DOCSLIB.ORG

Global Identification of MLL2-Targeted Loci Reveals Mll2ts Role in Diverse Signaling Pathways

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Global Identification of MLL2-Targeted Loci Reveals Mll2ts Role in Diverse Signaling Pathways Global identification of MLL2-targeted loci reveals MLL2’s role in diverse signaling pathways Changcun Guoa,b,c,1, Chun-Chi Changa,b,c,1, Matthew Worthama,b,c, Lee H. Chena,b,c, Dawn N. Kernagisc, Xiaoxia Qind, Young-Wook Choe,2, Jen-Tsan Chid, Gerald A. Granta,b,f, Roger E. McLendona,b,c, Hai Yana,b,c, Kai Gee, Nickolas Papadopoulosg, Darell D. Bignera,b,c, and Yiping Hea,b,c,3 aThe Preston Robert Tisch Brain Tumor Center at Duke, bPediatric Brain Tumor Foundation Institute, cDepartment of Pathology, dInstitute for Genome Sciences and Policy, and fDepartment of Surgery, Duke University, Durham, NC 27710; eLaboratory of Endocrinology and Receptor Biology, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD 20892; and gLudwig Center for Cancer Genetics and Therapeutics, Sidney Kimmel Comprehensive Cancer Center, Baltimore, MD 21231 Edited* by Bert Vogelstein, Johns Hopkins University, Baltimore, MD, and approved September 14, 2012 (received for review June 1, 2012) Myeloid/lymphoid or mixed-lineage leukemia (MLL)-family genes SWI/SNF, the MLL2 or MLL3 (hereafter referred to as MLL2/ encode histone lysine methyltransferases that play important 3) complex has been found to play essential roles as a coactivator roles in epigenetic regulation of gene transcription. MLL genes for transcriptional activation by nuclear hormone receptors (11). are frequently mutated in human cancers. Unlike MLL1, MLL2 (also Consistent with this notion, previous studies have shown that known as ALR/MLL4) and its homolog MLL3 are not well-under- MLL2/3 complexes regulate Hox gene transcription in an es- stood. Specifically, little is known regarding the extent of global trogen receptor-dependent manner, and that they play critical MLL2 involvement in the regulation of gene expression and the roles in PPARγ-dependent adipogenesis (12–14). mechanism underlying its alterations in driving tumorigenesis. Somatically acquired epigenetic changes are prevalent in hu- Here we profile the global loci targeted by MLL2. A combinatorial man cancers. Recent cancer genetics studies have uncovered analysis of the MLL2 binding profile and gene expression in MLL2 frequent somatic loss-of-function mutations in the genes encod- wild-type versus MLL2-null isogenic cell lines identified direct tran- ing MLL2/3 complex subunits in a variety of cancer types. UTX scriptional target genes and revealed the connection of MLL2 to was found to be mutated in numerous human cancer types (15– multiple cellular signaling pathways, including the p53 pathway, 17). MLL3 was found to be mutated in a subset of colorectal cAMP-mediated signaling, and cholestasis signaling. In particular, cancers and in transitional cell carcinoma (16, 18–20). Most nota- we demonstrate that MLL2 participates in retinoic acid receptor bly, several recent studies identified frequent MLL2-inactivating signaling by promoting retinoic acid-responsive gene transcrip- mutations in non-Hodgkin B-cell lymphomas (21–23). Finally, tion. Our results present a genome-wide integrative analysis of genes encoding MLL2/3 complex subunits, particularly MLL2, the MLL2 target loci and suggest potential mechanisms underlying MLL3,andUTX, were found to be mutated in medulloblastoma, tumorigenesis driven by MLL2 alterations. establishing them as critical tumor suppressors (24–26). In contrast to the compelling genetic evidence, much less is tumor suppressor | somatic targeting | S100A gene cluster known regarding the mechanism underlying the tumor suppres- sor roles of the MLL2/3 complex. It was shown that knockdown odulation of chromatin accessibility through chromatin