i
DEVELOPMENT OF DUCKWEED TRANSFORMATION TECHNIQUE FOR BIOLOGICAL APPLICATION
AORNPILIN JAIPRASERT
A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE MASTER DEGREE OF SCIENCE IN BIOLOGICAL SCIENCE FACULTY OF SCIENCE BURAPHA UNIVERSITY JULY 2018 COPYRIGHT OF BURAPHA UNIVERSITY ii
iii
ACKNOWLEDGEMENT
In the success of this thesis, I would like to express my sincere gratitude and deep appreciation to my advisor, Dr. Salil Chanroj for support, attention, motivation, technical assistance, helpful suggestion and comment, and encouragement throughout my study. I would like to thank Assistant Professor Dr. Waranyoo Phoolcharoen from Department of Pharmacognosy and Pharmaceutical Botany, Faculty of Pharmaceutical Sciences, Chulalongkorn University, Dr. Wasinee Pongprayoon from Department of Biology, and Dr. Somchart Maenpuen, Department of Biochemistry, Faculty of Science, Burapha University for all of their guidance and valuable advice throughout the examination. Great appreciation is also given to Biological Science Graduate Program, Department of Biotechnology for laboratory facilities. I would like to thank Microscopic center, Faculty of Science for technical assistance on fluorescence microscope. I also would like to thank National Research Council of Thailand and Burapha University for the financial support. Finally, a great respect is brought to my parents and my family for their loving, take caring, attention, encouragement, guidance and supporting throughout my study. I specially thank to all lecturers of Department of Biotechnology and Department of Biology and all of my friends for their kindness, support, suggestion, encouragement, and friendship.
Aornpilin Jaiprasert
iv
56910051: MAJOR: BIOLOGICAL SCIENCE; M.Sc. (BIOLOGICAL SCIENCE) KEYWORDS: DUCKWEEDS/ IDENTIFICATION/ CULTIVATION/ FLOWERING/ TRANSFORMATION AORNPILIN JAIPRASERT: DEVELOPMENT OF DUCKWEED TRANSFORMATION TECHNIQUE FOR BIOLOGICAL APPLICATION. ADVISORY COMMITTEE: SALIL CHANROJ, Ph.D. 150 P. 2018.
Plants are important as global energy and food sources, especially during the situation where the world population is rapidly increasing. Though the genetically modified crops such as maize and soybean are commercial available, these crops encounter several limitations, including long harvesting period, taking up land space, and requiring an extensive investment. Consequently, constructing genetically modified plants that can be cultivated in limited space and short-time life cycles is desirable. Duckweeds are one of the promising choices due to their rapid biomass duplication and high carbohydrate and protein contents. Nevertheless, the basic information and gene transformation technique in duckweeds are poorly described. Therefore, the main objectives of this research are studying the fundamental of duckweed biology, analyzing their biochemical composition and developing the simple method for genetic transformation of duckweeds. Three species of duckweeds found in Burapha University, Chon-Buri, Thailand, were characterized, including Spirodela polyrhiza, Lemna aequinoctialis and Wolffia globosa. They were subsequently surfaced sterilized using NaClO and successfully cultured axenically in the laboratory. When grown in Hoagland’s E medium, their doubling times were 2.4 days (L. aequinoctialis), 3.2 days (S. polyrhiza), and 3.6 days (W. globosa), respectively. Interestingly, of all duckweeds, S. polyrhiza was able to accumulate carbohydrate and protein content upto 40.7% and 31.4%, respectively. In contrast, the highest level of carbohydrate content in L. aequinoctialis was only 6.9% compensated for its fastest growth. Furthermore, addition of salicylic acid, a plant growth regulator, to the culture media triggered flowering in S. polyrhiza. The floral structure of S. polyrhiza was incomplete, lacking of petal and sepal, but was a perfect flower v
having one pistil and two stamens. Agrobacterium-mediated transformation was performed to genetically modify S. polyrhiza by agroinfiltration of its turions, specialized fronds. Intriguingly, vacuum infiltration for 5 min yielded the highest transformation frequency as shown by the detection frequency of Bar and Egfp up to 75% and the observation of GFP fluorescence signals in the first generation of transgenic duckweeds (T1). Nevertheless, the transgenes were apparently lost during vegetative proliferation as shown by the reduction of the detection frequency of Bar and Egfp to 50% and 0%, respectively, in T2 (the second generation of transgenic duckweeds). Altogether, the striking superiority of S. polyrhiza, including rapid growth, high carbohydrate and protein content, inducible flowering, a simple transformation protocol, and an availability of its genomic DNA sequence, will make this duckweed as a versatile tool in biotechnology to cope with the world’s challenging problems, especially food and energy security, in the near future.
vi
CONTENTS
Page
ABSTRACT iv CONTENTS vi LIST OF TABLES xii LIST OF FIGURES xiii CHAPTER 1. INTRODUCTION 1 1.1 Objectives 2 1.2 Benefits expected to receive 2 1.3 Scope of the study 2 2. LITERATURE REVIEWS 2.1 Duckweeds 4 2.1.1 Classification 4 2.1.2 Growth 5 2.1.3 Reproduction 5 2.2 Molecular identification of duckweeds 6 2.3 Duckweeds surface sterilization 7 2.4 Tissue culture media 8 2.4.1 The composition of tissue culture media 8 2.4.2 Media formulas 9 2.5 The chemical compositions of duckweeds 12 2.6 Applications of duckweeds 13 2.7 Genetic transformation and transgenic plants 14 2.7.1 Physical gene transfer method 14 2.7.2 Chemical gene transfer method 15 2.7.3 Biological or vector gene transfer method 16 2.7.3.1 Gene transfer by Agrobacterium tumefaciens 16
vii
CONTENTS (CONTINUED)
Chapter Page
2.7.3.2 Agrobacterium mediated genes transfer in Monocotyldon and dicotyledon 18 2.8. Developing techniques for duckweed transformations 19 2.8.1 Flowering induction of duckweeds 19 2.8.1.1 Plant growth regulator 19 2.8.1.2 Photoperiodism 19 2.8.1.3 Stress conditions 20 2.8.1.4 Floral dip transformation 21 2.8.2 Callus induction 21 2.8.2.1 Factors affecting callus induction 22 2.8.2.2 Gene transfer into callus 23 2.8.3 Turions induction 24 2.8.3.1 Agroinfiltration 24 3. MATERIALS AND METHOD 26 3.1 Plant material preparation 28 3.2 Identification of duckweeds species 28 3.2.1 DNA extraction 28 3.2.2 DNA Amplification and Sequencing 29 3.3 Cultivation of duckweeds in the laboratory 29 3.3.1 Optimization of duckweeds surface sterilization 29 3.3.2 Optimization of media for duckweeds cultivation 30 3.4 Biochemical analyses 31 3.4.1 Carbohydrate analysis 31 3.4.2 Protein analysis 32 3.4.3 Oxalate analysis 33 3.5 Preparation of the transformation vector, Agrobactim 33 3.5.1 Growth analysis of transformed A. tumefaciens GV-3101 34
viii
CONTENTS (CONTINUED)
Chapter Page
3.5.2 Ceftriaxone tolerance of transformed A. tumefaciens GV-3101 34 3.6 Genetic transformation of duckweeds 35 3.6.1 Preparation of target tissues 35 3.6.1.1 Induction of flowering in S. polyrhiza (BUU1) 35 3.6.1.2 Induction of callus in S. polyrhiza and L. aequinoctialis 36 3.6.1.3 Induction of turion formation in S. polyrhiza 36 3.6.2 DNA transformation of duckweed 36 3.6.2.1 Herbicide (glufosinate) resistance of target tissue of duckweed 37 3.6.2.2 Turion transformation by Agroinfiltration 37 3.6.3 Verification of transgenic duckweeds 38 3.6.3.1 Genotyping by PCR technique 38 3.6.3.2 EGFP expression 39 3.7 Statistical analysis 39 4. RESULT 40 4.1 Identification of duckweeds species in Burapha University 40 4.1.1 Characterization of duckweed isolates 40 4.1.2 Identification of duckweed species by PCR technique 42 4.2 Cultivation of duckweeds in the laboratory 43 4.2.1 Optimization of surface sterilization regime 43 4.2.2 Optimal medium for culturing duckweeds 48 4.3 Carbohydrate, Protein and Oxalate content in duckweeds 50 4.3.1 Carbohydrate content in duckweeds 50 4.3.2 Protein content in duckweeds 51 4.3.3 Oxalate content in duckweeds 52 4.3.4 Biochemical composition of duckweeds 53 ix
CONTENTS (CONTINUED)
Chapter Page
4.4 Growth of Agrobacterium 54 4.4.1 Growth of A. tumefaciens GV-3101 54 4.4.2 Effect of ceftriaxone on growth of A. tumefaciens GV-3101 harboring pB7WG and pB7WG2D-X 56 4.5 Duckweed transformation 58 4.5.1 Preparation of target tissues 58 4.5.1.1 Induction of flowering in S. polyrhiza 58 4.5.1.2 Induction of callus 63 4.5.1.3 Induction of turions 65 4.5.2 Effect of herbicide on target tissues 67 4.5.2.1 Effect of glufosinate on growth of S. polyrhiza 67 4.5.2.2 Effect of glufosinate on growth of L. aequinoctialis 67 4.5.2.3 Effect of glufosinate on regeneration of turions from S. polyrhiza 67 4.5.2.4 Effect of glufosinate on regeneration of callus from L. aequinoctialis 68 4.5.3 Turions transformation by Agroinfiltration 72 4.5.4 Verification of transgenic duckweeds 73 4.5.4.1 Genotyping by PCR technique 73 4.5.4.2 Observation of Egfp expression 75 5. DISCUSSION AND CONCLUSIONS 77 5.1 Species of duckweeds in Burapha University 77 5.2 Surface sterilization of duckweeds 78 5.2.1 Surface sterilization of S. polyrhiza and L. aequinoctialis 78 5.2.2 Surface sterilization of W. globosa 79 5.3 Culture of duckweeds in the laboratory 79 5.3.1 Hoagland’s E is a universal medium for duckweeds 79 x
CONTENTS (CONTINUED)
Chapter Page
5.3.2 L. aequinoctialis is the fastest growing duckweed in the laboratory 80 5.4 Carbohydrate, Protein and Oxalate content in duckweeds 80 5.4.1 S. polyrhiza and W. globosa have high carbohydrate and protein content 80 5.4.2 L. aequinoctialis has high protein content but low in carbohydrate 81 5.4.3 All three species of duckweed have significant amount of oxalate 81 5.4.4 Duckweeds as alternative food and energy sources 82 5.5 Optimization of Agrobacterium growth and growth inhibition 82 5.6 Salicylic acid induces flowering in S. plyrhiza 83 5.7 2,4-D induces callus formation in L. aequinoctialis 84 5.8 Starvation induces turion formation in S. plyrhiza 85 5.9 Herbicide tolerance of target tissues 85 5.10 Turion transformation by Agroinfiltration 86 5.10.1 Optimization of transformation protocol 86 5.10.1.1 Agrobacterium strains 86 5.10.1.2 Surfactants 87 5.10.1.3 Acetosyringone 87 5.10.1.4 Co-cultivation time 87 5.10.1.5 Vacuum infiltration 88 5.10.2 Verification of transformation 88 5.10.3 Transmission of transgenes 89 5.11 Conclusion & Significance 89 REFERENCES 90
xi
CONTENTS (CONTINUED)
Chapter Page
APPENDIX 105 Appendix 1 106 Appendix 2 108 Appendix 3 116 Appendix 4 121 Appendix 5 125 Appendix 6 133 Appendix 7 144 BIOGRAPHY 150
xii
LIST OF TABLES
Tables Page
2-1 Common chemicals use for sterilizations 7 2-2 Inorganic nutrients 10 2-3 Composition of tissue culture media 11 2-4 The chemical compositions of duckweed 12 2-5 List of Agrobacterium mediated gene transfer in plants 18 2-6 Photoperiodism and chemicals affecting to flowering in duckweeds 21 2-7 Media and plant growth regulators used in duckweed callus induction 23 2-8 Lists of the successful agroinfiltration methods for transient gene expression in plants 25 4-1 Morphological features of members in Lemnaceae family 41 4-2 Doubling time of duckweeds grown in various media 49 4-3 Carbohydrate content of duckweeds grown in various media 51 4-4 Protein content of duckweeds grown in various media 52 4-5 Oxalate content in duckweeds grown in various media 53 4-6 Biochemical composition of duckweeds and selected plants 54 4-7 Turion regeneration (T0) and target gene detection percentage of T1 74 4-8 Percentage of transgenic fronds proliferation and gene detection of T2 75
xiii
LIST OF FIGURES
Figures Page 2-1 The Lemnaceae family. 4 2-2 Anatomy of duckweeds 6 2-3 Binding of oxalate to metal ions 13 2-4 Physical gene transfer method 15 2-5 A process of gene transfer into plants mediated by A. tumefaciens 17 2-6 The photoperiodic regulation of flowering 20 3-1 Schematic diagram of the binary vector pB7WG and pB7WG2D-X 34 4-1 Morphology of duckweeds collected from Burapha University 41 4-2 The size of amplified product from BUU1, BUU2 and BUU3 with atpF-atpH primer by PCR technique 42 4-3 Phylogenetic tree of the duckweed family 43 4-4 Effect of surface sterilization on survival rate of S. polyrhiza 45 4-5 Effect of surface sterilization on contamination rate of S. polyrhiza 45 4-6 Effect of surface sterilization on survival rate of L. aequinoctialis 46 4-7 Effect of surface sterilization on contamination rate of L. aequinoctiali 46 4-8 Effect of surface sterilization on survival rate of W. globosa 47 4-9 Effect of surface sterilization on contamination of W. globosa 47 4-10 Fronds regeneration of duckweeds cultured in Hoagland’s E media 48 4-11 Doubling time of S. polyrhiza, L. aequinoctialis and W. globosa grown in media 49 4-12 Growth of A. tumefaciens GV-3101 (Wild type) cultured in liquid LB medium 55 4-13 Growth of A. tumefaciens GV-3101 harboring pB7WG cultured xiv
in liquid LB medium 55 LIST OF FIGURES (CONTINUED)
Figures Page
4-14 Growth of A. tumefaciens GV-3101 harboring pB7WG2D-X cultured in liquid LB medium 56 4-15 Growth of A. tumefaciens GV-3101 harboring pB7WG cultured in liquid LB medium 57 4-16 Growth of A. tumefaciens GV-3101 harboring pB7WG2D-X cultured in liquid LB medium 57 4-17 Morphology of fronds and flower of S. polyrhiza 59 4-18 to 4-21The number of vegetative fronds and %flowering of S. polyrhiza 60 4-22 Effect of 3µM Salicylic acid (SA) on flowering of S. polyrhiza 62 4-23 Callus induction in S. polyrhiza and L. aequinoctialis 63 4-24 The percentage of explants forming callus in L. aequinoctialis 64 4-25 Regenaration of L. aequinoctialis frond from callus 65 4-26 Induction of turion using distilled water 66 4-27 Regeneration of turions into new fronds in Hoagland’s E media 66 4-28 Growth of S. polyrhiza grown on solid MS medium containing different concentration of glufosinate 68 4-29 Doubling time of S. polyrhiza grown on solid MS medium containing different concentrations of glufosinate 69 4-30 Growth of L. aequinoctialis grown on solid MS medium containing different concentrations of glufosinate 69 4-31 Doubling time of L. aequinoctialis grown on solid MS medium containing different concentrations of glufosinate 70 4-32 Growth of turions grown on solid MS medium containing different concentration of glufosinate 70 xv
LIST OF FIGURES (CONTINUED)
Figures Page
4-33 Number of vegetative fronds regenerated from turions 71 4-34 Proliferation of callus of L. aequinoctialis grown on solid MS medium containing different concentration of glufosinate 71 4-35 Effect of vacuum infiltration on frond regeneration 72 4-36 PCR analysis of first generation of transgenic duckweeds (T1) 71 4-37 PCR analysis of first generation of transgenic duckweeds (T2) 75 4-38 Expression of Egfp in transgenic fronds (T1) 76
1
CHAPTER 1 INTRODUCTION
1.1 Introduction Plants are important as global energy and food sources, especially during the situation where the world population is rapidly increasing. One way to cope with this problem is to genetically modify plants harboring distinctive characteristics. For example, supplementing essential amino acids to soybeans, enhancing protein content in maize, and producing disease and pest resistance in crops to reduce the pesticide usage. Though the genetically modified crops such as cassava, maize, sugarcane and soybean have specialized properties, these crops encounter several limitations, including long harvesting period, taking up land space, and high investment. Therefore, searching for the genetically modified plants that can be cultivated in limited space and short-time life cycles is desirable. Duckweeds are one of the promising choices due to their high carbohydrate (30-75%) and protein (15.02-38.6%) contents (Reid & Bieleski, 1970). Moreover, their biomass can double within 16-48 h (Pooponpan & Chantiratikul, 2010). Duckweeds are small aquatic flowering plants which are free floating on water surface. They are generally classified into the Lemnaceae family comprising 37 species in 5 genera, including Lemna, Landoltia, Spirodela, Wolffia and Wolffiella. Nowadays, duckweeds are used as food sources for aquaculture and livestock (Fasakin, Balogun, & Fasuru, 1999), phytoremediators for removing heavy metal toxics and organic compounds (Sekomo, Rousseau, Saleh, & Lens, 2012) and energy harvesters by converting solar energy into electricity as direct photosynthetic plant fuel cells (Hubenova & Motov, 2012). Furthermore, genetically modified duckweeds are used in molecular farming to produce bio-medical products (Rivals et al., 2008). Nevertheless, the gene transformation technique in duckweeds is poorly established and is considered complicated compared to the model plant species, Arabidopsis thaliana. Therefore, the main objectives of this research are to study biology and biochemistry of duckweeds and to develop the simple method for gene transformation in duckweeds. 2
1.2 Objectives 1. Identify duckweeds species collected from Burapha University. 2. Optimize duckweed culture condition in the laboratory. 3. Study biology and biochemistry of duckweeds cultured in the laboratory. 4. Develop the simple gene transformation technique in duckweeds.
