DOCSLIB.ORG

Chicken Hemogen Homolog Is Involved in the Chicken-Specific Sex

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Chicken Hemogen Homolog Is Involved in the Chicken-Specific Sex Chicken hemogen homolog is involved in the chicken-specific sex-determining mechanism Tomohiro Nakataa, Manabu Ishiguroa, Nana Adumaa, Hiroe Izumib, and Asato Kuroiwaa,b,1 aGraduate School of Life Science, and bLaboratory of Animal Cytogenetics, Department of Biological Sciences, Faculty of Science, Hokkaido University, Hokkaido 060-0810, Japan Edited by Patricia K. Donahoe, Massachusetts General Hospital, Boston, MA, and approved January 18, 2013 (received for review October 29, 2012) Using a comprehensive transcriptome analysis, a Z chromosome- of male chickens. We present evidence that cHEMGN acts as linked chicken homolog of hemogen (cHEMGN)wasidentified and a transcription factor in the nucleus of (pre)Sertoli cells after the showntobespecifically involved in testis differentiation in early sex-determination period and directly or indirectly triggers the ex- chicken embryos. Hemogen [Hemgn in mice, EDAG (erythroid pression of SOX9, suggesting this gene is specifically involved in differentiation-associated gene protein) in humans] was recently chicken sex determination. characterized as a hematopoietic tissue-specific gene encoding a transcription factor that regulates the proliferation and differen- Results and Discussion tiation of hematopoietic cells in mammals. In chicken, cHEMGN was Identification of Chicken Hemogen cDNA and Chromosome Localization. expressed not only in hematopoietic tissues but also in the early High coverage expression profiling (HiCEP) was used to conduct embryonic gonad of male chickens. The male-specific expression a comprehensive transcriptome analysis (10) comparing male was identified in the nucleus of (pre)Sertoli cells after the sex de- and female gonads at day 5.5–6.5 of incubation. A total of 33,962 termination period and before the expression of SOX9 (SRY-box 9). transcripts were identified. The 18 transcripts that were ex- The expression of cHEMGN was induced in ZW embryonic gonads pressed specifically in males or were more than fivefold higher that were masculinized by aromatase inhibitor treatment. ZW em- in males than females were sequenced, and cHEMGN was among bryos overexpressing cHEMGN, generated by infection with retrovi- these transcripts. The full-length coding sequence of cHEMGN rus carrying cHEMGN, showed masculinized gonads. These findings was obtained by RT-PCR and 5′ and 3′ RACE. The full-length suggest that cHEMGN is a transcription factor specifically involved coding sequence was 543 bp, and the predicted amino acid sequence in chicken sex determination. was 180 aa. A bipartite nuclear localization signal and a coiled-coil domain that are present in mouse HEMGN were also conserved bird | gonadal differentiation in cHEMGN (7) (Fig. S1). The amino acid sequence identities be- tween human and chicken, or mouse and chicken, were both 26%. n birds, as in mammals, sex is genetically determined, but males We performed FISH using cHEMGN cDNA clone as probe. fl Iare the homogametic sex (ZZ), and females are heterogametic The uorescence signals were detected in Zq21 in chicken (ZW). The molecular mechanisms determining sex in birds has chromosomes (Fig. S2). This location corresponded with the been a long-standing mystery. In mammals, the sex-determination information of cHEMGN in a chicken genome database (Ensem- gene SRY (sex determining region Y) acts as a transcription factor ble, www.ensembl.org/index.html, last accessed October 20, 2012). to activate SOX9 (SRY-box 9) expression directly by binding to the cHEMGN SOX9 enhancer in pre-Sertoli cells in the undifferentiated gonads Expression Pattern of in Early Embryonic Gonads. Northern cHEMGN of XY embryos (1). SOX9 functions in Sertoli cell differentiation in blot analysis