of MLL2 resulted in reduced cancer cell growth and altered Mremodeling and histone modification is a critical step in adhesion in HeLa cells (9). An MLL3-knockout mouse model regulating eukaryotic gene transcription. Histone H3 lysine 4 study showed that MLL3 plays a role in DNA damage response (H3K4) methylation by histone methyltransferases is an evolu- in a p53-dependent manner, suggesting that the complex serves tionarily conserved epigenetic mark for active gene transcription as a transcriptional coactivator for p53 (27). The link to p53 is (1). In mammalian cells, six complexes with H3K4 methyl- consistent with the tumor suppressor role of the MLL3 complex. transferase activity have been identified, each with one SET However, it is most likely that MLL2/3 epigenetic complexes domain-containing methyltransferase subunit, including Set1A, have a broader role biochemically and that the deficiency of the Set1B, and four MLL-family proteins. In humans, these MLL- pathway has a more profound impact on cellular processes. To family genes include MLL1, MLL2 (GenBank accession no. further elucidate the tumor suppressor role of MLL2, we per- NM_003482; also known as ALR/MLL4), MLL3, and MLL4 formed a direct profiling of the global loci that are targeted by (GenBank accession no. NM_014727; also known as MLL2 or MLL2. Moreover, we show that somatic knockout of MLL2 in Wbp7, conflicting with the official symbol for MLL2). Each of human cells affects the expression of a variety of genes. We these proteins is associated with a complex that modulates his- note a set of genes that are retinoic acid-responsive and may be tone methylation (2). Among the MLL genes, MLL1 and its directly regulated by MLL2. Finally, integrative pathway anal- homolog MLL4 have been the most extensively studied, as the ysis uncovered various signaling pathways that are regulated by former is frequently involved in genetic alterations in leukemia the MLL2 complex. Our results reveal the global and pathway- (reviewed in ref. 3). In addition, MLL4 has been found to be overexpressed in breast and colorectal cell lines (4). MLL1 and MLL4 play essential roles in regulating the expression of genes Author contributions: C.G. and Y.H. designed research; C.G., C.-C.C., and Y.H. performed research; C.-C.C., Y.-W.C., G.A.G., K.G., N.P., and D.D.B. contributed new reagents/analytic that are involved in cell differentiation and early embryonic tools; C.G., C.-C.C., M.W., L.H.C., D.N.K., X.Q., J.-T.C., R.E.M., H.Y., N.P., and Y.H. analyzed development, among which the most notable and best-estab- data; and C.G. and Y.H. wrote the paper. MEDICAL SCIENCES lished are the Homeobox (Hox) genes (5, 6). The authors declare no conflict of interest. MLL2 was originally cloned as a human homolog of Dro- *This Direct Submission article had a prearranged editor. sophila trithorax (7). MLL2 and its homolog, MLL3, function 1C.G. and C.-C.C. contributed equally to this work. distinctly from MLL1 and MLL4. Each of them associates with 2Present address: Korea Basic Science Institute Chuncheon Center, Chuncheon-si 200-701, nuclear receptor coactivator 6 (also known as activating signaling Republic of Korea. cointegrator 2) to form a complex that contains other subunits 3To whom correspondence should be addressed. E-mail: [email protected]. including ASH2L, RbBP5, WDR5, DPY30, PTIP, PA1, and This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. UTX (8–10). Together with the chromatin-remodeling complex 1073/pnas.1208807109/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1208807109 PNAS | October 23, 2012 | vol. 109 | no. 43 | 17603–17608 Downloaded by guest on September 29, 2021 specific roles of MLL2 and suggest that it participates in reg- (30), we have established a human cell assay that consists of ulating a wide range of pathways with relevance to its role in isogenic