1.3 Future application Developed methods for growing duckweeds in the laboratory and duckweed transformation technique from this study are essential for generating genetically modified duckweeds which can be simply and rapidly applied to molecular farming, biosensor and research in plant cell and molecular biology in the future.
1.4 Scopes of research 1. Collect three duckweed species, including Spirodela sp. (BUU1), Lemna sp. (BUU2), and Wolffia sp. (BUU3) from natural reservoirs in Burapha University, Chonburi, Thailand. 2. Identify duckweed species using morphological and nucleotide differences. 3. Optimize exposure time and concentration of surface sterilizing agents, including sodium hypochlorite, iodine solution and povidone-iodine for producing axenic culture of duckweeds. 4. Compare growth of duckweeds axenically growing in different media, including Hoagland's E-medium (E), Hoagland's E+ medium (E+), Schenk and Hildebrandt medium (SH), and Murashige and Skoog medium (MS). 5. Analyze biochemical composition of duckweeds grown in natural reservoirs and in the laboratory, including carbohydrate, protein, and oxalate content. 6. Study the effect of photoperiod and concentration of salicylic acid on flowering in duckweeds. 7. Optimize 2,4-D concentration for callus induction in duckweeds. 8. Study the effect of starvation on turion formation in duckweeds. 3
9. Transform duckweeds by vacuum infiltration method using Agrobacterium tumefaciens GV-3101 as a mediator. 10. Analyze transformed duckweeds using genetic, molecular and cellular approaches.
4
CHAPTER 2 LITERATURE REVIEWS
2.1 Duckweeds Duckweeds are small aquatic monocotyledons floating on the surface of the water (Landolt & Kandeler, 1987). Their leaves look like small plates or cube green ovals called fronds or thalli which are the combination of both stems and leaves. Furthermore, they can reproduce sexually (flowering and seeds) and asexually (vegetative fronds). 2.1.1 Classification The Lemnaceae family, commonly called duckweeds, comprises 37 species and 5 genera according to frond structures and number of roots, including Spirodela, Landoltia, Lemna, Wolffiella and Wolffia (Figure 2-1). For example, Spirodela has several roots, but Wolffia without roots (Armstrong, 2004).
Figure 2-1 The Lemnaceae family. a) Members of the family Lemnaceae and b) Representatives of duckweeds from different genera. (Adapted from Klaus, Nikolai, & Eric, 2013) 5
2.1.2 Growth Duckweeds can adapt to a range variety of climate zone. Most of them are found in the moderate climate zones such as tropical and temperate zones. Interestingly, many duckweed species are able to survive in such an extreme condition. They generally grow faster in the tropical environment. The growth and development of duckweeds depend on many factors, including nutrients, pH, and temperature. However, pH tolerant limitations are different from species to species. Stephenson et al. (1980) reported that duckweed exhibited optimum growth in a medium ranging between pH 5.0 – pH 7.0. In addition, some species of duckweeds can survive at low temperature by forming special fronds called “turions” which sink into the bottom of the pond where they remain dormant until the warm water triggers their regeneration. 2.1.3 Reproduction Duckweeds can undergo either asexual (vegetative fronds) or sexual (flowering and seeds) reproduction. Asexual reproductions in most species of duckweeds are vegetative propagations by the formation of daughter fronds from two pockets on each side of the narrow end of the frond (reproductive pouches). Newly formed fronds remain attached to their mother frond during their initial growth and appear to consist of several fronds when they are completely grown (Gaigher & Short, 1986). Though the sexual reproduction of duckweeds results in the production of flowers and seeds, their flowers are very small and surrounded by the spathe. These flowers are bisexual and usually protogynous. The androecium consists of 1 or 2 stamens, while the gynoecium consists of a single pistil in which its ovary contains 1-4 ovules (Figure 2-2). The fruit is a utricle, and seeds are smooth or ribbed (Armstrong, 2007). Nevertheless, the flowering of duckweeds is not commonly observed as the maturation of duckweeds is rare in nature and required various factors such as plant growth regulators, day light, photoperiod, temperature, and stress conditions. It has been shown previously that growth media composition affected the flowering of duckweeds. Tanaka and Cleland (1980) demonstrated that Lemna gibba + G3 flowered when grown in half-strength Hutner’s medium depleting of NH4 . Interestingly, the flowering rate was increased when grown under continuous light 6
(24 h) and supplemented with 10 µM salicylic acid (Cleland & Ben-Tal, 1982). These studies suggested that there are several factors stimulating the flowering of duckweeds. Therefore, most species of duckweeds always reproduce by asexual reproduction unless the right condition has been met, they will undergo sexual reproduction. Duckweed flowers
Figure 2-2 Anatomy of duckweeds. a) Structure of duckweeds and b) Duckweed flowers. (Adapted from Armstrong, 2007)
2.2 Molecular identification of duckweeds Duckweeds comprise 37 species, yet they are tiny and closely-related in, especially among the same genus. Furthermore, taxonomic classification of duckweeds by using their flower is difficult and taking time. Thus, the new molecular technique called “DNA barcoding” has been developed for quick, accuracy and reliable identification. The DNA barcodes refer to a standardized short sequence of DNA ranged between 400 and 800 bp. The process of DNA barcoding comprises two basic steps: (1) building the DNA barcode library of known species and (2) matching the barcode sequence of the unknown sample against the barcode library for identification (Kress & Erickson, 2012). Wang et al. (2010) had developed a simple and rapid DNA-based molecular identification system for duckweeds based on sequence polymorphism. There were seven candidate sequences used as barcoding markers such as rpoB, rpoC1, rbcL, matK, atpF-atpH, psbK-psbI and trnH-psbA. After compared these markers, authors 7
suggested that the atpF-atpH noncoding spacer was the most likely universal DNA barcoding marker for species-level identification of duckweeds.
2.3 Duckweeds surface sterilization Duckweeds grown in natural reservoirs are usually contaminated with other organisms, including bacteria, fungi, algae, protozoa, small aquatic animals, and insect larvae. Therefore, removal of contaminants is the first procedure prior to conducting axenic culture of duckweeds. There are several sterilizing agents (Table 2-1) for surface sterilization, typically depending on types of explants and plant species. For example, Lemna minor and Landotia punctata were surface sterilized by 10% clorox and washed with sterile water three times to remove an excess clorox solution (Kittiwongwattana & Vuttipongchaikij, 2013).
Table 2-1 Common chemicals used for sterilization (Gayatri & Kavyashree, 2015)
Interval Effective of Sterilizing agents Concentrations time disinfection (minute)
1. Calcium hypochlorite (CaoCl2) 9-10 5-30 Very good 2. Sodium hypochlorite (NaClO) 0.25-2.65 5-30 Very good
3. Hydrogen peroxide (H2O2) 10-12 5-15 Good 4. Bromide water 1-2 2-10 Very good 5. Iodine water 3 30 Good
6. Mercuric chloride (HgCl2) 0.1-1.0 2-10 Medium 7. Alcohol (ethyl, methyl, isopropyl) 70-95 2-5 Very good
8. Sulfuric acid (H2SO4) 20-70 5-20 Very good
8
2.4. Tissue culture media The most important factor of tissue culture is media which are specifically formulated for the optimal growth and development of plants. In general, the culture medium comprises various chemicals and natural organic compounds. The selection of media composition is necessary for tissue culture of different explants and plant species. 2.4.1 The composition of tissue culture media The composition of tissue culture media can be divided into two major groups which are inorganic and organic nutrients. Inorganic nutrients contain macronutrients and micronutrients. The macronutrients are essential elements in plant cells required at high concentration while the micronutrients are minor elements for plant cells and tissue growth (Table 2-2) Organic compounds (Saad & Elshahed, 2012) 1. Carbon sources Several sugars play an important role in growth and development of plants, such as sucrose, glucose, fructose, maltose, and galactose. Generally, sucrose is used as a carbon source at a concentration of 2-5%. 2. Vitamins Most plants are able to synthesize the essential vitamins for their growth, however, supplementation of vitamins boosts plant growth and development. Vitamins normally required for the cell and tissue culture media are thiamin (B1), a co-enzyme of organic acid metabolism in Kreb’s cycle; nicotinic acid (B3), a co-enzyme in light reaction; and ascorbic acid (C), the most abundant antioxidant in plants. 3. Plant growth regulators Plant growth regulators are important in plant tissue culture. They play pivotal roles in growth and development, generally classified into several groups, such as auxins, cytokinins, ethylene, and gibberellins. For example, the proportion of auxins to cytokinins can determine the type and extent of organogenesis in plant cell cultures. 9
Auxins plays a roles in cell enlargement, initiation of root and callus induction. The common auxins used in plant tissue culture media include IAA, IBA, 2,4-D, and NAA. Cytokinins commonly used in culture media such as BAP, 2iP, TDZ, kinetin and zeatin acted as cell division, induction of shoot formation, auxillary shoot proliferation and retardation of root formation. 4. Complex natural products The major complex natural products are derived from natural sources such as coconut milk, yeast extract, tomato juice, and casein hydrolysate. The specific composition is unknown but they have been used successfully in plant tissue culture media for a decade. 2.4.2 Media formulas There are many tissue culture media recipes, for example, White medium for root culture (White, 1943), B5 medium for callus culture (Gamborg, Miller, & Ojima, 1968), MS medium for plant cell culture (Murashige & Skoog, 1962), SH medium (Schenk & Hildebrandt, 1972) and Hoagland medium (Hoagland & Arnon, 1950) which are used for whole plant culture. Table 2-3 shows the composition of each tissue culture media. For duckweed cultivation, Kittiwongwattna and Vuttipongchaikij (2013) studied the effects of Murashige and Skoog (MS) and Hoagland media on the vegetative growth rate of Lemna minor and Landoltia punctata. Their results showed that under in vitro conditions, frond proliferations rates of L. minor and L. punctata grown in Hoagland medium was higher than that of MS medium (8% and 11.5%, respectively). In contrast, in ex vitro, the regeneration of frond colonies in MS medium was 22.2% (L. minor) and 17.1% (Lan. punctata) higher when compared to Hoagland medium.
10
Table 2-2 Inorganic nutrients (Silva & Uchida, 2000)
Macronutrients Functions
Nitrogen (N) A necessary part of all amino acids, nucleic acids, and chlorophyll Phosphorus (P) Playing roles in energy storage (ATP), root development, flower initiation, and fruit development
Potassium (K) Controlling the opening and closing of leaf stomates, turgor pressure, cell expansion and translocation of sugars Calcium (Ca) Contributing to the formation of cell wall, cell division, membrane permeability, and signaling Magnesium (Mg) A major constituent of the chlorophyll and a co-factor in several enzymatic reactions Micronutrients Functions Iron (Fe) A component of the heme enzyme systems Manganese (Mn) Activating several metabolic functions e.g. pyruvate carboxylase Zinc (Zn) Required in the synthesis of tryptophan, which is necessary for the formation of indole-acetic acid
Copper (Cu) Essential in several plant enzyme systems e.g. superoxide dismutase Boron (B) Essential for pollen germination and cell wall integrity
11
Table 2-3 Composition of tissue culture media (Adapted from Trigiano & Gray, 2000)
Compounds MS B5 SH White Hoagland Macronutrients in mg/L
NH4NO3 1650.00 - - - -
(NH)4H2PO4 - - 300.00 - -
NH4SO4 - 134.00 - - -
CaCl2·2H2O 332.20 150.00 151.00 - -
Ca(NO3)2·4H2O - - - 288.00 820.45
MgSO4·7H2O 370.00 250.00 400.00 737.00 492.74 KCl - - - 65.00 -
KNO3 1900.00 2500.00 2500.0 80.00 505.50
KH2PO4 170.00 - - - 136.09
NaH2PO4 - 130.50 - 16.50 -
Na2SO4 - - - 200.00 - Micronutrients in mg/L
H3BO3 6.20 3.00 5.00 1.50 2.86
CoCl2·6H2O 0.025 0.025 0.10 - -
CuSO4·5H2O 0.025 0.025 0.20 0.01 -
Na2EDTA 37.30 37.30 20.10 - -
Fe2(SO4)3 - - - 2.50 -
FeSO4·7H2O 27.80 27.80 15.00 - -
MnSO4·H2O 16.90 10.00 10.00 5.04 - KI 0.83 0.75 0.10 0.75 -
NaMoO3 - - - 0.001 -
Na2MoO4·2H2O 0.25 0.25 0.10 - 0.025
ZnSO4·7H2O 8.60 2.00 1.00 2.67 - Organics in mg/L Myo-inositol 100.00 100.00 1000.00 - - Glycine 2.00 - - 3.00 - Nicotinic acid 0.50 1.00 5.00 0.50 - Pyridoxine HCl 0.50 0.10 0.50 0.10 - Thiamin HCl 0.10 10.00 5.00 0.10 -
12
2.5. The chemical compositions of duckweeds Duckweeds grow rapidly with a short time life cycle. Their biomass can be doubled within 16-48 h. The chemical composition of duckweeds, including starch content and crude protein, can be ranged between 9.50%-13.97% and 20.50%-36.50% dry matter, respectively (Table 2-4). In addition, Zhao et al. (2014) showed that L. minor had high starch content. Thus, duckweed biomass was suggested for bioethanol production (Chen et al., 2012). Furthermore, Casal, Vermaata, and Wiegman (2000) demonstrated that the protein content in L. gibba was 20.5±0.3% or 21.3±0.1% of dry matter depending on the determination methods used in the experiment (BAC and Kjeldahl method, respectively). Due to their rich in protein content, duckweeds were used for producing feedstuff (Leng, Stambolie, & Bell, 1995). In this regard, duckweeds can be used as alternative energy and food source in the future.