demonstrated that mRNA was more highly expressed in male gonads than female gonads at day 7.5 mammals and other vertebrates (2). A strong candidate for male (Fig. 1A). Quantitative RT-PCR (qRT-PCR) analysis revealed sex determination in chicken is doublesex and mab-3 (Protein that cHEMGN was expressed in the male gonads from day 5.5 MAB-3) related transcription factor 1 (DMRT1), which is on the Z onward, and expression increased dramatically to a peak at day chromosome (3). DMRT1 has been suggested to activate SOX9 8.5 and was then lost before hatching (Fig. 1B). By contrast, fe- indirectly, because there is a time lag between the expression of male gonads exhibited only very low expression throughout em- DMRT1 and SOX9,whicharefirst expressed on day 4.5 and day 6.5 bryogenesis. The expression in male gonads at day 8.5 was more of incubation, respectively (4–6). Therefore, other factors that are fi than 10-fold higher than in female gonads. The cHEMGN pro- likely to be chicken speci c must be in the molecular cascade be- tein was detected in male gonads from day 6.5 onward (Fig. S3). tween DMRT1 and SOX9. Anti-müllerian hormone (AMH) expression in Sertoli cells is one Herein we show that chicken homolog of hemogen (cHEMGN), of the earliest markers of sex differentiation in chicken embryo also in the Z chromosome linkage group, is a transcription factor fi gonads (11). AMH expression was up-regulated between days 5.5 involved in this chicken-speci c molecular cascade. In mice, hem- and 6.5, similarly to cHEMGN expression (Fig. 1C). SOX9 ex- ogen [Hemgn;alsoknownasEDAG (erythroid differentiation- pression was present from day 6.5 and was up-regulated by day associated gene protein) in humans] is a recently characterized fi 8.5 (Fig. 1C). These results are consistent with previous studies hematopoietic tissue-speci c gene encoding a nuclear protein (7). that reported that AMH was expressed in the male gonad before The expression of Hemgn is restricted to the blood islands of the significant SOX9 expression (5, 12). The RT-PCR analysis here yolk sac and the fetal liver during embryogenesis, as well as the revealed that cHEMGN was also expressed before SOX9. BIOLOGY adult spleen and bone marrow (BM) (7). EDAG shows similar expression patterns. EDAG expression is high in the BM cells in DEVELOPMENTAL acute myeloid leukemia, suggesting that EDAG may play a modu- Author contributions: A.K. designed research; T.N., M.I., N.A., and A.K. performed lator role in acute myeloid leukemia (8). Overexpression of Hemgn research; H.I. contributed new reagents/analytic tools; T.N., M.I., N.A., H.I., and A.K. in hematopoietic cells suppresses lymphopoiesis and enhances analyzed data; and T.N. and A.K. wrote the paper. myelopoiesis in transgenic mice, suggesting that Hemgn regulates The authors declare no conflict of interest. the proliferation and differentiation of hematopoietic cells (9). This article is a PNAS Direct Submission. However, the gene is not expressed in the gonads during embryo- 1To whom correspondence should be addressed. E-mail: [email protected]. genesis in mammals. In chicken, cHEMGN was expressed not only This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. in hematopoietic tissues but also in the early embryonic gonad 1073/pnas.1218714110/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1218714110 PNAS | February 26, 2013 | vol. 110 | no. 9 | 3417–3422 Downloaded by guest on September 28, 2021 Fig. 1. cHEMGN is highly expressed in early embryonic male chicken gonads. (A) Northern blot analysis of cHEMGN in embryonic tissues at day 7.5. cHEMGN mRNA was highly expressed in the male gonad. 