cell lines that differ only in the presence or absence of oncogenesis. an MLL2-Flag allele, thus permitting the direct profiling of MLL2- targeted loci by a proven-quality antibody-based ChIP-seq. Results Generation of Endogenous Flag-Tagged MLL2-Expressing Cells. Global Identification of MLL2-Targeted Loci. The parental cell line Identifying genomic binding sites is a powerful strategy to re- and MLL2-Flag–expressing cells (clone MLL2-Flag1 and 2) were veal genes regulated by transcriptional regulators (5, 28, 29). subjected to anti-Flag antibody-based ChIP-seq procedures (Fig. However, two hurdles confront the direct global profiling of S2A). We modified a previously described differential tag-density MLL2-targeted loci: (i) It is a massive protein of 5,537 amino analysis (34, 35) to obtain a global view of MLL2-bound loci. We acids (∼600 kDa), which complicates biochemical studies that generated bins (regions) across the human genome and com- require ectopic expression; and (ii) neither a proven-quality pared the tag density for each bin between the parental and antibody nor a human cell assay is available for chromatin im- MLL2-Flag–expressing cell lines. The relative tag density of the munoprecipitation-sequencing (ChIP-seq). To overcome these MLL2-Flag–expressing cell line to the parental line showed fre- obstacles, we have adopted a somatic knockin-based approach in quent spikes (Fig. 1C), indicating an MLL2-Flag–specific enrich- which an endogenous protein is fused with a short tagging pep- ment. In contrast, such enrichment was absent in the parental tide, which facilitates antibody-based ChIP studies (30, 31). We line, as indicated by the reverse tag-density ratio (Fig. 1C). The chose the HCT116 carcinoma cell line for our study, as it is same set of MLL2-Flag–specific enrichments was also apparent a near-diploid cell line with well-defined key cancerous pathways. in MLL2-Flag–expressing cell line 2 (Fig. S2B). Furthermore, this cell line has homozygous MLL3-inactivating To identify MLL2-targeted regions, we applied a criterion by mutations, thus preventing compensatory effects from obscuring which at least fivefold enrichment was required to identify dif- functional analysis (19). An rAAV-based somatic knockin con- ferential tag density (35). A total of 2,060 MLL2 binding events struct (30, 32, 33) enabled the insertion of a DNA fragment fi encoding Flag tags immediately upstream of the stop codon of were identi ed.
Load more

Recommended publications
  • Modes of Interaction of KMT2 Histone H3 Lysine 4 Methyltransferase/COMPASS Complexes with Chromatin
    cells Review Modes of Interaction of KMT2 Histone H3 Lysine 4 Methyltransferase/COMPASS Complexes with Chromatin Agnieszka Bochy ´nska,Juliane Lüscher-Firzlaff and Bernhard Lüscher * ID Institute of Biochemistry and Molecular Biology, Medical School, RWTH Aachen University, Pauwelsstrasse 30, 52057 Aachen, Germany; [email protected] (A.B.); jluescher-fi[email protected] (J.L.-F.) * Correspondence: [email protected]; Tel.: +49-241-8088850; Fax: +49-241-8082427 Received: 18 January 2018; Accepted: 27 February 2018; Published: 2 March 2018 Abstract: Regulation of gene expression is achieved by sequence-specific transcriptional regulators, which convey the information that is contained in the sequence of DNA into RNA polymerase activity. This is achieved by the recruitment of transcriptional co-factors. One of the consequences of co-factor recruitment is the control of specific properties of nucleosomes, the basic units of chromatin, and their protein components, the core histones. The main principles are to regulate the position and the characteristics of nucleosomes. The latter includes modulating the composition of core histones and their variants that are integrated into nucleosomes, and the post-translational modification of these histones referred to as histone marks. One of these marks is the methylation of lysine 4 of the core histone H3 (H3K4). While mono-methylation of H3K4 (H3K4me1) is located preferentially at active enhancers, tri-methylation (H3K4me3) is a mark found at open and potentially active promoters. Thus, H3K4 methylation is typically associated with gene transcription. The class 2 lysine methyltransferases (KMTs) are the main enzymes that methylate H3K4. KMT2 enzymes function in complexes that contain a necessary core complex composed of WDR5, RBBP5, ASH2L, and DPY30, the so-called WRAD complex.