Table 2-4 The chemical compositions of duckweed
Chemical compositions (% dry matter) Species Crude Starch References protein S. polyrhiza - 29.10 Rusoff, Blakney, and Culley (1980) - 23.80 Hassan and Edwards (1992) - 30.03 Fasakin et al. (1999) 11.14 - Tang, Li, Ma, and Cheng (2015) 13.97 36.20 Li, Zhang, Daroch, and Tang (2016) L. gibba - 25.20 Rusoff et al. (1980) L. perpusilla - 25.30 Hassan and Edwards (1992) L. minor - 20.50 Noor, Hossain, Bari, and Azimuddin (2000) L. aequinoctialis 11.61 - Tang et al. (2015) L. aequinoctialis 12.49 32.61 Li et al. (2016) W. columbiana - 36.50 Rusoff et al. (1980) W. arrhiza 9.50 24.30 Fujita, Mori, and Kodera (1999) 13
However, it has been showed that duckweeds usually accumulate oxalate in their special cells called idioblasts (Franceschi, 1987). Oxalate is one of the chemical components in many plant species accumulated primarily in the cells as a soluble form, but becomes insoluble crystal when it forms the complex with metal ions such as calcium (Ca), magnesium (Mg), and zinc (Zn). (Figure 2-3). Therefore, if human and animal consume high level of oxalate, this may lead to the occurrence of hyperoxaluria disease also known as the kidney stones. The idioblasts function as calcium storages by producing calcium-binding organic matrix materials regulating calcium crystal deposition in intravascular membrane system (Mazen, Zhang, & Franceschi, 2003).
Figure 2-3 Binding of oxalate to metal ions (Adapted from Makkar, Siddhuraju, & Becker, 2007)
2.6 Application of duckweeds Currently, duckweeds have been utilized in many ways. 2.6.1 Agriculture: duckweeds were used as feedstuff due to their high protein content. Fasakin et al. (1999) used protein from duckweeds (Spirodela polyrhiza (L.) Schleid) to replace protein from fish for tilapia cultivation resulted in higher growth rate and reducing cost of feedstuff production. 2.6.2 Environment: L. minor and S. polyrhiza (L.) Schleid accumulated lead up to 561 and 330 mg/g dry weight, respectively (Leblebici & Aksoy, 2011). Therefore, they can be used in phytoremediation. 2.6.3 Energy: duckweeds were proposed to be used in converting solar energy into electricity by the direct photosynthetic plant fuel cell (Hubenova & Motov, 2012) due to their rapid growth. Chen et al. (2012) could produce 30.8 g/L of ethanol from L. punctata by using pectinase and Saccharomyces cerevisiae. 14
According to their high starch content, duckweeds can be used as a novel biomass for bioethanol production. 2.6.4 Pharmaceuticals, Rival et al. (2008) used duckweeds as alternative production systems for pharmaceutical products by biosynthesizing aprotinin in transgenic duckweeds (S. polyrhiza)). The aprotinin was used to lower the systemic inflammatory response and reduce blood loss associated with cardiac surgery. Furthermore, duckweeds (L. minor) were also used as the model plant system for studying human microbial pathogenesis (Zhang et al., 2010). Plant infection model provide an advantage over animal model due to its ease, rapidity, and inexpensiveness.
2.7 Genetic transformation and transgenic plants Plant genetic transformation is a process to transfer genes of interest into organisms resulting in an insertion of a novel gene into the genome of plants. At present, scientist and plant breeder pay more attention to the recombinant DNA as a tool for plant biotechnology. For example, the development of plants that can grow in an inappropriate environment: transgenic rice transformed with AtNHX1 gene from Atriplex gmelini was able to grow in salinity soil (Ohta et al., 2002). The keys of success for transferring gene into the plants depend on various factors, including 1) target tissue of gene transformation must be able to initiate cell division or develop a plant regeneration, 2) marker gene selective agents and 3) transformation method. Currently, the transformation techniques can be divided into three groups according to gene delivery approach. 2.7.1 Physical gene transfer method 1. Microinjection method uses 0.5-1.0 µm diameter capillary glass needle or micropipettes to inject gene of interest into the nucleus or cytoplasm of protoplast and tissue. In this method, the desired gene is introduced into large cells, such as oocytes, eggs, and the cells of early embryo (Figure 2-4A). 2. Particle bombardment method or gene gun This method uses heavy- metal particles (~1 µm gold or tungsten) coated with DNA and accelerated toward the target tissue. The heavy-metal particles introduce gene into the cell with pressure 15
under the vacuum condition. This method is also useful for the transformation of organelles, such as chloroplasts, enabling the engineering of organelle-encoded herbicide or pesticide resistance in crop plants (Figure 2-4B). 3. Electroporation method is a popular method to transfer the gene into protoplasts. The dynamics of electric charge enlarge the pore size of the plasma membrane then gene of interest can be transferred into the protoplast by electric field. The plasma membrane can repair itself, subsequently initiate cell division to form callus, and eventually regenerate the whole plants (Figure 2-4C).
Figure 2-4 Physical gene transfer method A) Microinjection B) Particle bombardment and C) Electroporation. (Adapted and modified from IIT Guwahati, 2012)
2.7.2 Chemical gene transfer method Chemical gene transfer method can insert genes into plant tissue by a chemical such as PEG, poly L-ornithine, DMSO, and DEAE. These chemicals can alter cell membrane properties allowing an insertion of the gene of interest into the cells. PEG-mediated gene transfer is commonly used for gene transfer into protoplasts. The cell suspension of protoplast is co-cultured with DNA plasmid and polyethylene glycol (PEG). The PEG mediates DNA plasmid transfer into the 16
protoplasts. Subsequently, certain DNA plasmid can insert itself into the chromosome of the host cell (Mathur & Koncz, 1998). Protoplasts are then cultured under conditions that allowed them to grow cell walls, start dividing to form a callus, develop shoots and roots, and regenerate the whole plants. However, the gene transfer by physical and chemical methods has some disadvantages, for example, the particle bombardment method, when transferring a large gene, can damage DNA structure during the transfer causing insertion of several pieces of DNA into the genome resulting in decreased expression of the gene (Hansen & Wright, 1999). 2.7.3 Biological or vector gene transfer method Biological or vector gene transfer method is mediated by an organism. These genes of interest are linked with DNA in vectors. The vector then can transfer genes of interest into the plant cells. Currently, there are several vectors e.g. Agrobacterium tumefaciens, African cassava mosaic virus (Meyer, Heidmann, & Niedenhof, 1992), and Zucchini yellow mosaic virus-AGII (Arazi et al., 2002). All vectors harbor the ability to propagate genes of interest and transfer them into plant cells. 2.7.3.1 Gene transfer by A. tumefaciens 1. Biology of Agrobacterium: Agrobacterium is gram negative bacteria, non-spore forming, and rod shape in Rhizobiaceae family. It causes crown gall disease in plants. Since Agrobacteriun can transfer DNA between itself and plants, and for this reason, it has become the preferred organism for genetic engineering in plants. Agrobacteriun can be dividing into four types. - A. radiobacter (avirulence species) - A. rubi (cane gall disease) - A. rhizogenes (hairy root disease) - A. tumefaciens (crown gall disease) 2. Molecular biology of the disease: Agrobacterium can cause crown gall disease in plants by transferring their gene into wound area of plant cells directly. These genes are part of Tumor-inducing (Ti) plasmid called T-DNA. Ti plasmid contains virulence gene (Vir) which control protein production associated with T-DNA transfer such as VirA, VirB, VirC,VirD, VirE, and VirH. T-DNA consists of 17
two different groups of genes; the oncogenic genes are enzyme encoding genes involved in auxin and cytokinin production and biosynthesis of opines leading to crown gall disease in plants. Agrobacterium specifically uses opines as its carbon and nitrogen sources. Another group of genes are genes encoding enzymes for inserting DNA into plant cells. 3. Gene transferring into plants mediated by A. tumefaciens. The virulence mechanism of A. tumefaciens for causing crown gall disease in plants is shown in Figure 2-5. 1. Agrobacterium sensor-protein detects phenolic compounds such as acetocyringone released from the plant as a response to wound. 2. Phenolic compounds activate Vir gene (VirA VirB, VirC, VirD, VirE, and VirH) leading to an intimate binding between Agrobacterium and plant cells at wound site. 3. VirA protein which is an acetocyringone receptor phosphorylates VirG. Then, VirG activates another Vir proteins, including VirD. 4. VirD protein which is an endonuclease break down phosphodiester bond at right border (RB) and left border (LB) generating single strand T-DNA or t-stand. 5. All Vir proteins mediated T-DNA transfer into chromosomes of plant cells. After that, the genes on t-strand are expressed leading to rapid cell proliferation causing crown gall formation.
Figure 2-5 A process of gene transfer into plants mediated by A. tumefaciens (Adapted and modified from Komari, Ishida, & Hiei, 2004) 18
2.7.3.2 Agrobacterium mediated gene transfer in monocotyledon and dicotyledon Agrobacterium causing crown gall diseases in plants are the most widely used as a tool for plant genetic engineering producing numerous genetically modified (GM) crops such as rice, maize, canola, and tomato. In addition, Shrawat, Becker, and Lorz (2007) successfully transferred gene into Barley by using A. tumefaciens stains LBA4404 and Rashid, Yokoi, Toriyama, and Hinanta (1996) reported the success of gene transformation in indica rice which was cultivated in most parts of Asia such as China, Vietnam, Philippines, Thailand, Indonesia, India, and Srilanka in which the foreign gene was detected and expressed in F1 population. Interestingly, the success of gene transfer was dependent on plant species and A. tumefaciens stains (Yadav, Sharm, Srivastav, Desai, & Shrivastava, 2014) as reported by Koetle, Finnie, Balázs, and Van Stadena (2015) in table 2-5.
Table 2-5 List of Agrobacterium mediated gene transfer in plants
Host plants Explant types Strains used References Tulipa gesneriana L. Shoots EHA101, Wilmink, van de Ven, and Dons C58C1, (1992) LBA4404 Agapanthus praecox Callus EHA101, Suzuki, Supaibulwatana, Mii, Willd. LBA4404 and Nakano (2001)
Typha latifolia L. Callus EHA105, Nandakumar, Chen, and Rogers LBA4404 (2004) Narcissus tazzeta L. Leaves LBA4404 Lu et al. (2007)
Tricyrtis Wall. Sp. Callus EHA105 Otani et al. (2013) ‘shinonome’
As to a huge success of genetic transformation using A. tumefaciens, it is said that Agrobacterium mediated transformation is the most effective technique for producing transgenic plants.
19
2.8 Duckweed transformation 2.8.1 Flowering induction of duckweeds Duckweeds are smallest monocotyledons. Their flowering depends on several factors which are plant growth regulator, photoperiodism, temperature, and stress condition. 2.8.1.1 Plant growth regulator (Richard, 1996) Abscisic acid (ABA) is a 15-carbon sesquiterpenoid which is produced in chloroplast and other plastids via the Mevalonic acid pathway. The ABA regulates stomatal opening and closing, induction of seed storage protein, dormancy, abscission, and seed germination. Gibberellic acids (GAs) are a class of plant growth regulator and synthesized via the Mevalonic acid pathway. The GAs regulate stem growth, flowering, seed germination, dormancy, sex expression, senescence, and fruit set. Jasmonic acid (JA) promotes senescence, petiole abscission, root formation, callus growth and disease resistance. Salicylic acid (SA) induces flowering, senescence, abscission, and disease resistance. 2.8.1.2 Photoperiodism (Thomas, 1993) Photoperiodism is a plant response to the length of the day. The effect of photoperiodism is induction of the flowering in plant which can be divided into three groups (Figure 2-6). Short-day plants are flower only when the dark period is greater than a certain critical length since plants perceive the length of the dark period in order to flower. Examples of short-day plants are Trifolium repens (White clover), Campanula medium (Canterbury bells), Chrysanthemum morifolium and Fragaria ananassa (Strawberry). Long-day plants are flower only when the dark period is shorter than a certain critical length. Examples of long-day plants are Bryophyllum, Kalanchoe and Cestrum nocturnum. Day-neutral plants are plants that can flower regardless of photoperiod.
20
Figure 2-6 The photoperiodic regulation of flowering (Adapted and modified from Taiz & Zeiger, 2006)
2.8.1.3 Stress condition Starvation stress is defined as a physiological response as the plants adapt to environmental demands during starvation. Sometime, the stress conditions can trigger flowering in some plant. For example, it was shown that Lemna paucicostata flowered during starvation stress (Shimakawa et al., 2012). Further information regarding flowering induction in duckweeds was summarized in Table 2-6 (Pieterse, 2013). Vernalization is the process in which flowering is promoted by a cold treatment given to a seed or to growing plant. Without the cold treatment, plants that require vernalization show delayed flowering or remain vegetative. For example, Brassica oleracea can initiate flower during an exposure to low temperature (Richard, 1996); Arabidopsis thaliana can induce flowering when cultured in the cool place (Taiz & Zeiger, 2006).
21
Table 2-6 Photoperiodism and chemicals affecting to flowering in duckweeds
Species Inducer Effect References Wolffia microscopica Fe-EDDHA flowering in the short-day Maheswari and Seth (1966).
Lemna paucicostata EDDHA flowering in the short-day Gupta and Maheswari Fe-EDDHA flowering in the long-day (1970).
L. gibba G3 Salicylic acid flowering in the long-day Cleland and Ajami (1974). L. gibba G3 Salicylic acid flowering in the long-day Cleland and Tanaka (1979).
Spirodela polyrhiza Jasmonic acid flowering in the long-day Hrzenjak, Kristl, and (L.) Schleiden EDDHA flowering in the short-day Krajncic (2008).
2.8.1.4 Floral dip transformation Floral dip is a technique used for transferring genes into flowers via Agrobacterium mediated transformation. This method is easy, convenient and economical which can efficiently eliminate contamination commonly found in the tissue culture required for plant regeneration. The disadvantages of the floral-dip method include low transformation efficiency, a requirement of many flowers and seeds, and no specific target site. At present, this method has been successfully applied to various plant species, e.g., A. thaliana, Oryza sativa, Medicago truncatula, Camelina sativa, and Zea mays (Wongkhamprai, Sangsavang, Sriboonler, & Huehne, 2011; Rod-in, Sujipuli, & Ratanasut, 2014). 2.8.2 Callus induction Callus is the group of cells in plants that can differentiate into tissue or organ. Callus contains only parenchymal cells. Almost explants can be induced to form the callus, however the high percentage of success only found when embryo, cotyledon, shoot, and root of dicotyledon, and embryo, spathe, shoot, flower, and germ seed of monocotyledon were used as explants.
22
2.8.2.1 Factors affecting callus induction (Lkeuchi, Sugimoto, & Iwase, 2013) 1. Size and shape of explants don’t have any effect on callus induction. However, it is suggested that using small explants induced more callus formation. 2. Growth regulators, such as auxin and cytokinin, are commonly used in callus induction. The ratio of these two chemicals directly affects cell differentiation and development in plants. Generally, callus could differentiate to form root when cultured with the high ratio of auxin to cytokinin. On the other hand, if the ratio of auxin to cytokinin is low, callus would differentiate to shoot. In addition, when the ratio of auxin and cytokinin is in equilibrium, callus could differentiate into any tissues or organs. The optimum concentration of auxin and cytokinin for plant tissue culture is ranged between 0.01-10.0 mg/L and 0,1-10.0 mg/L, respectively. Nevertheless, concentration and ratio of these chemicals for callus induction depend on plant species, types of explants, and growth rate of explants. 3. Nutrients, especially amino acids, such as glutamine, aspirate, and arginin, are also added to the medium for inducing callus formation. 4. Environmental factors could affect callus formation, especially light. For callus induction, explants must be cultivated under the low intensity of light or in the dark with optimum temperature at 25°C. Interestingly, according to a previous study, callus formation in duckweeds was mostly affected by media compositions and plant growth regulators (Yang et al., 2014) as shown in table 2-7.