18S rRNA was used as a loading control. (B) qRT-PCR of male and female gonads. In male embryos, cHEMGN expression was detected by day 5.5 (just after sex determination) and achieved a peak at day 8.5. The expression was gradually reduced and lost at hatching. Filled square, male; filled circle, female. Data are mean ± SEM; n ≥ 3. (C) RT-PCR of cHEMGN, AMH,andSOX9 in male gonads at day 5.5, 6.5, 7.5, and 8.5. cHEMGN expression was detected before SOX9 expression. GAPDH is the loading control. cHEMGN expression was detected in the gonads of male the SOX9 signal in the gonadal medulla (Fig. 2 G–J). By contrast, embryos using in situ hybridization of whole embryos (WISH) the cHEMGN signal did not colocalize with that of CVH (Fig. 2 K– (Fig. 2A) and in the gonadal medulla using frozen sections of N). The cHEMGN protein was observed in the nucleus of male embryos (Fig. 2 C and D). No signals were detected in the gonads gonadal cells by immunohistochemistry (IHC) (Fig. 2 O–R). These of female embryos (Fig. 2 B, E,andF). To identify the cells that results suggested that cHEMGN was a nuclear protein expressed in expressed cHEMGN, double-label in situ hybridization was con- Sertoli cells. ducted using SOX9 and chicken vasa homolog [CVH, also known as DDX4 (DEAD box polypeptide 4)] as markers for Sertoli cells and Expression Pattern of cHEMGN in Hematopoietic Tissues. The ex- germ cells (13), respectively. The cHEMGN signal colocalized with pression of cHEMGN in chicken hematopoietic tissues was Fig. 2. cHEMGN is expressed in the nucleus of Sertoli cells within the medulla of the male gonads. (A and B) WISH of male and female embryos at day 7.5. cHEMGN was expressed throughout the male gonads. The dashed lines indicate the gonads. (Scale bar, 300 μm.) (C–F) cHEMGN in situ hybridization in frozen sections of male and female gonads at day 7.5. cHEMGN expression was localized to the medulla of the male gonad. The negative control used a sense probe for hybridization. (Scale bar, 100 μm.) (G–N) Dual-labeled in situ hybridization of frozen sections of male and female gonads at day 8.5. cHEMGN expression colocalized with SOX9 expression in Sertoli cells. (Scale bars, 100 μm.) (O–Q) IHC of day-8.5 male gonads using a cHEMGN antibody. cHEMGN was expressed in the nucleus of Sertoli cells in the medulla of the male gonad.
Load more

Recommended publications
  • Genetic Variability in the Italian Heavy Draught Horse from Pedigree Data and Genomic Information
    Supplementary material for manuscript: Genetic variability in the Italian Heavy Draught Horse from pedigree data and genomic information. Enrico Mancin†, Michela Ablondi†, Roberto Mantovani*, Giuseppe Pigozzi, Alberto Sabbioni and Cristina Sartori ** Correspondence: [email protected] † These two Authors equally contributed to the work Supplementary Figure S1. Mares and foal of Italian Heavy Draught Horse (IHDH; courtesy of Cinzia Stoppa) Supplementary Figure S2. Number of Equivalent Generations (EqGen; above) and pedigree completeness (PC; below) over years in Italian Heavy Draught Horse population. Supplementary Table S1. Descriptive statistics of homozygosity (observed: Ho_obs; expected: Ho_exp; total: Ho_tot) in 267 genotyped individuals of Italian Heavy Draught Horse based on the number of homozygous genotypes. Parameter Mean SD Min Max Ho_obs 35,630.3 500.7 34,291 38,013 Ho_exp 35,707.8 64.0 35,010 35,740 Ho_tot 50,674.5 93.8 49,638 50,714 1 Definitions of the methods for inbreeding are in the text. Supplementary Figure S3. Values of BIC obtained by analyzing values of K from 1 to 10, corresponding on the same amount of clusters defining the proportion of ancestry in the 267 genotyped individuals. Supplementary Table S2. Estimation of genomic effective population size (Ne) traced back to 18 generations ago (Gen. ago). The linkage disequilibrium estimation, adjusted for sampling bias was also included (LD_r2), as well as the relative standard deviation (SD(LD_r2)). Gen. ago Ne LD_r2 SD(LD_r2) 1 100 0.009 0.014 2 108 0.011 0.018 3 118 0.015 0.024 4 126 0.017 0.028 5 134 0.019 0.031 6 143 0.021 0.034 7 156 0.023 0.038 9 173 0.026 0.041 11 189 0.029 0.046 14 213 0.032 0.052 18 241 0.036 0.058 Supplementary Table S3.