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name protein kinase (cAMP-dependent, catalytic) inhibitor beta Gene Symbol PKIB Organism Human Gene Summary The protein encoded by this gene is a member of the cAMP-dependent protein kinase inhibitor family. Studies of a similar protein in rat suggest that this protein may interact with the catalytic subunit of cAMP-dependent protein kinase and act as a competitive inhibitor. At least three alternatively spliced transcript variants encoding the same protein have been reported. Gene Aliases FLJ23817, PRKACN2 RefSeq Accession No. NC_000006.11, NT_025741.15 UniGene ID Hs.486354 Ensembl Gene ID ENSG00000135549 Entrez Gene ID 5570 Assay Information Unique Assay ID qHsaCED0044612 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000368452, ENST00000368448, ENST00000258014, ENST00000354275, ENST00000368446, ENST00000392491, ENST00000392490 Amplicon Context Sequence GGCTCATAATCTATCAAGAGTGCTGAATTTCTGCATGTTGAAAGACTTAGTGGTT CTGTTTTCTTGAGACATTTAATCTGGTGGTAACTGTGGTAACATTGCAGCC Amplicon Length (bp) 76 Chromosome Location 6:123046342-123046447 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 95 R2 0.9996 cDNA Cq 22.83 cDNA Tm (Celsius) 76.5 gDNA Cq 24.52 Page 1/5 PrimePCR™Assay Validation Report Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report PKIB, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Location Analysis of Estrogen Receptor Target Promoters Reveals That
    Location analysis of estrogen receptor ␣ target promoters reveals that FOXA1 defines a domain of the estrogen response Jose´ e Laganie` re*†, Genevie` ve Deblois*, Ce´ line Lefebvre*, Alain R. Bataille‡, Franc¸ois Robert‡, and Vincent Gigue` re*†§ *Molecular Oncology Group, Departments of Medicine and Oncology, McGill University Health Centre, Montreal, QC, Canada H3A 1A1; †Department of Biochemistry, McGill University, Montreal, QC, Canada H3G 1Y6; and ‡Laboratory of Chromatin and Genomic Expression, Institut de Recherches Cliniques de Montre´al, Montreal, QC, Canada H2W 1R7 Communicated by Ronald M. Evans, The Salk Institute for Biological Studies, La Jolla, CA, July 1, 2005 (received for review June 3, 2005) Nuclear receptors can activate diverse biological pathways within general absence of large scale functional data linking these putative a target cell in response to their cognate ligands, but how this binding sites with gene expression in specific cell types. compartmentalization is achieved at the level of gene regulation is Recently, chromatin immunoprecipitation (ChIP) has been used poorly understood. We used a genome-wide analysis of promoter in combination with promoter or genomic DNA microarrays to occupancy by the estrogen receptor ␣ (ER␣) in MCF-7 cells to identify loci recognized by transcription factors in a genome-wide investigate the molecular mechanisms underlying the action of manner in mammalian cells (20–24). This technology, termed 17␤-estradiol (E2) in controlling the growth of breast cancer cells. ChIP-on-chip or location analysis, can therefore be used to deter- We identified 153 promoters bound by ER␣ in the presence of E2. mine the global gene expression program that characterize the Motif-finding algorithms demonstrated that the estrogen re- action of a nuclear receptor in response to its natural ligand.