23
Table 2-7 Media and plant growth regulators used in duckweed callus induction
Species Regeneration Reference Basal Hormonesb mediuma Lemna gibba MS 2,4-D;2ip Chang and Chiu (1978) L.gibba SH BA Moon and Stomp (1997) L.gibba var. Hurfeish B5 TDZ Li et al.(2004) L. minor MS; Kin, IAA Stefaniak, Woźny, and Budna (2002) L. minor B5 Kin, IAA Chhabra et al (2011) Spirodela punctata 8717 WP 2ip Li et al.(2004) Spirodela oligorhiza WP TDZ Li et al.(2004) S. polyrhiza MS 2,4-D Wang ( 2016) Wolffia arrhiza SH 2,4-D , PCL Khvatkov, Chernobrovkina, Okunev, Pushin, and Dolgov (2015) a MS= Murashige and Skoog medium, SH= Schenk and Hildebrandt medium,
B5= Gamborg’s B5 medium, WP= Woody Plant medium b 2,4-D= 2,4-Dichlorophenoxyacetic, BA=N6-Benzyladenine acid, 2iP=N6-(2-Isopentenyl)adenine, TDZ=Thidiazuron, Kin= Kinetin, IAA= Indole-3-Acetic Acid (IAA), PCL = Picloram
2.8.2.2 Gene transfer into callus A technique preferred to use for plant breeding currently is gene transformation and tissue culture because all of the explants, such as leaf, root, stem, or flower, could be cultivated to generate new generation of plants through organogenesis or embryogenesis of callus due to the special property of plant cells called totipotency. As to the characteristics mentioned above, callus was extensively used for gene transformation of the target tissue. For example, Poeaim, Wongkankha, and Jayasuta (2007) demonstrated the high efficiency of gene transformation in the callus of Zoysia japonica when used 50 μM acetosyringone. Furthermore, the concentration of acetosyringone at 100 μM increased efficiency of gene 24
transformation in the callus of duckweeds (Yamamoto et al., 2001). Moreover, it has been shown that concentration of Agrobacterium at 107 cell ml-1 yielded the highest transformation efficiency of callus transformation in duckweed (L. minor) (Chhabra et al., 2011). Therefore, several factors including bacterial concentrations, inoculation time, co-cultivation time and acetosyringone concentrations directly affect the achievement of Agrobacterium-mediated transformation of duckweed calli. 2.8.3 Turion induction Turion is a morphologically different form of normal fronds, sunk to the bottom of the water body and become dormant. Turions can be distinguished from normal fronds by their smaller size, lack of aerenchyma, thicker cell wall and accumulation of starch. Turions also contain two meristematic pockets from which new vegetative fronds can develop following the germination (Appenrot, 2002). 2.8.3.1 Agroinfiltration Agroinfiltration is an effective method for rapid transformation and transient transgene expression in many plant species. Bringing A. tumefaciens into contact with susceptible host plant cells is the principle of agroinfiltration. One strategy is to conduct the vacuum infiltration, where plant tissue is submerged in a liquid suspension of A. tumefaciens and subjected to decreased pressure followed by rapid re-pressurization. This procedure is a common method for introducing bacteria to the interior of the plant tissue (Tague & Mantis, 2006). Subramanyam, Sailaja, Srinivasulu, and Lakshmidevi (2011) developed the method of gene transformation in banana CV. Rasthali (AAB) by using three A. tumefaciens strains (EHA105, EHA101, and LBA4404) via sonication and vacuum infiltration. The highest transformation efficiency was observed suckers were sonicated and vacuum infiltered for a minute with A. tumefaciens EHA105. Furthermore, vacuum infiltrated with A. tumefaciens KYRT for 2 min was found to increase transformation efficiency in Indian soybean CV. Pusa (Mariashibu et al., 2013). Hence, the Agroinfiltration method is rapid and increases the effectiveness of transformation; however, it is required explants selection and optimization of vacuum infiltrate interval. Further information according to agroinfiltration is shown in table 2-8. 25
Table 2-8 Lists of the successful agroinfiltration methods for transient gene expression in plants.
Plants Explants Agroinfiltration References method Oryza sativa L. leaves vacuum in a Andrieu et al. (2012) needleless plastic syringe
Musa acuminata L. shoot vacuum at Rustagi et al. (2015) cv. Matti (AA) 400 mmHg
Soybean seedlings sonication followed King, Finer, and Mchale by vacuum (2015)
Nicotiana benthamiana leaves vacuum in a Matsuo, Fukuzawa, and needleless plastic Matsumura (2016) syringe
Chrysanthemum leaves vacuum in a Nabeshima, Doi, and morifolium needleless plastic Hosokawa (2016) syringe
26
CHAPTER 3 MATERIALS AND METHODS
Plant materials Three duckweed species (BUU1, BUU2, and BUU3) were collected from natural reservoirs in Burapha University, Chonburi, Thailand. (GPS coordinates:
13.278699, 100.923863)
Instrument 1. Autoclave (HIRAYAMA HA-300 MII, Japan) 2. Auto pipette (GILSON, UK.) 3. Centrifuge (HERMLE Z 323 K, Germany) 4. Centrifuge (HERMLE LTD 8000 series, Germany) 5. Shaker (HEIDOLPH UNIMAX, Germany 6. Hot air oven (SHEL LAB SL 1375 FX Sheldon manufacturing. Inc) 7. Spectrophotometer (HALO SB-10-visible, Dinamica, UK.) 8 Thermocycler (MASTERCYCLER nexus Gx2 EPPENDORF, Germany)
Chemicals 1. Agrose (Vivantis, USA.) 2. Anthrone (Himedia, India) 3. 10% w/v povidone-iodine (Betadine®,Thailand) 4. Bovine serum albumin (VWR, USA.) 5. Folin Ciocalteae (Merck, Germany) 6. Glufosinate (ERABAS, Thailand) 7. 6% w/v sodium hypochlorite (Haiter®, Thailand) 8. Polyethylene glycol 9. Salicylic acid
10. TLC Silica gel 60 F254 (20x20 cm.) (MERCK, Germany) 11. Yeast extract 12. 2,4-dichloropheenoxy (2,4-D) 27
Antibiotics 1. Ampicillin (T.P. Drug laboratories, Thailand) 2. Ceftriaxone (Trixone®, L.B.S. laboratory, Thailand) 3. Gentamycin (EC. 2157789, Applichem, Germany) 4. Spectinomycin (EC.2445443, Applichem, Germany)
Culture media (Appendix 2) 1. Hoagland’s E medium (E) 2. Hoagland’s E+ medium (E+) 3. Murashige and Skoog medium (MS) 4. Schenk and Hildebrant medium (SH) 5. Flowering induction medium 6. Selective medium for transformation 7. Yeast extract mannitol medium (YEM)
28
Method 3.1 Plant material preparation Three different species of duckweeds designated as BUU1, BUU2 and BUU3 were collected from natural reservoirs at Burapha University (GPS coordinates: 13.278699, 100.923863). The duckweeds were washed with tap water three times.
3.2. Identification of duckweeds species Duckweeds are classified into 37 species. However, morphological identification at the species level is relatively difficult because of their small and similar morphological features. To cope with this problem, DNA barcode technique has been introduced to obtain better accuracy. Therefore, genetic information of duckweeds at atpF-atpH loci (Wange et al., 2010), intergenic region sequence of chloroplast genomes, was amplified, sequenced and analyzed for identifying the BUU1, BUU2 and BUU3. 3.2.1 DNA extraction (on ice) 1. BUU1 and BUU2 were surface sterilized with 0.30% sodium hypochlorite (NaClO) for 3 min, whereas BUU3 was wrapped with straining cloth before surface- sterilization by submerging in 0.30% NaClO solution for 1 min. After that, they were washed with sterile water 3 times to remove excess bleach. Each frond was placed separately on solid MS medium (Appendix 2) and cultured under 16h to expose light (16L: 8D) with an irradiance of 55 µmol.m-2s-1 from fluorescent light bulbs at 25±2° C for 14 d. 2. 0.5 g of 14 d-old sterilized duckweeds were weighed and grounded in 3 ml Edward’s buffer (Edward, Johnstone, & Thompson, 1991, Appendix 3). After that, 1.5 ml of the suspension was transferred to a microcentrifuge tube and centrifuged at 10,000 rpm for 10 min. 3. Supernatant was then transferred to a new microcentrifuge tube. Equal volume of isopropanol was added, mixed thoroughly and centrifuged at 10,000 rpm for 10 min. 29
4. Supernatant was then discarded. 500 µl of 75% ethanol was added, rinsed and centrifuged at 10,000 rpm for 5 min. 5. After supernatant was removed, the dried pellet was resuspended in
100 µl of dH2O and used as DNA template for further amplification. 3.2.2 DNA amplification and sequencing Target DNA was amplified by PCR technique using Pfu DNA polymerase (PL5201, Vivantis) and atpF-atpH primer pairs (Forward: ACTCGCACACACTCCCTTTCC; Reverse: GCTTTTATGGAAGCTTTAACAAT).
1. Reaction mixture contained Pfu DNA polymerase in 25 μl reaction volume. Each reaction mixture consisted of approximately 50 ng of template DNA, 0.2 μM of each primer (forward and reverse of atpF-atpH), 0.2 mM of dNTPs,
1X PCR buffer with 2.0 mM of MgCl2 and 2.0 U of Pfu DNA polymerase. 2. PCR was carried out in a thermal cycler (Mastercycler, Germany) for the amplification reaction with the following cycle set up: Initial 2 min denaturation at 95° C, followed by 30 cycles comprising: 20 sec denaturation at 94° C, 30 sec annealing at 55° C and 2 min extension at 72° C with the final extension of 7 min at 72° C (Appendix 4). 3. PCR products were obtained and visualized by DNA agarose gel electrophoresis technique, using ethidium bromine as a fluorescent dye. 4. Purification of target DNA from PCR products was achieved by following the protocol according to nucleic acid extraction kit (GF-1, Vivantis) and submitted for DNA sequencing (www.wardmedic.com). DNA sequences were aligned and phylogenetic tree was constructed using the UPGMA method in MEGA 6 (Tamura, Stecher, Peterson, Filipski, & Kumar, 2013) for database comparison and identification of duckweed species.
3.3 Cultivation of duckweeds in the laboratory 3.3.1 Optimization of duckweed surface sterilization Duckweeds collected from natural reservoirs were always contaminated with other organisms. The initial step prior to culturing is to eliminate other contaminants without killing duckweeds. In this experiment, the optimal time and concentration of 30
sterilizing agents, including sodium hypochlorite (NaClO) and povidone-iodine (PVP-I) were evaluated. 3.3.1.1 Surface sterilization of BUU1 and BUU2 BUU1 and BUU2 were subject to root and old frond removal and surface sterilization with different concentration of NaClO solution at 0.18%, 0.30%, 0.42%, 0.54%, 0.66% and 0.90% for 1, 3 and 5 min, respectively. After that, they were washed with sterile water 3 times to remove excess bleach for 1 min. Each frond was placed separately on solid MS medium (Appendix 2). The growth condition was the 16L: 8D photoperiod with an irradiance of 55 µmol.m-2s-1 from fluorescent light bulbs at 25±2° C for 14 d. Percentages of survival and contamination were measured and analyzed. 3.3.1.2 Surface sterilization of BUU3 Due to its small size, BUU3 was wrapped with straining cloth before surface-sterilization by submerging in different concentration of NaClO solution at 0.12%, 0.30% and 0.42 % and PVP-I solution at 0.5%, 1.0%, 1.5% and 2.0% for 30 sec and 60 sec, respectively. Surface sterilized fronds were washed with sterile water 3-5 times to remove excess sterilizing agents for 1 min. Subsequently, each frond was placed on solid MS medium to allow frond regeneration. The growth condition was 16L: 8D photoperiod with an irradiance of 55 µmol.m-2s-1 from fluorescent light bulbs at 25±2° C for 14 d. Percentages of survival and contamination were measured and analyzed. 3.3.2 Optimization of media for duckweeds cultivation There are several culture media suggested for duckweed cultivation depending on duckweed species and cultivation target (Kittiwongwattana & Vuttipongchaikij, 2013). The finding of optimal media is important for duckweed cultivation. In this experiment, four different media and two concentrations were tested for their effects on growth of each duckweed species. 1. Pre-culture step was conducted by transferring 3 surface sterilized duckweed fronds into MS solid medium and culturing for 14 d. Then, duckweeds were transiently transferred to 0.7% solid agar without nutrients for 24 h prior to cultivating in liquid medium at half-strength (0.5X) or full-strength 1X (Appendix 2). 31
2. Four media, including of E, E+, SH and MS (using distilled water as a control) were prepared at 0.5X and 1X, aliquoted to each culture glass bottle 80 ml, and sterilized with autoclave for 20 min at 121° C. 3. Three fronds of each duckweed were transferred into each medium and cultured under the 16L: 8D photoperiods with an irradiance of 55 µmol.m-2s-1 from fluorescent light bulbs at 25±2° C for 14 d. 4. The change in number of fronds and their morphological appearance in each culture media were observed and recorded by taking a photo using a digital camera (Motic SMZ-168, USA) every 2 d. The fronds proliferation rate was determined based on the doubling time (Td) according to the following equation:
:( )
n1 = total frond number at the beginning of the test (day 0) n2 = total frond number at the last of the test (day 14) t1 = time the beginning of the test t2 = time the last of the test
3.4 Biochemical analysis To use duckweeds as alternative food and energy sources, it is required to know their biochemical properties, especially carbohydrate and protein content. In this experiment, BUU1, BUU2 and BUU3 collected from natural or cultured in the laboratory were immediately ground into powder in liquid nitrogen and stored at -20° C until carbohydrate, protein and oxalate analyses were performed as the following. 3.4.1 Carbohydrate analysis The carbohydrate content can be measured by hydrolyzing the polysaccharides into simple sugars by acid and dehydrated with concentrated H2SO4 to form “Furfural”, condensing with anthrone to form a green color complex which can be colorimetrically measured at 630 nm (Hedge & Hofreiter, 1962). Therefore, 32
BUU1, BUU2 and BUU3 were collected from natural and laboratory that they were measured carbohydrate content with Anthrone method. 1. 100 mg of ground duckweed sample was transferred to a screw cap glass tube and boiled for 3 h in 5 ml of 2.5 N HCl. After, the sample cool down, 1.5 ml of the mixture was transferred to a microcentrifuge tube and centrifuged at 10,000 rpm for 5 min. 2. 500 µl of supernatant was transferred to a screw cap glass tube, added with 2 ml anthrone reagent (Appendix 3), mixed and heated for 8 min in boiling water. 3. After cool down, absorbance at 630 nm was measured, and calculated for carbohydrate content (Appendix 5) compared to those of standard starch and glucose. 3.4.2 Protein analysis The method of protein determination commonly known as Lowry’s method is widely used to determine the protein content of biological samples. The peptides bonds in proteins react with the Folin reagent, which is subsequently reduced into a blue colored substance. Thus, the concentration of protein can be determined proportional to blue color (Lowry et al., 1951). In this experiment, duckweeds were collected from natural and laboratory that were measured protein content with Lowry’s method. 1. 100 mg of ground duckweed sample was transferred to a screw cap glass tube and incubated for 3 h in 5 ml of 0.1 N HCl at room temperature (Casal et al., 2000). 1.5 ml of the mixture was transferred to a microcentrifuge tube and centrifuged at 10,000 rpm for 5 min. 2. 400 µl of supernatant was transferred to a microcentrifuge tube, added with 1 ml of reagent C. (Appendix 3), and incubated in the dark at room temperature for 30 min. 3. 100 µl of 2 N Folin-Ciocalteu reagent was added (Appendix 3) to the mixture, mixed immediately within 30 sec and incubated at room temperature for another 30 min. Absorbance at 750 nm was measured and calculated for protein content (Appendix 5) according to the standard bovine serum albumin (BSA).
