 Pre-amble ...... 14 Appendices ...... 125 Forward ...... 21 Opening Prologue ...... 29 Glossary of Terms ...... 126 Introduction ...... 30 Study: A - Gallery of theory ...... 130 The Stories ...... 39 B - Gallery of the Oulipo ...... 138 Book ...... 41 C - Gallery of other writers ...... 144 Bed ...... 59 Desk ...... 67 Utility Room: A - 9 dot puzzle (solutions) ...... 164 B - Unused text ...... 166 Bedroom ...... 79 Staircase ...... 83 Bibliography ...... 173 Balcony ...... 91
Landing ...... 95 Estate ...... 97 Kings Cross ...... 103
4 5 “WHAT more glorious than to open for one’s self a new career, — to appear suddenly before the learned world with a book of discoveries in one’s hand, like an unlooked- for comet blazing in the empyrean!” 3
* * *
Dedicated to my Grandpa.
With thanks to my tutor Naomi for sharing and indulging my interests; to my boyfriend Joseph for his patience and to my mum Sally, for her keen eye.
3 Xavier De MAistre, A Journey Round My Room, (New York, Hurd and Houghton, Cambridge Riverside Press, 1871), p.1
6 7 ‘WHAT?’ This text and the exploration therein is not written in the traditional ACKNOWLEDGEMENT sense (see PREFACE), instead, as you will see, it is more of a of you, dear reader construction, ||ARCHITECTURE|| and this “assemblage of bits and pieces […] forces an abandonment of the idea of [the] reader as a passive receptor. The reader must engage, work on, rewrite this “ We come into the world intent on finding narrative in everything: in text. The reader must be a writer.”5 & 6 the landscape, in the skies, in the faces of others, and, of course, in the images and words that our species creates. We read our own lives Along this path you will find various textual exercises and and those of others, we read the societies we live in and those that lie beyond our borders, we read pictures and buildings, we read that which experiments from the physical and visual, to the grammatical lies between the covers of a book.” and etymological, seen through the examples of others as well – Alberto Manguel 4 as TEXT-speriments of my own. This journey of the reader
‘WHY?’ 5 Jennifer Bloomer, Architecture and the Text: the (S)crypts of Joyce and Piranesi (Yale: It is hard to know if this should have been called an Yale University Press, 1995), 13 6 She then quotes Kristeva - “For the Ancients the verb “to read” has a meaning ACKNOWLEDGMENT; a more precise word could have been a that is worth recalling and bringing out with a view to an understanding of literary practice. “To read” was also “to pick up,” “to pluck,” “to keep watch on,” “to recognise FOREWARNING, (and forewarned is forearmed). I say this because traces,” “to take,” “to steal.” “To read” thus denotes an aggressive participation, an the journey, |…and yes, reading a text, any text, is a journey of sorts, active appropriation of the other. “To write” would be “to read” become production, industry: writing-reading, paragrammatic activity, would be the aspiration towards a a movement through…| the journey you are about to embark upon total aggressiveness and participation.” - Julia Kristeva, Semiotika, p.181 expects you to be not just a reader, but I guess a PATA-reader. (See Sub Note - This aggression put me in mind of this quote by Michel Leiris with regard to the paintings of Francis Bacon, but I think that it stands up well when talking about the For’w rd for a greater explanation of the term “pata”) the creation and interaction
“Beauty must have within it an element that plays the motor role of the first sin. What constitutes beauty is not the confrontation of opposites but the mutual antagonism of these opposites; and the active and vigorous manner in which they invade one another and emerge from the conflict marked as if by a wound or depredation.” - Michel Leiris, Francis Bacon: Full Face and In Profile (New York, Rizzoli) 1983 4 Alberto Manguel, A Reader On Reading, (United States of America, Yale University Press) 2008, p. ix
8 9 into the world of PATA-modern writing is an unfamiliar adventure. You are being handed a text, a space to explore, a story-world where you will find “a struggle between antagonistic” reread subnote to footnote
6 “realities, inducing an ontological flicker, the fiction’s reality and the book’s coming into focus by turns, first one, then the other. And The Written World: The Tectonic World: this flicker seems to induce instability.”7 These structures and the In writing ‘“[v]isual and verbal John Hedjuk stated that oscillation between them causes perspectival shifts, alter-experiences effects vie for our attention.” “architecture has the double and new perceptions of what you, the reader, are reading, actively And the reader processes the aspect of making one an engaging with the text, so that you, “the reader [are] no longer a language and “becomes the text observer or voyeur externally, consumer but a producer of the text,”8 a reader-writer if you will. without losing himself as he and then completely “ingesting” reads.”’ 9 Becoming the text is as one internally. One becomes an if one is becoming a character element of the internal system in the story, navigating the text, of the organism.” 10 To become
‘WHERE?’ page to page, room to room, an architectural element is to This construction will focus on two things, simply put, architecture comma to comma. be an inhabitant, someone in and writing. As the reader, it is important that you are aware of the constructed space, to go the space[s] in which these currently occur so that over time, the through a door and navigate ontological flickering can deconstruct these worlds and build them from hall to stair, room to room, anew. cellar to attic.
9 Jennifer Bloomer quoting David Haymans, Wake on the Wake (a text about James Joyce’s, Finnegans Wake) - Jennifer Bloomer, Architecture and the Text: the (S)crypts of Joyce and Piranesi (Yale: Yale University Press, 1995), 7 Brian McHale, Post-modernist Fiction (Routledge: London, 1987), 180. 10 John Hejduk, Mask of Medusa: Works, 1947-1983. New York: Rizzoli, 1985. Page 90 8 Roland Barthes, S/Z, (United Kingdom, Blackwell Publishing) 2002. p.4
10 11 ‘WHO?’ So dear PATA-reader, who are you really?
You are to be the reader of this essay, the receptive writer of it, a character in its story and an inhabitant of the wor[l]d, For in the immortal words of Doctor Who, “we’re all stories, in the end. Just make it a good one, eh?” 11
11 Doctor Who: The Big Bang, 26 June 2010
12 13 The beginning begins, I guess, with frustration. After four years 12 PRE-AMBLE of architectural education I am tired, tired of being told that I must My own ambulation(s) through architecture. do a drawing, or make a model to explain myself when in my mind a few well chosen words would do equally well thank you very much.
In the timeless words of the King of Hearts, “[b]egin at the The notion that one cannot talk or write spatially seemed counter beginning.” 13 So, in the hope of clarity, I feel the need to enlighten intuitive to me. you to my interpretation of what architecture is,14 by which I mean what it should be or what I hope it could become. To go back a bit further > I spent most of my childhood (and adult life too) enveloped by books, in a story-world 15. One of my childhood memories aged approximately 6, has me sat in my parents sea of a bed, my 4 year old brother and I nestled between mother and farmer (as I viewed my dad then), whilst Mum (as I
12 Late 14c., from Old French preambule (13c.) and directly from Medieval Latin preambulum, neuter adjective used as a noun, properly “preliminary,” from Late 15 Story n (plural stories) Latin praeambulus “walking before,” from Latin prae- “before” + ambulare “to walk” • 1 an account of imaginary or real people and events told for entertainment - http://www.etymonline.com/index.php?term=preamble (accessed 5 September an adventure storyI’m going to tell you a story 2013) • a plot or storyline:the novel has a good story • a piece of gossip; a rumour:there have been lots of stories going around, 13 Lewis Carroll, Alice’s Adventures In Wonderland, (London: Macmillan and Co., Ltd.) as you can imagine 1906. P.182 • informal a false statement; a lie:Ellie never told stories—she had always believed in the truth 14 A dictionary definition of architecture stands thus: • 2 a report of an item of news in a newspaper, magazine, or broadcast stories in the local papers Architecture - • 3 an account of past events in someone’s life or in the development of 1 : the art or science of building; specifically : the art or practice of designing and something building structures and especially habitable ones the story of modern farmingthe film is based on a true story 2 a : formation or construction resulting from or as if from a conscious act
- http://www.merriam-webster.com/dictionary/architecture (accessed 12 August http://oxforddictionaries.com/definition/english/story?q=story (accessed 7 2013) September 2013)
14 15 know her now) would invent stories for us about Mr Spiv Rabbit, for whom the world seems to be made of stories.” 19 his wife Priscilla, and two children. These were stories of morals to be learned, of relationships, of home, all wrapped up in adventure, This essay is the first chapter in the story of WHERE, and how in life. 16 WHERE (note the turning of WHERE into a character by removing the definite article “the”) could be built || constructed. It/they is/ ‘ “and go on[…]” ’ 17 are the space in which life occurs, from church to home, room to Life is eating, sleeping, working, etc. IN the world, and the story- stairwell, door to window, public to private. It/they is/are concerned world is a reflection of this - our (actual, potential, imagined) with the production of architecture. versions of living; how we do it, why we do it, when we do it and 18 where we do it. For “[a]s far as we can tell, we are the only species Our world || architecture – is made of stories.
16 At the time I distinctly remember enjoying this “telling” of stories to be much This essay is not concerned with how a story itself might be more enjoyable than the reading of them. To read a book when I was young, although not a trial, was sometimes bothersome. This wasn’t because of long words or a lack translated ~ made into a piece of architecture, but how the act of of understanding but due to a plethora of illustrations that seem to deluge childrens literature. The text was what interested me, the words, my imagination could quite writing and that of constructing architecture are similar. It is the happily invent the worlds, the characters, the tiger who came to tea etc. To be given an illustration of it that appeared untrue to the visual in my head was a hindrance. a idea that architecture and space can be written and conversely that
a. These days I have conquered this stumbling block, able to separate writing, as a habitable space, can be spatial and constructed… the two and appreciate the image for its own sake and let the text-world exist unbastardized.α It is “[…]in the constructive operation upon many possible α. HECTOR – ‘“Uncoffined” is a typical Hardy usage. It’s a compound adjective, formed by putting “un” in front of the noun. Or verb, of relationships at many levels of scale (letter, word, sentence, course. Unkissed, unrejoicing, unconfessed, unembraced.’ - Alan Bennet, The History Boys, 2006 paragraph, plot), the literary work not only begins to bear a
17 The King of Hearts continues - Lewis Carroll, Alice’s Adventures In Wonderland, resemblance to architecture […], but also becomes a model of what (London: Macmillan and Co., Ltd.) 1906. P.182 architecture might be,” 20 i.e. architecture as WOR[L]D 18 This put me in mind of a rather eloquent gobbet by Foucault about the places of mans being:
“sacred places and profane places: protected places and open, exposed places: urban places and rural places (all these concern the real life of men). In cosmological theory, there were the supercelestial places as opposed to the celestial, and the celestial place was in its turn opposed to the terrestrial place. There were places where things had been put because they had been violently displaced, and then on the contrary places where things found their natural ground and stability.” - Michel Foucault, Of other spaces, Heterotopias, http://foucault.info/ 19 Alberto Manguel, The Traveller, The Tower and The Worm, (Philadelphia: University documents/heteroTopia/foucault.heteroTopia.en.html (accessed 8 August, 2013) p.2 of Pennsylvania Press)2013, p.1 20 Jennifer Bloomer, “In the Museyroom,” Assemblage No. 5 (Feb 1988), 63.
16 17 It is about architecture as text || text as architecture and thus the intertextual threads that weave between these two constructions and what, as an architect, can be gleaned from this.
‘ “[…] till you come to the end: then stop.” ’ 21
21 The King of Hearts concludes - Lewis Carroll, Alice’s Adventures In Wonderland, (London: Macmillan and Co., Ltd.) 1906. P.182
18 19 FOR’W RD A Note on Pataphysics – a cento 21 Instead of rewriting a definition of pataphysics I think it more appropriate to give you the original, from the creator himself, Alfred Jarry:
“An epiphenomenon is that which is superimposed upon a phenomenon. Pataphysics, whose etymological spelling should be ἔπι (μετά τά φυσικά) and actual orthography ’pataphysics, preceded by an apostrophe so as to avoid a simple pun, is the science of that which is superimposed upon metaphysics, whether within or beyond the latter’s limitations, extending as far beyond metaphysics as the latter extends beyond physics. Ex: an epiphenomenon being often accidental, Pataphysics will be, above all, the science of the particular, despite the common opinion that the only science is that of the general. Pataphysics will examine the laws which govern exceptions, and will explain the universe supplementary to this one; or, less ambitiously, will describe a universe which can be – and perhaps should be – Dear reader, envisaged in the place of the traditional one, since the laws which are supposed to have been discovered in the traditional universe are My name is Norman D.E Guerre, aspiring writer and also correlations of exceptions, albeit more frequent ones, but in any case accidental data which, reduced to the status of the unexceptional apprentice Oulipian. We have not met before and we will not meet exceptions, poses no longer even the virtue of originality. again in this space, but I feel an introduction only polite. DEFINITION. Pataphysics is the science of imaginary solutions, which symbolically attributes the properties of objects, described by their virtuality, to their lineaments” – Alfred Jarry, Exploits and Opinions of Doctor Faustroll, Pataphysician, (Boston, Exact Change) Thomas has invited me to broach the topic of the OuLiPo from p.21-22 a the perspective of an Oulipian writer. The full title is Ouvroir de To ‘clarify matters further it has been said that “[t]o understand pataphysics is to fail to understand pataphysics. To define it is merely Littérature Potentielle (workshop of potential literature), and this to indicate a possible meaning, which will always be the opposite of order22 of literature is a branch of the College of ’Pataphysics… another equally possible meaning, which, when diurnally interpolated with the first meaning, will point toward a third meaning which will That literature and a physical science, all be it an obscure one, are in turn elude definition because of the fourth element that is missing” : “for how can one ever make sense of, or truly define an imaginary eternally linked is already a key to what lies ahead. science, and why should you when it exits purely because of its invention. Jarry said that ‘all meanings that can be discovered in a text are equally legitimate. There is no single true meaning, banishing all other faulty ones.’ ” b 21 Cento. This ancient practice, also known as patchwork verse and mosaics, makes a Andrew Hugill, Pataphysics, A Useless Guide, (Cambridge, Massachusetts, a poem out of lines by other poets.” HarryMathews, & Alastair Brotchie, editors.
The MIT Press 2012, p.1-2 Oulipo Compendium. (London: Atlas Press) 1998. p.120 b R Shattuck, The Banquet Years, (London, Faber and Faber Ltd)1958, P.23 22 The word ‘order’ is used here to hint at the idea of structure by making reference to the classical order of columns, ionic, Doric etc.
20 21 The notion of a foreword is a text written by someone other than the author: as the author of the foreword I have decided the rest a group which proposes to examine in what shall be written by other Oulipeans. I shall appear as the joints: the Oulipo: manner and by what means, given a scientific theory ultimately concerning bits of welding between beams and columns of quotation: and the language (therefore anthropology) one can introduce aesthetic pleasure embellishments, the acanthus leaves, that help define the order in (affectivity and fancy) therein. We will never know exactly who came up its new context of writing as a spatial practice. To quote Walter with this definition, the definitive secretary having generously attributed it Benjamin, “[t]o write history thus means to cite history. It belongs to all in his minutes of the 5 April 1961 meeting. to the concept of citation, however, that the historical object in each case is torn from its context.” 23 & 24 “ Things could only get worse. And the same day, the Oulipian ‘slyly’ followed this definition with another: Oulipians: rats who must build the labyrinth from which they propose to escape. 25
Oulipo merely follows, then extends, the clinamen already present in the NOTE numerical sophistry of Jarry[,]26 The idea of clinamen is a fine example A certain amount of liberty has been taken with the formatting of the text of an imaginary solution, since Epicurus had little or no experimental below, the words themselves, and their order remains unchanged. evidence on which to base his theorising. The Epicurean universe consists Their words of atoms in continuous descent from an absolute high to an absolute low. My words During their descent, for reasons we cannot know or understand, some of the atoms happen to make a slight swerve of bias (the clinamen) in their trajectory, causing them to collide with other atoms. The chain reactions create matter.