    [Show full text]
  • Rage (Receptor for Advanced Glycation End Products) in Melanoma
    RAGE (RECEPTOR FOR ADVANCED GLYCATION END PRODUCTS) IN MELANOMA PROGRESSION A Dissertation Submitted to the Graduate Faculty of the North Dakota State University of Agriculture and Applied Science By Varsha Meghnani In Partial Fulfillment for the Degree of DOCTOR OF PHILOSOPHY Major Department: Pharmaceutical Sciences May 2014 Fargo, North Dakota North Dakota State University Graduate School Title RAGE (RECEPTOR FOR ADVANCED GLYCATION END PRODUCTS) IN MELANOMA PROGRESSION By VARSHA MEGHNANI The Supervisory Committee certifies that this disquisition complies with North Dakota State University’s regulations and meets the accepted standards for the degree of DOCTOR OF PHILOSOPHY SUPERVISORY COMMITTEE: ESTELLE LECLERC Chair BIN GUO STEPHEN O’ROURKE JANE SCHUH Approved: 5/22/2014 JAGDISH SINGH Date Department Chair ABSTRACT The Receptor for Advanced Glycation End Products (RAGE) and its ligands are expressed in multiple cancer types and are implicated in cancer progression. Our lab has previously reported higher transcript levels of RAGE and S100B in advanced staged melanoma patients. The contribution of RAGE in the pathophysiology of melanoma has not been well studied. Based on previous reports, we hypothesized that RAGE, when over-expressed in melanoma cells, promotes melanoma progression. To study the pathogenic role of RAGE in melanoma, a primary melanoma cell line, WM115, was selected and stably transfected with full length RAGE (FL_RAGE) to generate a model cell line over-expressing RAGE (WM115_RAGE). WM266, a sister cell line of WM115, originated from a metastatic tumor of the same patient was used as a metastatic control cell line in the study. After assessing the expression levels of RAGE in the transfected cells, the influence of RAGE on their cellular properties was examined.
    [Show full text]
  • Aberrant Activity of Histone–Lysine N-Methyltransferase 2 (KMT2) Complexes in Oncogenesis
    International Journal of Molecular Sciences Review Aberrant Activity of Histone–Lysine N-Methyltransferase 2 (KMT2) Complexes in Oncogenesis Elzbieta Poreba 1,* , Krzysztof Lesniewicz 2 and Julia Durzynska 1,* 1 Institute of Experimental Biology, Faculty of Biology, Adam Mickiewicz University, ul. Uniwersytetu Pozna´nskiego6, 61-614 Pozna´n,Poland 2 Department of Molecular and Cellular Biology, Institute of Molecular Biology and Biotechnology, Faculty of Biology, Adam Mickiewicz University, ul. Uniwersytetu Pozna´nskiego6, 61-614 Pozna´n,Poland; [email protected] * Correspondence: [email protected] (E.P.); [email protected] (J.D.); Tel.: +48-61-829-5857 (E.P.) Received: 19 November 2020; Accepted: 6 December 2020; Published: 8 December 2020 Abstract: KMT2 (histone-lysine N-methyltransferase subclass 2) complexes methylate lysine 4 on the histone H3 tail at gene promoters and gene enhancers and, thus, control the process of gene transcription. These complexes not only play an essential role in normal development but have also been described as involved in the aberrant growth of tissues. KMT2 mutations resulting from the rearrangements of the KMT2A (MLL1) gene at 11q23 are associated with pediatric mixed-lineage leukemias, and recent studies demonstrate that KMT2 genes are frequently mutated in many types of human cancers. Moreover, other components of the KMT2 complexes have been reported to contribute to oncogenesis. This review summarizes the recent advances in our knowledge of the role of KMT2 complexes in cell transformation. In addition, it discusses the therapeutic targeting of different components of the KMT2 complexes. Keywords: histone–lysine N-methyltransferase 2; COMPASS; COMPASS-like; H3K4 methylation; oncogenesis; cancer; epigenetics; chromatin 1.