33
3.4.3 Oxalate analysis Calcium oxalate crystals are prevalent in fungi and many higher plants, playing a role in calcium storage and self-defense (Ilarslan, Palmer, Imsande, & Horner, 1997). To preliminarily quantity oxalate content, duckweeds were collected from natural and laboratory that they were measured oxalate content by Thin-layer chromatography (TLC) method. 1. Ground duckweed sample, approximately 2 g and a known quantity of 1% oxalate standard were put into a screw cap glass tube. The sample was then left in a hot air oven at 50° C for 1.30 h. 2. Oxalate in the sample was then extracted and methylated using EMS solution (sulfuric acid, chloroform, and ethanol; Appendix 3) (Roughan & Slack, 1973) by adding 5 ml of EMS solution to the dried sample, and left overnight at room temperature 3. Phase separation was done by adding 1 ml of distilled water, mixing thoroughly, subsequently taking 1 ml of the lower phase (chloroform) to a microcentrifuge tube, and finally doubling its concentration by evaporation. 4. Concentrated chloroform fractions from duckweed sample and oxalate standard were spotted on the same TLC plate (TLC Silica gel 60 F254) 2 µl each Then each plate was submerged in a mobile phase, benzene, and developed until the mobile phase reached the front line.
5. Developed TLC plate was briefly submerged in hydroxylamine-FeCl3 solution (Appendix 3) and fumigated with ammonia vapor for 5 min. Processed TLC plate was left overnight at room temperature. Methyl ester derivatives of organic acids in the sample were showed up as brown colored spots on the processed TLC plate The retardation factor (Rf) and intensity of the spot was quantified using Image J program (Michael, Paulo, & Sunanda, 2004) (Appendix 5).
3.5 Preparation of the transformation vector, A. tumefaciens GV-3101 A. tumefaciens strain GV-3101 was transformed with binary vectors, pB7WG or pB7WG2D-X, harboring streptomycin-spectinomycin-resistance gene 34
(Spr), phosphinothricin acetyltransferase gene (Bar) and enhanced green fluorescent protein gene (EGfp), in which the latter was under the control of the CaMV35S promoter (Figure 3-1), by heat shock technique (Appendix 6).
Figure 3-1 Schematic diagram of the binary vector pB7WG and pB7WG2D-X
3.5.1 Growth analysis of transformed A. tumefaciens GV-3101 The 5% inoculum of A. tumefaciens GV-3101, harboring pB7WG and pB7WG2D-X, was cultured in the liquid LB medium containing 50 µg/ml gentamycin and 200 µg/ml spectinomycin and cultivated at room temperature (25±2° C) with continuous shaking at 200 rpm for 72 h. The culture medium was collected at 0, 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 36, 42, 48, 66 and 72 h for measuring absorbance at 600 nm. 3.5.2 Ceftriaxone tolerance of transformed A. tumefaciens GV-3101 A. tumefaciens GV-3101, harboring pB7WG or pB7WG2D-X, was cultured in liquid LB medium containing 50 µg/ml gentamycin in the presence of various concentration of ceftriaxone at 0, 50, 100, 250, 500 and 1,000 mg/L at room temperature (25±2° C) with continuous shaking at 200 rpm for 36 h. The culture medium was collected at 0, 6, 12, 18, 24, 30 and 36 h for measuring absorbance at 600 nm.
35
3.6 Genetic transformation of duckweeds In this experiment, agroinfiltration method was primarily developed for transferring genes in T-DNA of pB7WG into the genome of duckweeds, S. polyrhiza (BUU1), in target tissues, including flowers, calli and turions. 3.6.1 Preparation of target tissues The initial step of duckweed genetic transformation is inducing the formation of specialized tissues susceptible for infiltration and propagation which are flower, callus and turion. 3.6.1.1 Induction of flowering in S. polyrhiza (BUU1) Flowering induction requires complex interaction between growth regulators, light quality and light quantity. In this experiment, concentration of salicylic acid and photoperiod were optimized for inducing flowering in giant duckweeds. 1. Liquid flowering-induction medium was prepared and transferred to each glass bottle 80 ml (Appendix 2). Salicylic acid (SA) was added to the medium at the final concentration of 0, 1, 3 and 5 µM, respectively. The medium was sterilized at 121° C for 20 min. 2. S. polyrhiza pre-cultured on solid MS medium for 14 d were transferred to liquid E-medium and cultured under 9L: 15D photoperiod with an irradiance of 110 µmol.m-2s-1 (Cleland & Tanaka, 1979) from 5000K white light LED at 25±2° C for 8 d. 3. After acclimation for 8 d, 3-4 fronds of S. polyrhiza were transferred to liquid flowering induction medium and cultured at 25±2° C either with an irradiance of 55 µmol.m-2s-1 from fluorescent light bulbs or 110 µmol.m-2s-1 from 5000K white light LED at 0L, 16L and 24L photoperiods for 24 d. 4. Percentage of flowering and the number of vegetative fronds were counted and analyzed using images taken by the digital camera (Motic SMZ-168, USA) every 2 d. The following equation was used to calculate to %flowering (Cleland & Briggs, 1967):
%Flowering = (Number of flower in 24 d × 100) Number of fronds in 24 d 36
3.6.1.2 Induction of callus in S. polyrhiza and L. aequinoctialis Callus is an amorphous group of parenchymal cells in plants that can differentiate into tissue or organ. In this experiment, S. polyrhiza (BUU1) and L. aequinoctialis (BUU2) were induced to form callus with various concentrations of 2,4-Dichlorophenoxyacetic acid (2,4-D) from either intact plant or surgically injured plants (Stefaniak et al., 2002). 1. Solid MS medium (containing 3% sucrose and 0.8% agar) was prepared and poured into each glass bottle 30 ml. The medium was sterilized at 121° C for 20 min. After that, the filter-sterilized 2,4-D was added to the medium at final concentration of 0, 2, 3, 4 and 5 µM, respectively. 2. Explants obtained from 14 d-old stock culture (either intact or surgically injured) were sterilized with 0.18%NaClO solution for 3 min. After that, they were washed with sterile water for 3-4 times to remove excess bleach for 1 min. 3. 3-4 processed explants were placed on solid MS medium and cultivated under 16L: 8D an irradiance of 55 µmol.m-2s-1 from fluorescent light bulbs at 25±2° C for 28 d. 4. The morphological appearance in each culture media were observed and recorded by taken a photo using digital camera (Motic SMZ-168, USA) every 7 d. 3.6.1.3 Induction of turion formation in S. polyrhiza (BUU1) In starved condition, S. polyrhiza forms modified fronds to store nutrients called turions sinking to the bottom of the water body. Turions are morphologically different from fronds in which they can regenerate to form fronds when required nutrients are replenished. In this experiment, 10-15 fronds of S. polyrhiza were left to starve in distilled water and cultured under 16L: 8D photoperiods with an irradiance of 55 µmolm-2s-1 from fluorescent light bulbs at 25±2° C for 14 d. Turions formed or sunk to the bottom of the flask were observed, counted and analyzed using images taken by the digital camera (Motic SMZ-168, USA) every 2 d. 3.6.2 DNA transformation of duckweeds The methods of DNA transformation can be classified into to 3 groups consisting of physical, chemical and biological methods. In general, selection of DNA transformation method depends on the type of target tissue and available instruments. 37
In this experiment, Agrobacterium-mediated transformation was chosen due to its simplicity, reliability and inexpensiveness.
3.6.2.1 Herbicide (glufosinate) resistance of target tissue of duckweeds In this experiment, Bar gene was a selection marker of transgenic duckweeds resisting to the herbicide (glufosinate). Prior to transformation, we need to test the inhibitory effect of glufosinate on target tissues including fronds, turions and callus. 1. 5-7 fronds of target tissue were cultivated in solid MS medium containing different concentrations of glufosinate such as 0, 0.001, 0.005, 0.01, 0.05 and 0.10 mM (Appendix 3) and cultured under 16L: 8D photoperiods with an irradiance of 55 µmolm-2s-1 from fluorescent light bulbs at 25±2° C for 14 d. 2. The change in number of fronds and their morphological appearance in each culture media were observed and recorded by taking a photo using a digital camera (Motic SMZ-168, USA) every 3 d. The fronds proliferation rate was determined based on the doubling time (Td). 3. The lowest concentration of glufosinate leading to necrosis of duckweed was used to select transgenic duckweeds. 3.6.2.2 Turion transformation by Agroinfiltration 1. A. tumefaciens GV-3101 harboring pB7WG was pre-cultured on a solid LB medium and subsequently inoculated in 50 ml liquid YEM medium containing 50 µg/ml gentamycin, 200 µg/ml spectinomycin and 100 µM acetosyringone. The cultivation was done at room temperature (25±2° C) with 200 rpm shaking overnight. 2. 5% innoculum was transferred into 50 ml liquid YEM medium, shaked at 200 rpm and incubated at room temperature for 12-15 h until an absorbance at 600 nm reached approximately 2.0). 3. The culture medium was centrifuged at 5,000 rpm for 10 min. After discarding supernatant, cell pellets were resuspended in 200 ml liquid MS1 medium (MS+1%sucrose+100µM acetosyringone+ 0.2%tween-80, pH 5.84) and incubated at room temperature with 200 rpm shaking for 2 h (OD 600 ≈ 0.3-0.5). 38
4. Turions which were previously surface sterilized with 0.18% NaClO for 3 min were immerged in bacterial suspension, infiltrated under vacuum for 0, 5, 10 and 20 min, respectively, and incubated at room temperature for 30 min. 5. Infiltrated turions were blotted and dried on sterile filter paper and co-cultivated on filter paper discs soaked with 20 ml liquid MS1* medium (MS+1%sucrose+100 µM acetosyringone, pH 5.84) for 3 d (modified from Chhabra et al., 2011) under 16L: 8D photoperiods with an irradiance of 55 µmol.m-2s-1 from fluorescent light bulbs at 25±2° C 6. Co-cultivated turions were gently washed with sterile distilled water containing 500 mg/L ceftriaxone for 4-5 times using a dropper, blotted and dried on sterile filter paper. Transformed turions were then transferred to selective medium (MS3) (Appendix 2) and cultured under 16L:8D photoperiods with an irradiance of 55 µmol.m-2s-1 from fluorescent light bulbs at 25±2° C for 14 d. 8. Transgenic fronds grown in the presence of glufosinate in the selective medium were analyzed by assessing the insertion of Egfp and Bar into the duckweed genome by PCR technique using each gene specific primers. Furthermore, the expression of EGFP was confirmed using a fluorescence microscope (Olympus BX51). 3.6.3 Verification of transgenic duckweeds The binary vector pB7WG contains Bar and Egfp inserted into duckweed genome. To verify this insertion, the presence of Bar, Egfp and Actin (control) loci were genotyped with PCR technique and tested for EGFP expression using fluorescent microscope. 3.6.3.1 Genotyping by PCR technique DNA extraction (on ice) 1.The transgenic duckweed were ground in 3 ml Edward’s buffer (Edward et al., 1991, Appendix 3). After that, 1.5 ml of the suspension was transferred to a microcentrifuge tube and centrifuged at 10,000 rpm for 10 min. 2. Supernatant was then transferred to a new microcentrifuge tube. Equal volume of isopropanol was added, mixed thoroughly and centrifuged at 10,000 rpm for 10 min. 39
3. Supernatant was then discarded. 500 µl of 75% ethanol was added, rinsed, and centrifuged at 10,000 rpm for 5 min. 4. After supernatant was removed, the dried pellet was resuspended in
100 µl of dH2O and used as DNA template for further amplification. DNA amplification Target DNA was amplified by PCR using Taq DNA polymerase (PL1202, Vivantis) and primer pairs named Bar, Egfp, and ActinSP (Appendix 7) 1. Reaction mixture contained Taq DNA polymerase in 25 μl reaction volume. Each reaction mixture consisted of approximately 50 ng of template DNA,
0.2 μM of each primer, 0.12 mM of dNTPs, 1X PCR buffer with 2.0 mM of MgCl2 and 1.5 U of Taq DNA polymerase. 2. PCR was carried out in a thermal cycler (Mastercycler, Germany) for the amplification reaction with the following cycle set up: Initial 2 min denaturation at 94° C, followed by 40 cycles comprising: 30 sec denaturation at 94° C, 30 sec annealing at 60° C and 30 sec extension at 72° C with the final extension of 7 min at 72° C (Appendix 7). 3. The size of PCR products from amplification of Bar, Egfp and Actin were 400 bp, 600 bp and 400 bp, respectively. 3.6.3.2 EGFP expression EGFP expression in transgenic duckweeds was evaluated by observing the GFP fluorescence under fluorescence microscope (Olympus BX51, USA.) and non- transformed duckweeds were used as controls. The fluorescence color and intensity collected from transgenic duckweeds excited with blue light and green light were compared to evaluate whether it was an autofluorescence from chlorophyll. Images were captured using with Olympus DP22 digital camera.
3.7 Statistical analysis All experiments were repeated at least three times. Data were expressed as mean ± standard deviation (SD) or standard error of the mean (SEM) analyzed by One-way ANOVA and Tukey’s test using Minitab program (Minitab version 18). A value of p < 0.05 was considered significant difference.
40
CHAPTER 4 RESULT
4.1 Identification of duckweeds species in Burapha University
4.1.1 Characterization of duckweed isolates Duckweeds collected from natural reservoirs in Burapha University were morphologically different and assigned as BUU1, BUU2 and BUU3 (Figure 4-1A) of all isolates, fronds of BUU1 were the largest size about 5-6 mm harboring multiple roots and had reddish pigments on the lower side of each frond (Figure 4-1B-C). BUU2 had the frond size around 2-3 mm containing one root per frond (Figure 4-1D- E). Meanwhile, BUU3 were the smallest in size about 1 mm and had no root (Figure 4-1F). Morphological characteristics including frond morphology, and the presence the number of roots and size of duckweeds were used to classify duckweeds species. The presence of roots can be used to differentiate Spirodela, Landoltia and Lemna from Wolffia and Wolfiella (Armstrong, 2004) (Table 4-1). The members in genera Spirodela and Landoltia produce several roots on the lower side of each frond, while the genus Lemna produces one root per frond. Reddish pigments are accumulated in vegetative fronds of Spirodela and Landoltia species but absent in Lemna species. Therefore, the reddish pigments observed on the abaxial side of BUU1 and the larger frond size (5-6 mm) indicated that BUU1 was Spirodela not Landoltia. On the other hand, BUU2 had morphological appearances similar to Lemna spp. as shown by their solitary roots. Meanwhile, the feature of plant body and size can be used to differentiate Wolffia and Wolfiella, BUU3 was closely related Wolffia spp. because they had no root, were smallest in size and relatively globose. However, taxonomic classification of duckweeds by using morphological features is sometimes difficult because duckweeds have many species in which they are all tiny and closely related, especially among the same genus. Therefore, the molecular technique was used further identifying duckweed species due to its accuracy and reliability. 41
Figure 4-1 Morphology of duckweeds collected from Burapha University (A) Mixture of three isolates duckweed: BUU1, BUU2 and BUU3 (B-C) The upper and the lower side of BUU1 (D-E) The upper and the lower side of BUU2 (F) The upper side of BUU3 (Scale bar = 1 mm)
Table 4-1 Morphological features of members in Lemnaceae family (Armstrong, 2004) and corresponding duckweeds collected from Burapha University
Duckweed species Root Plant body Ventral Corresponding color Isolate Spirodela polyrhiza 5-16 5-10 mm Reddish BUU1 Landoltia punctata 2-5 3-5 mm Lemna minuta L. aequinoctialis solitary 2-4 mm Green BUU2 L. gibba L. minor Wolffia globosa 0.4-1.0 mm W. arrhiza no Green BUU3 (globose) W. australiana Wolffiella spp. no 3-10 mm Green - (fattened) 42
4.1.2 Identification of duckweed species by PCR technique For molecular identification of duckweed species, DNA of the polymorphic region (atpF-atpH) in the chloroplast genomes of duckweed (BUU1, BUU2 and BUU3) was amplified by PCR technique. The size of amplified fragment was approximately 700 base pairs as predicted (Appendix 4) (Figure 4-2). These fragments were subsequently compared to sequences deposited in NCBI (https://blast.ncbi.nlm.nih.gov/Blast.cgi) database. By constructing the phylogenetic tree with UPGMA method (MEGA 6), results demonstrated that BUU1 and BUU3 were Spirodela polyrhiza and Wolffia globosa (Figure 4-3). On the other hand, BUU3 was closely related to Lemna aequinoctialis distinct from Lemna minor and Lemna turionifera as shown in Figure 4-3. Taken together, morphological characters and molecular data indicated that duckweeds collected from natural reservoirs in Burapha University were S. polyrhiza, L. aequinoctialis and W. globosa.