23 Walter Benjamin, The Arcade Project, (United States of America, Harvard University Press) 1999. P.476 24 This charming quote was explored and illuminated by Hannah Arendt when discussing his work as “tearing fragments out of their context and arranging them afresh in such a way that they illustrated one another and were able to prove their raison d’être in a free-floating state, as it were. […] Benjamin’s ideal [was] of producing work consisting entirely of quotations, one that was mounted so masterfully that it 25 Warren F. Motte, Jr. , Oulipo: a Primer of Potential Literature, (United States of could dispense with any accompanying text.” – Hannah Arendt, “Walter Benjamin: America, Dalkey Archive Press) 1998, p.37 1892-1940”, Introduction to Walter Benjamin, Illuminations, (London, Pimlico) 1999, 26 Christian Bök, ’Pataphysics: The Poetics of an Imaginary Science, (United States p.51 of America, Northwestern University Press) 2002, p.68
22 23 series of constraints and procedures (rules and structures) that fit inside each other like Chinese boxes. 29 Even when a writer accords “The atoms, as their own weight bears them down the principal importance to the message he intends to deliver (that is, Plumb through the void, at scarce determinate times, what a text and its translation have in common), he cannot be wholly In scare determined places, from their course insensitive to the structures he uses[.] 30 Indeed, the creative effort in these Decline a little – call it, so to speak, works is principally brought to bear on the formal aspects of literature: Mere changed trend. For were it not their wont alphabetical, consonantal, vocalic, syllabic, phonetic, graphic, prosodic, Thuswise to swerve, down they would fall, each one, rhymic, rhythmic, and numerical constraints, structures, or programs. Like drops of rain, through the unbottomed void; (On the other hand, semantic aspects were not dealt with, meaning having And then collisions ne’er could be nor blows been left to the discretion of each author and excluded from our structural Among the primal elements; and thus preoccupations.) 31 To explore the rule is to be emancipated from it by Nature would never have created aught.” (Lucretius 2007, 50) 27 becoming the master of its potential for surprise. 32
The word “potential” concerns the very nature of literature; that is, The overwhelming majority of Oulipian works thus far produced inscribe fundamentally it’s less a question of literature strictly speaking than themselves in a SYNTACTIC structurElist perspective, 33 of which there of supplying forms for the good use one can make of literature. We call are two principle tendencies of the workshop, analysis and synthesis, potential literature the search for new forms and structures that may be the discovery and exploration of rules (structures), Anoulipism is used by writers in any way they see fit. 28 devoted to discovery, Synthoulipism to invention. From one to the other
Every literary work begins with an inspiration (at least that’s what its author suggests) which must accommodate itself as well as possible to a
30 Warren F. Motte, Jr. , Oulipo: a Primer of Potential Literature, (United States of America, Dalkey Archive Press) 1998, p.30 31 François Le Lionnais – “Second Manifesto”, in Warren F. Motte, Jr. , Oulipo: a 27 Andrew Hugill, Pataphysics, A Useless Guide, (Cambridge, Massachusetts, The MIT Primer of Potential Literature, (United States of America, Dalkey Archive Press) 1998, Press 2012, p.15 p.29 28 Quenaeu in conversation with Charbonnier : Warren F. Motte, Jr. , Oulipo: a Primer 32 Christian Bök, ’Pataphysics: The Poetics of an Imaginary Science, (United States of of Potential Literature, (United States of America, Dalkey Archive Press) 1998, p.38 America, Northwestern University Press) 2002, p.71 29 François Le Lionnais – “Lipo, First Manifesto”, in Warren F. Motte, Jr. , Oulipo: a 33 François Le Lionnais – “Second Manifesto”, in Warren F. Motte, Jr. , Oulipo: a Primer of Potential Literature, (United States of America, Dalkey Archive Press) 1998, Primer of Potential Literature, (United States of America, Dalkey Archive Press) 1998, p.26 p.29
24 25 there exist many subtle channels. 34 It has been said of pataphysics that the rule itself is the exception, 35 in the world of the Oulipo it would be better to say the rule creates exceptions. It is the swerve of the clinamen that weaves its way around the rules, through cracks and sparking collisions that give the text its potentielle.
To illustrate examples of the OULIPO, for it is only through” READING that one can really examine the potential present in each text, please refer to the STUDY: Appendix 1.
34 François Le Lionnais – “Lipo, First Manifesto”, in Warren F. Motte, Jr. , Oulipo: a Primer of Potential Literature, (United States of America, Dalkey Archive Press) 1998, p.28 35 Christian Bök, ’Pataphysics: The Poetics of an Imaginary Science, (United States of America, Northwestern University Press) 2002, p.39
26 27 PROLOGUE GAMBIT OPENING GOBBET {4 x 4}
Where the Author introduces some themes.
This is the story that rites what is read, This is the story that takes you to bed, This is the story that moves down the hall, This is the story of book space et al. This is the view to the room ’cross the way, This is the train that left the next day, This is the bed where the children are boggled, This is the flat where you saw her hobbled. This is the writing of bricks blocks and mortar, This is the writing of an urban quarter, This is the writing of worlds yet to come, This is the writing of worlds that are done. This is the story that pit-‘pata-phors This is the story that wonders through doors This is the story that knows not where to start This is the story that’s falling apart. |This is [the story of] how space begins, with words only, signs traced on the blank page.|
36 pro·logue n. 1. An introduction or preface, especially a poem recited to introduce a play. - http://www.thefreedictionary.com/prologue (accessed 6 July 2013)
As is fitting with the nature of a prologue, this one begins to hint at certain things one will discover in the main body of the story. 37 HECTOR: “what did you call them? Gobbets? is that what you think they are? Gobbets? Handy little quotes that can be trotted out to make a point? GOB BITS? Codes, runes, spells, call them what you like. Do not call them Gobbets!” - Alan Bennett. The History Boys, 2006 38 The Author’s play on nursery rhyme, Oranges and Lemons – “Here comes a candle to light you to bed, Here comes a chopper to chop off your head.” From http://www.childhoodheritage.org/oranges_and_lemons.html, (accessed 12 August 2013) although I originally found this quote whilst watching an episode of Doctor Who called The God Complex. 39. Georges Perec, Species of Space. (London, Penguin Group 2008) p.13 This quote has been altered structurally, it is presented differently to its original context where it forms a single line.
28 29 SUBJECT The subject of these pages is, in essence: space; in reality: words; in opening of this sentence is mimicry fiction: architecture. of Perec’s Foreword, (Perec, Species of Space, 5)
It is not strictly about architecture, and it is certainly not concerned with writing about architecture, but rather, writing in INTRODUCTION an architectural manner; to write architecture; the plane (or page) where architecture and the written wor[l]d coalesce. It is not strictly about writing either, but rather, spatial writing; writing that is less “CLARA - I’m not sweet on the inside and I’m certainly not…. (TARDIS 42 interior revealed) little written than it is constructed or built. DOCTOR - It’s called the TARDIS, it can travel anywhere in time and space. And it’s mine. It is about space, for this is the place where the two others are CLARA runs goes out the door, around the TARDIS and comes back inside. mutually entangled: the ontological arena for their coexistence. CLARA - Well it’s… look at it, it’s DOCTOR - Go on, say it, most people do. Up until this moment, you have read about my expectations of you,
CLARA - It’s smaller on the outside.” 40 the reader; a brief understanding of my approach to architecture, my belief in what it is and what it could become; and you have heard from their own mouths what it is to be an Oulipian. But it is here, in
“[T]here is nothing outside the text” [Il n’y a pas de hors-texte] 41 the introduction, that these previous pages begin to come together as a new space.
42 Jennifer Bloomer writes of the same phenomenon in her book, Architecture and the Text, first on writing as a tectonic act:
“[w]hen I use the word writing in this text (and I use it a lot), I do not refer simply to that concept of writing as a mirror or documentation of speech, but to writing as a constructing, nonlinear enterprise that works across culture in networks of signification.” P.6
40 Doctor Who: The Snowmen, 2012. And then on the text as a whole: This quote is a comical take on the normal scripting of Doctor Who where the Doctors Companion would say “it’s bigger on the inside!” “The text is less a narrative to be apprehended than an object to be entered, less 41 Jacques Derrida, Of Grammatology, trans. G. Spivak (Baltimore: Johns Hopkins narrated than constructed.” P.15 - Jennifer Bloomer, Architecture and the Text: the (S) University Press, 1976), 158. crypts of Joyce and Piranesi (Yale: Yale University Press) 1995
30 31 It is the construction of a small world, the story-world of my flat, PLACE: MY FLAT where truth & structure and fiction & language can inhabit the same The location in which this story takes place is my flat in Mornington plane, and the use of this setting as a means for exploring the realm of Crescent and the surrounding area of King’s Cross. The nine plot This mimics Perec again, here archi[text]ure This exploration takes some of the ideas that Jennifer points vary from my bedside book tower to the street outside, though in creating a hypertrophic Bloomer lays down: how text can be constructed like architecture, engaging with various scales and types of space along the way. This journey through space, (Perec, Species of Space) how it is not just words but a physical form, how it is spatial, how the is WHERE, that I spoke of earlier, and it/they are our world from reader engages with the text in an architectural manner: and it uses here on. the operations that governed the Oulipo to construct a space that is both written and built || read and inhabited. This world is written I chose WHERE for a particular reason, it/they, are currently under as an exploration of Oulipian Creationism. going a change, experiencing a spatiotemporal fluctuation. I have lived here for the last seven years. It has, until now been what they The Oulipo’s methods were devised with a dual intent. The first; a term, a student flat. It has no sitting room and a very communal way of fuelling the ingenuity and vision of the writing, while the kitchen and bathroom, thus all other rooms are rentable bedrooms, second a means of cre;ating/forcing interaction with the text being (after all, there is a mortgage to pay). Something else of note is its read thus engaging the reader with both the space of the page/book upstairs, or rather that it has one. The difference that this engenders and the story-world contained within it. The combination of rules/ in the space, for me at least, is intoxicating. The staircase, its mere structures and the clinamen designed by the writer that build its existence makes it a home, a dwelling without one is just NOT. potential, are what cause the ontological flicker, those perspective shifts between fiction, the page and reality, that make us question the “What is the objective of our work? To The change that it is undergoing involves the ingress of my propose new “structures” to writers, reading of the worlds and the spaces they exist in. The shape of the mathematical in nature, or to invent boyfriend, Joseph. His moving in has sparked a move upstairs writing becomes the shape of the reading. new artificial or mechanical procedures This is a gerrund. that will contribute to literary activity: thus facilitating the creation of a sitting room, a new place in props for inspiration as it were, or this flat-space; or more correctly, maisonette-space; or more rather, in a way, aids for creativity.” – Raymond Queneau emotionally, home-space. Currently though we exist in a (Motte, Jr. Potential Literature, 512) middle-space, waiting for one person to move that we out up might move up , and thus there is a large pile of boxes under, in and around my desk; piles of books and clothes where before there was order; three more blankets on my bed and Fritz, Joe’s cuddly Hedgehog, keeping me company at my computer.
32 33 WHERE is swerving into a new spatial trajectory, its own clinamen, and this pata-movement, this ontological flicker between 1. The nine spaces are listed as follows HERE and THERE, so with realities perception of it is shifting like a reader with a piece of post modern fiction, now would seem a good 1 Book 2 Desk 3 Bed time to explore it in a written world. 4 Bedroom 5 Stairs 6 Balcony 7 Landing 8 Estate 9 Kings Cross And now, my own patáinstructions for exploring space comme Perec. Complimenting the Perec figure, these are laid out over a Græco- Aα Bγ Cβ Latin bi-square to eventtually create a series of constraints for each RULES: MY STRUCTURE Bβ Cα Aγ individual square. 45 The rules to create this story are in fact a re-writing of George Cγ Aβ Bα Perecs, Life, A User’s Manual. For full information on his rules, known as the four figures, see the STUDY. For a brief summary please see this footnote. 46 2. The schedule of obligations is a series of paired thematic lists, each containing three items that the texts will have to respond to based on the permutations generated by the bi-square. The themes 45 In the structural sense. chosen (unlike Perec’s who focused mainly on the physical attributes 46 One of the most famous Oulipians was Georges Perec, and one of his most famous novels was Life, A User’s Manual… of the flat such as furniture, colour, style etc.) reflect the ambitions
PEREC: “I have imagined a building that has its façade removed so that all its rooms of the story to be told: on the street side are visible”
This was written using three rules: Styles of writing A Constraint 1. The apartment block he conceived consisted of a 10 x 10 grid which he laid over A second set of styles Structures of writing a Græco-Latin bi-square, thus enabling him to generate endless permutations of possible number sequences to apply to rule number two, his “schedule of obligations” 2. The “schedule of obligations” he created consisted of 42 lists or themes, in pairs, each containing 10 “things”. These items were then selected using the bi-square, A movement A Time creating 100 completely unique and individual sets that for all permutations of the original lists. Each chapter would then have to contain every item set out on the A perspective A tense corresponding list. 3. The Knights Tour was his way of navigating the apartment great. He imagined a night from the chessboard travelling across the great touching each square only once A sense A faux and this generated a pattern allowing him to explore the apartment block room by room in a manner that was not random, but a greater exploration of the space than A sense A manqué could have been conceived otherwise.
34 35 THE LISTS: MY BLOCKS Thinking outside the box: this references a spatial approach 3. The terminology in this list is further explained in the glossary. to the 9 point puzzle. I have written these chapters based on a solution to the puzzle below. (SEE UTILITY ROOM) Whilst they are Style of writing Displacement Substitution Pataphor presented back in scale order, the pages have bee perforated so that Second style Subtraction Addition Multiplication you might complete the puzzle also, and rearrange the texts based A constraint Letter Word Sentence on your solution to create a re-reading of the story. Structure Grammar space Text space Image text
A movement Around Into Through A perspective On/in Adjacency vista
A time Morning Afternoon Night A tense Past Present Future
A sense Taste Touch Hear
A sense See Smell Proprioception
There is a separate 5x5 magic square to produce a set of PATAconstraints, inducing a sense of clinamen and antinomy among the lists. The fuax applied to the 1st in the pair, means you can freely substitute it: the manqué as applied to the second, means you don’t use it therefore you should consider the opposite. As Perec put it in an interview, any “system of constraints” must contain “an anti-constraint built into it,” giving the system “some free play, as the phrase goes . . . one needs a clinamen” 47
Whilst each item must be used in the text, it does not have to apply to the whole text. The use of other structures can also be introduced Using four straight lines, join all nine dots together without taking your pencil off the paper. if there is a relevant link. You cannot retrace over a line or use the same dot twice. 47 Paul A. Harris, ‘The Invention of Forms: Perec’s “Life A User’s Manual” and a Virtual Sense of the Real”, SubStance, Vol. 23, No. 2, Issue 74: Special Issue: Between Science & Literature (1994) p.63
36 37 story time
References in this section shall be contained in the marginalia and shall include (authors surname, title, possibly shortened, page number). They shall be indicated not by number but graphically by a line.
The marginalia here is an exploratory analysis of the writing and its structures. It is filled with thoughts, assumptions, and gobbets or quotes that help illuminate Kendall’s original text.
The marginalia is in itself one of the structures of the essay, designed to pull you out of the original page space allowing you to look back on it with an alter-gaze.
The marginalia does not have to be read, and you are free to add your own, for only by writing can you truly have been reading. (see FORW RD).
38 39 BOOK
Space grammar – where space is (for terms unknown, see GLOSSARY for full list of definitions and examples) defined by grammar and grammar Displacement : spoonerism, Rrose Sélavy, Matthew’s algorithm. is defined by space. At no point is the text shaped or Subtraction : abreviat’, syncope, elision, lipogram, belle absent. formed by anything other than As applied to the Letter the keyboard or symbols inserted into the text. The only way space Spatial Grammar is shaped is through the use of the space bar on the keyboard. Movement – Around (the house) Perspective – in/on Morning - night Past - future Taste See
A written account of the reading of House Of Leaves, This is a journey that occurs through the physical experiences a novel by Mark Z Danielewski. found in and through a book.
“I write: I inhabit my sheet of paper, I invest it, I travel across it.” (Perec, Species of Space, 11)
VASHTA NERADA: We did not come here. THE DOCTOR: Well of course you did. ‘Course you came here. VASHTA NERADA: We come from here. (Doctor Who, Series 4, Forest of the Dead) THE DOCTOR: From here? VASHTA NERADA: We hatched here. THE DOCTOR: But you hatch from trees— from spores in trees. VASHTA NERADA: These. Are. Our. Forests. THE DOCTOR: You’re nowhere near a forest. Look around here. VASHTA NERADA: These are our forests. THE DOCTOR: You’re not in a forest. You’re in a library. There’s are no trees in a— Library. Books. You came in the books.
40 41 Subtraction and displacement BOOKS (strange lipogram too): The plural s’s have been displaced by apostrophes but remember their presence allowing the reader to well various pile’ actually of fluctuating size and description with place them in themselves and feel a spine’ pacing forward while others face .sdrawkcab sense of the alter-text.
Chronograph: A sequence of words About seven fourteen is the nights expiration into the bright a.m. that give you a temporal result based on Roman numerals. This and a mountain range of babel tower’ so that one could feel like particular one tells you what time it is that morning. 7.14 a.m. a Minpin’ or Borrower’ fills my view with sedimentary layer’ of flat squeezed paper mulch horizontal — angled \ some attempting
The missing plural on fingers here the vertical ⎞ ⎛ and full of gap’ || to sque-----ze one’s finger’ into is particularly good as it implies the use of one finger returning our || and embark upon a climb to find a new text last nights finished sense of scale from mountain range to real book and left at the bedside.
