DOCSLIB.ORG

Control of Growth and Gut Maturation by Hoxd Genes and the Associated

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Control of Growth and Gut Maturation by Hoxd Genes and the Associated Control of growth and gut maturation by HoxD genes PNAS PLUS and the associated lncRNA Haglr Jozsef Zakanya, Fabrice Darbellayb, Bénédicte Mascreza, Anamaria Necsuleab,1, and Denis Duboulea,b,2 aDepartment of Genetics and Evolution, University of Geneva, 1211 Geneva 4, Switzerland; and bSchool of Life Sciences, Federal Institute of Technology, Lausanne (EPFL), 1015 Lausanne, Switzerland Contributed by Denis Duboule, September 21, 2017 (sent for review July 13, 2017; reviewed by Nicoletta Bobola and Natasza Kurpios) During embryonic development, Hox genes participate in the build- side (9), emphasizing a potential link between growth retardation ing of a functional digestive system in metazoans, and genetic con- and alterations in gut development. ditions involving these genes lead to important, sometimes lethal, In this study, we tried to find a common explanatory frame- growth retardation. Recently, this phenotype was obtained after work for the various cases described above. We decided to deletion of Haglr,theHoxd antisense growth-associated long non- complete the allelic series with a few more mutant chromosomes coding RNA (lncRNA) located between Hoxd1 and Hoxd3. In this necessary to unambiguously interpret the previous observations study, we have analyzed the function of Hoxd genes in delayed relating phenotypes to particular genes. By using CRISPR/Cas9 growth trajectories by looking at several nested targeted defi- mutagenesis in embryo, we demonstrate that the growth-retardation – ciencies of the mouse HoxD cluster. Mutant pups were severely phenotype observed in HoxDDel(1 9) mice is caused by the dominant- stunted during the suckling period, but many recovered after wean- negative effect of the HOXD10 protein. We also report comparable ing. After comparing seven distinct HoxD alleles, including CRISPR/ growth deficits in mice lacking the entire region from Hoxd1 to – Cas9 deletions involving Haglr, we identified Hoxd3 as the critical Hoxd4 [HoxDDel(1 4)] (10) and that a mutation in the HOXD3 component for the gut to maintain milk-digestive competence. This DNA-binding domain produces mice with similar growth defi- essential function could be abrogated by the dominant-negative cits, in contrast to mice mutant for either HOXD1 or HOXD4. effect of HOXD10 as shown by a genetic rescue approach, thus We document pathological signs of intestinal failure in three further illustrating the importance of posterior prevalence in Hox independent nested deletions. Together, these results converge BIOLOGY gene function. A role for the lncRNA Haglr in the control of post- toward a central role for Hoxd3 in the growth-retardation phe- DEVELOPMENTAL natal growth could not be corroborated. notypes previously recorded and further explain the strong functional hierarchy at work among HOX proteins. lncRNA | digestive system | Hox regulation | growth control | CRISPR-cas9 To address the potential function of Haglr in this context, we further engineered a pair of alleles carrying either a deficiency or low postnatal weight gain phenotypes can be induced by an inversion of the CpG island containing the bidirectional Smutations in a range of genes important for developmental promoter for both Hoxd1 and the antisense lncRNA. Neither of patterning. However, the molecular and physiological bases of these two alleles affected postnatal growth, even in the resulting such growth retardations are often difficult to pinpoint due to the absence of the reported Haglr RNA, suggesting that the Haglr- high pleiotropy associated with these genes. While none of the associated phenotype may result from an interference with Hoxd3 39 gene members of the Hox family has been included in this broad phenotypic class thus far, we noticed two cases of postnatal Significance growth retardation during the several-years-long studies of our allelic series at the mouse HoxD locus. First, animals homozygous During development, transcription factors are necessary not for a complete HoxD cluster deficiency showed about 30% body- only to pattern the body plan but also to control growth. mass deficit by the time of weaning. However, given that they However, the link between these two developmental compo- suffered severe limb and innervation defects, growth retardation nents has been difficult to establish. Hox genes are involved in seemed compatible with reduced feeding (1). Secondly, a shorter the emergence of a functional digestive system in metazoans, – deficiency removing Hoxd1–Hoxd9 [HoxDDel(1 9)] was associated thus providing a potential impact on growth through nutrition. with postnatal growth retardation in heterozygous mice in the absence Also, genetic conditions involving these genes lead to impor- tant growth retardation. We analyzed several targeted mutant of mobility defects. However, some specimens also displayed facial lines at the HoxD locus and found that stunted phenotypes can defects, again suggesting the existence of a physical problem all be explained by the lack of function