    [Show full text]
  • Homeobox Gene Expression Profile in Human Hematopoietic Multipotent
    Leukemia (2003) 17, 1157–1163 & 2003 Nature Publishing Group All rights reserved 0887-6924/03 $25.00 www.nature.com/leu Homeobox gene expression profile in human hematopoietic multipotent stem cells and T-cell progenitors: implications for human T-cell development T Taghon1, K Thys1, M De Smedt1, F Weerkamp2, FJT Staal2, J Plum1 and G Leclercq1 1Department of Clinical Chemistry, Microbiology and Immunology, Ghent University Hospital, Ghent, Belgium; and 2Department of Immunology, Erasmus Medical Center, Rotterdam, The Netherlands Class I homeobox (HOX) genes comprise a large family of implicated in this transformation proces.14 The HOX-C locus transcription factors that have been implicated in normal and has been primarily implicated in lymphomas.15 malignant hematopoiesis. However, data on their expression or function during T-cell development is limited. Using degener- Hematopoietic cells are derived from stem cells that reside in ated RT-PCR and Affymetrix microarray analysis, we analyzed fetal liver (FL) in the embryo and in the adult bone marrow the expression pattern of this gene family in human multipotent (ABM), which have the unique ability to self-renew and thereby stem cells from fetal liver (FL) and adult bone marrow (ABM), provide a life-long supply of blood cells. T lymphocytes are a and in T-cell progenitors from child thymus. We show that FL specific type of hematopoietic cells that play a major role in the and ABM stem cells are similar in terms of HOX gene immune system. They develop through a well-defined order of expression, but significant differences were observed between differentiation steps in the thymus.16 Several transcription these two cell types and child thymocytes.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Homeobox A10 Promotes the Proliferation and Invasion of Bladder Cancer Cells Via Regulation of Matrix Metalloproteinase‑3
    ONCOLOGY LETTERS 18: 49-56, 2019 Homeobox A10 promotes the proliferation and invasion of bladder cancer cells via regulation of matrix metalloproteinase‑3 CHUNLEI LIU1*, MINGZHU GE2*, JUN MA1*, YANHUI ZHANG1, YANHUI ZHAO1 and TAO CUI1 Departments of 1Urology and 2Ultrasound, Qingdao Central Hospital, Qingdao, Shandong 266042, P.R. China Received February 9, 2018; Accepted January 31, 2019 DOI: 10.3892/ol.2019.10312 Abstract. Homeobox A10 (HOXA10) belongs to the family Smoking and obesity are risk factors for BC (2), and genetic of HOX genes, which are closely connected with embryonic mutations and abnormal protein expression serve important development and serve important roles in various tumors. roles in the genesis, development and progression of BC (4). However, the role of HOXA10 in bladder cancer (BC) remains Therefore, exploring new anomalous molecules involved in unclear. In the present study, the role of HOXA10 in BC and the development of BC may advance the understanding of the underlying mechanisms by which it promotes the disease the mechanisms behind this disease and contribute to the progression were investigated. Immunohistochemical analysis improvement of treatment strategies. demonstrated that the expression of the HOXA10 protein Homeobox A10 (HOXA10) belongs to the family of HOX was significantly higher in BC tissues as compared with that genes, which are classified into four subgroups, namely HOX in adjacent normal tissues. Subsequent statistical analysis A-D (5), and are closely connected with embryonic develop- revealed that upregulation of HOXA10 was significantly ment (6). HOXA10 encodes a DNA-binding transcription factor associated with the pathological grade and clinical stage of that serves vital roles in regulating gene expression, viability BC patients.