‘Every house is an architecturally Eye’ and finger’ are moving steadily upward and along searching this structured “path”: the specific possibilities of movement and the nesting ground of world’ My tip’ touch a spine lined drives toward movement as one proceeds from the entrance through with Polaroid’ and ease it out careful to not let the rest topple on the sequence of spatial entities have me. been predetermined by the architectural structuring of backspace and one experiences the space accordingly – Dragobert Frey, Grundlegung zu einer My hand’ pull the cover open and without pausing to think I walk, vergleichenden Kunstwissenscgaft.’ (Danielewski, House, 153) on to the page and in to the House Of Leaves
and it is bigger on the inside
42 43 The displacement from reality to inside the book sees the return of pure plurals. Thus suggesting that any constraints used here on will Kendall’s adaptation of the word to page it gets w i d e r and and I move be purely based on the book being ‘and’ to ‘nd could be a reference to walked through. Perec’s rules for writing the word ‘nd as I stroll from page from font to font || voice to voice and yet always the same story, “and” in The Exeter Texts, his story only containing the vowel “e” this house with walls that are longer on the inside where doors (Perec, Three, 59) appear from nowhere. The use of arrows here make it unsure if a comma or full stop would have been used, thus giving the sentence two ways to 1. be read. The use of a bold letter Although solo it is not solitary this journey → across pages → I “a” suggests it could become capitalized? am surrounded by the foices of vonts the character of characters The change in the CH phoneme. chattering to me across the soft cream pageα walking with me down corridors past familiar words and mo_ _ _ ts through this Sous rature section is a spelling of the French word for words, mot T.A.R.D.I.S blue house till I came upon a plain, white door with a glass & a hangman game of the words moments knob. [it opens] into a space resembling a walk-in closet that I hadn’t Italics are a quote from the book, noticed before (Danielewski, House, 30) I turn the evanescent handle and “The spatiality of English texts step forward into the blue edged as physical objects is normally backgrounded, but that does not frame of this white door negate the significance of this aspect of their existence. What might we learn, for instance, about the history of Chaucer’s reception if we paid more attention to the development of typography in Chaucerian texts printed from the Renaissance to the nineteenth century? How do the physical details of publication (style of type, size of page, locations of glosses, presence or absence of illustrations, even texture of paper) reflect the α There is something about the paper that infests the way the book is read. Is it cultural status of the text, and how smooth or rough? Is this easier to turn? Does that make you read at a different pace? do they affect the reader’s experience?” Is the book so bent you can see the binding in the gutter? Is the paper bumped and (Mitchell, Spatial Form in Literature, cockled from long hot baths? Is the paper diaphanous, with words of the past and 550) those yet to be read almost visible through the page? Has it been thumbed by other wandering fingers who dog-eared corners of the faded and foxed? And is it gilded or gnawed by time along its edge? Are pages loose from ancient horse bones, stained with the taste of red wine and sunned through creases? Or unbound, underlined, and unpaginated; water stained and wormed; yellow by the sweat of past palms.
44 45 “See, the irony is it makes no difference that the documentary at the heart of above, this book is fiction. Zampanò knew from the get go that what’s real or isn’t real doesn’t matter here. The consequences are the same.” from falling in||to the words (Danielewski, House, xx)
This could be rewritten with Kendall’s name in the place of Zampanòs. He knows that the particular text he is walking through is not of consequence but that each book written has the same outcomes, even if not written in such an avant-garde manner as House Of Leaves.
Derrida explores this spatial grammar rather succinctly, although he did not know his words would be applied to it when he wrote them.
“This fissure is not one among others. It is the fissure: the necessity of interval, the harsh law of spacing. It could not endanger song except by being inscribed in it from its birth below and in its essence. Spacing is not the accident of song. Or rather, as accident and accessory, fall and supplement, it is also that without which, strictly higher speaking, the song would not have Unsure if this sentence is carrying the gaps between these coats are getting wider now come into being. In the Dictionary, on from the previous or if the ‘ leaving stretches of ‘lackness all around following the complex the interval is a part of the definition denotes a subtraction of letters of song. It is therefore, so to speak, an unknown. holes path original accessory and an essential ‘s insides ‘here footnotes slide to the side in vertical stacks accident. Like writing.” (Derrida, Of The is a notable displacement of Grammatology, 290) capital letters, except with the
nouns he uses causing ambiguity upside down as if gravity worked another way for I will confess to feeling ill at ease here the descent into the
with the grammar, the spaces with words slung upside down as if gravity worked another way for The deliberate subtraction of inserted still imply a pause but one a time minotaur’s labyrinth has found me not at the end of the hole b from “blackness” implies that is almost unsure if one has time to a time lists and temperatures and stories and other books whilst the pages cannot be filled breath or carry on or even the centre but the bottom of the page stuck lining this hole fur coats in a Lewisian wardrobe ‘here the with it, it is somehow inherently there, whilst synchronously Despite the notion of the Alice in on this low path, the shortening sentences hastening my pace till the creating an alter word to describe Wonderland whole, he chooses the footnotes, have footnotes, inserted, on their side, to support the text the page itself. Narnian metaphor as a space that is pages flicker by like film stills walked through rather than fallen.
46 47 Mimicking the original text gives us a sense of the space that MZD constructed in HOL, (Danielewski, House, 220-224)
one after
48 49 another.
after
50 51 projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns another projecting newspaper columns projecting newspaper columns projecting newspaper columns projecting newspaper columns
and written transcripts of radio conversations and written transcripts of radio conversations and written transcripts of radio conversations and written transcripts of radio conversations and written transcripts of radio conversations and written transcripts of radio conversations and written transcripts of radio conversations and written transcripts of radio conversations and written transcripts of radio conversations and written transcripts of radio conversations and written transcripts of radio conversations and written transcripts of radio conversations and written transcripts of radio conversations.
52 53 all of a sudden it lurches and I’m sliding down the gutter all of and the lurch into a new corner and the top again
before the pages sp -l- it and the I suppose inevitable fall through “In less time than it takes for a single frame of film to flash the leaves. A descent through blacks marks and each one wounds. upon a screen, the linoleum floor dissolves, turning the kitchen into ______a vertical shaft. Tom tumbles into the blackness, not even a scream ______long up behind him to mark his ______fall,” – (Danielewski, House, 346) bumping ______off l t ______e t e r s ______on my ______way to the top ______upside ______down the of ______and _ the and as the structure di sin t e g r a t e s around us lurch pages tumble on to their sides and over even the footnotes that pin into a new down each page topple and finally caught on the edge of a precipice corner and the an ignis fatuus flickers, a will-o-the-wisp, the false end in sight bottom again
54 55 Italics are a quote form the end of Q: How did you get him out of the house? HOL, (Danielewski, House, 525)
Karen: It just dissolved
Q: Dissolved? What do you mean?
Karen: Like a bad dream. We were in pitch blackness and then I saw, no… actually my eyes were closed. I felt this warm, sweet air on my face, and then I opened my eyes and I could see trees and grass. I thought to myself, “We’ve died. We’ve died and this is where you go after you die.” But it turned out to be just our front yard.
Q: You’re saying the house dissolved?
Karen: [No response]
Q: How is that possible? It’s still there, isn’t it?
A play on the quote from Alice — and it really was a book, after all. Through The Looking Glass by Lewis Carroll. The original quote stands thus:
“— and it really was a kitten, after all.” (Carroll, Through The Looking Glass, 196
56 57 ‘The American writer Pablo Lopez has coined the term ‘pataphor to describe “a figure of speech that exists as far from metaphor as metaphor exists from non figurative language. Whereas BED metaphor is the comparison of a real object or event with a seemingly unrelated subject in order to emphasise the similarities between the two, the Pataphor – see glossary of terms ‘pataphor uses the newly created Addition –pleonasm, syntagm interpolation, echolalia, encasement metaphorical similarity as a reality with which to base itself. In going As applied to Words beyond the mere ornamentation of the original idea, the ‘pataphor seems to Text space describe a new and separate world, in Movement - into which an idea or aspect has taken on a life of its own.”’ (Hugill, Pataphysics, Perspective - vista A Useless Guide, 51) Afternoon Present Pataphor (noun): Touch - hear - An extended metaphor that creates its own context. Smell - Proprioception - That which occurs when a lizard’s tail has grown so long it breaks off and grows a new lizard.
From - http://www.pataphor. com/whatisapataphor.html
The opening words to Perec’s “ ‘For a long time I went to bed in writing’ chapter in Species of Space, according to Perec it was “a play Parcel Mroust” on the first sentence of Proust’s great novel, A la recherché du temps perdu, which reads: ‘for a long time I went to bed early.’ ” (Perec, Space, 16)
“A bed sees us born, and sees us die. It is the ever changing scene upon His alternative has wonderful which the human race play by turns interesting dramas, laughable farces, pataphorical connotations for and fearful tragedies. It is a cradle decked with flowers. A throne of love. A instead of saying “as if in writing” sepulchre.” the metaphorical version, he actually went to bed IN IT, and this – Xavier de Maistre is what Kendall plays with in this chapter.
Note from the author - (De Maistre, Journey Round My Room, 16) All books mentioned I have read in the same bed I sleep in now, and all beds mentioned are the same bed, this bed.
58 59 The telling of stories creates the So today sees us taking a whistle-stop tour through some of her real world. - (Manguel, http:// www.brainyquote.com/quotes/ favourite stories beginning with the Hundred-acre Wood, although quotes/a/albertoman521749.html) apparently there was no time to stay for tea or honey, and at the ∞ The symbol for infinity 2. Bed = ∞ Books mention of Christopher In Robin’s name the every culture, in every civilization, there are real wood blinked And like the opening words of places - places that do exist and that Perec’s chapter, Kendall begins are formed in the very founding of society - and was his with a re-writing of Neil The tale started, as many tales have started, in Bed. which are something like counter- sites, a kind replaced by Gaimen’s, Stardust . The original of effectively enacted utopia in which the real sites, sentence read: “The tale started, as all the other real sites that can be found within the a Grimm many tales have started, in Wall.” (Gaimen, Stardust, 1) I have lived in B¬ed for the last 26 years. It is a strange place of ever culture, are simultaneously represented, contested, and inverted. Places of this kind become spaces outside of country. changing worlds, shifting phantasmagoria of spatial disturbances, as all places, even though it may be possible to indicate This definition of a textopia is a their location in reality. Because these places are bastardisation through syntagm if rifts in the story world were opening up and merging with the — It should absolutely different from all the sites that they interpolation of Michel Foucaults definition of real. Its finite edge keeps reality at bay. create and speak about, and yet are undoubtedly be noted that Heterotopias(Foucault, Of other woven into reality through cognitive and the physics in spaces, Heterotopias. 6) spatial similarities, I shall call them, this part of Bed “The books transported her into new I have seen some extraordinary things in Bed. In fact it was here by way of contrast to utopias, worlds and introduced her to amazing textopias. are not those of “A spatial structure is easiest to think people who lived exciting lives. She I first stumbled across a little girl called Matilda, a particularly ordinary space. It is, after of as an assemblage of went on olden-day sailing ships with elements, each with its separate all, a textopia. Joseph Conrad. She went to Africa vindictive little cow, but one whose knowledge of Story World is meaning, all arranged in a fixed with Ernest Hemingway and to India pattern to establish a total significance. unsurpassed. She is now 25, and her slavish affection for books and This conception of form falsifies the with Rudyard Kipling. She travelled all Here, space doesn’t exist topographically but rather temporally, based on actual mode of existence of a novel, over the world while sitting in her little a lust for revenge over the slightest of insults (even Miss Honey fell room in an English village.” units of time known as Books, Chapters, Sentences and Words. The space the way in which it is a temporal (Roald Dahl, Matilda, p.15) victim in the end), has left her single, bitter and almost alone, but for around you exists only for the length of time that you are cognitively structure constantly creating its own meaning.” (Miller, The Form of processing the Chapters, Sentences and Words that make up whole Books. a cat she had neutered. Victorian Fiction, 46) This is what makes Bed such an intriguing place.
Despite this slightly unappealing side to her nature, this literary We climb up towers using golden rope made of hair, which takes despot makes an excellent guide through the story world of Bed. us in through the window of a ginger bread cottage filled with the death rattle of infants on a roasting spit. This cottage sits in a wood filled with little girls in red cloaks that carry shotguns to keep away perverted wolves. At the edge of the wood we find a sleep ridden wasteland where towers of thorns climb up to the sky and turn into
60 61 pile of mattresses. At the top of this pile the spy hole we see Tomas as he fucks Sabina in her studio whilst she Bed: Where unformulated dangers threatened[…] we are the bottom of an ocean, walking still wears her bowler hat, feeling the sensation of lentils as it passes between my fingers, thrusting my through a garden made of hand deeper into the sack being used we sat on the bed after dinner on seaweeds as red as the sun. for a bed in Shepheard’s Hotel where the floor, at right angles to each there is plenty of red plush and red other me leaning against the Once the tide had wall, him against the bed head Morocco and innumerable wedding conversing through a mix of ebbed we began again, presents of the ‘80s; in particular many Miranda Hart quotes and book of those massive, mechanical devices theories while his socked foot following Milo through covered with crest and monograms, and my bare one inched closer and associated in some way with cigars, over the covers till they closed the tollbooth in his like a jigsaw. and out onto a racetrack speeding with […] the foreclosed place of little car, through the automobiles of shiny green and glass desire, […] Foothills of Confusion, which crashes off through the countryside poop poop and into an asylum where the those who crazy see the truth. the island of Conclusions, And as golden dust falls through an abyss rent in all the skies onto two lovers below, we see what must be unseen of cross Dictionopolis, Digitopolis, hatched streets, foreign alter spaces and topologangers who un- sense each other till we eventually see all 55 of the invisible cities at via Expectations and once and times arrow is released into Alices looking glass and time begins to go backwards. backwards. go to begins time and glass times arrow is is arrow times and once This is a combination of Pleonasm
into the mountains Of […] the improbable place where I had my roots, […] Alices looking Alices into released till we we till So hard, so high, so sterile, the main other each and echolalia. The pleonasm Ignorance to climb to the Castle in the Air. Then into the hunting feature of this utilitarian room; that occurs is showed backwards The green text is a quote from see eventually the invisible invisible the the connection was immediate. f o 55 all though as a response to the words Perec’s chapter on The Bed (Perec, grounds of mobile cities who one day rose up on gigantic caterpillar at cities Here I was to change the course of in the texts in a mirrored echolalia. Space, 17). It has been split up in foreign streets, hatched spaces and and spaces my life by giving life, on this cool alter This mirroring establishes a sense this text to form conceptual titles tracks and began to prey on the smaller suburb. As one gets mawled topologangers metal and plastic structure which o h w of infinitely generative story for each of the text inserts. The unsense by tearing urban jaws a door gets left behind. was to become a disinfected sterile worlds between its beginning and stacking of three worlds causes lovers two onto skies see what what see place of retreat; of safety; of fear; e w below, end. shifts in a readers awareness of the We open the door […] the space of the solitary body encumbered of unseen e b must of pain; of support; of tearing cross page, what is on it, around it and by it ephemeral harems, […] golden as And to Paul Dentons bedroom, an through battle; exhaustion; umbilicus and falls dust The densification of words outside it. “The sex urge is very powerful, when a boy the all in rent abyss desperate love. also serves to create a written filled with the smell of is excited he is likely to have sexual thoughts and poop poop truth. about all manner of things which ordinarily asylum n a into encasement of the other worlds “Each change of narrative level in those the where he wouldn’t think of at all. The memory of the see Oh Bed keep me alive to see this crazy o h w embedded within them. a recursive structure also involves a Absolute, pot and something and racetrack a cigars, onto with y a out w some of them may horrify him, may make with speeding child. Hold us all as we push and change of ontological level, a change automobiles male. As the fug clears you him guilty or afraid, when he remembers covered gasp and strain against your rails. devices of world.” These and monograms, crest with them after he ejaculates. […] That’s the way it You, Bed, are my world – we are and nested worlds can be continuous or see strange bed fellows only in associated is with whatever fantasy a boy has when he is welded. I fear any movement from some subtly different, or even radically in ‘80s; the particular of presents in the window we climb masturbating. The chances are astronomical massive, those here, I will not be parted from you. f o many different from the parent world. The mechanical that any of those fantasies would ever come red and and Morocco plush Silent support in my final scream; red of plenty is “recursive structure serves as a tool out of on the wrong side, innumerable true, but they’re exciting to think about while for used being wedding my son, placenta – Bed you take sack the into for exploring issues of narrative Shepheard’s n i bed Hotel a masturbating. Then he comes back to the real passes it there the mess and hear the relief and the s a lentils of where authority, reliability and