Kinase Regulation of HOX Transcription Factors
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Role of Hox Genes in Regulating Digit Patterning ROCÍO PÉREZ-GÓMEZ, ENDIKA HARO, MARC FERNÁNDEZ-GUERRERO, MARÍA F
Int. J. Dev. Biol. 62: 797-805 (2018) https://doi.org/10.1387/ijdb.180200mr www.intjdevbiol.com Role of Hox genes in regulating digit patterning ROCÍO PÉREZ-GÓMEZ, ENDIKA HARO, MARC FERNÁNDEZ-GUERRERO, MARÍA F. BASTIDA and MARÍA A. ROS* Instituto de Biomedicina y Biotecnología de Cantabria, CSIC–SODERCAN Universidad de Cantabria, Santander, Spain ABSTRACT The distal part of the tetrapod limb, the autopod, is characterized by the presence of digits. The digits display a wide diversity of shapes and number reflecting selection pressure for functional adaptation. Despite extensive study, the different aspects of digit patterning, as well as the factors and mechanisms involved are not completely understood. Here, we review the evidence implicating Hox proteins in digit patterning and the interaction between Hox genes and the Sonic hedgehog/Gli3 pathway, the other major regulator of digit number and identity. Currently, it is well accepted that a self-organizing Turing-type mechanism underlies digit patterning, this being understood as the establishment of an iterative arrangement of digit/interdigit in the hand plate. We also discuss the involvement of 5’ Hox genes in regulating digit spacing in the digital plate and therefore the number of digits formed in this self-organizing system. KEY WORDS: limb development, Hox gene, digit patterning, Shh, Gli3 Introduction and Meyer, 2015). The digits are crucial elements for the function of the limb. They The basic plan of the tetrapod limb includes three distinct can be viewed as serial identical structures arranged along the proximo-distal (PD) segments: the stylopod (arm), the zeugopod antero-posterior (AP) axis of the autopod, thumb to little finger, or (forearm) and the autopod (hand/foot). -
Gabriel Dover)
Dear Mr Darwin (Gabriel Dover) Home | Intro | About | Feedback | Prev | Next | Search Steele: Lamarck's Was Signature Darwin Wrong? Molecular Drive: the Third Force in evolution Geneticist Gabriel Dover claims that there is a third force in evolution: 'Molecular Drive' beside natural selection and neutral drift. Molecular drive is operationally distinct from natural selection and neutral drift. According to Dover it explains biological phenomena, such as the 700 copies of a ribosomal RNA gene and the origin of the 173 legs of the centipede, which natural selection and neutral drift alone cannot explain. by Gert Korthof version 1.3 24 Mar 2001 Were Darwin and Mendel both wrong? Molecular Drive is, according to Dover, an important factor in evolution, because it shapes the genomes and forms of organisms. Therefore Neo-Darwinism is incomplete without Molecular Drive. It is no wonder that the spread of novel genes was ascribed to natural selection, because it was the only known process that could promote the spread of novel genes. Dover doesn't reject the existence of natural selection but points out cases where natural selection clearly fails as a mechanism. Molecular drive is a non-Darwinian mechanism because it is independent of selection. We certainly need forces in evolution, since natural selection itself is not a force. It is the passive outcome of other processes. It is not an active process, notwithstanding its name. Natural selection as an explanation is too powerful for its own good. Molecular drive is non-Mendelian because some DNA segments are multiplied disproportional. In Mendelian genetics genes are present in just two copies (one on the maternal and one on the paternal chromosome). -
Homeobox Gene Expression Profile in Human Hematopoietic Multipotent
Leukemia (2003) 17, 1157–1163 & 2003 Nature Publishing Group All rights reserved 0887-6924/03 $25.00 www.nature.com/leu Homeobox gene expression profile in human hematopoietic multipotent stem cells and T-cell progenitors: implications for human T-cell development T Taghon1, K Thys1, M De Smedt1, F Weerkamp2, FJT Staal2, J Plum1 and G Leclercq1 1Department of Clinical Chemistry, Microbiology and Immunology, Ghent University Hospital, Ghent, Belgium; and 2Department of Immunology, Erasmus Medical Center, Rotterdam, The Netherlands Class I homeobox (HOX) genes comprise a large family of implicated in this transformation proces.14 The HOX-C locus transcription factors that have been implicated in normal and has been primarily implicated in lymphomas.15 malignant hematopoiesis. However, data on their expression or function during T-cell development is limited. Using degener- Hematopoietic cells are derived from stem cells that reside in ated RT-PCR and Affymetrix microarray analysis, we analyzed fetal liver (FL) in the embryo and in the adult bone marrow the expression pattern of this gene family in human multipotent (ABM), which have the unique ability to self-renew and thereby stem cells from fetal liver (FL) and adult bone marrow (ABM), provide a life-long supply of blood cells. T lymphocytes are a and in T-cell progenitors from child thymus. We show that FL specific type of hematopoietic cells that play a major role in the and ABM stem cells are similar in terms of HOX gene immune system. They develop through a well-defined order of expression, but significant differences were observed between differentiation steps in the thymus.16 Several transcription these two cell types and child thymocytes. -
Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7 -
UNIVERSITY of CALIFORNIA, IRVINE Combinatorial Regulation By
UNIVERSITY OF CALIFORNIA, IRVINE Combinatorial regulation by maternal transcription factors during activation of the endoderm gene regulatory network DISSERTATION submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biological Sciences by Kitt D. Paraiso Dissertation Committee: Professor Ken W.Y. Cho, Chair Associate Professor Olivier Cinquin Professor Thomas Schilling 2018 Chapter 4 © 2017 Elsevier Ltd. © 2018 Kitt D. Paraiso DEDICATION To the incredibly intelligent and talented people, who in one way or another, helped complete this thesis. ii TABLE OF CONTENTS Page LIST OF FIGURES vii LIST OF TABLES ix LIST OF ABBREVIATIONS X ACKNOWLEDGEMENTS xi CURRICULUM VITAE xii ABSTRACT OF THE DISSERTATION xiv CHAPTER 1: Maternal transcription factors during early endoderm formation in 1 Xenopus Transcription factors co-regulate in a cell type-specific manner 2 Otx1 is expressed in a variety of cell lineages 4 Maternal otx1 in the endodermal conteXt 5 Establishment of enhancers by maternal transcription factors 9 Uncovering the endodermal gene regulatory network 12 Zygotic genome activation and temporal control of gene eXpression 14 The role of maternal transcription factors in early development 18 References 19 CHAPTER 2: Assembly of maternal transcription factors initiates the emergence 26 of tissue-specific zygotic cis-regulatory regions Introduction 28 Identification of maternal vegetally-localized transcription factors 31 Vegt and OtX1 combinatorially regulate the endodermal 33 transcriptome iii -
Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1. -
Hox Gene Variation and Evolution
news and views annually degasses about 1 gigatonne (109 not nitrate exhaustion. on the microbial algae. The growth perfor- tonnes) of CO2 (ref. 3), equivalent to 20 per Yet the paradox persists. Virtually all phy- mance of the diatoms is all the more surpris- cent of current anthropogenic output. The toplankton species, including the picoplank- ing as nitrate reduction requires energy regression lines and intercepts of dissolved ton, are able to use nitrate; indeed, phyto- and the mediating enzyme contains iron. inorganic carbon, silicate and nitrate con- plankton other than diatoms routinely Indeed, why diatoms can be so much more centrations, measured in the upper 200 m of exhaust nitrate in the surface waters of the efficient than the other algae despite the the EUZ, indicate that silicate availability non-HNLC ocean. So why does this not hap- nitrate handicap needs to be explained. regulates both carbon and nitrate uptake pen in the EUZ and other low-silicate HNLC Balancing pelagic ecosystem budgets is and fate. The slope of the highly significant regions? Differences in grazing pressure still an art because we know so little about the 5 regression between nitrate and silicate is 1, have been proposed as an explanation . One abilities and predilections of the organisms8 which coincides with the known require- widely held view is that the small algae of the and their interactions with one another5. ment of these two elements by diatoms. The microbial loop are kept in check by heavy Whatever the outcome of studies on the lim- intercept represents the excess nitrate (about grazing pressure, whereas diatoms, because iting factors in the various HNLC regions 4 mmol m–3) that confers HNLC status on of their larger size (and possibly also the pro- and their subsystems, the status of diatoms as the EUZ. -
SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line -
Large Scale Transgenic and Cluster Deletion Analysis of the Hoxd Complex Separate an Ancestral Regulatory Module from Evolutionary Innovations
Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press RESEARCH COMMUNICATION where groups of genes acquired shared enhancer se- Large scale transgenic and quences acting independently of colinearity. For in- cluster deletion analysis of the stance, the early phase of Hoxd gene expression in limb buds is regulated in a colinear fashion, whereas expres- HoxD complexseparate an sion of the same genes in digits is concurrent, rather than ancestral regulatory module colinear (Nelson et al. 1996). In the HoxD complex, gene recruitment involved in from evolutionary innovations many instances the design of potent enhancer sequences, which regulate several genes at once. We proposed ear- François Spitz,1 Federico Gonzalez,1 lier that expression of four genes in developing digits was Catherine Peichel,2,3 Thomas F. Vogt,2,4 controlled by a unique enhancer that displays poor pro- Denis Duboule,1,5 and József Zákány1 moter specificity as it influenced foreign promoters when targeted to the locus (van der Hoeven et al. 1996; 1Department of Zoology and Animal Biology, University Hérault et al. 1999). Targeted deletions in the posterior of Geneva, Sciences III, 1211 Geneva 4, Switzerland; HoxD complex placed this enhancer somewhere up- 2Department of Molecular Biology, Princeton University, stream of Evx2, outside the cluster (Kondo and Duboule Princeton, New Jersey 08544, USA 1999). Likewise, several genes respond to a gut enhancer sequence that is required to form the ileo-coecal sphinc- The ancestral role of the Hox gene family is specifying ter (Zakany and Duboule 1999) and is localized either in morphogenetic differences along the main body axis. -