    [Show full text]
  • Noelia Díaz Blanco
    Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • NF-Ya Activates Multiple Hematopoietic Stem Cell (HSC) Regulatory Genes and Promotes HSC Self-Renewal
    NF-Ya activates multiple hematopoietic stem cell (HSC) regulatory genes and promotes HSC self-renewal Jiang Zhu, Yi Zhang, Gerard J. Joe, Richard Pompetti, and Stephen G. Emerson* Departments of Medicine and Pediatrics, and Abramson Cancer Center, University of Pennsylvania School of Medicine, Philadelphia, PA 19104 Communicated by Zhu Chen, Shanghai Second Medical University, Shanghai, People’s Republic of China, April 25, 2005 (received for review December 15, 2004) Hematopoietic stem cell (HSC) self-renewal and differentiation are chased from The Jackson Laboratory and maintained in the animal influenced through multiple pathways, including homeobox tran- facilities of the University of Pennsylvania with sterile water or with scription factors, signaling through ␤-catenin and Notch-1, telom- the water supplemented with neomycin sulfate and polymyxin B erase, and p27. How these multiple pathways interact and are (Sigma) within 3–4 weeks after BMT. orchestrated is currently unknown. We now report that NF-Ya, the regulatory and DNA-binding subunit of the trimeric transcription NF-Ya cDNA, MigR1 Retroviral Vector, and Preparation of Retrovi- factor NF-Y, plays a central, integrating role in several of these HSC ruses. cDNA for NF-Ya was amplified from human normal bone pathways. NF-Ya is preferentially expressed in HSC-enriched bone marrow (BM) cell RNA by using Pfu DNA polymerase (Strat- marrow subpopulations, and NF-Ya mRNA rapidly declines with agene) (7). MigR1 retroviral vector was obtained from Warren HSC differentiation. Overexpression of NF-Ya in primitive hema- Pear (Department of Pathology and Laboratory Medicine, Uni- topoietic cells activates the transcription of multiple HOX4 paral- versity of Pennsylvania).
    [Show full text]
  • Coordination of Hox Identity Between Germ Layers Along the Anterior-To-Posterior Axis of the Vertebrate Embryo
    Coordination of Hox identity between germ layers along the anterior-to-posterior axis of the vertebrate embryo Ferran Lloret Vilaspasa PhD Developmental Biology Department of Anatomy and Developmental Biology University College of London (UCL) London, United Kingdom 2009 1 Coordination of Hox identity between germ layers along the anterior-to- posterior axis of the vertebrate embryo ‘ I, Ferran Lloret Vilaspasa confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. ' Thesis for the obtainment of a PhD in Development Biology at the University College of London under the supervision of Prof. dr. Claudio D. Stern and Prof. dr. Antony J. Durston (Leiden University). To be defended by Ferran Lloret Vilaspasa A la meva família… Born in Barcelona, 05-08-1977 2 Abstract During early embryonic development, a relatively undifferentiated mass of cells is shaped into a complex and morphologically differentiated embryo. This is achieved by a series of coordinated cell movements that end up in the formation of the three germ layers of most metazoans and the establishment of the body plan. Hox genes are among the main determinants in this process and they have a prominent role in granting identity to different regions of the embryo. The particular arrangement of their expression domains in early development corresponds to and characterises several future structures of the older embryo and adult animal. Getting to know the molecular and cellular phenomena underlying the correct Hox pattern will help us understand how the complexity of a fully-formed organism can arise from its raw materials, a relatively undifferentiated fertilised egg cell (zygote) and a large but apparently limited repertoire of molecular agents.