unreliability, and into Doctor Finches fingers, deeper thrusting my hand y m between world and deals with it in a realistic way.” still she whilst tears. I lie on you so grateful. studio her the circulation of knowledge, and so Masturbatorium, a dark hat, through bowler till sensation her the handle feeling wears Boys And Sex, P.46-49 in Tomas see a Sabina we into fucks hole he spy walk as the forth.” (Brian McHale, Postmodernist the and long a of by door the tissues try turning of We it. box a every on with theory, curled door woman psychiatric same on blonde a the books with via with couch room lined room leather new calm room lined with books the you calm on of dark clears a out fug the climb As we male. Masturbatorium, window the Finches in something only and Doctor pot into fellows and bed Absolute, side, of strange smell see wrong Fiction, 114). h Paul jhgjhg b kuytfjhgf to hgdf bcv door lufjdghdf the hdgfsdhfs yf open hgf jhjgfghf We jkhgjghf Dengfdfgdffdgnfdfgdgfdfgdgfdgjhgvmnbv on psychiatric theory, a box of tissues by a long leather couch with the with filled bedroom, jhgfjhgjhjhgjhgjghjhgtons behind. left gets door hhhgjhgjhgjhj on the smaller suburb. As one gets mawled by tearing urban jaws a prey cities jaws to urban mobile began of and tearing by tracks grounds mawled hunting caterpillar gets the one into gigantic As on Then up suburb. Air. rose the day smaller in one the Castle who on through the tollbooth in his little car, through the Foothills of via the to Foothills climb to Digitopolis, the through Ignorance Of Dictionopolis, car, little his mountains Conclusions, in the of into island tollbooth and the the through Confusion, Expectations a blonde woman curled on it. We try the door and walk into a new Milo following again, began we ebbed had tide the Once sun.,ngvbvcbvncxbvncbvcnbvcbvncbnvcbvcnbvcnbvcnbvcnbvcnbvcb pile of mattresses. At the top of this pile we are the bottom of an the of as red as bottom the are seaweeds we of pile made this of garden top a the At through mattresses. walking of pile ocean, vcb room via the same door with every turning of the handle till through awa into riddeilled turn keep to and sleep a sky the find shotguns to we up carry wood climb the that of thorns edge cloaks of the red At towers in girls where wolves. little with perverted wasteland apparently there was no time to stay for tea or honey, and at the was at and and blinked honey, or wood tea the for stay name to time Robin’s no country. was Grimm Christopher there a of by apparently mention eplaced 62 her calm of although dark a some Wood, through tour Masturbatorium, Hundred-acre 63the Finches with whistle-stop a Doctor taking into beginning us and sees stories side, today wrong So favourite We open the door to Paul Dentons bedroom, filled with the the you with on of clears out filled fug the climb As we bedroom, male. window Dentons the Paul in something to only and door pot the fellows open bed Absolute, We of strange smell see on the smaller suburb. As one gets mawled by tearing urban jaws a jaws urban tearing by mawled gets one As suburb. behind. left smaller gets bvcbvcbvncbnvcbvcnbvcnbvcnbvcnbvcnbvcnbvcnbvcbvcnbc the on door gcgf Expectations and into the mountains Of Ignorance to climb to the prey cities to to climb mobile began to of and tracks grounds Ignorance Of hunting caterpillar the mountains into gigantic the on Then into up Air. and rose the day in one Expectations Castle who through the tollbooth in his little car, through the Foothills of via Milo Foothills following Digitopolis, the again, through began Dictionopolis, car, we little ebbed his Conclusions, in had of tide island the tollbooth the the Once through Confusion, ocean, walking through a garden made of seaweeds as red as the as red as seaweeds of made garden a through walking ocean, sun. perverted wolves. At the edge of the wood we find a sleep riddeilled an into of riddeilled turn and bottom sleep a sky the the find are to we we up pile wood climb this the of of thorns top edge of the the At At towers where wolves. mattresses. of perverted wasteland pile mention of Christopher Robin’s name the wood blinked and was awa and keep to blinked wood shotguns the carry name that Robin’s cloaks country. red in Grimm Christopher girls a of by little mention eplaced with apparently there was no time to stay for tea or honey, and at the her at of although and some Wood, honey, or through tea tour for Hundred-acre stay the to with whistle-stop time a no taking was beginning us there sees stories today So favourite apparently name the wood blinked and was and blinked wood the name there was no time to stay stay to time no was there for tea or honey, and at the at and honey, or tea for stories beginning with the Hundred- the with beginning stories once and times arrow is released into Alices looking Alices into released is arrow times and once each other till we eventually see all 55 of the invisible cities at cross unsense cities of who unseen invisible be the of must 55 what all andtopologangers see see we altaces below, eventually foreign we lovers till two streets, other onto skies hatched each apparently although Wood, acre And as golden dust falls through an abyss rent in all the all looking in rent Alices abyss into an through released is falls dust arrow golden as times And and once once each other till we eventually see all 55 of the invisible cies at cies unsense invisible topologkhgdgjjh who the and of 55 all spaces see alter eventually foreign we till streets, other vn,bvbnvmnbvnbvnvnbvnbvmnbvmangers hatched each And as golden dust falls through an abyss rent in all the cross all looking of in seen rent be Alices abyss must into an what see through released hgf is falls wekgf dust arrow below, golden lovers as times two And and onto once skies favourite her of some through tour each other till we eventually see all 55 of the invisible cities at cross unsense cities of who unsen invisible be the must of topologangers 55 what all and see see we spaces alter below, eventually foreign we till twoovers streets, onto other skies hatched each An as golden dust falls through an abyss rent in all the all looking in rent Alices abyss into an released through is falls dust arrow golden times as An and once each other till we eventually see all 55 of the invisible cities at cross of unsense cities who unseen be invisible the must of what 55 all andtopologangers see sejghgfjhge altaces we eventually below, foreign we lovers till two streets, other onto skies hatched each whisle-stop a taking us sees today So each other till we eventually see all 55 of thekhgfjhgdf invisible cities at the all cities looking in rent invisible Alices into abysluyfjhdjs an thekhgfjhgdf of released 55 through all is see falls dust arrow eventually golden times we as till And and other each once And s golden dust falls through an abyss rent in all the cross all of unsense in who rent unseen be abyss must an topologangers what see and through we falls spaces dust alter below,fgfghf golden foreign s lovers two And streets, onto skies hatched […] where all his kinsfolk were each other we eventually see all 55 of the invisible cities at looking cities Alices invisible the into of 55 all released is see arrow eventually times we and other each once jgfg So today sees us taking a whistle-stop And as golden dust falls through an abyss rent in all the cross all unsense of in who rent unseen be abyss an must topologangers what and through see falls we saces dust alter below, golden foreign lovers as two And streets, onto skies hatched born and where they died.[…] each other till we eventually see all 55 of the invisible cities at looking cities Alices invisible the into of 55 all released see is eventually we timesrw till and other each once And as golden dust falls through an abyss rent in all the cross all unsense of in who rent unseen be abyss an must topologangers what and through see falls we spaces dust alter below, golden foreign lovers as two And streets, onto skies hatched tour through some of her favourite poop poop and into an asylum where the those who crazy see the see crazy who those the where asylum an into and poop poop truth. It should have been huge but it way with cigars, and out onto a racetrack speeding with automobiles with speeding racetrack a onto out and cigars, with way wasn’t, more like a valise. He devices covered with crest and monograms, and associated in some in mechanical associated massive, and those of many monograms, and particular crest in with ‘80s; the of covered presents devices is plenty of red plush and red Morocco and innumerable wedding innumerable and Morocco red and plush red of plenty is had shrunk. Maybe it had been stories beginning in Mexico City where into the sack being used for a bed in Shepheard’s Hotel where there where Hotel Shepheard’s in bed a for used being sack the into of lentils as it passes between my fingers, thrusting my hand deeper hand my thrusting fingers, my between passes it as lentils of after he shaved his moustache her studio whilst she still wears her bowler hat, feeling the sensation the feeling hat, bowler her wears still she whilst studio her off by mistake that he looked we go …into an exhibition of paintings handle till through the spy hole we see Tomas as he fucks Sabina in Sabina fucks he as Tomas see we hole spy the through till handle walk into a new room via the same door with every turning of the of turning every with door same the via room new a into walk smaller... Now though you leather couch with a blonde woman curled on it. We try the door and door the try We it. on curled woman blonde a with couch leather knew it wasn’t. On a conveyor by the beautiful Spanish exile Remedios room lined with books on psychiatric theory, a box of tissues by a long a by tissues of box a theory, psychiatric on books with lined room belt disguised by velvet and wrong side, and into Doctor Finches Masturbatorium, a dark calm dark a Masturbatorium, Finches Doctor into and side, wrong braided trim was the casket. Varo: in the central paintings of a triptych, see strange bed fellows only in the window we climb out of on the on of out climb we window the in only fellows bed strange see Above, smell of Absolute, pot and something male. As the fug clears you clears fug the As male. something and pot Absolute, of smell the curtains waiting to descend. titled ‘Bordando el Manto Terrestre’, were a We open the door to Paul Dentons bedroom, filled with the with filled bedroom, Dentons Paul to door the open We In the wall, at the caskets head, was a matt grey mechanized door gets left behind. behind. left gets door pair of what looked like number of frail girls with heart-shaped faces, on the smaller suburb. As one gets mawled by tearing urban jaws a jaws urban tearing by mawled gets one As suburb. smaller the on miniaturised lift doors, the only who one day rose up on gigantic caterpillar tracks and began to prey to began and tracks caterpillar gigantic on up rose day one who real reminder of the huge eyes, spun-gold hair, prisoners in the Castle in the Air. Then into the hunting grounds of mobile cities mobile of grounds hunting the into Then Air. the in Castle procedure waiting to happen Expectations and into the mountains Of Ignorance to climb to the to climb to Ignorance Of mountains the into and Expectations once the curtains closed. top room of a circular tower, embroidering Confusion, the island of Conclusions, Dictionopolis, Digitopolis, via Digitopolis, Dictionopolis, Conclusions, of island the Confusion, Climbed between something through the tollbooth in his little car, through the Foothills of Foothills the through car, little his in tollbooth the through and 30 steps past the stench of Once the tide had ebbed we began again, following Milo following again, began we ebbed had tide the Once three lilies into the pulpit. The a kind of tapestry which spilled out the slit sun. dark of the wood arose out of ocean, walking through a garden made of seaweeds as red as the as red as seaweeds of made garden a through walking ocean, the carpet and came out of the magnolia walls simultaneously. windows and into a void, seeking hopelessly pile of mattresses. At the top of this pile we are the bottom of an of bottom the are we pile this of top the At mattresses. of pile There was something on the wasteland where towers of thorns climb up to the sky and turn into turn and sky the to up climb thorns of towers where wasteland wall overhead perverted wolves. At the edge of the wood we find a sleep ridden sleep a find we wood the of edge the At wolves. perverted that bowed over you,pushing to fill the void: for all the other buildings and filled with little girls in red cloaks that carry shotguns to keep away keep to shotguns carry that cloaks red in girls little with filled at your back to steer you lecternwards. I removed the death rattle of infants on a roasting spit. This cottage sits in a wood a in sits cottage This spit. roasting a on infants of rattle death three sheets of paper from creatures, all the waves, ships and forests of us in through the window of a ginger bread cottage filled with the with filled cottage bread ginger a of window the through in us their silk pocket and unfolded them with my finger tips across We climb up towers using golden rope made of hair, which takes which hair, of made rope golden using towers up climb We the horizontal grain of the the earth were contained in this tapestry, intriguing place. intriguing wall. I saw the switched off microphone and Words that make up whole Books. This is what makes Bed such an such Bed makes what is This Books. whole up make that Words then past it. I saw no empty that you are cognitively processing the Chapters, Sentences and Sentences Chapters, the processing cognitively are you that seats. and the tapestry was the world.” (Pynchon, The Crying of Lot 49, 13) Words. The space around you exists only for the length of time of length the for only exists you around space The Words. based on units of time known as Books, Chapters, Sentences and Sentences Chapters, Books, as known time of units on based Excerpt from a text Kendall wrote called Vallise, see UTILITY ROOM. Here, space doesn’t exist topographically but rather temporally, rather but topographically exist doesn’t space Here, of ordinary space. It is, after all, a textopia. textopia. a all, after is, It space. ordinary of — It should be noted that the physics in this part of Bed are not those not are Bed of part this in physics the that noted be should It — Grimm country. country. Grimm Robin’s name the wood blinked and was replaced was and blinked wood the name Robin’s 64 65 for tea or honey, and at the mention of Christopher of mention the at and honey, or tea for acre Wood, although apparently there was no time to stay to time no was there apparently although Wood, acre DESK
Substitution – Displacement - Rrose Sélavy, Matthews algorithm. Multiplication - nothing As applied to the Sentence Image space Movement - Through Perspective - Adjacent Night Future Hear
Proprioception
A picture held us captive. And we could not get outside it, for it lay in our language and language seemed to repeat it to us inexorably.
-LUDWIG WITTGENSTEIN (Wittgenstein, Philosophical Investigations, 539)
A series of sentences taken from my desk. “A writer’s domestic interior opens a window onto both author and text, reminding us that what we may at first perceive to be the timeless and universal truth of writing cannot be so neatly extricated from the complex particularities of its spatial and material origins.” (Fuss, The Sense of an Interior, 2)
66 67 7. Then there is the TEMPORARY which consists of my camera for Matthews Algorithm has been the purpose of this essay, wet wipes to clean my left hand which is applied here displacing each currently in a blue splint with red Velcro due to my putting a chisel piece of text out of its originally through the back of my arm… etc. intended sequence. The cut in the page has been applied that we might locate each piece of text to help interpret its intended image.
68 69 Description of Perec’s desk in his 8. WORKING objects such as notebooks and drawing equipment, 9. And finally the more sentimental objects of MEMORY, the ones EACH CAPITALISED WORD essay, Notes Concerning the Objects a series of half drunk mugs of tea and packets of chocolate biscuits we wouldn’t be without where we to up and move house; the WAS DERIVED FROM THE that are on my Work-table, (Perec, (not other types, only chocolate), which I would consider neither photograph pinned to the wall above, the coaster one always thinks SAME ESSAY AND WAS PEREC’S Species of Space, 144-5 temporary nor permanent as they appear for various periods of time they will put their mug of tea on, and here, Winnie the Pooh would METHOD OF DEFININGF THE depending on the task at hand. certainly make a reappearance. OBJECTS ON HIS TABLE.
70 71 Each piece of text serves to elaborate 2. So let us look at this desk. Much like Perec’s work table it is a 1. Let us look at the writer. What do we see – only a person who sits with a (Virginia Woolf, The Moment, and on what we can already see in the 1400mm x 700mm sheet of glass with metal trestles for legs: unlike pen in his hand in front of a sheet of paper? That tells us little or nothing Other Essays, 128) image. This repetition being a play his it has a 2500mm set of 1.5” timber ratchet strapped to it: much on the earlier Wittgenstein quote, like his desk it is usually cluttered, although great pleasure comes Virginia Woolf pulling into question our notions from the tidying and organisation of this, my reading/writing place. of picture, internal language and written language.
72 73 4. There are those that exist by CHANCE like Fritz (Joe’s teddy), 3. Part of this REARRANGEMENT raises the question of what camera films, and a selection of bonbons. should stay and what should go and quite often, “how did that get there¿”, “well where do I put it now¿” or “what does that mean for
74 75 6. PERMANENT residence has been allotted to various others i.e. 5. And others from NECESSITY, such as my many piles of books hard-drives, pots of pens and Winnie the Pooh – this is focused on whose organisations have consisted of, genre, author, format, how the area around my computer much I like them and research based priority.
76 77 BEDROOM
Substitution – holorhyme, homophony Addition – accumulation, larding As applied to the Sentence Text space Movement - Through Perspective - Vista
Night - no time Present - past/future Hear Smell.
These facts are a severely edited version of http://en.wikipedia.org/wiki/42_ (number) (accessed 09.08.2013) This is a journey around my bedroom, a series of rememberances and anticipations. 1. The answer to the ultimate question of life, the universe, and everything, in This is a response to Xavier de Maistre’s Journey Round My Room, Hitchhiker’s Guide to the Galaxy who spent 42 very eloquent days pontificating the room he lived in. 2. This was a joke. This is a set of 42 sentences, written one a day, for 42 days, each 3. It is the average number of lines on an average page of an average paperback correlating to his original 42 chapters. (de Maistre, Journey Round My 4. The 42 puzzle, is a game devised by Douglas Adams. Room, 539) 5. Alice’s Adventures in Wonderland has 42 illustrations 6. In the same story, rule 42 is that “all persons more than a mile high to leave the court”. 7. The combined ages of Lewis Carroll’s red and white queens is 74, 088 days, which Is there any one saintly thing I can do to my room, paint it pink Extract from “Second Poem”, is for 42 x 42 x 42. Orlovsky, Clean Asshole Poems & 8. 42 is the episode of Doctor Who that is set in real time, lasting 42 minutes. maybe or instal an elevator from the bed to the floor, Smiling Vegetable Songs, 11 9. The board game Risk has 42 territories. maybe take a bath on the bed? (the typos are original) 10. 42 is the number of hits on a pair of standard six-sided dice. Whats the use of liveing if I cant make paradise in my own 11. In Romeo and Juliet, Juliet takes a potion that makes her appear dead for 42 hours. room-land? 12. There are 42 generations in the gospel of Matthew’s version of the genealogy of Jesus. 13. In Revelations 13:5, it is proper sized that for 42 months the Beast will hold dominion over the earth. 14. The Gutenberg Bible contains 42 lines per page and is known as the 42-line Bible. 15. The angle rounded to hold degrees for which a rainbow appears, the critical angle.