Figure 4-2 The size of amplified product from BUU1, BUU2 and BUU3 with atpF-atpH primer by PCR technique 43
Figure 4-3 Phylogenetic tree of the duckweed family representing evolutionary relationships between BUU1, BUU2, BUU3 and other members in the Lemnaceae family. The tree was constructed using the UPGMA method based on atpF-atpH intergenic region sequences. The bootstraps are 1,000 replicates
4.2 Cultivation of duckweeds in the laboratory 4.2.1 Optimization of surface sterilization regime To cultivate duckweeds axenically in the laboratory, the surface sterilizing agent and time were optimized. NaClO solution and Povidone-iodine solution were used as sterilizing agents due to their effectiveness and availability. By varying exposure time and concentration of sterilizing agents, the optimal surface sterilization method would be obtained. S. polyrhiza submerged in NaClO solution at 0.18% (for 1, 3 and 5 min), 0.30% (for 1 and 3 min), 0.42% (for 1 and 3 min) and 0.54% (for 1 min) had the highest survival rate ranging between 77.8%-88.9%, while S. polyrhiza submerged in 0.90%NaClO for 3 and 5 min had no survival rate (Figure 4-4). Interestingly, only surface sterilization with 0.90% NaClO at 1, 3 and 5 min yielded no contaminate rate 44
(Figure 4-5). However, there were no significant differences in contaminate rate among these treatments. L. aequinoctialis submerged in NaClO solution at 0.18% (for 1 and 3 min), 0.30% (for 3 and 5 min), 0.42% (for 1 and 3 min) and 0.54% (for 1 min) had high survival rate ranging between 77.8%-88.9% whereas L. aequinoctialis submerged in 0.54% NaClO (for 5 min) and 0.90% NaClO (for 3 and 5 min) had no survival rate (Figure 4-6). However, only L. aequinoctialis submerged in NaClO solution at 0.18% (for 5 min), 0.30% (for 3 and 5 min), 0.42% (for 5 min), 054% (for 5 min), 0.66% (for 5 min) and 0.90% (for 1, 3 and 5 min) had no contamination despite there were no significant differences among these treatments (Figure 4-7). W. globosa was submerging in NaClO solution at 0.12%, 0.30% and 0.42 % for 30 and 60 sec and had survival rate ranging between 11.1%-33.3%. Also, W. globosa submerged in PVP-I solution at 0.5%, 1.0%, 1.5% and 2.0% for 30 and 60 sec had survive rates between 11.1% to 44.4% (Figure 4-8). However, all of the PVP-I solution treatments showed high contamination rate ranging between 11.1%- 77.8% but surface sterilization with 0.42% NaClO at 60 sec resulted in no contamination (Figure 4-9). Nevertheless, there were no significant differences in survival rate and contaminate rate among these treatments. .
45
100 a a a a a 90 a a a 80 ab ab 70 ab ab
60 ab
50 ab ab 40 ab %Survival %Survival 30 20 10 b b 0 1m 3m 5m 1m 3m 5m 1m 3m 5m 1m 3m 5m 1m 3m 5m 1m 3m 5m 0.18% 0.30% 0.42% 0.54% 0.66% 0.90% NaClO
Figure 4-4 Effect of surface sterilization regime (time and NaClO concentration) on survival rate of S. polyrhiza (n = 3). Different letters indicated statistically significant differences (p<0.05), bar = SEM
100 90 80
70
60 50 40 30
%Contamination %Contamination 20 10 0 1m 3m 5m 1m 3m 5m 1m 3m 5m 1m 3m 5m 1m 3m 5m 1m 3m 5m 0.18% 0.30% 0.42% 0.54% 0.66% 0.90%
NaClO
Figure 4-5 Effect of surface sterilization regime (time and NaClO concentration) on contamination rate of S. polyrhiza. (n = 3). No statistically significant differences were observed (p<0.05), bar = SEM 46
100 a a ab 90 ab ab ab ab 80 abc abc abc 70 abc abc abc 60 50
40 %Survival %Survival 30 20 bc bc 10 c c c 0 1m 3m 5m 1m 3m 5m 1m 3m 5m 1m 3m 5m 1m 3m 5m 1m 3m 5m 0.18% 0.30% 0.42% 0.54% 0.66% 0.90%
NaClO
Figure 4-6 Effect of surface sterilization regime (time and NaClO concentration) on survival rate of L. aequinoctialis (n = 3). Different letters indicated statistically significant differences (p<0.05), bar = SEM
100 90 80
70 60 50 40 30
%Contamination %Contamination 20 10 0 1m 3m 5m 1m 3m 5m 1m 3m 5m 1m 3m 5m 1m 3m 5m 1m 3m 5m 0.18% 0.30% 0.42% 0.54% 0.66% 0.90% NaClO
Figure 4-7 Effect of surface sterilization regime (time and NaClO concentration) on contamination rate of L. aequinoctialis (n = 3). No statistically significant differences were observed (p<0.05), bar = SEM 47
100 90 80 70 60 50 40 30 20 10 0
%Survival of BUU3 culturing for 14days for culturing BUU3of %Survival 30s 60s 30s 60s 30s 60s 30s 60s 30s 60s 30s 60s 30s 60s 0.12% 0.30% 0.42% 0.5% 1.0% 1.5% 2.0% NaClO NaClO NaClO PVP-I PVP-I PVP-I PVP-I
Figure 4-8 Effect of surface sterilization regime (time and NaClO and PVP-I concentration) on survival rate of W. globosa (n = 3). No statistically significant differences were observed (p<0.05), bar = SEM
100 90
80
70 60 50 40
%Contamination %Contamination 30 20 10 0 30s 60s 30s 60s 30s 60s 30s 60s 30s 60s 30s 60s 30s 60s 0.12% 0.30% 0.42% 0.5% 1.0% 1.5% 2.0% NaClO NaClO NaClO PVP-I PVP-I PVP-I PVP-I
Figure 4-9 Effect of surface sterilization regime (time and NaClO and PVP-I concentration) on contamination rate of W. globosa (n =3). No statistically significant differences were observed (p<0.05), bar = SEM 48
4.2.2 Optimal medium for culturing duckweeds Duckweeds were axenically cultured in four different liquid media, including E, E+, SH and MS medium (two concentrations: 0.5X and 1X) at 25±2° C for 14 d. The result showed that three species of duckweeds were able to grow in all media demonstrated by a decrease in doubling time compared with those grew in dH2O. New fronds emerged with in 3 d and fully developed within 5-7 d (Figure 4-10). In general, S. polyrhiza, L. aequinoctialis and W. globosa grew well in Hoagland’s E medium as shown by the short doubling time at 3.2±0.1, 2.4±0.1 and 3.6±0.4 d, respectively (Figure 4-11). However, W. globosa grew slightly better in Schenk and Hildebrandt (SH) medium with a doubling time of 3.2±0.1 d. (Table 4-2). Interestingly, L. aequinoctialis had the shortest doubling time as 2.6±0.1 d when compared the S. polyrhiza (3.6±0.7 d) and W. globosa (3.5±0.2 d) (Figure 4-11) Therefore, Hoagland-E medium tends to be the most favorable culture media for duckweeds proliferation except SH medium best for W. globosa. Interestingly, of all duckweeds, L. aequinoctialis is the fastest growing duckweeds when culture in the laboratory.
Duckweeds 0 d 3 d 5 d 7 d
S. polyrhiza
L.aequinoctialis
W. globosa
Figure 4-10 Fronds regeneration of duckweeds cultured in Hoagland’s E media. The growth condition was the 16L: 8D photoperiod with an irradiance of 55 µmol.m-2s-1 from fluorescent light bulbs at 25±2° C for 14 d. (scale bar = 1 mm) 49
Table 4-2 Doubling time of duckweeds grown in various media
Doubling time (day) Medium S. polyrhiza L. aequinoctialis W. globosa a b bc dH2O 12.3±1.5 6.1±0.4 5.7±0.7
E 3.2±0.1d 2.4±0.1d 3.6±0.4d
0.5xE 3.5±0.2d 2.6±0.2d 3.3±0.1d
E+ 4.1±0.7cd 2.7±0.3d 3.6±0.4d
0.5xE+ 3.8±0.8d 2.5±0.1d 3.8±0.3d
SH 3.5±0.6d 2.6±0.1d 3.2±0.2d
0.5xSH 3.5±0.7d 2.6±0.1d 3.3±0.5d
MS 3.5±0.3d 2.7±0.1d 3.8±0.4d
0.5xMS 3.4±0.4d 2.6±0.2d 3.4±0.5d
All data are mean ± SD, n=3. Different letters in the same column are significantly different (p<0.05)
5
4 a a
3 b
2
Doubling tims (day) tims Doubling 1
0 S. polyrhiza L. aequinoctialis W. globosa
Figure 4-11 Doubling time of S. polyrhiza, L. aequinoctialis and W. globosa grown in media. The growth condition was the 16L: 8D photoperiod with an irradiance of 55 µmol.m-2s-1 from fluorescent light bulbs at 25±2° C for 14 d. All data are mean ± SD, n=8. Different letters are significantly different (p<0.05) 50
4.3 Carbohydrate, Protein and Oxalate content in duckweeds 4.3.1 Carbohydrate content in duckweeds S. polyrhiza, L. aequinoctialis and W. globosa cultured in the laboratory for 14 d were analyzed for carbohydrate content using Anthrone method. S. polyrhiza grown in E, E+ and SH media had the highest carbohydrate content at 40.72±1.28%, 38.48±7.88% and 40.59±2.96%, respectively. Interestingly, reduction of media strength by 50% tent to decrease carbohydrate content in S. polyrhiza as shown in Table 4-3. In contrast, L. aequinoctialis grown in MS, E, 0.5xE+ and 0.5xMS had the highest carbohydrate content at 6.88±0.75%, 6.28±1.68, 5.59±0.87 and 5.46±0.68%, respectively. Whereas, 0.5xE+, E+, 0.5xMS and 0.5xE were media contributing to the highest carbohydrate content in W. globosa at 32.36±8.28%, 28.57±4.90%, 25.33±1.93% and 22.65±4.83%, respectively (Table 4-3). Taken together, these results indicated that media selection and media concentration strongly affected carbohydrate accumulation. Carbohydrate content in S. polyrhiza could reach 38.48±7.88%-40.72±1.28% when grown in E, E+ or SH media and dropped more than 50% when the strength or concentration of media was reduced by 50%. Similar results were observed in L. aequinoctialis and W. globosa but less pronounced in these duckweeds. L. aequinoctialis grown in MS medium had maximum carbohydrate content at 6.88±0.75% and W. globosa grown in 0.5xE+ had the highest carbohydrate content at 32.36±8.28%.
51
Table 4-3 Carbohydrate content of duckweeds grown in various media
% Carbohydrate DW. Medium S.polyrhiza L. aequinoctialis W. globosa
E 40.72±1.28a 6.28±1.68de 18.09±6.30ij
E+ 38.48±7.88a 4.29±1.03efg 28.57±4.90hi
SH 40.59±2.96a 3.40±0.59fg 16.51±6.32j
MS 10.92±1.04bc 6.88±0.75d 20.62±6.32ij
0.5xE 13.33 ± 4.19b 4.65±1.98efg 22.65±4.83hij
0.5xE+ 9.67± 2.47bc 5.59±0.87de 32.36±8.28h
0.5xSH 10.20±2.42bc 3.36±0.53g 20.91±2.58ij
0.5xMS 5.33±1.06c 5.46±0.68def 25.33±1.93hij All data are mean ± SD, n=6. Different letters in the same column are significantly different (p<0.05).
4.3.2 Protein content in duckweeds S. polyrhiza, L. aequinoctialis and W. globosa cultured in the laboratory for 14 d were analyzed for protein content using Lowry’s method. S. polyrhiza grown in SH and E+ media had the highest protein content at 31.37±2.22% and 27.52±2.57%, respectively. Meanwhile, reduction of media strength by 50% had protein content ranged between 11.58%±2.98-20.80±4.66% as shown in table 4-4. Moreover, L. aequinoctialis grown in MS and E media had the highest protein content at 26.67±6.24% and 22.80±6.31%, respectively. Meanwhile, 0.5xE and E were media yielding the highest protein content in W. globosa at 28.34±4.09% and 26.17±1.82%, respectively (Table 4-4). Generally, these results indicated that S. polyrhiza and L. aequinoctialis accumulate protein higher when grown in full-strength concentration of media. 52
S. polyrhiza had the maximum protein content at 31.37±2.22% and 27.52±2.57% when grown in SH and E+ media while L. aequinoctialis grown in MS and E media had the highest protein content at 26.67±6.24% and 22.80±6.31%, respectively. In contrast, W. globosa had the maximum protein content at 28.34±4.09% and 26.17±1.82% when grown in either full-strength or half-strength concentration of E media.
Table 4-4 Protein content of duckweeds grown in various media
% Protein DW. Medium S.polyrhiza L. aequinoctialis W. globosa
E 21.36±4.78bc 22.80±6.31ef 26.17±1.82i
E+ 27.52±2.57ab 15.62±5.61g 13.19±1.64kl
SH 31.37±2.22a 8.83±3.18h 16.33±7.15jkl
MS 12.79±3.26d 26.67±6.24e 12.43±3.23l
0.5xE 20.80±4.66c 16.29±3.33g 28.34±4.09i
0.5xE+ 13.98 ±2.98d 18.13±4.88fg 18.72±3.76j
0.5xSH 14.96±3.35d 7.96±2.48h 19.48±4.77j
0.5xMS 11.58±2.98d 15.61±3.85g 18.05±3.05jk All data are mean ± SD, n=10. Different letters in the same column are significantly different (p<0.05).
4.3.3 Oxalate content in duckweeds Oxalate content in S. polyrhiza, L. aequinoctialis and W. globosa analyzed with Thin-layer chromatography (TLC). Retardation factor (Rf) and intensity of the brown spots were analyzed qualitatively and semi- qualitatively using Image J as shown in table 4-5. In S. polyrhiza, oxalate content was lowest when grown in SH medium (3.30±0.81%) but highest in 0.5xE (4.98±0.03%). In contrast, oxalate content in L. aequinoctialis was lowest when grown in 0.5xE, 0.5xE+ and MS media 53
(2.56±0.68%, 2.97±0.22% and 3.31±0.11%, respectively) but highest in SH and 0.5xSH media (6.43±0.16% and 6.55±0.16%, respectively). Interestingly, oxalate content in W. globosa was fairly constant ranging between 2.63±0.07%-3.48±0.02% when grown in tested media (Table 4-5).