    [Show full text]
  • An in Cellulo-Derived Structure of PAK4 in Complex with Its Inhibitor Inka1
    ARTICLE Received 27 May 2015 | Accepted 21 Sep 2015 | Published 26 Nov 2015 DOI: 10.1038/ncomms9681 OPEN An in cellulo-derived structure of PAK4 in complex with its inhibitor Inka1 Yohendran Baskaran1,*, Khay C. Ang1,2,*, Praju V. Anekal1, Wee L. Chan1, Jonathan M. Grimes3,4, Ed Manser1,5,6 & Robert C. Robinson1,2 PAK4 is a metazoan-specific kinase acting downstream of Cdc42. Here we describe the structure of human PAK4 in complex with Inka1, a potent endogenous kinase inhibitor. Using single mammalian cells containing crystals 50 mm in length, we have determined the in cellulo crystal structure at 2.95 Å resolution, which reveals the details of how the PAK4 catalytic domain binds cellular ATP and the Inka1 inhibitor. The crystal lattice consists only of PAK4– PAK4 contacts, which form a hexagonal array with channels of 80 Å in diameter that run the length of the crystal. The crystal accommodates a variety of other proteins when fused to the kinase inhibitor. Inka1–GFP was used to monitor the process crystal formation in living cells. Similar derivatives of Inka1 will allow us to study the effects of PAK4 inhibition in cells and model organisms, to allow better validation of therapeutic agents targeting PAK4. 1 Institute of Molecular and Cell Biology, A*STAR (Agency for Science, Technology and Research), Biopolis, Proteos Building, 61 Biopolis Drive, 8-15, Singapore 138673, Singapore. 2 Department of Biochemistry, Yong Loo Lin School of Medicine, National University of Singapore, Singapore 117597, Singapore. 3 Division of Structural Biology, Wellcome Trust Centre for Human Genetics, University of Oxford, Roosevelt Drive, Oxford OX3 7BN, UK.
    [Show full text]
  • The UVB-Induced Gene Expression Profile of Human Epidermis in Vivo Is Different from That of Cultured Keratinocytes
    Oncogene (2006) 25, 2601–2614 & 2006 Nature Publishing Group All rights reserved 0950-9232/06 $30.00 www.nature.com/onc ORIGINAL ARTICLE The UVB-induced gene expression profile of human epidermis in vivo is different from that of cultured keratinocytes CD Enk1, J Jacob-Hirsch2, H Gal3, I Verbovetski4, N Amariglio2, D Mevorach4, A Ingber1, D Givol3, G Rechavi2 and M Hochberg1 1Department of Dermatology, The Hadassah-Hebrew University Medical Center, Jerusalem, Israel; 2Department of Pediatric Hemato-Oncology and Functional Genomics, Safra Children’s Hospital, Sheba Medical Center and Sackler School of Medicine, Tel-Aviv University,Tel Aviv, Israel; 3Department of Molecular Cell Biology, Weizmann Institute of Science, Rehovot, Israel and 4The Laboratory for Cellular and Molecular Immunology, Department of Medicine, The Hadassah-Hebrew University Medical Center, Jerusalem, Israel In order to obtain a comprehensive picture of the radiation. UVB, with a wavelength range between 290 molecular events regulating cutaneous photodamage of and 320 nm, represents one of the most important intact human epidermis, suction blister roofs obtained environmental hazards affectinghuman skin (Hahn after a single dose of in vivo ultraviolet (UV)B exposure and Weinberg, 2002). To protect itself against the were used for microarray profiling. We found a changed DNA-damaging effects of sunlight, the skin disposes expression of 619 genes. Half of the UVB-regulated genes over highly complicated cellular programs, including had returned to pre-exposure baseline levels at 72 h, cell-cycle arrest, DNA repair and apoptosis (Brash et al., underscoring the transient character of the molecular 1996). Failure in selected elements of these defensive cutaneous UVB response.
    [Show full text]
  • 8296.Full.Pdf
    Inflammation-Induced Chondrocyte Hypertrophy Is Driven by Receptor for Advanced Glycation End Products This information is current as Denise L. Cecil, Kristen Johnson, John Rediske, Martin of September 28, 2021. Lotz, Ann Marie Schmidt and Robert Terkeltaub J Immunol 2005; 175:8296-8302; ; doi: 10.4049/jimmunol.175.12.8296 http://www.jimmunol.org/content/175/12/8296 Downloaded from References This article cites 43 articles, 13 of which you can access for free at: http://www.jimmunol.org/content/175/12/8296.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 28, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2005 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Inflammation-Induced Chondrocyte Hypertrophy Is Driven by Receptor for Advanced Glycation End Products1 Denise L. Cecil,* Kristen Johnson,* John Rediske,‡ Martin Lotz,§ Ann Marie Schmidt,† and Robert Terkeltaub2* The multiligand receptor for advanced glycation end products (RAGE) mediates certain chronic vascular and neurologic degen- erative diseases accompanied by low-grade inflammation.