78 79 There is a pleasure and melancholia to this act: there is a treasure, S1 – Holorhyme, not only that but an élan, eunoia in this fact.//It has cost me nothing and yet I feel both sentences try to express a that its result might be the death of my bedroom.//But I have similar meaning not just sounds. made myself comfortable here in my ways. //It is located at the co- S2 - a dual note - the idea of ordinates: 51.5369203 N , 0.13562630000001263 W//Here is the bed confession as destruction – Joe’s I have since I was 13; a low and ugly grey metal frame, with the same moving in and the anticipation of mattress that will have been turned about 52 times: it came from our what this might change B&B so saw many bodies, although none that it owned till mine. // There was once an occasion in which I was collapsed on the floor outside my room. //My head and heart were in it, moving across floor and bed through the smell of his clothes and unused valentines IOU’s, echoing his words as we stood in the Covent Garden street.// My body was crumpled outside it against the frame, it rendered physically incapable of ingress except through those senses unlinked to motion forwards.//But it betters me.//Pinned to the wall are The addition rule is adhered to mum and dad and me, for safety.//Four steps away from where I here by the accumulation of the write sits my blue bed.//A padded red silk paisley smoking jacket sentences over time, adding one to with a black collar hangs on the wall.//STOP.//From here I can hear the other one of the girls making me tea soporifically.//My eyeless masks eye up every corner at once.//Bear sits, as usual on the edge of the blue bed.//He is nearly 80 years old and has a Jack-Russell chewed ear.//Hannah quietly left after she put me in here.//It was then my face made my pillow damp.//Now there is a picture of Joes friend Shonagh on my wall.//His boxes of books and bits sit below my desk.// It is to him this chapter goes.// His books to soon go on my shelf.// Fritz will move in beside Bear.//My half finished painting by S21 – Joes boxes = half way and a the window might get finished.//It is of a woman stood bare with change yellow roses.// Above my desk a child’s drawing of a dog hangs.//At my desk I have three chairs to sit on depending on the task.//And it is where I am sat now, in the highest and spiniest of my chairs to ensure a straight back and mobile procrastination.//Behind me is where the air bed goes when my room becomes a flop house.//There are 385 books and 432 DVD’s in my room of which 12 are the same story.//I have not closed my curtains for six years.//So Tigger has S 32 Antimony of de maistre who a view of the balcony.//A once tidy Junk Tower filled with drawing felt misanthropic and painterly accoutrements, looms by my desk.//Dry Roses hang on a string above my head.//Books not included in my bedroom are S 35 - He also had a dried rose. mostly: plays, big art books, biographies, unread fiction, children’s books, the poets, historical texts, and a few to hard to allocate a specific genre.//I have another library contained on my computer S 36 – DM described what WAS of audio-books, for to be read to, while lying on the blue bed, is in his. another world.// Something that has been in all my bedrooms, is a small china pig with a playmobil black bowler hat, it is familiar, grounding.// I have a quilt of hot air balloons that fly over me in my sleep.// His unpacked clothes perch on half a shelf in anticipation of the whole thing.//His long coat hangs on the same hook as mine now.// They hang there bodily, on the door, as if contemplating walking out as if in Mary Norton’s Bedknob and Broomstick.
And thus ends the 42 days of my bedroom voyage to observe my four 43rd sentence as aligned with DM’s walls and all they hold through De Maistre’s eyes. 43rd chapter entitled Liberty, a free sentence and his final freedom from the room. 80 81 STAIRCASE
Displacement - pataphor
Multiplication – not actually missing: tautogram, alliteration, rhyme,
homoeuteleuton
As applied to the Letter
Image space
Movement - Around
Perspective - Adjacent
Morning
Future
Taste
Proprioception
A series of observations on the staircase.
82 83 Jennifer Bloomer quoting Becket - 1. LITERAL / DESCRIPTIVE This particular staircase has various functions: the physical conduit “Here form is content, content is form. You complain that this stuff is not of fourteen steps by which one can move between the two floors; written in English. It is not written at all. It is not to be read - or rather it is Stairs have a passing for those ascending and those descending; where you can not only to be read. It is to be looked A b a l u s t r a d e hear the neighbours in their kitchen at breakfast time; a seat on at and listened to. His writing is not about something; it is that something which to converse with those in the kitchen; a miniature library of itself” (Bloomer, Architecture and the Text, 7) a top books too big for my book shelves
Here we see Kendall using the text itself to construct an image, not just an idea. To physically imbue a step a step the text with a sense of movement a step through a constructed space, literally following his words up and a middle a step down stairs. a step a riser a step a step an under a tread a step a step a foot transitional books keys laundry & conversation step separately they are bike paraphernalia As well as the physical structure of the text the words themselves a step a step have been used to influence the experience. a step a step
The general sense given by the a step multiplication rules give a sense of the repetition of ones footsteps a step and the moment one exhibits in a step climbing the stairs, such as this tautogram of repeated a’s a step
but together they are a staircase, a stairway, flight of stairs, a companionway, in a stairwell.
84 85 3. MYTH It is believed that Kendall wrote this note on the staircase as a response to the passage below:
A staircase is what I imagine one should find at the heart of “The function of [a] centre was not a labyrinth for it would seem a relief to move upwards or downwards; only to orient, balance, and organise the structure - one cannot in fact something other than the horizontal centrifuge that spun you to that conceive of an unorganised structure - but above all to make sure that the “The building is a document of point. The centre of the labyrinth though, is not the goal but merely organising principle of the structure something that happened. It is a would limit what we might call the document of great transparency a portal to elsewhere outside it for a staircase is not a place but a clay of the structure. By orienting and (translatability), because it is the transition, a movement from here to there. organising the coherence of the system, concretisation of what happened. the centre of a structure permits the […] Architecture in this sense (and By sitting at the centre, it is both the locus and the antithesis play of its elements inside the total architectural theory) is, to a degree, form. And even today the notion of a “always already” allegorical in of the home, for it pulls all places together by being a non-place, one structure lacking any centre represents the Benjaminian sense. That is, the unthinkable itself. […] This is architecture contains the instrument for of no definable stationary purpose. why classical thoughts concerning radical critical operations upon itself Like the Minotaur at the centre of the Labyrinth, there is structure could say that the centre is, within itself.” paradoxically, within the structure (Bloomer, Architecture and the Text, something that lurks around stairways; the creek on the stair, step and outside it. The centre is at the 22-23 centre of the totality, and yet, since the by wicked step. When I was a child, although that would be a lie, for centre does not belong to the totality (is not part of the totality), the totality “The Staircase sits as an allegory for 2. FORMAL even now there was and is something that lurked at the bottom of has its centre elsewhere. The centre is the center of the essay; of the scales not the centre.” (Derrida, Writing and of spaces; of the three levels of scale; the stair. At night, when all the other lights were switched off one Difference, 352) of the grid itself — which is in itself an allegory of the flat and of an I hope that in the future we have stairs. I don’t want by one, I would be forced to run up the stairs in case a fingered hoof architecture.” domestic scale escalators and elevators, or the invention of the should come through the riser and drag me down. (This fear might (Teskey, Allegory and Violence, 119) Stannah hover step that floats up upwards, assuming there is an up have been fed by the rumour of a murderous tunnel from under the This was written as a response to Step by Wicked Step is actually a Giambattista Tiepolo’s painting of to go to. stairs to the smugglers coves. Despite my having started this myth, children’s book by Anne Fine about Apollo, and the magnificent hallway having stepparents. around it. There is a life around stairs. Harry Potter lived under I came to believe it so forcibly that all manner of mythical creatures them, Joan Crawford was pushed down, they ascend to heaven in could emerge from there.) Christianity and descend to the underworld in Greek Mythology Back in my current flat, opposite this portal to the nether There is a certain schizophrenia about them, they create a world, there exists a mirror. In the day it is no more than the perfect sense of a home because they sever the up from the down. “There tool to reflect oneself. But as the day goes on, and light becomes less is no position from which the entire [flat] is visible at once. It must sure of itself, so do you. The figures in it become like Peter Pan’s be experienced in time, like an allegory, and the architecture of the shadow — flighty, dark and soulless staircase causes that experience to unfold in a manner that is richly Strange though it may seem, these mythological stairs suggestive, creating a labyrinth of meanings.” make me feel more at home rather than fearful of being here.
86 87 Each of these four sections took one of the four of Frye’s symbolic phases to critique the staircase.
The final one was a Anagogic which he described as being, “the imitation of infinite social action and infinite human thought, the mind of a man who is all men, the universal creative word which is all wor[l]ds.” (Frye, Anatomy of Criticism, 125)
This links to the pataphor where the staircase is no longer like something but has become something else.
4. ANAGOGIC
“bridges you cast toward the outside, toward the world that interests you so much that you want to multiply and They are the bridges to all other places, like the bridges of Venice extend its dimensions through books.” they make a series of floating isles a whole world, or those of (Calvino, Winters Night, 142) London that make a severed city a single space.
The A Bao A Tu is a reference to the mythical creature that Borges Here, in this bridging place, the turbulence of all footsteps forever wrote about called the A Bao A Qu, a creature who also lives on treading its timbers, are eddying and coagulating into a creature. It stairs. The substitution of ‘Qu’ for the French pronoun ‘Tu’ to imply a is called the A Bao A Tu and it is following at your heels, hungrily creature that follows you! (Borges, Imaginary Beings, 15) snapping up your steps.
Homoeuteleuton – the repeated use of the ending “ing” It is there always, hiding in the pile of the carpet or knotting in the wood, waiting to lick the sole of your foot clean. Surprising it is Like the deaths in the Amber Spyglass (Pullman, The Amber never seen, like your death, it is creeping politely behind you just Spyglass, 271-276) waiting for the moment. And when two people are passing, it is feasting.
88 89 BALCONY
Pataphor of “Good prose is like a window pane” (Orwell, Why I Write, 4) Subtraction: couper à la ligne, ellipsis, brachylogia, zeugma As applied to Words - Sentence Grammar - text looking - Into perspective - in/on Afternoon Past Touch
See.
Some window texts about the people who live opposite as seen from my balcony.
“The eye travels along the paths cut out for it in the work.” (Klee, Pedagogical Sketchbook, 33)
“The story, or narrative, of the book does not unroll along a line of time. Its (Bloomer, Architecture and the units of narrative are assembled in space - in the space of the text. Thus the Text, 12) text pushes at a privileging of spatiality over temporality.”
90 91 In this chapter Kendall has given us an insight into a few windows in a block of flats allowing us to Ellipsis – the omission of a word that I only moved the cur’ain a I love this chair, oooghh, construct similar windows in the described the physical condition of space left, as well as the block itself the curtains leaves the sentence fraction; just to see. I hung how great is this chair. around them. open to a slight interpretation. Is I left the curtains as I took these lacey ones thinkin’ Little bugger! Blood! the word “open” or “ajar”? how my clothes off in the hope that “[V]irtuality is synonymous with does this change the reading of the they’d make it a bi’ easier Urgh! I keep saying “architecture” proper as opposed sentence and therefore the size of some one was watching me. to building simple. Through the the confession. for lookin’. Bu’ the holes, he’s going to have my use of gesture, the non-present is Sometimes I think he is looking made present […] The principle of they’re too bloody small! nipples as after dinner our access to the virtual is based and sometimes… well… not. on the act of reading, where the mints. movement from the actual to the virtual is simultaneously a spatial and a philosophical transformation. Who’s he going to pick Reading is not simply the translation of phonetic or iconographic characters today? Pick me! Pick me! Subtraction of the name preceding into their linguistic equivalents, Trollope, could either imply book Not the Trollope! Nope…. but a restructuring of the space envy or disdain depending on which of appearance. The origins and Trollope you think of first. This URGH, Angels and Demons. Potatoes! Potatoes! Potatoes! evolution of this “space of reading” affects the reading of the final two are characterized by a distinctive sentences. Of all of us, he had to pick Potatoes! Potatoes! Potatoes! architecture, and the architecture of inhabitable spaces is conditioned that, another for the charity Potatoes! Potatoes! Potatoes! by this distinctive architecture: the architecture of reading is the means of shop. Potatoes! Potatoes! Potatoes! reading architecture.” Potatoes! Potatoes! Potatoes! (Kunze, Architecture as Reading, 28) Potatoes! Potatoes! Potatoes! Potatoes! Potatoes! Zeugma – the word “goes” applies to all the articles of clothing. On goes the purple No one ever comes to visit Brachylogia
Couper à la ligne – gives us time sweater, grey shorts, me. I blame bed, he’s just to think but as a result of the socks, headband and not comfortable under characters previous statement this could also become time to worry trainers. “I’m going to strangers, that, and she about what happened to them or what they might do. Asking the learn how to box! Going keeps leaving crap in me, reader to think, pulls them off the page and into their own memories to stand up for myself! oh and I’m magnolia, of to construct a potential filler. all the colours, council flat magnolia. .”
92 93 LANDING Heart Frustrated Relaxation Ascendency En mi salsa Miracle Worker Comfortable Contingent Organised Sage Happy Trapped freeloader Cup cakes “Phantasmagorias of the interior are Wet Craving Ordered At peace Claustrophobic Hungry Maternalistic constituted by man’s imperious need Pataphor – substitution: N+7, antonymic translation to leave the imprint of his private individual existence on the rooms he Multiplication – nothing inhabits.” Word (Benjamin, The Arcades Project.14) Text image Movement - Into Persoective - Adjacent Afternoon Future Touch Proprioception.
Whore Impatient Angry Cramped Sticky 50’s housewife Chardonnay Indecisive Pressurised Unwanted God like Satiated Watery Tall PULL The landings along my block are public walkways that give access to Artist Unpleasant smell Surplus Homicide Elevated Donkey Grounded every flat. As you walk down each gangway, you can peek into eve- ryone’s kitchens. To fully comprehend the movement of going into these kitchens would be to ask each resident how they saw their rela- tionship to the kitchen space.
“Lemme in! Lemme yinnnnn!” “Gnyaa!” yawns the door without budging an inch. “Go ‘way!” “Who said that?” The Last Museum “Me,” groans the door. “An’ you, who are you? Whazya name?” (Gysin, , 9)
And so my LANDING of kitchens began: a series of one(ish) word Foreign Content Violent generous Masterchef Dancey Miles away descriptions of how the people of my block feel about being in their Warm Self-love Dirty Crampt Safe Wanting Productive kitchens. Inept In Control Inspired At home Homily Domesticated Useless
95 ROYAL COLLEGE ESTATE
Substitution – paragram, cryptography Subtraction - abreviat’, syncope, elision, lipogram, belle absent As applied to Sentence - Letters Grammar - Text Through in/on Night Past Hear
See
The horrific story of someone who used to live there.
Dwelling is both process and artefact: it is the experience of living at a specific location and it is the physical expression of doing so. (Oliver, Dwellings, 15)
96 97 Three years ago someone broke into my flat. While sitting on the landing outside my door waiting for the police to arrive, my He was caught out by complete chance. It turned out ’e’d chopped up his next two shin girls, also His neighbours son, Alan, arrived to check on his ancient mother ( the prostitutes, and put them in bin bags. But neighbours commotion had worried her). Looking across the estate at midnight, because it was Christmas time, the bin men all said he proceeded to tell us of all the past crimes committed here. There weren’ as frequent back then so when they would a homeless guy comes along lookin’ hear power were the Turkish drug lords and Russian pimps who lived opposite; forearm for food, he got a rather nasty shock. He tools and a few brutal muggings; the crack whores who lurk in the stairways took bits of leg down to the hospital a saw at
and finally the tale of the Camden Ripper. While Alan talked I was where breast they phoned the police. They said all times quietly taking notes, which I have rediscovered and rewritten here. a blood trail led them to his flat but the rumour of day and was he had put his actual rubbish leg in with night the bodies and there was a letter torso with his address on. THE CAMDEN RIPPER, FROM ALAN’S MOUTH
It was abou’ eight year ago. They discover’ this girl’s body in one low risk to public A more colloquial language is given of the flats on the bo’’om floor. It’s the one that now ’as a solid to Allen through the use of the first Mr. Anthony Hardy me’al door, it’s all locked up, never been sold. They put that door three substitution rules Before he chopped them up on during the trial. but after he’d had violent sex with them shoulder Paragraph written as a lipogram of He was called Anthony Hardy, in ’n’ out of institutions for years, and strangled them to death, the ripper’s initials, A & H. It alters the words used, making the ever since tryin’ to drown the wife. Disturbed in ‘is noggin you see. he posed language used much more inventive But the police told everyone… due to neccesity. 1 2 3 “LOW RISK TO PUBLIC”
bodies The police wen’ in ’n’ found her, lyin’ on the bed, all covered in bruises n’ bite marks. The problem was they let him go, an’ photographed them they thought she ’ad died of an ‘art attack instead. But because The judge said he was “obsessed with pornography,”. they let him go, they thought she ’ad died of an ‘art attack instead. But because they let him go, “LOW RISK TO PUBLIC”, it meant he didn’t stop. It was like thigh he had got it wrong on her and now he wan’ed to do it right.