Table 4-5 Oxalate content in duckweeds grown in various media
% Oxalate DW. Medium S.polyrhiza L. aequinoctialis W. globosa
E 4.52±0.51ab 3.83±0.15de 3.09±0.05gh
E+ 4.41±0.33ab 4.47±0.44d 3.23±0.68gh
SH 3.30±0.81b 6.43±0.16c 3.35±0.11gh
MS 3.60±0.09ab 3.31±0.11ef 3.03±0.61gh
0.5xE 4.98±0.03a 2.56±0.68f 3.48±0.02g
0.5xE+ - 2.97±0.22ef 3.45±0.07g
0.5xSH 4.04±0.84ab 6.55±0.16c 2.63±0.07h
0.5xMS - - 3.45±0.12g All data are mean ± SD, n=10. Different letters in the same column are significantly different (p<0.05).
4.3.4 Biochemical composition of duckweeds Duckweeds and selected plants were analyzed and compared for their biochemical composition including carbohydrate, protein and oxalate content. It was shown that in general, S. polyrhiza and W. globosa drastically accumulated carbohydrate more than L. aequinoctialis (21.16± 15.72%, 23.13± 5.35% and 4.99± 1.29%, respectively). In contrast, there were no significant differences between protein content in these duckweeds ranging between 16.49±6.31%- 19.30±7.26%. As expected, S. polyrhiza, L. aequinoctialis, and W. globosa accumulated oxalate (4.14±1.99%, 4.30±2.13% and 3.21±0.29%, respectively) more than soybean 54
(Glycine max (L.) Merr.) and climbing wattle (Acacia pennata (L.) Willd.) (0.17±0.04% and 0.62±0.007%, respectively) and close to wildbetal leafbush (Piper sarmentosum Roxb.; 2.50±0.42%) but slightly higher (as shown in Table 4-6).
Table 4-6 Biochemical composition of duckweeds and selected plants
Sample % Carbohydrate % Protein DW. % Oxalate DW. DW. a c d S.polyrhiza 21.16± 15.72 19.30±7.26 4.14±1.99
b c d L. aequinoctialis 4.99± 1.29 16.49±6.31 4.30±2.13
a c d W. globosa 23.13± 5.35 19.09±5.65 3.21±0.29 Soybean - - 0.17±0.04f Climbing wattle - - 0.62±0.07ef Wildbetal leafbush - - 2.50±0.42de
All data are mean ± SD, n=10. Different letters in the same column are significantly different (p<0.05).
4.4 Growth of Agrobacterium Agrobacteriun tumefaciens is gram-negative bacteria which can transfer DNA to plants. To transform duckweeds, A. tumefaciens GV-3101, a transformation vector, was transformed with the binary vectors, including pB7WG and pB7WG2D- X, and optimized for further Agrobacterium-mediated transformation and selection. 4.4.1 Growth of A. tumefaciens GV-3101 Agrobacteriun (wild-type) and transformed Agrobacteriun harboring pB7WG or pB7WG2D-X was cultured in liquid LB medium containing 50 µg/ml gentamycin for 72 h. The latter was supplemented with 200 µg/ml spectinomycin. Similarly, Agrobacteriun and transformed Agrobacteriun had the maximum growth rate between 6-9 h prior to entering the late log phase. Meanwhile, the growth was stopped and started to decline after 18 h (Figure 4-12, 4-13 and 4-14).
55
3.0
2.5
2.0
1.5
1.0 Abs. 600 nm. 600 Abs. 0.5
0.0 0 3 6 9 12 15 18 21 24 27 30 33 36 39 42 45 48 51 54 57 60 63 66 69 72 75 Time (h)
Figure 4-12 Growth of A. tumefaciens GV-3101 (Wild type) cultured in liquid LB medium containing 50 µg/ml gentamycin (bar = SD)
3.0
2.5
2.0
1.5
Abs.600 nm. Abs.600 1.0
0.5
0.0 0 3 6 9 12 15 18 21 24 27 30 33 36 39 42 45 48 51 54 57 60 63 66 69 72 75 Time (h)
Figure 4-13 Growth of A. tumefaciens GV-3101 harboring pB7WG cultured in liquid LB medium containing 50 µg/ml gentamycin and 200 µg/ml spectinomycin (bar = SD) 56
3.0
2.5
2.0
1.5
Abs. 600 nm 600 Abs. 1.0
0.5
0.0 0 3 6 9 12 15 18 21 24 27 30 33 36 39 42 45 48 51 54 57 60 63 66 69 72 75 Time (h)
Figure 4-14 Growth of A. tumefaciens GV-3101 harboring pB7WG2D-X cultured in liquid LB medium containing 50 µg/ml gentamycin and 200 µg/ml spectinomycin (bar = SD)
4.4.2 Effect of ceftriaxone on growth of A. tumefaciens GV-3101 harboring pB7WG and pB7WG2D-X To obtain the minimal concentration of ceftriaxone, a third-generation antibiotic in the cephalosporin family, that inhibits growth of Agrobacteriun for further elimination in the later transformation process, transformed Agrobacteriun harboring pB7WG or pB7WG2D-X was cultured in liquid LB medium supplemented with various concentrations of ceftriaxone for 36 h. The results showed that the ceftriaxone at 250 mg/L, 500 mg/L and 1,000 mg/L effectively inhibited growth of Agrobacteriun from the beginning between 0-12 h. Meanwhile, the concentrations at 50 mg/L and 100 mg/L were able to inhibit the growth after 6 h. These results indicated that the minimal concentration of ceftriaxone effectively inhibiting growth of Agrobacteriun was 250 mg/L (Figure 4-15 and 4-16). 57
3.0 0 mg/L Cef. 2.5 50 mg/L Cef.
2.0 100 mg/L Cef. 250 mg/L Cef. 1.5
500 mg/L Cef. Abs. 600 nm. 600 Abs. 1.0 1000 mg/L Cef.
0.5
0.0 0 6 12 18 24 30 36 Time (h)
Figure 4-15 Growth of A. tumefaciens GV-3101 harboring pB7WG cultured in liquid LB medium containing 50 µg/ml gentamycin, 200 µg/ml spectinomycin and various concentrations of ceftriaxone (bar = SD)
3.0
0 mg/L Cef. 2.5 50 mg/L Cef.
2.0 100 mg/L Cef.
250 mg/l Cef. 1.5
500 mg/L Cef. Abs. 600 nm. 600 Abs. 1.0 1000 mg/L Cef.
0.5
0.0 0 6 12 18 24 30 36 Time (h)
Figure 4-16 Growth of A. tumefaciens GV-3101 harboring pB7WG2D-X cultured in liquid LB medium containing 50 µg/ml gentamycin, 200 µg/ml spectinomycin and various concentration of ceftriaxone (bar = SD) 58
4.5 Duckweed transformation To develop duckweed transformation protocol, a binary vector pB7WG was chosen for Agrobacterium-mediated transformation by transferring T-DNA into the genome of S. polyrhiza. The transformation procedures included preparation of target tissues, agroinfiltration, selection and verification. 4.5.1 Preparation of target tissues The initial step of duckweed genetic transformation is induction of the formation of specialized tissues, including flower, callus and turion, susceptible for infiltration and suitable for propagation. 4.5.1.1 Induction of flowering in S. polyrhiza S. polyrhiza was cultured in liquid flowering induction medium containing various concentrations of salicylic acid (SA) and different light regimes. Remarkably, after 24 d, the fronds of S. polyrhiza grown in the presence of SA were smaller than usual and accumulated reddish pigments underneath (abaxial side) when compared to the control (Figure 4-17 A-B). The highest flowering percentage at 33.5% was observed when cultured in medium supplemented with 3 µM SA with a continuous irradiance of 110 µmol.m-2s-1 (Figure 4-21). Their flowers had white color, very small and surrounding by the spathe (Figure 4-17 C-F). Interestingly, flowering was initially observed between day 12-day 15 (Figure 4-20, 4-21) when cultured under 110 µmol.m-2s-1 and SA was added but it was also observed when cultured under 55 µmol.m-2s-1 at day 24 (Figure 4-19). These results indicated that not only SA (Figure 4-22) but light regime also had a prominent effect on the flowering as shown by the lack of flowering when cultured under 55 µmol.m-2s-1 (Figure 4-18) and flowering retardation when cultured under 16L photoperiod (Figure 4-20). 59
Figure 4-17 Morphology of fronds and flowers of S. polyrhiza A) Cultured in liquid flowering induction medium (control) B) Cultured in liquid flowering induction medium (added 3µM SA) C-F) Flower and pollen close-up (scale bar = 1.0 mm and 1.0 cm)
60
120 16L, 55 µmol.m-2s-1
100 SA 1µM
80 SA 3µM SA 5 µM 60 SA 0 µM
40
20
0 NO. vegetative frondsand %flowering frondsand vegetative NO. 0d 12d 15d 18d 21d 24d 0d 12d 15d 18d 21d 24d NO. Fronds %Flowering
Figure 4-18 The number of vegetative fronds and %flowering of S. polyrhiza cultured under an irradiance of 55 µmol.m-2s-1 at 16L photoperiod for 24 d. (bar = SD)
-2 -1 120 24L, 55 µmol.m s SA 1µM 100 SA 3µM
80 SA 5 µM SA 0 µM 60
40
20 NO. vegetative fronds and %flower and fronds vegetative NO. 0 0d 12d 15d 18d 21d 24d 0d 12d 15d 18d 21d 24d NO. Fronds %Flowering
Figure 4-19 The number of vegetative fronds and %flowering of S. polyrhiza cultured under an irradiance of 55 µmol.m-2s-1 at 24L photoperiod for 24 d. (bar = SD) 61
120
16L, 110 µmol.m-2s-1 SA 1µM
100 SA 3µM
SA 5 µM 80 SA 0 µM 60
40
20
NO. vegtative fronds nad %flowering nad fronds vegtativeNO. 0 0d 12d 15d 18d 21d 24d 0d 12d 15d 18d 21d 24d NO. Fronds %Flowering
Figure 4-20 The number of vegetative fronds and %flowering of S. polyrhiza cultured under an irradiance of 110 µmol.m-2s-1 at 16L photoperiod for 24 d. (bar = SD)
120 24L, 110 µmol.m-2s-1 SA 1µM 100 SA 3µM SA 5 µM 80 SA 0 µM
60
40
20
NO. vegetative fronds and %flowering and fronds vegetative NO. 0 0d 12d 15d 18d 21d 24d 0d 12d 15d 18d 21d 24d NO. Fronds %Flowering
Figure 4-21 The number of vegetative fronds and %flowering of S. polyrhiza cultured under an irradiance of 110 µmol.m-2s-1 at 24L photoperiod for 24 d. (bar = SD) 62
120
No. Vegatative Fronds 3µM SA
100 No. Vegatative Fronds 0µM SA
%Flowering 3µM SA 80 %Flowering 0µM SA
60
40
No. vegetative fronds and % Flowering % and fronds vegetativeNo. 20
0 0 5 10 15 20 25 30 Days
Figure 4-22 Effect of 3µM Salicylic acid (SA) on flowering of S. polyrhiza when cultured at 25±2° C with an irradiance 110 µmol.m-2s-1 from 5000K white light LED 24L photoperiod for 24 d. (bar = SD)
63
4.5.1.2 Induction of callus To induce callus formation, explants of S. polyrhiza and L. aequinoctialis (whole intact plant and surgically injured) were cultured in solid MS medium containing 2,4-D at 0, 2, 3, 4, and 5 µM. After 20 days, explants from S. polyrhiza exposed to 2,4-D were undergone chlorosis and died (Figure 4-23A-B). In contrast, the formation of callus was observed in explants from L. aequinoctialis (Figure 4-23 C-D). Furthermore, comparison the effect of injury on callus formation revealed that there were no significant differences between using intact or surgically injured duckweeds on callus formation percentage (Figure 4-24). Taken together, these results indicated that 2,4-D induced callus formation in L. aequinoctialis and intact duckweeds could be used as explants for inducing callus formation.
Figure 4-23 Callus induction in S. polyrhiza and L. aequinoctialis. Duckweeds were cultured in solid MS medium with and without 2,4-D under an irradiance of 55 µmolm-2s-1 from fluorescent light bulbs at 25±2° C for 20 d. A, C) Cultured without 2,4-D (control) B, D) Cultured with 3 µM of 2,4-D (scale bar = 0.5 cm) 64
whole intact plant
120 surgically injured
a a a a a a a 100 a
80 L. aequinoctialis L. 60
40
20 % of induction Callus % b 0 0 2 3 4 5 2,4-D (µM)
Figure 4-24 The percentage of explants forming callus in L. aequinoctialis cultured in MS medium contains various concentrations of 2,4-D under an irradiance of 55 µmolm-2s-1 from fluorescent light bulbs at 25±2° C for 20 d. Different letters indicated statistically significant differences (p<0.05), bar = SD.
Morphogically, callus arose from the base of L. aequinoctialis fronds and had green color (Figure 4-25A). After 28 d, the color of callus changed to cream- yellow (Figure 4-25B). When green calli were transferred to new media, they started to form fronds after two weeks (Figure 4-25C) and developed to vegetative fronds after four weeks (Figure 4-25D). Therefore, the time required for callus induction and frond regeneration was approximately two months.
65
Figure 4-25 Regenaration of L. aequinoctialis frond from callus. Calli of L. aequinoctialis were cultured in solid media with an irradiance of 55 µmolm-2s-1 from fluorescent light bulbs at 25 ± 2° C (scale bar = 0.5 cm). A) Green callus (arrow) after 20 days on callus induction medium (MS + 3µM 2,4-D) B) Cream-yellow callus (arrow) after 28 days on callus induction media (MS + 3µM 2,4-D) C) New fronds (arrow) formed from calli after 14 days on liquid Hoagland E media D) Well-developed fronds after 28 days on liquid Hoagland E media.
4.5.1.3 Induction of turions Turions are special organs of some species of duckweed developed for survival during unsuitable condition. To induce turion formation, fronds of S. polyrhiza were subject to starvation. 15-20 fronds of S. polyrhiza were placed in distilled water for 14 d. After 7 d, fronds began to undergo chlorosis (yellow color) and reddish pigments were accumulated on the ventral side (abaxial side). After 14 d, tuions were observed as dark green color organs and attached to the mother fronds. 66
After that, turions were sunk into the bottom of the vessels (Figure 4-26). Interestingly, when turions were transferred into enrich medium, they regenerated to new fronds immediately (Figure 4-27).
Figure 4-26 Induction of turion using distilled water at 16L: 8D photoperiod with an irradiance of 55 µmolm-2s-1 from fluorescent light bulbs at 25±2° C for 14 d (scale bar = 1 cm).
Figure 4-27 Regeneration of turions into new fronds in Hoagland’s E media at 16L: 8D photoperiod with an irradiance of 55 µmolm-2s-1 from fluorescent light bulbs at 25±2° C for 14 d (scale bar = 1 cm).
67
4.5.2 Effect of herbicide on target tissues Due to the selectable markers used in this study was a gene conferring resistance to the herbicide bialaphos (bar), also known as glufosinate, however, information regarding the susceptibility of duckweeds and their specialized tissues to glufosinate was largely unknown. Therefore, the effect of glufosinate on growth of target tissues was studied to ensure the effectiveness of subsequent selection regime. Duckweeds were cultured on solid MS medium containing different concentrations of glufosinate at 16L: 8D photoperiod with an irradiance of 55 µmol m-2s-1 from fluorescent light bulbs at 25±2° C for 14 d, unless otherwise stated. 4.5.2.1 Effect of glufosinate on growth of S. polyrhiza Glufosinate at 0.010 mM started to have an effect on frond morphology as shown by the yellowish color, curvature and smaller in size (Figure 4-28). Furthermore, the growth rate was also decreased as shown by the increase in doubling time from 4.07±0.38 (no added) to 17.75±1.97 d. As expected, the concentrations of glufosinate beyond 0.010 mM completely stunted the growth of S. polyrhiza (Figure 4-29) and subsequently led to death. 4.5.2.2 Effect of glufosinate on growth of L. aequinoctialis Unlike S. polyrhiza L. aequinoctialis was able to tolerate glufosinate at 0.010 mM and started to have an effect on growth and morphology at the concentration above 0.010 mM (Figure 4-30). However, increasing the concentration of glufosinate (0.001, 0.005, and 0.010 mM) tent to slightly decrease the growth rate of L. aequinoctialis as shown by the increase in doubling time from 2.38±0.05 to 2.49±0.11, 2.55±0.08, and 2.67±0.06 d, respectively (Figure 4-31). 4.5.2.3 Effect of glufosinate on regeneration of turions from S. polyrhiza Regeneration of turions to form fronds in S. polyrhiza was affected by glufosinate similar to its growth as shown by the abnormal morphology (Figure 4-32) and significant reduction in number of newly formed vegetative fronds at 0.010 mM from 13.00±2.16 (no added) to 3.75±1.26 fronds (Figure 4-33). As anticipated, concentration of glufosinate more than 0.010 mM completely inhibited regeneration of turions in S. polyrhiza (Figure 4-33).