    [Show full text]
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
    [Show full text]
  • Mitoxplorer, a Visual Data Mining Platform To
    mitoXplorer, a visual data mining platform to systematically analyze and visualize mitochondrial expression dynamics and mutations Annie Yim, Prasanna Koti, Adrien Bonnard, Fabio Marchiano, Milena Dürrbaum, Cecilia Garcia-Perez, José Villaveces, Salma Gamal, Giovanni Cardone, Fabiana Perocchi, et al. To cite this version: Annie Yim, Prasanna Koti, Adrien Bonnard, Fabio Marchiano, Milena Dürrbaum, et al.. mitoXplorer, a visual data mining platform to systematically analyze and visualize mitochondrial expression dy- namics and mutations. Nucleic Acids Research, Oxford University Press, 2020, 10.1093/nar/gkz1128. hal-02394433 HAL Id: hal-02394433 https://hal-amu.archives-ouvertes.fr/hal-02394433 Submitted on 4 Dec 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License Nucleic Acids Research, 2019 1 doi: 10.1093/nar/gkz1128 Downloaded from https://academic.oup.com/nar/advance-article-abstract/doi/10.1093/nar/gkz1128/5651332 by Bibliothèque de l'université la Méditerranée user on 04 December 2019 mitoXplorer, a visual data mining platform to systematically analyze and visualize mitochondrial expression dynamics and mutations Annie Yim1,†, Prasanna Koti1,†, Adrien Bonnard2, Fabio Marchiano3, Milena Durrbaum¨ 1, Cecilia Garcia-Perez4, Jose Villaveces1, Salma Gamal1, Giovanni Cardone1, Fabiana Perocchi4, Zuzana Storchova1,5 and Bianca H.
    [Show full text]
  • Developmental Differences in the Expression of ABC Transporters at Rat Brain Barrier Interfaces Following Chronic Exposure to Di
    www.nature.com/scientificreports OPEN Developmental diferences in the expression of ABC transporters at rat brain barrier interfaces Received: 28 November 2018 Accepted: 28 March 2019 following chronic exposure to Published: xx xx xxxx diallyl sulfde Liam M. Koehn1, Katarzyna M. Dziegielewska1, Kjeld Møllgård 2, Elodie Saudrais3, Nathalie Strazielle3,4, Jean-Francois Ghersi-Egea3, Norman R. Saunders 1 & Mark D. Habgood1 Many pregnant women and prematurely born infants require medication for clinical conditions including cancer, cardiac defects and psychiatric disorders. In adults drug transfer from blood into brain is mostly restricted by efux mechanisms (ATP-binding cassette, ABC transporters). These mechanisms have been little studied during brain development. Here expression of eight ABC transporters (abcb1a, abcb1b, abcg2, abcc1, abcc2, abcc3, abcc4, abcc5) and activity of conjugating enzyme glutathione-s- transferase (GST) were measured in livers, brain cortices (blood-brain-barrier) and choroid plexuses (blood-cerebrospinal fuid, CSF, barrier) during postnatal rat development. Controls were compared to animals chronically injected (4 days, 200 mg/kg/day) with known abcb1a inducer diallyl sulfde (DAS). Results reveal both tissue- and age-dependent regulation. In liver abcb1a and abcc3 were up- regulated at all ages. In cortex abcb1a/b, abcg2 and abcc4/abcc5 were up-regulated in adults only, while in choroid plexus abcb1a and abcc2 were up-regulated only at P14. DAS treatment increased GST activity in livers, but not in cortex or choroid plexuses. Immunocytochemistry of ABC transporters at the CSF-brain interface showed that PGP and BCRP predominated in neuroepithelium while MRP2/4/5 were prominent in adult ependyma. These results indicate an age-related capacity of brain barriers to dynamically regulate their defence mechanisms when chronically challenged by xenobiotic compounds.
    [Show full text]