98 99 He hid the faces with a devil mask and the baseball cap he wore when shin they arrested him. They know this because he sent the film to a friend of ‘is who then sent the pho’os to the thigh police.
But they never shoulder found the heads or hands or feet.
forearm But they did find a note in his flat.
Sally White RIP
And a headless torso. They used breast her boob implant serial numbers to identify her.
He is now one of those men whose never leavin’ prison. He’ll die in there leg
And he chose to live ‘ere so he was close to prozzies at Kings Cross.
low risk to public
torso
100 101 KING’S CROSS
Displacement – anagram, palindrome, metathesis, spoonerism Addition – prosthesis, epenthesis, paragoge, stuttering. As applied to the Letter Text space
Movement Around - Through Perspective Vista - Adjacent Morning Present Taste Smell.
A man of scale – a walk back through the spaces previously encountered, departing from Kings Cross.
“Tell me one last thing,” said Harry. “Is this real? Or has this been happening inside my head?” Dumbledore beamed at him, and his voice sounded loud and strong in Harry’s ears even though the brightness was descending again, obscuring his figure. “Of course it’s happening inside your head, Harry, but why on earth should (Rowling, Deathly Hallows, 579) that mean that it is not real?”
“The text is less a narrative to be apprehended than an object to be entered, (Bloomer, Architecture and the Text, less narrated than constructed.” 15)
[S]pace is, after all, a form of representation. (Colomina, Sexuality, intro)
102 103 It has been noticed that the act of walking alone along a path does not in all honesty exist. T.S. Elliot wrote in What The Thunder Said;
Who is the third who walks all ways beside you? When I count, there are only you and I together But when I look ahead up the White Road There is always another one walking beside you Gliding wrapped in a brown mantle, I did I do not know whether a man or a woman
- But who is that on the other side of you? (Elliot, Selected Poems, 55)
The implication being that someone follows you; maps your progress; narrates your journey; is a part of your story and you might never know.
Harry Potter’s path and mine have crossed many times. Via the mellifluous voice of Stephen Fry, he lulls me to sleep at night and is my companion during the wee hours of the morning whilst drawing; he filled my early years of reading with pages of JK’s badus Latinae punums and sometimes I still find myself saying accio whilst gesturing at something I want… So earlier this afternoon (a sunny one in early October), at Kings Cross station, I gravitated towards a chair next to the imitation of Platorm 9 ¾.
To my right sat a young man in his mid twenties who, like me, had a notebook and biro, and was diligently making observations. His demeanour and sense of purpose put him in a different place to all others present. He was neither waiting for a train, or for someone on a train, or anyone at all. There was no sense of his killing time, just his writing,
104 105 … Platform 9 ¾. Now I’m sat heres however I find myself distracted by fake Hogwartians the line of Fogwartians waiting to be scarrfed in Gryffindor colours and Scarrfed – use of epenthesis and snapped pushing half a trolley into the wall. To my left, a granny with paragoge on the word scarf to a diamante bracelet gets up and waddles off with her daughter in law to create a new word meaning, to have a scarf put on you. the toilet. LUGGAGE LEFT UNATENDED She leaves her son awkwardly
alone with a handbag of glittery silver letters, I ♥ DUBAI. The queue for Kendall uses italics here to imply Platform 9 ¾’s is getting loooooonger. The blonde attendant keeps waveing he is quoting this man, when actually he is writing his own story. 16:43 At this point the young man gets up and walks off, and I herI wand,and off, jumpping walks intoand theup air gets and clickclickingman young herthe heels.point I wasthis onceAt sat16:43 here waiting prostitution. for Joesfor train.good so DESTROYED was place BYthis SECURITYwhy see SERVICEScan You He follow.
had beenstreet, to seeevery Helenaon andhotels Pete,the his parents.froing, and Thetoing lure ofpeople theof Harry Potteramount The Repeated use of the letters H and P shop wasroom drawringevery mecouncil, in, the obviously by them to to buy a presentgiven door for him,next by estates which the Iall turned into a bedroom including one for the kids they have. Camden mean me,Camden the perfecthave. cover.they kids Therethe isfor a bakeonone sandwichincluding behindbedroom a me. Stomachinto turned Addition of grr to rumbles add to Council, pimping through property since 1949. Picking one out of grrrumbles.of out one I could seePicking that1949. nobodysince wants theproperty Sssslytherinthrough ssssscarf.pimping The Council, its aural qualities cleanning would lady quietly pushes them her trolleyremoving around,and , the high-visprepriced man jacketa that glintingcrowd of the Sibilance of the added s’s hints at have been a cinch for that Anthony Hardy. He would have followed her 2 inchfollowed talonshave for nails.would He A fat chickHardy. takes Anthony photos that offor the contrastcinch a inbeen thehave the image of the snake assosciated the route we’re currently taking up St Pancras Way, with its antique stainlessantique steel its gutterwith andWay, the stonePancras paveingSt up whiletaking her friendscurrently commentwe’re on howroute the with Slytherin House in Harry Potter. shop, its windows filled with rocking horses. Past the church where creaaativewhere she church is andthe howPast they wishhorses. they hadrocking herwith “creatiiivity”,filled saidwindows inits that shop, way his thatand is somehow…Soane where Bullshit. Tree, THISHardy IS Athe SAFETYagainst ANNOUNCEMENTpiled are graves the wife are decomposing and Mary Wollstonecraft Godwin planned to Twoto parentsplanned rush offGodwin to the Harry Wollstonecraft Potter Mary shop and leaveing their decomposing two teenageare wife become Mary Shelly over the stone memory of her mother. Taking boys behind,Taking whomother. I likeher toof imagine memory are secretlystone the listeningover to Shelly it on theirMary Skullbecome a right onto Royal College Street and then a left into the ESTATE. Candy headphones.ESTATE. the into WILL left a KEVIN then LANGand PLEASEStreet UnderCollege theirRoyal I don’tonto giveright a a fuckmesh mug with shot I seeribcaged a yearninggarden a forpast magickaldoor, paraphernaliametal the past thathim shinesfollow I Epenthesis occurs at various points through the crack between headphonecaptivity. of andsong a ear. Twosinging littlebirds boyswith run acrossfilled and here, altering the pronunciation of the station with cowboy hats firmly atop their mops, dragging a red suitcase the word, sometimes so much so one feels one should read them out as big as they are. An unwilling white dog whose paws have no grip on a loud to see the difference. smooth stone floor, is skated across it by his mistress. They have repeated the same message over the tannoy three times at different speeds in case Kevin Lang does not understand it. HORNSEY AND ALEXANDRA PALACE. CHANGE AT ALEXANDRA PALACE FOR WELWYN GARDEN CITY. Earlier I was sat in a coffee shop dreaming of Brief Encounter, although knowing my luck I would end up more Victoria Wood than Celia Johnson.
106 107 … Platform 9 ¾. Now I’m sat heres however I find myself distracted by by distracted myself find I however heres sat I’m Now ¾. 9 Platform … the line of Fogwartians waiting to be scarrfed in Gryffindor colours and and colours Gryffindor in scarrfed be to waiting Fogwartians of line the snapped pushing half a trolley into the wall. To my left, a granny with with granny a left, my To wall. the into trolley a half pushing snapped a diamante bracelet gets up and waddles off with her daughter in law to to law in daughter her with off waddles and up gets bracelet diamante a the toilet. LUGGAGE LEFT UNATENDED She leaves her son awkwardly awkwardly son her leaves She UNATENDED LEFT LUGGAGE toilet. the Anagram of Camden Ripper for queue The DUBAI. ♥ I letters, silver glittery of handbag a with alone Platform 9 ¾’s is getting loooooonger. The blonde attendant keeps waveing waveing keeps attendant blonde The loooooonger. getting is ¾’s 9 Platform Anagram of birdcage 16:43sat Atonce thiswas I pointheels. theher young manclickclicking and gets air upthe andinto walks jumpping off, andwand, Iher follow. He You canSERVICES see whySECURITY thisBY place was DESTROYED so goodtrain. forJoes for prostitution. waiting here
Don Wall: Can you clarify what you The amountPotter Harry ofthe peopleof lure toingThe and froing,parents. his thePete, hotelsand onHelena everysee to street,been had said before about the two systems of allI the which estates by nexthim, for door givenpresent a buy to to them by obviously the in, council,me everydrawring roomwas shop We turn stairwards and along the landings, architectural experience? the whiff of four different curries pumping turned intoStomach me. a bedroombehind includingsandwich onebakeon a foris theThere kids theycover. have.perfect the Camdenme, mean the in clothes his removes He John Hejduk: You can be in a volumetric out of windows whilst the steam from boilers situation which is “encompassing.” Council, The pimpingssssscarf. throughSssslytherin propertythe wants sincenobody 1949.that Pickingsee could I one out ofgrrrumbles. there sits and sun afternoon Architecture is the only art where make the roof sweat drip drip even in the the of crowdglinting that ajacket man prepricedhigh-vis the , andaround, removingtrolley her them pushes quietly lady would cleanning herbs of line little A naked. you can have that experience, which warm afternoon sun. Bikes and hydrangeas is very curious. Or else, you can be a havethe beenin a cinchcontrast the forof that photos Anthony takes Hardy.chick fat A He wouldnails. for havetalons followedinch 2 her to height right the at just set distance away, a block away from a the routehow on we’recomment currentlyfriends her takingwhile up Stpaveing Pancrasstone the Way,and withgutter its steel antiquestainless line the sides in a colourful processional as house on a hill somewhere, and you genitalia his of view the obscure we climb higher and higher till the landing can look at that distant thing as an shop, that itsin windowssaid filled“creatiiivity”, withher rockinghad they horses.wish they Pasthow theand is church she wherecreaaative opposite. windows the from object, whatever your perspective is. sits in the leafy tops. You approach it, you move toward the graves are piledANNOUNCEMENT againstSAFETY theA IS HardyTHIS Tree, Bullshit. where Soanesomehow… is andthat his way perfectly see can he Though it, the object is upon you. There is a As he opens his door I creep past Two parents rush off to the Harry Potter shop leaveing their two teenage wife areteenage two decomposing their leaveing and shop Mary Potter Wollstonecraft Harry the to Godwinoff rush plannedparents toTwo one. every and each into “[a]t the door there is someone whom moment—and I am talking not only him and am inside. The notebook goes down we know and yet who is disquieting. about the physical but also the mental becomeSkull Marytheir on it Shelly to overlistening the stonesecretly are memory imagine ofto herlike I mother.who Takingbehind, boys . . . At the door there is someone with moment—when you cross the threshold a rightgive ontodon’t I Royaltheir CollegeUnder StreetPLEASE andLANG then KEVIN a left WILL into the ESTATE.headphones. Candy on his desk and he sits on the little balcony. whom,despite the signs, we have a and you are no longer outside the contradictory relation” (Rey, Nihilism object. You are in it. I followshines himthat past the metalparaphernalia door,magickal pastfor a gardenyearning a ribcagedsee I shot with mug meshfuck a and Autobiography. 30)
John Hejduk: While you can mentally and filledacross run withboys birdslittle singingTwo ear. a songand of captivity.headphone between crack the through “go into” a painting—your mind gets suitcase red a dragging mops, their atop firmly hats cowboy with station the “caught” in it and you mentally proceed through—you cannot physically go into a on grip no have paws whose dog white unwilling An are. they as big as it. Sculpture is similar, it’s external to the repeated have They mistress. his by it across skated is floor, stone smooth you; very seldom can you go in it […] Architecture has the double aspect Kevin case in speeds different at times three tannoy the over message same of making one an observer or voyeur externally, and then completely PALACE. ALEXANDRA AND HORNSEY it. understand not does Lang “ingesting” one internally. One CITY. GARDEN WELWYN FOR PALACE ALEXANDRA AT CHANGE becomes an element of the internal system of the organism. although Encounter, Brief of dreaming shop coffee a in sat was I Earlier knowing my luck I would end up more Victoria Wood than Celia Johnson. Celia than Wood Victoria more up end would I luck my knowing (John Hejduk, Mask of Medusa, 90)
108 109 stairs. We turn stairwards and along the landings, landings, the along and stairwards turn We the the whiff of four different curries pumping pumping curries different four of whiff the climbs He removes his clothes in the out of windows whilst the steam from boilers boilers from steam the whilst windows of out Room My Round he Journey afternoon sun and sits there make the roof sweat drip drip even in the the in even drip drip sweat roof the make pocket the out as hangs naked. A little line of herbs warm afternoon sun. Bikes and hydrangeas hydrangeas and Bikes sun. afternoon warm on coat cleantravelling his of set just at the right height to Paragogic ‘s’ added to certain line the sides in a colourful processional as as processional colourful a in sides the line bedroom feetshis of door the words. This makes them sound obscure the view of his genitalia bare more creature-ish, in reference to we climb higher and higher till the landing landing the till higher and higher climb we it. left have must he where the A Bao A Tu. from the windows opposite. his sits in the leafy tops. tops. leafy the in sits out it pluck thoughtfully I Though he can see perfectly of As he opens his door I creep past past creep I door his opens he As desk. his to it return and into each and every one. souls him and am inside. The notebook goes down down goes notebook The inside. am and him the on his desk and he sits on the little balcony. little the on sits he and desk his on licks I
110 111 stairs. the climbs Journeyhe Round My Room hangs as out the pocket There it now of his travellingclean coat on enter We sits amongst the the door of hisfeets bedroom and Bed into piles of books, where he must havebare left it. delivers Matilda Paragoge of ‘st’ to the end of atop a stack of ‘among’ give the sentence syntagm I thoughtfully pluck it his out book a us unpacked boxes. sibilance. and return it to his desk.of souls the licks I
112 113 There it now now it There We enter But that’s sits amongst the the amongst sits A phrase often used in fiction, most into Bed and another attributed to the Never Ending piles of books, books, of piles Matilda delivers story for Story. atop a stack of of stack a atop us a book another time. unpacked boxes. unpacked This final chapter has served as a rewind back through all other chapters, giving each a concluding moment relative to their scale.
[A]ll these forms are, in some sense, spatial constructs which permeate experience as well as the analysis of experience and that the particular nature of each can best be defined in the context of a theory which recognizes what they have in common. (Mitchell, Spatial Form In Literature, 540)
Each is textual, each has its own definable space and yet they flow from one to the other as well as sitting inside one another like intertextual Russian dolls with the smallest sentence but the most provocative at its heart.
114 115 AFTERWORD
HECTOR: The best moments in reading are when you come across something, a thought, a feeling, a way of looking at things that you’d thought special, particular to you. And here it is, set down by someone else, a person you’ve never met, maybe even someone long dead. And it’s as if a A final note from this reader.
hand has come out and taken yours. (Alan Bennet - The history boys) I keep looking at the story- world around me, I move from an inwardness and the sense of the word at my toe-tips, to step outward to observe the meaning of what they are in my memory and the associations between his words and mine and then beyond into the real world and I see the words again, reflected back at me in the room I sit in, in the world outside my window.
116 117 6 TEMPORARY EPILOGUE
And so dear reader, we find ourselves, you and I, at an end. Not THE END you understand, for this was if you remember, but the first chapter on a much longer journey through written space and the story world. However, the written descent through all nine of the texts in KINGS CROSS, draws our time together to conclusion and establishes a perfect moment for reflection on the experience.
Throughout my writing of this story I was trying to understand a connection, maybe in the hope of one day defining it, between the world of architecture, and the world that is written.
“No one, wise Kublai, knows better than you that the city must never be confused with the words that describe it. And yet between the one and the other there is a connection.”
It was THIS connection. In those few words that Calvino penned, a seed was planted. City || Words Space || Writing Architecture || Text
48 Epilogue n. 1. a. A short poem or speech spoken directly to the audience following the conclusion of a play. b. The performer who delivers such a short poem or speech. 2. A short addition or concluding section at the end of a literary work, often dealing with the future of its characters. Also called afterword. - http://www.thefreedictionary.com/epilogue (accessed September 24th) 49 Italo Calvino, Invisible Cities, (London, Vintage Classics) 1997. p.61
118 119 Architexture
On our journey together through the reading and writing of this story I hope I have been able to build you a world of the flat in which I live; that you have been inside it and looked out of it; walked its stairs; slept in my bed or stripped naked and sun bathed on my Wity Cords balcony.