of Hoxd3, whose role potentially affecting the feeding behavior (2). seems to be critical in the developing gut of suckling mice, Highly severe postnatal growth retardation in the absence of perhaps as an adaptation to the milk-dependent early post- any obvious malformations was recently reported following a natal period in mammals. targeted deletion of the Hoxd antisense growth-associated long noncoding RNA (lncRNA) Haglr in mice. This midget (Mdgt) Author contributions: J.Z. and D.D. designed research; J.Z., F.D., and B.M. performed phenotype, which was recorded in homozygous-mutant specimens research; J.Z., F.D., B.M., A.N., and D.D. analyzed data; and J.Z. and D.D. wrote the paper. (3), displayed a reduced viability attributed to a function of the Reviewers: N.B., University of Manchester; and N.K., Cornell University. lncRNA distinct from those associated with either Hoxd1 (4, 5) or The authors declare no conflict of interest. Hoxd3 (6, 7), the two genes flanking Haglr in the HoxD cluster. This open access article is distributed under Creative Commons Attribution- Therefore, in these cases, both recessive and dominant phenotypes NonCommercial-NoDerivatives License 4.0 (CC BY-NC-ND). were recorded, and they were always associated with loci located in Data deposition: The data reported in this paper have been deposited in the Gene Ex- pression Omnibus (GEO) database, https://www.ncbi.nlm.nih.gov/geo (accession no. the anterior (telomeric) part of the HoxD gene cluster. In addition, GSE103086). other HoxD alleles showed midgut patterning defects, but their 1Present address: Laboratory of Biometry and Evolutionary Biology, CNRS, University detailed analyses were made difficult by lethality at birth (8). Finally, Claude Bernard Lyon 1, 69662 Villeurbanne, France. distant cis-acting regulatory regions necessary for the transcriptional 2To whom correspondence should be addressed. Email: [email protected]. control of these genes in midgut were reported within the large This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. regulatory landscape flanking this gene cluster on its telomeric 1073/pnas.1712511114/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1712511114 PNAS Early Edition | 1of10 Downloaded by guest on October 4, 2021 transcription or mRNA stabilization rather than from a direct ef- difference (Table 1). It is noteworthy that, once growth of mutant fect of the lncRNA as previously reported (11). As many of the animals resumed, it reached slopes similar to those of their wild- severely stunted mutant mice largely recovered after weaning, we type siblings weeks before. Therefore, while strong growth re- hypothesize that the suckling period and its particular physiological tardation occurred during milk feeding, growth could catch up requirements may vitally depend on the function of the Hoxd3 after weaning in the surviving specimens. gene in the gut. Previously, we had observed in various alleles carrying partial deletions in the HoxD cluster (13) that the remaining gene located Results next to the breakpoint after the deletion had occurred was likely to Gain of Function-Dependent Growth Retardation. Hoxd deficiencies adopt some of the expression specificities of the deleted genes. have been used extensively to study the complex regulation of this This observation, along with the dominant inheritance pattern of gene cluster (12). One of them involving the DNA interval from this Del(1–9) stock, strongly suggested a gain-of-function mecha- – Hoxd1 to Hoxd9 [HoxDDel(1 9) or Del(1–9), discussed further be- nism, because even a full deficiency of the HoxD cluster did not low] (Fig. S1) resulted in a semilethal slow postnatal weight gain. induce such severe growth retardation in heterozygous-mutant Heterozygous males crossed with wild-type females produced the animals (1). Therefore, we suspected Hoxd10 expression was predicted 50% proportion of wild-type normal and 50% hetero- gained in space and time and thus interfered with more anterior zygous offspring. Soon after birth, growth of half of the progeny Hox gene function following the property of posterior prevalence. lagged. Many growth-retarded individuals dropped below half their Posterior prevalence was defined as the capacity of some pos- normal siblings’ body mass and thus were killed following legal recom- terior HOX proteins to override the function of more anterior mendation. However, the majority of growth-retarded specimens ones when coexpressed in some contexts (14). As this property survived, and they were genotyped along with their killed litter- may rely upon the binding of these proteins on their DNA target mates. All growth-retarded individuals carried a Del(1–9) chro- sites, we induced a small deletion within the Hoxd10 homeobox mosome (Fig. 1A; red labels), whereas all normally growing siblings sequence in cis with the Del(1–9) deficiency by using the CRISPR/ – werewildtype(Fig.1A; green labels). Wild-type individuals showed Cas9 technology in fertilized mouse zygotes. In this HoxDDel(1 9)d10hd a peak of body growth between postnatal days (P)2 and P14, followed allele, while the same Del(1–9) deficiency was present, the adjacent by a few days of slower growth.