    [Show full text]
  • Expression Pattern of the Class I Homeobox Genes in Ovarian Carcinoma
    J Gynecol Oncol Vol. 21, No. 1:29-37, March 2010 DOI:10.3802/jgo.2010.21.1.29 Original Article Expression pattern of the class I homeobox genes in ovarian carcinoma Jin Hwa Hong1, Jae Kwan Lee1, Joong Jean Park2, Nak Woo Lee1, Kyu Wan Lee1, Jung Yeol Na1 Departments of 1Obstetrics and Gynecology, 2Physiology, Korea University College of Medicine, Seoul, Korea Objective: Although some sporadic reports reveal the link between the homeobox (HOX) genes and ovarian carcinoma, there is no comprehensive analysis of the expression pattern of the class I homeobox genes in ovarian carcinoma that determines the candidate genes involved in ovarian carcinogenesis. Methods: The different patterns of expression of 36 HOX genes were analyzed, including 4 ovarian cancer cell lines and 4 normal ovarian tissues. Using a reverse transcription-polymerase chain reaction (RT-PCR) and quantification analysis, the specific gene that showed a significantly higher expression in ovarian cancer cell lines than in normal ovaries was selected, and western blot analysis was performed adding 7 ovarian cancer tissue specimens. Finally, immunohistochemical and immunocytochemical analyses were performed to compare the pattern of expression of the specific HOX gene between ovarian cancer tissue and normal ovaries. Results: Among 36 genes, 11 genes had a different level of mRNA expression between the cancer cell lines and the normal ovarian tissues. Of the 11 genes, only HOXB4 had a significantly higher level of expression in ovarian cancer cell lines than in normal ovaries (p=0.029). Based on western blot, immunohistochemical, and immunocytochemical analyses, HOXB4 was expressed exclusively in the ovarian cancer cell lines or cancer tissue specimens, but not in the normal ovaries.
    [Show full text]
  • Downregulation of Prdm16 Is Critical for HOXB4-Mediated Benign HSC Expansion in Vivo Hui Yu University of Tennessee Health Science Center
    University of Tennessee Health Science Center UTHSC Digital Commons Theses and Dissertations (ETD) College of Graduate Health Sciences 12-2014 Downregulation of Prdm16 Is Critical for HOXB4-mediated Benign HSC Expansion In Vivo Hui Yu University of Tennessee Health Science Center Follow this and additional works at: https://dc.uthsc.edu/dissertations Part of the Medical Genetics Commons, and the Medical Molecular Biology Commons Recommended Citation Yu, Hui , "Downregulation of Prdm16 Is Critical for HOXB4-mediated Benign HSC Expansion In Vivo" (2014). Theses and Dissertations (ETD). Paper 307. http://dx.doi.org/10.21007/etd.cghs.2014.0367. This Dissertation is brought to you for free and open access by the College of Graduate Health Sciences at UTHSC Digital Commons. It has been accepted for inclusion in Theses and Dissertations (ETD) by an authorized administrator of UTHSC Digital Commons. For more information, please contact [email protected]. Downregulation of Prdm16 Is Critical for HOXB4-mediated Benign HSC Expansion In Vivo Document Type Dissertation Degree Name Doctor of Philosophy (PhD) Program Biochemistry Track Therapeutics and Cell Signaling Research Advisor Brian P. Sorrentino, MD Committee Suzanne J. Baker, PhD Wing H. Leung, MD, PhD Janet F. Partridge, PhD Lawrence M. Pfeffer, PhD DOI 10.21007/etd.cghs.2014.0367 This dissertation is available at UTHSC Digital Commons: https://dc.uthsc.edu/dissertations/307 DOWNREGULATION OF PRDM16 IS CRITICAL FOR HOXB4-MEDIATED BENIGN HSC EXPANSION IN VIVO A Dissertation Presented for The Graduate Studies Council The University of Tennessee Health Science Center In Partial Fulfillment Of the Requirements for the Degree Doctor of Philosophy From The University of Tennessee By Hui Yu December 2014 Copyright © 2014 by Hui Yu All rights reserved ii DEDICATION This dissertation is dedicated to my parents, Guoquan Yu and Yan Xu, my husband, Satish Kumar Nandakumar and my precious daughter Emma Satish for all their love and support.