From the beginning of this essay I was not aiming towards “It is […] a three dimensional map of “systems” of ideas, documents, discovering a formal conclusion about this connection. If I had, I and configuring diagrams represented as black marks upon a page. It is might have chosen to look more directly at existing examples of not exactly a writing as “writing” is conventionally constituted, nor is it spatial writing (many of which are included in the STUDY). Instead exactly a “drawing” as such. It oscillates between writing and drawing, I felt it more intriguing to explore these constructions through operating in the spaces between. […] that “space between” must be explored, [deconstruction is] understood as an affirmative appropriation of building them myself, with you, dear reader, as an active participant or built within, in order to construe the relations between the two. […] a structures that identifies structural in their architecture through your interaction with the text and all flaws, cracks in the construction paratheoretical construction of architecture and text.” 8 that have been systematically its constraints. As a result, many of the conclusions are up to you. disguised, not in order to collapse those structures but, on the contrary, to demonstrate the extent This text required my own weaving of many, many cords. The warp to which the structures depend on Knowing this fact was a reason for choosing to write fictions (or of the essay taking the form of its rules leaving the weft free to both these flaws and the way in which they are disguised” at least bastardised truths). When picking up a piece of fiction our “think outside the box”, or as Christian Bök more eloquently 9 terms (Wigley, “Domestication of the brain is in a certain state of acceptance. It is a tabula rasa primed House”, 207) it: to explore the rule is to be emancipated from it by becoming the master for exploration, ready to face the unexpected. It is able to follow the of its potential for surprise. 10 many threads (or cords), and over story-time create an intertextual weaving of them together into an architexture. Why do we read if I wrote my way through the warp via grammar, text and image; not to fall into a world that we can build around us? addition, multiplication, and algorithm and the many other
50 Jennifer Bloomer, Architecture and the Text: the (S)crypts of Joyce and Piranesi (Yale: Yale University Press) 1995, p.20 51 For there is a great difference between being succinct, and being eloquent. 52 Christian Bök, ’Pataphysics: The Poetics of an Imaginary Science, (United States of America, Northwestern University Press) 2002, p.71
120 121 constraints. These rules I created to navigate the construction of this Space [W]rites text opened up doors to words via whole sentences that I would have never otherwise written. Any moment I found myself hesitating or Every good story is a construction, be it as complex and constrained floundering, returning to the constraints pushed my shuttle back as the ones explored here, or as simple as Paddington Bear. They into motion. Leiris talks about this interaction (see footnote 6) of are all worlds that you enter and engage with. Good prose, well- the active antagonism of two beings, author and rules, and their constructed prose, will serve to shed light on reality. Through the emergence as something wounded but more beautiful and perfect fantastical deconstructing, reconstructing, mirroring, mimicking, for having been so marked. exaggerating, flipping upside down of, altering the perspective of, and general questioning of reality, these marks on paper, these Around the main weave sits the border. Whilst each story could have archimots, build walls filled with windows from which to look back been read as is, I invited another reader along the journey in the on our own reality, reframing the space in which we live. marginalia allowing my own experience of the ontological flickering between reality and text, as the writer writing about the writer’s Having performed the writes of passage as it were to build this essay, writing. story-world and all; having begun to explore the connection between words and worlds, have I learned anything that can be projected into the realm of what others might term, real architecture? I think so, but as an Epilogue, even a temporary one, serves not necessarily to conclude but indicate certain happenings in the future of the narratives characters, I think it more pertinent to consider a second chapter where I, having begun to explore writing in an architectural manner, should next investigate architecture and building something in a writerly manner…
But that’s another story for another time.
122 123 Appendices:
124 125 Glossary of terms Lipogram – the omission of chosen letters Matthew’s Algorithm – see the STUDY’s theory section Abbreviation – the shortening of a word Metathesis – the rearranging of letters or sounds between or in Accumulation - the collecting of letters/words/sentences etc into words constructions Metonymy – when something is called not by its true name but a Alliteration – the reoccurrence of the same letter of phoneme in a word associated with it sentence N + 7 - where one uses the 7th next noun (or other word type) in Anagram – the rearrangement of letters to form new words place of the original Antonymic Translation – the conversion of a word to its opposite Palindrome – where a word or sentence reads the same backwards Aphaeresis – the loss of a letter or phoneme from the beginning of as forwards a word Pataphor – see the marginalia at the beginning of BED Belle Absent – A passage of text where certain letters are noted by Paragoge – the addition of a sound at the end of a word their absence Paragram – a pun made by changing letters around Brachylogia – the concision of speech or writing to give greater Phoneme – a unit of sound in a word that is distinct effect. Pleonasm – the use of more words than neccessary Chronogram – a sentence whose arrangement of letters that also Portmanteau Word – the combining of other words to create new refer to numerals can be translated as a time or date ones Coupeur à la ligne – the subtraction of lines from a body of text. Prosthesis – the addition of a letter or sound at the beginning of a Echolalia – the repetition of sounds or words word Elision - speech that lacks certain sounds Rrose Sèlavy – The invention of words that sound like real ones Ellipsis – the removal or omission of a word. (based on the name Marcel Duchamp invented for his female alter Encasement – being surrounded by something. ego) Epenthesis – the addition of a sound or letter to the middle of a Spoonerism – a play on words by the switching of letters e.g. Multi word chlorey star park || Multi story car park Gemination – the elongation of consonant length Syncope – the removal of sounds from the middle of a word Holorhyme – where two whole lines rhyme Syntagm – a string of words that do not yet make a whole sentence Homoeuteleuton – the repetition of similar endings Tautogram – a set of sentences that all start the same way/with the Homophony – where words have similar sounds same word Interpolation – to add or insert new material Zeugma – where one word applies to two others in a sentence e.g. I Larding – to insert a whole new sentence have come to the end of this glossary and my patience.
126 127 Appendix 1: The study
128 129 a - Gallery of Theory
These pages are taken from: Motte Jr, Warren F, This is an explination of one of the methods used in Oulipo: A Primer of Potential Literature. USA: Dalkey the essay. It is a way of reaaraging everything from Archive Press; 1998. individual letters to whole paragraphs. 130 131 132 133 These pages are taken from : Mathews, Harry, & Brotchie Alastair, editors. Oulipo Compendium. These pages are an explination of the four figures of London: Atlas Press; 1998. Perec’s, Life A User’s Manual.
134 135 136 137 b - Gallery of The Oulipo
These pages are taken from : Queneau, Raymond. Queneau wrote the same story in 99 different styles Exercises in Style. Gaberbocchus Press Ltd; 1958. of writing, two of which are shown here.
138 139 This page is taken from : the story, The Exeter Text This page is taken from : Perec, George. A Void. by Perec sourced from: Perec, George. Three. New London: Vintage Classics; 2008. The whole book is Hampshire: Godine Publisher; 2007. a lipogram of the letter E. It is a story that only uses the vowel, E.
140 141 These pages are taken from : Bök, Christian. This book is a series of poems and paragraphs only Eunoia. First Edition. Edinburgh, London, New York: using specific vowels per piece. Canongate Books Ltd; 2008.
142 143 c - Gallery of Other writers
These pages are taken from : Warwicker, John. The Floating World : Ukiyo-e. Steidl MACK: Germany, 2009.
144 145 These pages are taken from : Danielewski, Mark Z. House of Leaves. 2nd ed. New York: Pantheon; 2000.
146 147 These pages are taken from : Foer, Jonathan S. This is : Danielewski, Mark Z. The Fifty Year editor. Tree of Codes. First Edition. London: Visual Sword. New York: Pantheon; 2012. Each cover is Editions Ltd; 2010. It is a story made by due cutting individually perforated with a pin by hand. sections of text out of another book.
148 149 These pages are taken from : Sterne L. The Life and This is a contemporary reworking of the original Opinions Of Tristram Shandy, Gentleman. 123rd ed. story, using visual interruptions and colour to London: Visual Editions Ltd; 2010. explore the text space.
150 151 These pages are taken from : Saporta, Mark. Every page in this book is loose allowing the reader Composition No. 1. London: Visual Editions Ltd; 2011 to broach it in any order. The back of each page contains a topography made of letters.
152 153 These pages are taken from : Tomasula, Steve. This book has been designed as a physical and VAS: An Opera In Flatland. Chicago: University Of illustrated version of the themes contained within Chicago, 2004 the text.
154 155 These pages are taken from : Thirlwell, Adam. The textin these pages is shaped and formed to KAPOW. London: Visual Editions Ltd, 2012 embed paralell stories one inside the other.
156 157 These pages are taken from : Foer, Jonathan S. These pages are taken from : Foer, Jonathan S. Extremely Loud and Incredibly Close. London: Penguin; Everything is Illuminated. Australia: Penguin Group; 2006. 2008.
158 159 These pages are taken from : Johnson, BS. The This novel has a starting chapter and an end, but all Unfortunates. London: Picador; 1999. the middle chapters are free to be arranged as the reader likes.
160 161 Appendix 2: utility room
162 163 Appendices:
Glossary of Terms
Study: A - Gallery of theory a - 9 dot puzzle solutions B - Gallery of the Oulipo C - Gallery of other writers D - Gallery of the flat 1 2 3 1 2 3 Utility Room: A - 9 dot puzzle (solutions) B - Unused text
C - Unused quotes 4 5 6 4 5 6 D - Potential titles
Bibliography - a visual record 7 8 9 7 8 9
1 2 3 1 2 3
4 5 6 4 5 6
7 8 9 7 8 9
164 165 b - un-used text
A short story wriiten as an initial experiment into the world of spatial writing.
We walked to the car to leave the smell of animal shit and clean ironing for a few moribund hours. The smeared concrete below our feet, her black shoes shuffled one in front of the other. WOBBLE. She had her arm through mine, it was a little dumpy. Still, she is perfect with age. Aged 75 He walks his she has a silk scarf from M & S knotted at her neck, grandmother across the her grey suit is soft yet uncrumpled, and her hair is farmyard to the first car firm and unrinsed, not like the biddies of other times behind the hearse and and places. They opened the door for her. She held helps her to climb in. my hand in one of hers and with the same fluttering grip she held the rubberised edge of the hole into the car. The car itself, black, so she hesitates in this || || knowing that sitting down
- A s A - VALISE - A s is one step closertohim but at the same time will only serve to push him one step further away in this unwavering covalence brought on by a lifetime.
m m
a a ll ll
p p
iece iece iece
of of hand l hand hand l
s ne uggage uggage a w it w , it seemed to happen in the w wro ho n e g o m rd o s er
t . W
. . e
y h
d e n ou n n n a She slips on the soft leather under her as we inch forward, I s r mimicking the car in front. It is so slow. The first one t a h e i hundred meters up the driveway n y
k
5 and through the gate. b
1
Her face is white from the unhurriedness of it all. She a
r
c o
f sits there, hands in lap, the right k
l ,
delicately folded over the left with a glint through i o t
o the wrinkled cracks whilst the air conditioning dries our throats. s
h e
c e
s m
o e
t d We followed that route we knew so well until those last few
e
t t
turns. Past Allied Carpets and Homebase, the slaughterhouse a o
u
s
o street away as the car slowed. Granite gate posts and a drive of
t
r
a
y
suburban flower beds paved a petalled way to the chapel past r
t
m
the car park full of everyone. The car came to a stop while his a
s t
a
moved on around the back. t
h
w
e
k
e They
o
n
o
d travel t
b
e u
through the country
t
a
w
t
t
h
e lanes, recognisable to e
t
s
a
u
m
both but mostly him,
o e
r
t
i
m
e
until the last few turns
e
h
w
T o
r
k towards the chapel and
t i r e l e s s l y crematorium.
166 167 It should have been huge but it wasn’t, more like a valise. He had shrunk. Maybe it had been after he shaved his moustache off by mistake that he looked smaller… Now though you knew it wasn’t. On a conveyor belt disguised by velvet and G-dnk went the door handle. The crunch of gravel underfoot braided trim was the casket. Above, walking around to her side. G-dnk again. Her hand comes out to the greet mine as her foot finds purchase on the ground. We stand in curtains the doorway to the chapel, framed by varnished timber and stone, waiting her left arm through my right and holding hands. Her right hand to descend. comes over to meet the two already at prayer and In the wall, at the caskets head, was a matt grey mechanized then pair of what looked like miniaturised lift doors, the only real reminder of the Jeans procedure waiting to happen once the curtains body gives closed. like one of those toys whose button you push and the elastic no longer supports and all of a sudden you The light in the aisle shifts and flickers from the people coming in and taking find each joint, once so upright has folded. The button is released their seats. The tops of the chairs cackled together as people sat. The soft strokes of hgshgshgshhhh as people ran their fingers over the card programs and I ran slowly, then stone step gave way to dark red carpet, on the carpet mine over the folded papers in mine before returning my hand to the button. sat a congregation of wooden chairs, and the chairs respectfully made an aisle guiding us to our seats in the front row.
They get out of the car and head into the chapel where she has a funny turn on at the entrance. They They sit in front go through the of the coffin, side door and down by side. People are the aisle. coming in behind them but they don’t look. They don’t want to cry.
168 169 OTHER TEXT
“I AM AN ARCHITEXT” said the book. “No, you are architexture.
and 30 steps past the stench of I, the author, am the architext.” “BUT YOU ARE NOT A TEXT” three lilies into the pulpit. The dark of the wood arose out of the carpet “what am I then if not a sequence of letters that can be told, I could between and came out of the magnolia be AGTTTTTCTCGGGACCTTGCGAA… etc, or I could be what something walls simultaneously. There was something on the wall overhead happened to me last night. Both science and language can confirm up that bowed over you, pushing at your back to steer you lecternwards. I removed Climbed that I am indeed textual. Indeed, it is from my letters that I wrote the three sheets of paper from their silk pocket and unfolded them with my finger tips across the horizontal you. You were built from my blocks. You are the space in which my grain of the wall. I saw the switched off microphone and then past it. I saw no empty seats. readers walk; you are a space that I made. I filled you full of walls “Death is but cr but is “Death “Death is but cr and staircases, door ways and windows, so that they might be more aware of the world. They see that world and see their own looking
ossing the world, as friends do the seas; they l they seas; the do friends as world, the ossing ossing the world, as friends do the seas; they l back or bumping alongside or on top. I put them in you, and you make them see and feel and sense space.”
* * *
He writes and I read . . . He writes and I read: He writes and I read . . . He writes and I read: ‘He writes and ‘I read . . .’’
i i v v He writes that I read that he writes . . . e e
i i n n
o o He ‘writes and I read-write
n n
e e
a a
n n
o o
t t
h h
e e
r
r This is one of many opportunities that I might have to bring up
s s
t t
i i
l l
l l
. .
” ”
another sub narrative to this meandering plot. That of ‘Pataphysics – –
W W
i i
l l
l l
i i
a a
m
m and the Oulipo. I chose to do so now, not merely that it is early in
P P
e e n n n
n the easy but because of the two moments of alteration to the word
He climbed the pulpit and took out the eulogy, laid it out in front of him and began to speak. “write”:
Homophone – rite
The ‘pataphysical apostrophe – ‘writes
170 171 Bilbliography & Image Reference
172 173 Fuss, Diana. The Sense of an Interior. New York: Routledge, 2004.
Hedjuk, John. Mask Of Medusa: Works 1947-1983. New York: Rizzoli, 1985. In the outlining of this tabletop library I have deemed it relevant to note down several of these books [constructions] two or three Klotz, Heinrich. Paper Architecture. NewYork: Rizzoli, 1990. times in different categories. I feel it highly pertinent to make sure Oliver, Paul. Dwellings. London: Phaidon, 2007. you know where to plunge when you want to find something, so do, Summerson, John. The Classical Language of Architecture. London: please, plʌnj away. Thames & Hudson, 1980
Vidler, Anthony. The Architectural Uncanny: Essays in the Modern Unhomely. Massachusettes & London: MIT Press; 1994. Arcitecture and Text Walkowitz, Judith. City of Dreadful Delight: Narratives of Sexual Bloomer, Jennifer. Architecture and the Text: The (S)crypts of Joyce and Danger in Late Victorian London. New edition. Chicago: University of Piranesi. New edition. USA: Yale University Press; 1995. Chicago Press; 1992.
Coates, Nigel. Narrative Architecture: Architectural Design Primers Wigley, Mark. “The Domestication of the House: Deconstruction series. USA: John Wiley & Sons; 2012. afterArchitecture.” Deconstruction and the Visual Arts: Art, Media, Architecture . Ed. Peter Brunette and David Wells. New York: Cam- Kahn, Andrea (ed). Drawing, Building, Text: Essays in Architectural bridge University Press, 1994. 203–27 Theory. illustrated edition. NewYork: Princeton Architectural Press; 1996. Zumthor, Peter. Atmospheres. Basel: Birkhauser, 2012.
Psarra, Sophie. Architecture and Narrative: The Formation of Space and Cultural Meaning. New York: Routledge; 2009. Oulipo
Rendell, Jane. Site-Writing. London: I.B.Tauris &Co Ltd Becker, Daniel L. Many Subtle Channels. London & Massachusettes: Harvard University Press; 2012. Stoner, Jill. Toward a Minor Architecture. Massachusettes & London: MIT Press; 2012. Bök, Christian. ‘Pataphysics, the Poetics of Imaginary Science. Illinois: Northwestern University Press, 2002.