Load more

Recommended publications
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • UNIVERSITY of CALIFORNIA, IRVINE Combinatorial Regulation By
    UNIVERSITY OF CALIFORNIA, IRVINE Combinatorial regulation by maternal transcription factors during activation of the endoderm gene regulatory network DISSERTATION submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biological Sciences by Kitt D. Paraiso Dissertation Committee: Professor Ken W.Y. Cho, Chair Associate Professor Olivier Cinquin Professor Thomas Schilling 2018 Chapter 4 © 2017 Elsevier Ltd. © 2018 Kitt D. Paraiso DEDICATION To the incredibly intelligent and talented people, who in one way or another, helped complete this thesis. ii TABLE OF CONTENTS Page LIST OF FIGURES vii LIST OF TABLES ix LIST OF ABBREVIATIONS X ACKNOWLEDGEMENTS xi CURRICULUM VITAE xii ABSTRACT OF THE DISSERTATION xiv CHAPTER 1: Maternal transcription factors during early endoderm formation in 1 Xenopus Transcription factors co-regulate in a cell type-specific manner 2 Otx1 is expressed in a variety of cell lineages 4 Maternal otx1 in the endodermal conteXt 5 Establishment of enhancers by maternal transcription factors 9 Uncovering the endodermal gene regulatory network 12 Zygotic genome activation and temporal control of gene eXpression 14 The role of maternal transcription factors in early development 18 References 19 CHAPTER 2: Assembly of maternal transcription factors initiates the emergence 26 of tissue-specific zygotic cis-regulatory regions Introduction 28 Identification of maternal vegetally-localized transcription factors 31 Vegt and OtX1 combinatorially regulate the endodermal 33 transcriptome iii
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Functional Genomics Atlas of Synovial Fibroblasts Defining Rheumatoid Arthritis
    medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. Functional genomics atlas of synovial fibroblasts defining rheumatoid arthritis heritability Xiangyu Ge1*, Mojca Frank-Bertoncelj2*, Kerstin Klein2, Amanda Mcgovern1, Tadeja Kuret2,3, Miranda Houtman2, Blaž Burja2,3, Raphael Micheroli2, Miriam Marks4, Andrew Filer5,6, Christopher D. Buckley5,6,7, Gisela Orozco1, Oliver Distler2, Andrew P Morris1, Paul Martin1, Stephen Eyre1* & Caroline Ospelt2*,# 1Versus Arthritis Centre for Genetics and Genomics, School of Biological Sciences, Faculty of Biology, Medicine and Health, The University of Manchester, Manchester, UK 2Department of Rheumatology, Center of Experimental Rheumatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland 3Department of Rheumatology, University Medical Centre, Ljubljana, Slovenia 4Schulthess Klinik, Zurich, Switzerland 5Institute of Inflammation and Ageing, University of Birmingham, Birmingham, UK 6NIHR Birmingham Biomedical Research Centre, University Hospitals Birmingham NHS Foundation Trust, University of Birmingham, Birmingham, UK 7Kennedy Institute of Rheumatology, University of Oxford Roosevelt Drive Headington Oxford UK *These authors contributed equally #corresponding author: [email protected] NOTE: This preprint reports new research that has not been certified by peer review and should not be used to guide clinical practice. 1 medRxiv preprint doi: https://doi.org/10.1101/2020.12.16.20248230; this version posted December 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Large Scale Transgenic and Cluster Deletion Analysis of the Hoxd Complex Separate an Ancestral Regulatory Module from Evolutionary Innovations
    Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press RESEARCH COMMUNICATION where groups of genes acquired shared enhancer se- Large scale transgenic and quences acting independently of colinearity. For in- cluster deletion analysis of the stance, the early phase of Hoxd gene expression in limb buds is regulated in a colinear fashion, whereas expres- HoxD complexseparate an sion of the same genes in digits is concurrent, rather than ancestral regulatory module colinear (Nelson et al. 1996). In the HoxD complex, gene recruitment involved in from evolutionary innovations many instances the design of potent enhancer sequences, which regulate several genes at once. We proposed ear- François Spitz,1 Federico Gonzalez,1 lier that expression of four genes in developing digits was Catherine Peichel,2,3 Thomas F. Vogt,2,4 controlled by a unique enhancer that displays poor pro- Denis Duboule,1,5 and József Zákány1 moter specificity as it influenced foreign promoters when targeted to the locus (van der Hoeven et al. 1996; 1Department of Zoology and Animal Biology, University Hérault et al. 1999). Targeted deletions in the posterior of Geneva, Sciences III, 1211 Geneva 4, Switzerland; HoxD complex placed this enhancer somewhere up- 2Department of Molecular Biology, Princeton University, stream of Evx2, outside the cluster (Kondo and Duboule Princeton, New Jersey 08544, USA 1999). Likewise, several genes respond to a gut enhancer sequence that is required to form the ileo-coecal sphinc- The ancestral role of the Hox gene family is specifying ter (Zakany and Duboule 1999) and is localized either in morphogenetic differences along the main body axis.