Evolutionary Developmental Biology 573
EVOC20 29/08/2003 11:15 AM Page 572 Evolutionary 20 Developmental Biology volutionary developmental biology, now often known Eas “evo-devo,” is the study of the relation between evolution and development. The relation between evolution and development has been the subject of research for many years, and the chapter begins by looking at some classic ideas. However, the subject has been transformed in recent years as the genes that control development have begun to be identified. This chapter looks at how changes in these developmental genes, such as changes in their spatial or temporal expression in the embryo, are associated with changes in adult morphology. The origin of a set of genes controlling development may have opened up new and more flexible ways in which evolution could occur: life may have become more “evolvable.” EVOC20 29/08/2003 11:15 AM Page 573 CHAPTER 20 / Evolutionary Developmental Biology 573 20.1 Changes in development, and the genes controlling development, underlie morphological evolution Morphological structures, such as heads, legs, and tails, are produced in each individual organism by development. The organism begins life as a single cell. The organism grows by cell division, and the various cell types (bone cells, skin cells, and so on) are produced by differentiation within dividing cell lines. When one species evolves into Morphological evolution is driven another, with a changed morphological form, the developmental process must have by developmental evolution changed too. If the descendant species has longer legs, it is because the developmental process that produces legs has been accelerated, or extended over time. -
Drosophila Pax6 Promotes Development of the Entire Eye-Antennal Disc, Thereby Ensuring Proper Adult Head Formation
PAPER Drosophila Pax6 promotes development of the entire COLLOQUIUM eye-antennal disc, thereby ensuring proper adult head formation Jinjin Zhua, Sneha Palliyila, Chen Ranb, and Justin P. Kumara,1 aDepartment of Biology, Indiana University, Bloomington, IN 47405; and bDepartment of Biology, Stanford University, Stanford, CA 94305 Edited by Ellen V. Rothenberg, California Institute of Technology, Pasadena, CA, and accepted by Editorial Board Member Neil H. Shubin February 17, 2017 (received for review July 26, 2016) Paired box 6 (Pax6) is considered to be the master control gene for molecular battle among GRNs allows for the subdivision of the eye development in all seeing animals studied so far. In vertebrates, eye-antennal disc to be maintained within a single continuous it is required not only for lens/retina formation but also for the cellular field (13–16). Of the GRNs that are known to operate development of the CNS, olfactory system, and pancreas. Although within the eye-antennal disc, the retinal determination (RD) Pax6 plays important roles in cell differentiation, proliferation, and network, which controls eye development, is the best studied (17). patterning during the development of these systems, the underlying At the core of the RD network lie the Paired box 6 (Pax6) genes mechanism remains poorly understood. In the fruit fly, Drosophila eyeless (ey)andtwin of eyeless (toy), the SIX family member sine melanogaster, Pax6 also functions in a range of tissues, including oculis (so), the transcriptional coactivator eyes absent (eya), and the the eye and brain. In this report, we describe the function of Pax6 in Ski/Sno family member dachshund (dac)(17). -
Reduced H3k27me3 Leads to Abnormal Hox Gene Expression In
Yu et al. Epigenetics & Chromatin (2019) 12:76 https://doi.org/10.1186/s13072-019-0318-1 Epigenetics & Chromatin RESEARCH Open Access Reduced H3K27me3 leads to abnormal Hox gene expression in neural tube defects Juan Yu1†, Lei Wang2†, Pei Pei2†, Xue Li4, Jianxin Wu3, Zhiyong Qiu2, Juan Zhang1, Ruifang Ao1, Shan Wang2*, Ting Zhang2* and Jun Xie1* Abstract Background: Neural tube defects (NTDs) are severe, common birth defects that result from failure of normal neural tube closure during early embryogenesis. Accumulating strong evidence indicates that genetic factors contribute to NTDs etiology, among them, HOX genes play a key role in neural tube closure. Although abnormal HOX gene expres- sion can lead to NTDs, the underlying pathological mechanisms have not fully been understood. Method: We detected that H3K27me3 and expression of the Hox genes in a retinoic acid (RA) induced mouse NTDs model on E8.5, E9.5 and E10.5 using RNA-sequencing and chromatin immunoprecipitation sequencing assays. Furthermore, we quantifed 10 Hox genes using NanoString nCounter in brain tissue of fetuses with 39 NTDs patients including anencephaly, spina bifda, hydrocephaly and encephalocele. Results: Here, our results showed diferential expression in 26 genes with a > 20-fold change in the level of expres- sion, including 10 upregulated Hox genes. RT-qPCR revealed that these 10 Hox genes were all upregulated in RA- induced mouse NTDs as well as RA-treated embryonic stem cells (ESCs). Using ChIP-seq assays, we demonstrate that a decrease in H3K27me3 level upregulates the expression of Hox cluster A–D in RA-induced mouse NTDs model on E10.5.