Architecture & Space Hugill, Andrew. ’Pataphysics: A Useless Guide. Massachusettes: MIT Press; 2012. Chandler, Marilyn. Dwelling in the Text: Houses in American Fiction. Berkeley: University of California Press, 1991 Mathews, Harry, & Brotchie Alastair, editors. Oulipo Compendium. London: Atlas Press; 1998. Colomina, Beatriz. Sexuality In Space. New York: Princeton Achitectural Press, 1992 Motte Jr, Warren F, Oulipo: A Primer of Potential Literature. USA: Dalkey Archive Press; 1998.
174 175 Shattuck R. The Banquet Years: The Origins of the Avant Garde in France, Manguel, Alberto. The Dictionary of Imaginary Places: The Newly 1885 to World War 1. London: Faber and Faber Ltd; 1958. Updated and Expanded Classic. San Diego, NewYork, London: Harcourt; 2003. Perec Manguel, Alberto. A History of Reading. London: Flamingo; 1997. Perec, George. A Void. London: Vintage Classics; 2008. Manguel, Alberto. The Library at Night. New Haven & London: Yale Perec, George. Life: A User’s Manual. London: Vintage Classics; 1996. University Press; 2009.
Perec, George. Species of Spaces and Other Pieces. London: Penguin Manguel, Alberto. A Reader on Reading. New Haven & London: Yale Classics; 2008. University Press; 2010.
Perec, George. Three. New Hampshire: Godine Publisher; 2007. Manguel, Alberto. The Traveler, the Tower andthe Worm. Philadelphia: University of Pennsylvania Press; 2013.
Page Space Wicker, Brian. The Story-shaped World: Fiction and Metaphysics; Some Variations on a Theme. London:The Athlone Press; 1975. Bohn, Willard. The Aesthetics of Visual Poetry, 1914-1928. New edition. Cambridge: Cambridge University Press; 1986. Words Higgins, Dick. Pattern Poetry: Guide to an Unknown Literature. USA: State University of New York Press; 1987. Deleuze and Guattari. Kaf ka: Toward a Minor Literature. USA: University Of Minnesota Press; 1986. Houedard, Dom S. Notes from the Cosmic Typewriter: The Life and Work of Dom Sylvester Houedard. Simpson N, editor. Occasional Papers; Lewis, C.S. Studies in Words. Massachusettes: Cambridge University 2012. Press; 1960.
Kostelanetz, Richard. Minimal Fictions, Santa Maria, Asylum Arts, McHale, Brian. Post-modernist Fiction. London: Routledge. 1987. 1994. Orwell, George. Penguin Great Ideas : Why I Write. London, Penguin; Phillips, Tom. A Humument: A Treated Victorian Novel. 5th ed. London: 2004. Thames & Hudson; 2012. Nabokov, Vladimir. Lectures on Literature. Bowers F, editor. New Warwicker, John. The Floating World : Ukiyo-e. Steidl MACK: york, Mariner Books; 1980. Germany, 2009. Queneau, Raymond. Exercises in Style. Gaberbocchus Press Ltd; 1958. Fiction – Theory Saussure F de. Course in General Linguistics. New edition. London: Kristeva, Julia. Desire In Language. Oxford: Basil Blackwell, 1980. Gerald Duckworth & Co Ltd; 1995.
Stern, Jerome. Making Shapely Fiction. New York & London: W. W. Norton & Co. 2001.
176 177 Truss, Lynne. Eats, Shoots & Leaves, London, Profile Books, 2003.
White H. Tropics of Discourse: Essays in Cultural Criticism. Reprint. Derrida, Jaques. Of Grammatology. Baltimore and London: The John The Johns Hopkins University Press; 1985. Hopkins University Press, 1997.
Derrida, Jaques. Paper Machine. California: Stanford University Press, Theory and Philosophy 1982.
Bachelard, Gaston. The Poetics Of Space. Boston: Beacon Press, 1994 Derrida, Jaques. Positions. Chicago: University of Chicago Press, 2005. Barthes, Roland. Camera Lucida: Reflections on Photography. New Ed. London: Vintage Classics; 1993. Derrida, Jaques. Writing and Difference. London & New York: Routledge; 2005. Barthes, Roland. Image Music Text. New Ed. London: Fontana Press; 1993. Dunker, Christian. The Constitution of the Psychoanalytic Clinic. London: Karnac, 2011. Barthes, Roland. Mythologies. London: Vintage Classics; 2009. Dyer, Geoff. ZONA. New York: Pantheon Books. 2012 Barthes, Roland. The Pleasure of the Text. New York: Hill and Wang; 1998. Foucault, Michel. The Order Of Things. London & New York: Routledge, 2002. Barthes, Roland. S/Z. Oxford: Blackwell, 2002. Frye, Northrop. Anatomy of Criticism. Princeton & Oxford: Princeton Barthes, Roland. Writing Degree Zero & Elememts of Semiology. University Press, 2000. London: Vintage Classics; 2010. Hume David. An Enquiry concerning Human Understanding. New Ed. Baudrillard, Jean. Simulacra and Simulation. USA: The University of Millican P, editor. OUP Oxford; 2008. Michigan Press; 1994. Klee, Paul. Pedagogical Sketchbook. New York: Frederick A Praeger. Benjamin, Walter. The Arcade Project. USA: Harvard Uniersity Press; 1953. 1999. Lefebvre, Henri. The Production Of Space. Oxford: Blackwell, 1991 Benjamin, Walter. The Origin of German Tragic Drama. London: Verso Books; 1998. Leiris, Michel. Francis Bacon: Full Face and In Profile. New York: Rizzoli, 1983. Benjamin, Walter. Illuminations. London: Pimlico, 1999 Nietzsche, Freidrich. Twilight of the Idols and The Anti-Christ. New Ed. Derrida, Jaques. The Ear of the Other. New York: Schoken Books, London: Penguin Classics; 1990. 1985. Pomeroy, Wardell B. Boys and Sex. England: Penguin Books, 1976 Derrida, Jaques. Glas. Lincoln & London: University of Nebraska Press; 1990. Wittgenstein, Ludwig. Philosophical Investigations. UK: Wiley- Blackwell, 2009
178 179 Rey, Jean-Michel. “Nihilism and Autobiography”. Nietzsche and the Carroll, Lewis. Through The Looking-Glass And What Alice Found Rhetoric of Nihilism: Essays on Interpretation, Language and Politics. There. London, Macmillan / St Martin’s Press; 1973. edited by Tom Darby, Béla Egyed, Ben Jones. P.23-36. Canada: Carleton University Press Inc. 1989 Carroll, Lewis. Alice’s Adventures in Wonderland. London, Macmillan and Co.; 1906. Sartre Jean-Paul. Words. New Ed. London, Penguin Classics; 1967. Chandler, Raymond. The Big Sleep: An Philip Marlowe Mystery. Saussure, F de. Course In General Linguistics. London: Duckworth, London: Penguin; 2011. 1998. Colonna, Francesco. Hypnerotomachia Poliphili. London: Thames & Teskey, Gordon. Allegory and Violence. Ithaca & London: Cornell Hudson, 2005 University Press, 1996 Dahl, Roald. Matilda. London: Penguin Group, 2013. White, Hayden. Tropics of Discourse. London: The John Hopkins University Press. 1985 Dahl, Roald. The Great Automatic Grammatizator and other stories. London: Puffin Books. 1997.
Fiction Danielewski, Mark Z. The Fifty Year Sword. Reprint. New York: Pantheon; 2012. Abbot, Edwin A. Flatland, A Romance of Many Dimensions. Great Britain: Amazon.co.uk Ltd. 2012 Danielewski, Mark Z. House of Leaves. 2nd ed. New York: Pantheon; 2000. Bester, Alfred. The Stars My Destination. Great Britain: Gollancz; 2010. Dillon, Brian. Brian Dillon - I am Sitting in a Room. Minneapolis: Cabinet; 2012. Bök, Christian. Eunoia. First Edition. Edinburgh, London, New York: Canongate Books Ltd; 2008. Dostoevsky. Notes from Underground. London: Vintage Books; 1993.
Borges, Jorge L. Collected Fictions. Penguin Books; 1999. Drewe, Robert (ed). The Penguin Book Of The City, London, Penguin Books, 1998 Borges, Jorge L. The Book Of Imaginary Beings. London: Vintage, 2002 Dunsany, Lord. The King of Elfland’s Daughter. USA: Ballantine Books Brooke-Rose, Christine. The Christine Brooke-Rose Omnibus: Four Inc; 2000. Novels- Out, Such, Between, Thru. Manchester: Carcanet Press; 2006. Foer, Jonathan S. Everything is Illuminated. Australia: Penguin Group; Calvino, Italo. If On A Winter’s Night A Traveller. New Ed. London: 2008. Vintage Classics; 1992. Foer, Jonathan S. Extremely Loud and Incredibly Close. London: Calvino, Italo. Invisible Cities. New Ed. London: Vintage Classics; Penguin; 2006. 1997. Foer, Jonathan S. editor. Tree of Codes. First Edition. London: Visual Carle, Eric. The Very Hungry Caterpillar [Board Book]. London: Puffin Editions Ltd; 2010. Books; 1994.
180 181 Forsyth M. Mark Forsyth’s Gemel Edition: The Etymologicon and The McCarthy, Tom. Remainder. Richmond: Alma Books Ltd; 2011. Horologicon. London: Icon Books; 2012. McEwan, Ian. The Comfort Of Strangers. London: Vintage; 1997. Gaimen, Neil. Stardust. Great Britain: Review, 2005. Mieville, China. The City & The City. London: Pan Books; 2011. Goldman, William. The Princess Bride. USA: Ballantine Publishing Group; 1999. Mieville, China. Un Lun Dun. London: Pan Books, 200.
Gysin, Brion. The Last Museum. London & Boston: Faber and Mirbeau, Octave. Torture Garden. UK: Dedalus Ltd; 2010. Faber. 1986. Mirrlees, Hope. Lud-In-The-Mist. Great Britain: Gollancz; 2008. Harkaway, Nick. The Gone-Away World. London: Windmill Books; 2009. Norton, Mary. Bedknob and Broomstick. Middlesex: Puffin Books, 1981. Heller, Joseph. Catch-22. London: Vintage, 1994 Pamuk, Orhan. The Black Book. London: Faber and Faber Fiction; Jarry, Alfred. Exploits & Opinions of Dr. Faustroll. Boston: Exact 2011. Change; 1996. Pamuk, Orhan. Istanbul: Memories of a City. London: Faber and Jarry, Alfred. The Supermale. Reprint. Massachusettes:Exact Change; Faber; 2006. 1999. Peake, Mervyn. The Gormenghast Trilogy. London: Vintage Classics; Johnson, BS. House Mother Normal. USA: New Directions Publishing; 1999. 1971. Pullman, Philip. His Dark Materials III: The Amber Spyglass. London: Johnson, BS. The Unfortunates. London: Picador; 1999. Scholastic Children’s Books. 2000
Joyce, James. Finnegans Wake. London: Penguin Classics, 2010 Pynchon, Thomas. The Crying Of Lot 49. London: Vintage Classics; 2000. Juster, Norton. The Phantom Tolbooth. London: Lions, 1992. Pynchon, Thomas. V. Great Britain: New. Picador; 1975. Kaf ka, Franz. The Complete Novels Of Kaf ka. London: Minerva; 1994. Reeve, Philip. Mortal Engines Quartet: 4 books - Mortal Engines / Kaf ka, Franz. The Metamorphosis and other stories. USA: Dover, Thrift Predators Gold / Infernal Devices / A Darkling Plain. London: Scholastic Editions. 1996. Books; 2008.
Lim, CJ & Liu, Ed. Short Stories: London in Two-and-a-half Dimensions. Rowling, J.K. Harry Potter and the Deathly Hallows. London: London & New York, Routledge; 2011. Bloomsbury Publishing PLC. 2007.
Maistre, Xavier De. A Journey Round My Room. New York: Hurd and Rushdie, Salman. Haroun and the Sea of Stories. London: Puffin Hudson; 1871. Books, 1999
Maugham, W.S. The Razor’s Edge. London: Vintage Classics; 2000. Saporta, Mark. Composition No. 1. London: Visual Editions Ltd; 2011.
182 183 Self, Will. Grey Area. London: Bloomsbury Publishing Plc; 1994. Fairy tales Self, Will. Scale. London: Penguin Books, 1995. Aesop. Aesop’s Fables. New edition. Hertfordshire: Wordsworth Self, Will. Umbrella. London,Bloomsbury Publishing PLC; 2012. Editions Ltd; 1994.
Shakespeare, William. The Complete Works Of William Shakespeare, Andersen, Hans Christian. Complete Andersen’s Fairy Tales. London: London: Oxford University Press. 1910 Wordsworth; 2009.
Sterne L. The Life and Opinions Of Tristram Shandy, Gentleman. 123rd Bernheimer Kate. My Mother She Killed Me, My Father He Ate Me. ed. London: Visual Editions Ltd; 2010. Original. US: Penguin; 2011.
Thirlwell, Adam. KAPOW. London: Visual Editions Ltd, 2012 Brothers Grimm. Complete Grimm’s Fairy Tales. London: Wordsworth; 2009. Tomasula, Steve. VAS: An Opera In Flatland. Chicago: University Of Chicago, 2004 Fontaine, Jean de La. The Complete Fables of Jean De La Fontaine. University of Illinois Press; 2007. Vonnegut, Kurt. Breakfast Of Champions. London: Granada Publishing Ltd; 1978. Pullman, Philip. Grimm Tales: For Young and Old. London: Penguin Classics; 2012. Vonnegut, Kurt. Slaughterhouse 5, or The Children’s Crusade - A Duty- dance with Death. London: Vintage Classics; 2000. Journals and Essays Wittig, Monique. Les Guerilleres. Boston: Beacon Press, 1985. Bloomer, Jennifer. “In The Musey Room.” Assemblage, No.5 (Feb, Woolf, Virginia. The Moment And Other Essays. New York: Harcourt, 1988), p.58-65 Brace, and Company, 1948. Harris, Paul A. “The Invention of Forms: Perec’s ‘Life A User’s Zamyatin, Yevgeny. We. London: Vintage Classics; 2007. Manual’ and a Virtual Sense of the Real.” SubStance, Vol. 23, No.2, Issue 74: Special Issue: Between Space and Literature (1994) p.56-85.
Kunze, Donald. “Architecture as Reading: Virtuality, Secrecy, Poetry Monstrosity.” Journal of Architectural Education, Vol. 41, No. 4 (summer, 1988), p.28-37 Orlovsky, Peter, Clean Asshole Poems & Vegetable Songs, San Francisco, City Lights Books, 1978. Mitchell, W.J.T. “Spatial Form In Literature: Toward a General Theory.” Critical Enquiry, Vol.6, No.3 (Spring, 1980), p.539-567. Eliot, T.S. Selected Poems. Faber & Faber, 2009.
184 185 Online References Transcripts of Television and Audio Books
Conversation: Alberto Manguel | Art Beat: PBS NewsHour. Bennett, Alan. The Histor Boys. Audio CD, BBC Audiobooks Ltd. Available from: http://www.pbs.org/newshour/art/blog/2010/02/ 2006 conversation-alberto-manguel.html (accessed 2013 September 5) Moffat, Steven. Doctor Who: “Forest of the Dead”. Season 4, Ep. 9. 31 May 2008. Disraeli I, Disraeli B. Curiosities of literature. - Vol i & II. Paris : Baudry’s European Library; 1835. Available from: http://archive. Moffat, Steven & Nation, Terry. Doctor Who: “The Big Bang”. Season org/details/disraelicuriosit01disr (accessed 2013 Jun 9). 5, Ep. 13. 26 June 2010
Foucault, Michel. “Of other spaces, Heterotopias”. Whitehouse, Toby. Doctor Who: “The God Complex”. Season 6, Ep. http://foucault.info/documents/heteroTopia/foucault. 11. 17 September 2011. heteroTopia.en.html (accessed 2013 August 8) Moffat, Steven & Nation, Terry. Doctor Who: “The Snowmen”. Poe, E A: Marginalia, Available from: http://books.eserver.org/ Season 7, Ep. 6. 25 December 2012 fiction/poe/marginalia.html/document_view (accessed 2013 Jun 9).
Poe, E A: The Man of the Crowd. Available from: http://books. eserver.org/fiction/poe/man_of_the_crowd.html/document_view [accessed 2013 Jun 9].
Sterne L, The Life and Opinions Of Tristram Shandy, Gentleman. FIRST EDITION, volume three, Available from: http://www.fulltable.com/ vts/t/ts/e/03/a.htm (accessed 2013 Jun 9) www.brainyquote.com (accessed at various dates) www. etymonline.com (accessed at various dates) www.merriam-webster.com (accessed at various dates) www.oxforddictionaries.com (accessed at various dates) www.pataphor.com (accessed at various dates) www.thefreedictionary.com (accessed at various dates) www.wikipedia.com (accessed at various dates)
Thank you for Reading
186 187