    [Show full text]
  • 1 Single-Cell Mrna Profiling Reveals Heterogeneous
    bioRxiv preprint doi: https://doi.org/10.1101/327619; this version posted May 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Single-cell mRNA profiling reveals heterogeneous combinatorial expression of Hoxd genes during limb development Short title: Single-cell Hox combinations in developing limbs Authors : P. J. Fabre1,4,*, M. Leleu1, B. Mascrez2, Q. Lo Giudice4, J. Cobb3 and D. Duboule1,2,* Affiliations: 1School of Life Sciences, Ecole Polytechnique Fédérale, Lausanne, 1015 Lausanne, Switzerland. 2Department of Genetics and Evolution, University of Geneva, 1211 Geneva 4, Switzerland. 3Department of Biological Sciences, University of Calgary, Calgary, Canada. 4Department of Basic Neurosciences, University of Geneva, 1205 Geneva, Switzerland. KEYWORDS: Hox genes, digits, limb, development, enhancers, single-cell, transcriptome, differentiation, gene expression. *Corresponding authors: Pierre Fabre ([email protected]) and Denis Duboule ([email protected]) HIGHLIGHTS • Collinear expression of Hox genes is only weaved at the tissue scale • Enhancer-sharing to specific target genes is reduced at the single-cell level • Hoxd gene combinatorial expression is linked to distinct transcriptional signatures • In presumptive digits, Hoxd combinations follow a pseudotime trajectory 1 bioRxiv preprint doi: https://doi.org/10.1101/327619; this version posted May 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
    [Show full text]
  • Role of HOX Genes in Stem Cell Differentiation and Cancer
    Thomas Jefferson University Jefferson Digital Commons Kimmel Cancer Center Papers, Presentations, and Grand Rounds Kimmel Cancer Center 7-22-2018 Role of HOX Genes in Stem Cell Differentiation and Cancer. Seema Bhatlekar Helen F. Graham Cancer Center and Research Institute; University of Delaware Jeremy Z Fields CATX Inc. Bruce M. Boman Thomas Jefferson University; Helen F. Graham Cancer Center and Research Institute; University of Delaware; CATX Inc. Follow this and additional works at: https://jdc.jefferson.edu/kimmelgrandrounds Part of the Oncology Commons Let us know how access to this document benefits ouy Recommended Citation Bhatlekar, Seema; Fields, Jeremy Z; and Boman, Bruce M., "Role of HOX Genes in Stem Cell Differentiation and Cancer." (2018). Kimmel Cancer Center Papers, Presentations, and Grand Rounds. Paper 62. https://jdc.jefferson.edu/kimmelgrandrounds/62 This Article is brought to you for free and open access by the Jefferson Digital Commons. The Jefferson Digital Commons is a service of Thomas Jefferson University's Center for Teaching and Learning (CTL). The Commons is a showcase for Jefferson books and journals, peer-reviewed scholarly publications, unique historical collections from the University archives, and teaching tools. The Jefferson Digital Commons allows researchers and interested readers anywhere in the world to learn about and keep up to date with Jefferson scholarship. This article has been accepted for inclusion in Kimmel Cancer Center Papers, Presentations, and Grand Rounds by an authorized administrator of the Jefferson Digital Commons. For more information, please contact: [email protected]. Hindawi Stem Cells International Volume 2018, Article ID 3569493, 15 pages https://doi.org/10.1155/2018/3569493 Review Article Role of HOX Genes in Stem Cell Differentiation and Cancer 1,2 3 1,2,3,4 Seema Bhatlekar , Jeremy Z.