    [Show full text]
  • PRDM16 Isoforms Differentially Regulate Normal and Leukemic Hematopoiesis and Inflammatory Gene Signature
    RESEARCH ARTICLE The Journal of Clinical Investigation PRDM16 isoforms differentially regulate normal and leukemic hematopoiesis and inflammatory gene signature David J. Corrigan,1,2 Larry L. Luchsinger,1,3 Mariana Justino de Almeida,1,2 Linda J. Williams,1,3 Alexandros Strikoudis,1,3 and Hans-Willem Snoeck1,2,3,4 1Columbia Center of Human Development, 2Department of Microbiology and Immunology, 3Department of Medicine, and 4Columbia Center for Translational Immunology, Columbia University Medical Center, New York, New York, USA. PRDM16 is a transcriptional coregulator involved in translocations in acute myeloblastic leukemia (AML), myelodysplastic syndromes, and T acute lymphoblastic leukemia that is highly expressed in and required for the maintenance of hematopoietic stem cells (HSCs), and can be aberrantly expressed in AML. Prdm16 is expressed as full-length (fPrdm16) and short (sPrdm16) isoforms, the latter lacking the N-terminal PR domain. The role of both isoforms in normal and malignant hematopoiesis is unclear. We show here that fPrdm16 was critical for HSC maintenance, induced multiple genes involved in GTPase signaling, and repressed inflammation, while sPrdm16 supported B cell development biased toward marginal zone B cells and induced an inflammatory signature. In a mouse model of human MLL-AF9 leukemia, fPrdm16 extended latency, while sPrdm16 shortened latency and induced a strong inflammatory signature, including several cytokines and chemokines that are associated with myelodysplasia and with a worse prognosis in human AML. Finally, in human NPM1-mutant and in MLL-translocated AML, high expression of PRDM16, which negatively impacts outcome, was associated with inflammatory gene expression, thus corroborating the mouse data. Our observations demonstrate distinct roles for Prdm16 isoforms in normal HSCs and AML, and identify sPrdm16 as one of the drivers of prognostically adverse inflammation in leukemia.
    [Show full text]
  • HOXB4's Road Map to Stem Cell Expansion
    HOXB4’s road map to stem cell expansion Bernhard Schiedlmeier*†, Ana Cristina Santos‡§, Ana Ribeiro‡, Natalia Moncaut‡, Dietrich Lesinski*, Herbert Auer¶, Karl Kornackerʈ, Wolfram Ostertag*, Christopher Baum*, Moises Mallo†‡, and Hannes Klump* *Department of Experimental Hematology, Hannover Medical School, Carl-Neuberg-Strasse1, 30625 Hannover, Germany; ‡Instituto Gulbenkian de Ciencia, 2780-156 Oeiras, Portugal; ¶Columbus Children’s Research Institute, Columbus, OH 43210; and ʈDivision of Sensory Biophysics, Ohio State University, Columbus, OH 43205 Edited by Tasuku Honjo, Kyoto University, Kyoto, Japan, and approved September 10, 2007 (received for review April 3, 2007) Homeodomain-containing transcription factors are important reg- BM cells. These HSCs fully replenish the stem cell pool of lethally ulators of stem cell behavior. HOXB4 mediates expansion of adult irradiated mice and maintain a normal supply of HSCs and mature and embryo-derived hematopoietic stem cells (HSCs) when ex- blood cells for the duration of life (2, 3). Ectopic HOXB4 expression pressed ectopically. To define the underlying molecular mecha- also enhances the in vitro development of definitive HSCs from nisms, we performed gene expression profiling in combination differentiating mouse ES cells that are capable of reconstituting with subsequent functional analysis with enriched adult HSCs and recipient mice (4, 5). However, ectopic expresssion of HOXB4 may embryonic derivatives expressing inducible HOXB4. Thereby, we eventually transform hematopoietic cells. Our group and others identified a set of overlapping genes that likely represent ‘‘uni- have described that the amount of ectopically expressed HOXB4 versal’’ targets of HOXB4. A substantial number of loci are involved has an impact on myeloid, lymphoid, and erythroid differentiation in signaling pathways important for controlling self-renewal, of adult HSCs of mice and humans in vitro and in vivo and on ES maintenance, and differentiation of stem cells.
    [Show full text]