    [Show full text]
  • Gene Networks Activated by Specific Patterns of Action Potentials in Dorsal Root Ganglia Neurons Received: 10 August 2016 Philip R
    www.nature.com/scientificreports OPEN Gene networks activated by specific patterns of action potentials in dorsal root ganglia neurons Received: 10 August 2016 Philip R. Lee1,*, Jonathan E. Cohen1,*, Dumitru A. Iacobas2,3, Sanda Iacobas2 & Accepted: 23 January 2017 R. Douglas Fields1 Published: 03 March 2017 Gene regulatory networks underlie the long-term changes in cell specification, growth of synaptic connections, and adaptation that occur throughout neonatal and postnatal life. Here we show that the transcriptional response in neurons is exquisitely sensitive to the temporal nature of action potential firing patterns. Neurons were electrically stimulated with the same number of action potentials, but with different inter-burst intervals. We found that these subtle alterations in the timing of action potential firing differentially regulates hundreds of genes, across many functional categories, through the activation or repression of distinct transcriptional networks. Our results demonstrate that the transcriptional response in neurons to environmental stimuli, coded in the pattern of action potential firing, can be very sensitive to the temporal nature of action potential delivery rather than the intensity of stimulation or the total number of action potentials delivered. These data identify temporal kinetics of action potential firing as critical components regulating intracellular signalling pathways and gene expression in neurons to extracellular cues during early development and throughout life. Adaptation in the nervous system in response to external stimuli requires synthesis of new gene products in order to elicit long lasting changes in processes such as development, response to injury, learning, and memory1. Information in the environment is coded in the pattern of action-potential firing, therefore gene transcription must be regulated by the pattern of neuronal firing.
    [Show full text]
  • Comprehensive Epigenome Characterization Reveals Diverse Transcriptional Regulation Across Human Vascular Endothelial Cells
    Nakato et al. Epigenetics & Chromatin (2019) 12:77 https://doi.org/10.1186/s13072-019-0319-0 Epigenetics & Chromatin RESEARCH Open Access Comprehensive epigenome characterization reveals diverse transcriptional regulation across human vascular endothelial cells Ryuichiro Nakato1,2† , Youichiro Wada2,3*†, Ryo Nakaki4, Genta Nagae2,4, Yuki Katou5, Shuichi Tsutsumi4, Natsu Nakajima1, Hiroshi Fukuhara6, Atsushi Iguchi7, Takahide Kohro8, Yasuharu Kanki2,3, Yutaka Saito2,9,10, Mika Kobayashi3, Akashi Izumi‑Taguchi3, Naoki Osato2,4, Kenji Tatsuno4, Asuka Kamio4, Yoko Hayashi‑Takanaka2,11, Hiromi Wada3,12, Shinzo Ohta12, Masanori Aikawa13, Hiroyuki Nakajima7, Masaki Nakamura6, Rebecca C. McGee14, Kyle W. Heppner14, Tatsuo Kawakatsu15, Michiru Genno15, Hiroshi Yanase15, Haruki Kume6, Takaaki Senbonmatsu16, Yukio Homma6, Shigeyuki Nishimura16, Toutai Mitsuyama2,9, Hiroyuki Aburatani2,4, Hiroshi Kimura2,11,17* and Katsuhiko Shirahige2,5* Abstract Background: Endothelial cells (ECs) make up the innermost layer throughout the entire vasculature. Their phe‑ notypes and physiological functions are initially regulated by developmental signals and extracellular stimuli. The underlying molecular mechanisms responsible for the diverse phenotypes of ECs from diferent organs are not well understood. Results: To characterize the transcriptomic and epigenomic landscape in the vascular system, we cataloged gene expression and active histone marks in nine types of human ECs (generating 148 genome‑wide datasets) and carried out a comprehensive analysis with chromatin interaction data. We developed a robust procedure for comparative epigenome analysis that circumvents variations at the level of the individual and technical noise derived from sample preparation under various conditions. Through this approach, we identifed 3765 EC‑specifc enhancers, some of which were associated with disease‑associated genetic variations.
    [Show full text]
  • Figure S1. Basic Information of RNA-Seq Results. (A) Bar Plot of Reads Component for Each Sample
    Figure S1. Basic information of RNA-seq results. (A) Bar plot of reads component for each sample. (B) Dot plot shows the principal component analysis (PCA) of each sample. (C) Venn diagram of DEGs for three time points, the overlap part of the circles represents common differentially expressed genes between combinations. Figure S2. Scatter plot of DEGs for each time point. The X and Y axes represent the logarithmic value of gene expression. Red represents up-regulated DEG, blue represents down-regulated DEG, and gray represents non-DEG. Table S1. Primers used for quantitative real-time PCR analysis of DEGs. Gene Primer Sequence Forward 5’-CTACGAGTGGATGGTCAAGAGC-3’ FOXO1 Reverse 5’-CCAGTTCCTTCATTCTGCACACG-3’ Forward 5’-GACGTCCGGCATCAGAGAAA-3’ IRS2 Reverse 5’-TCCACGGCTAATCGTCACAG-3’ Forward 5’-CACAACCAGGACCTCACACC-3’ IRS1 Reverse 5’-CTTGGCACGATAGAGAGCGT-3’ Forward 5’-AGGATACCACTCCCAACAGACCT-3’ IL6 Reverse 5’-CAAGTGCATCATCGTTGTTCATAC-3’ Forward 5’-TCACGTTGTACGCAGCTACC-3’ CCL5 Reverse 5’-CAGTCCTCTTACAGCCTTTGG-3’ Forward 5’-CTGTGCAGCCGCAGTGCCTACC-3’ BMP7 Reverse 5’-ATCCCTCCCCACCCCACCATCT-3’ Forward 5’-CTCTCCCCCTCGACTTCTGA-3’ BCL2 Reverse 5’-AGTCACGCGGAACACTTGAT-3’ Forward 5’-CTGTCGAACACAGTGGTACCTG-3’ FGF7 Reverse 5’-CCAACTGCCACTGTCCTGATTTC-3’ Forward 5’-GGGAGCCAAAAGGGTCATCA-3’ GAPDH Reverse 5’-CGTGGACTGTGGTCATGAGT-3’ Supplementary material: Differentially expressed genes log2(SADS-CoV_12h/ Qvalue (SADS-CoV _12h/ Gene Symbol Control_12h) Control_12h) PTGER4 -1.03693 6.79E-04 TMEM72 -3.08132 3.66E-04 IFIT2 -1.02918 2.11E-07 FRAT2 -1.09282 4.66E-05
    [Show full text]
  • View Conveyed by the Global Labelling
    Fabre et al. BMC Biology (2018) 16:101 https://doi.org/10.1186/s12915-018-0570-z RESEARCHARTICLE Open Access Heterogeneous combinatorial expression of Hoxd genes in single cells during limb development P. J. Fabre1,4* , M. Leleu1, B. Mascrez2, Q. Lo Giudice4, J. Cobb3 and D. Duboule1,2* Abstract Background: Global analyses of gene expression during development reveal specific transcription patterns associated with the emergence of various cell types, tissues, and organs. These heterogeneous patterns are instrumental to ensure the proper formation of the different parts of our body, as shown by the phenotypic effects generated by functional genetic approaches. However, variations at the cellular level can be observed within each structure or organ. In the developing mammalian limbs, expression of Hox genes from the HoxD cluster is differentially controlled in space and time, in cells that will pattern the digits and the forearms. While the Hoxd genes broadly share a common regulatory landscape and large-scale analyses have suggested a homogenous Hox gene transcriptional program, it has not previously been clear whether Hoxd genes are expressed together at the same levels in the same cells. Results: We report a high degree of heterogeneity in the expression of the Hoxd11 and Hoxd13 genes. We analyzed single-limb bud cell transcriptomes and show that Hox genes are expressed in specific combinations that appear to match particular cell types. In cells giving rise to digits, we find that the expression of the five relevant Hoxd genes (Hoxd9 to Hoxd13) is unbalanced, despite their control by known global enhancers. We also report that specific combinatorial expression follows a pseudo-time sequence, which is established based on the transcriptional diversity of limb progenitors.
    [Show full text]