68
4.5.2.4 Effect of glufosinate on regeneration of callus from L. aequinoctialis Despite L. aequinoctialis was capable of growing in the presence of 0.010 mM glufosinate, its callus failed to regenerate to form frond when cultured in any given concentrations of glufosinate ranging from 0.001 to 0.10 mM (Figure 4-34). Surprising, callus had stopped proliferating when grown in any given concentrations of glufosinate in accordance with the effect of glufosinate on its growth. The latter also rendered callus to turn yellow within 14 d of cultivation (Figure 4-34).
Figure 4-28 Growth of S. polyrhiza grown on solid MS medium containing different concentration of glufosinate at 25±2° C for 14 d. (Scale bar = 0.5 mm)
69
24 Doubling time (day)
21 a 18 15 12 9
Doubling time (Day) time Doubling b 6 b b 3 c c 0 0.000 0.001 0.005 0.010 0.050 0.100 Glufosinate (mM)
Figure 4-29 Doubling time of S. polyrhiza grown on solid MS medium containing different concentrations of glufosinate at 25±2° C for 14 d. Different letters indicated statistically significant differences (p<0.05), bar = SD
Figure 4-30 Growth of L. aequinoctialis grown on solid MS medium containing different concentrations of glufosinate at 25±2° C for 14 d (scale bar = 0.5 mm) 70
4.0 Doubling time (day) 3.5
3.0 ab a a 2.5 b
2.0
1.5
1.0 Doubling time (Day) time Doubling 0.5 c c 0.0 0.000 0.001 0.005 0.010 0.050 0.100 Glufosinate (mM)
Figure 4-31 Doubling time of L. aequinoctialis grown on solid MS medium containing different concentrations of glufosinate at 25±2° C for 14 d. Different letters indicated statistically significant differences (p<0.05), bar = SD
Figure 4-32 Growth of turions grown on solid MS medium containing different concentration of glufosinate at 25±2° C for 14 d (scale bar = 0.5 mm). 71
16 a Number of vegetative frond
14 a a 12
10
8
6 b 4
Number of vegetative frond vegetativeof Number 2 c c 0 0.000 0.001 0.005 0.010 0.050 0.100 Glufosinate (mM)
Figure 4-33 Number of vegetative fronds regenerated from turions cultured on solid MS medium containing different concentrations of glufosinate at 25±2° C for 14 d. Different letters indicated statistically significant differences (p<0.05), bar = SD
Figure 4-34 Proliferation of callus of L. aequinoctialis grown on solid MS medium containing different concentration of glufosinate at 25±2° C for 14 d (scale bar = 0.5 mm). 72
4.5.3 Turions transformation by Agroinfiltration Agroinfiltration is a technique incorporating advantages of gene transfer ability found in agrobacteria and physical alteration to increase surface contact between agrobacteria and plant cells, so called infiltration. To this regard, A. tumefaciens GV-3101 harboring pB7WG was used together with vacuum infiltration to mediate T-DNA insertion into target tissues, turions of S. polyrhiza by immerging turions in Agrobacterium suspension and infiltrating in vacuum at 0, 5, 10 or 20 min, respectively. After 14 days of cultivation on solid selection medium containing 0.010 mM glufosinate, frond regeneration was observed in all treatments (Figure 4-35) and scored as frond proliferation frequency at 100.00±0.00%, 96.88±0.06%, 86.15±0.20% and 96.88±0.06%, respectively (Table 4-5).
Figure 4-35 Effect of vacuum infiltration on frond regeneration. Agroinfiltrated turions were cultured on solid selection medium MS + 1%sucrose + 100 µM actosyringone+250 mg/L ceftriaxone + 0.010 mM Glufosinate) for 14 d. Control was not vacuum infiltrated and cultured in MS+ 1% sucrose (scale bar 0.5 mm).
73
4.5.4 Verification of transgenic duckweeds Glufosinate resistance gene, Bar, and enhanced green fluorescent protein gene, Egfp, found in the T-DNA of the binary vector, pB7WG, were probably inserted into the duckweed genome via agrobacterium mediated transformation as seen by the ability to grow in media containing 0.010 mM glufosinate. To verify this insertion, the presence of Bar, Egfp and Actin (control) loci in the transgenic duckweeds were detected by PCR technique and the expression of Egfp was observed by fluorescence microscope. 4.5.4.1 Genotyping by PCR technique The binary vector, pB7WG was used as a control for amplification of Bar and Egfp loci, whereas wild-type S. polyrhiza was used as a control for amplification of Actin locus. As expected, sizes of PCR products obtained from amplification of Bar, Egfp and Actin loci were 400, 600 and 400 bp, respectively (Figure 4-36, Figure 4-37). The transgenic duckweeds were scored from T0 (potential transgenic turions) regenerated from turions to form fronds on selective media containing 0.010 mM glufosinate. The regeneration percentage ranged between 86.15%–100.00% (Table 4-7). Even though it was shown that T1 (first generation of transgenic duckweeds) vacuum infiltrated with Agrobacterium at 0, 5, 10 and 20 min were positive for Bar, Egfp and Actin loci, the results were inconsistent (Figure 4-36, Table 4-7). It seemed that agrobacterium-mediated vacuum infiltration for 5 min yielded the highest consistency and transformation frequency as shown by the detection frequency of Bar and Egfp up to 75% (Table 4-7). Interestingly, transgenic duckweeds were also scored from the treatment without vacuum infiltration but the detection frequency of Bar was only 50% (Table 4-7). Curiously, T1 was unable to continuously grow to T2 (second generation of transgenic duckweeds) on solid MS medium containing 0.010 mM glufosinate (Appendix 7). Therefore, T2 was sub-cultured on solid MS medium containing 0.005 mM glufosinate for 14 d and genotyped for the detection frequency of Bar and Egfp loci. Results revealed the proliferation percentage at 90%, however, Egfp was no longer detected in any T2 but Bar and Actin was detected at 50% and 100%, respectively (Figure 4-37, Table 4-8). 74
Figure 4-36 PCR analysis of first generation of transgenic duckweeds (T1) Lane M (marker DNA) Lane B (BAR gene) Lane G (GFP gene) Lane A (Actin gene)
V0 (vacuum 0 min) V5 (vacuum 5 min)
V10 (vacuum10 min) V20 (vacuum 20 min),
Control (dH2O) and P (pure plasmid)
Table 4-7 Turion regeneration (T0) and target gene detection percentage of T1
% Frond %Gene detection in T1 Condition proliferation BAR GFP Actin
0 min 100.00±0.00 50.00±0.71ab 0.00±0.00c 100.00±0.00e
5 min 96.88±0.06 75.00±0.50ab 100.00±0.00d 100.00±0.00e
10 min 86.15±0.20 0.00±0.00b 33.3±0.58cd 100.00±0.00e
20 min 96.88±0.06 75.00±0.50ab 50.00±0.58cd 100.00±0.00e
b c f Control (dH2O) - 0.00±0.00 0.00±0.00 0.00±0.00
Pure plasmid - 100.00±0.00a 100.00±0.00d 0.00±0.00f
* T1 was cultured into agar MS media (MS+ 1%sucrose +100µM actosyringone+ 250 mg/L ceftriaxone + 0.010 mM Glufosinate). All data are mean ± SD, n=3. Different letters in the same column are significantly different (p<0.05). 75
Figure 4-37 PCR analysis of first generation of transgenic duckweeds (T2) Lane M (marker DNA) Lane B (BAR gene) Lane G (GFP gene) Lane A (Actin gene)
V0 (vacuum 0 min) V5 (vacuum 5 min)
V10 (vacuum10 min) V20 (vacuum 20 min),
Control (dH2O) and P (pure plasmid).
Table 4-8 Percentage of transgenic fronds proliferation and gene detection of T2
%Fronds %Gene detection in T2
proliferation BAR GFP Actin
90.00±3.53 50.00±28.87 0.00±0.00 100.00±0.00
* T2 was cultured into agar MS media (MS+ 1%sucrose +100µM actosyringone+ 250 mg/L ceftriaxone + 0.005mM Glufosinate). All data are mean ± SEM, n=8.
4.5.4.2 Observation of Egfp expression Egfp expression in transgenic duckweeds (T1) was demonstrated by the fluorescence of EGFP when observed under fluorescence microscope compared to those from wild-type duckweeds (Figure 4-38 A, D and G). The autofluorescence of 76
chlorophyll and fluorescence of GFP were distinguished by the fluorescent colors as autofluorescence of chlorophyll was red when excited by green light or blue light (Figure 4-38 G, H and I) whereas fluorescence of GFP was green when excited with blue light but appeared orange when mixed with autofluorescence of chlorophyll (Figure 4-38 E and F). These results indicated that some T1 transgenic duckweeds were successfully transformed by agroinflitration method using turions of S. polyrhiza as recipients as shown by glufosinate resistance phenotype, detection of Bar and Egfp insertion, and observation of green fluorescence. Nevertheless, the transmission of transgenes to their offspring via vegetative propagation was unsuccessful.
Figure 4-38 Expression of Egfp in transgenic fronds (T1). Bright field image (A, B and C), GFP fluorescence and chlorophyll autofluorescence (D, E and F) and chlorophyll fluorescence (G, H and I). * A, D and G was a representative from wild-type duckweeds (control)
77
CHAPTER 5 DISCUSSION AND CONCLUSIONS
5.1 Species of duckweeds in Burapha University BUU1, BUU2 and BUU3 were named as isolates of duckweeds collected from natural reservoirs in Burapha University. They were identified with morphological characteristics including size of frond and the number of roots BUU1 harbors multiple roots and reddish pigment on the ventral surface. BUU2 contains only one root per frond and BUU3 has no root. The presence of roots can be used to differentiate Spirodela, Landoltia and Lemna from Wolffia and Wolfiella (Armrtrong, 2004). Accordingly, BUU1 is likely a member of either the genera Spirodela or Landotia due to several roots and reddish pigments accumulation on the lower side of each frond (Les, Landolt, & Crawford 1997). However, the genus Spirodela is larger in size compared to Landotia and comprises only two species, Spirodela polyrhiza and Spirodela intermedia (Klaus et al., 2013). Meanwhile, the genus Lemna produces just one root per frond but lacks of the reddish pigments. Due to the closely related morphology of several species in this genus, they were classified according to the number of veins. Armstrong (2004) reported that L. minuta and L. valdiviana had only one vein whereas L.minor, L. turionifera and L. aeqnoctialis had 3-5 veins. Furthermore, L. aeqninoctialis had a special root sheath with two lateral wings distinct from other Lemna spp. The latter morphology is corresponding to BUU2. In addition, the genera Wolffia and Wolfiella are distinguished by their features on plant bodies and the size fronds in BUU3 resembles to Wolffia because of its globose frond shape and tiny size. Therefore, based on their morphological appearance BUU1, BUU2, and BUU3 are more likely Spirodela polyrhiza, Lemna sp. and Wolffia sp., respectively. However, identification of duckweeds using solely their morphology is relatively difficult because of their small size and closely-related in morphology, especially, among the same genus. Therefore, the molecular technique was used for facilitating identification of duckweed species due to its speed, accuracy and reliability. For molecular characterization, DNA sequencing is a molecular method 78
that has been widely used to identify living organisms. For example, the mitochondrial cytochrome coxidase subunit I (COI) gene has been successfully used as the DNA marker for identifying species of animals (Hebert, Ratnasingham, & Waard, 2003; Hajibabaei, Singer, Hebert, & Hickey, 2007). However, the application of COI for DNA sequencing in the plant kingdom has proved to be difficult (Wang et al., 2010). CBOL Plant Working Group (2009) used multiple loci including atpF–atpH, matK, rbcL, rpoB, rpoC1, psbK–psbI, and trnH–psbA for identification of plant species. However, a previous study demonstrated that the atpF-atpH intergenic region could be effectively used as a universal DNA sequencing marker at the species level in the Lemnaceae family (Wang et al., 2010). Therefore, the plastid atpF-atpH intergenic region was used as a DNA sequencing marker for identification of duckweed species in this work. According to morphological characters and molecular data, it is indicated that duckweeds collected from natural reservoirs in Burapha University are Spirodela polyrhiza, Lemna aequinoctialis and Wolffia globosa.
5.2 Surface sterilization of duckweeds Duckweeds collected from natural reservoirs were contaminated with other living organisms. The removal of contaminants is the first procedure prior to conducting axenic culture of duckweeds in the laboratory. The optimal procedures for surface sterilization of duckweeds were acquired as the following. 5.2.1 Surface sterilization of S. polyrhiza and L. aequinoctialis NaClO solution, such as Haiter® (6% w/v available chlorite), is effective enough to remove extraneous microorganisms on S. polyrhiza and L. aequinoctialis. Moreover, the NaClO solution is inexpensive which can be used conveniently. It turns out that either submerging in 0.42% NaClO for 5 min or 0.90% NaClO for 1 min is equally effective for surface sterilization of S. polyrhiza. Meanwhile, L. aequinoctialis which is smaller than S. polyrhiza requires 0.30% NaClO for 3 to 5 min, indicating that L. aequinoctialis is more sensitive to NaClO than S. polyrhiza.
79
5.2.2 Surface sterilization of W. globosa W. globosa is the smallest flowering plant and the most susceptible to chemicals when compared to other duckweed species. Thus, PVP-I solution (Betadine®) was used as an additional sterilizing agent in this experiment. Surprisingly, NaClO solution (Haiter®) is more effective than PVP-I solution (Betadine®) for surface sterilization of W. globosa (0.42% NaClO for 60 sec). Taken together, it is advisable to carefully use the optimal NaClO concentration and time of surface sterilization for each duckweed species to obtain maximal survival rate but minimal contamination.
5.3 Culture of duckweeds in the laboratory Culture of duckweeds in the field generally obtains inconsistent results, mostly due to environmental factors, such as light intensity, temperature and diseases. Establishment of axenic culture of duckweeds in the laboratory will promote controllable environment thereby rendering reliable results. To do so, S. polyrhiza, L. aequinoctialis and W. globosa were axenically cultured in four different liquid media, including E, E+, SH and MS medium at two concentrations (0.5X and 1X). The growth of all duckweeds in each medium was analyzed to obtain the suitable growth media in the laboratory. 5.3.1 Hoagland’s E is a universal medium for duckweeds All duckweeds can grow in all tested media though they generally grow best in Hoagland’s E medium as demonstrated by the shortest doubling time from 2 to 4 days. Curiously, duckweeds grown in Hoagland E+ medium experienced chlorosis (white-yellow fronds) after 14 day of cultivation, especially in S. polyrhiza (Appendix 5). However, this was not the case when the half-strength of Hoagland E+ medium was used which suggested that Hoagland E+ medium might contain an inadequate nutrient proportion. Even though duckweeds also grow well in MS and SH media resulted in no significant difference in growth, they are not suitable for prolonged cultivation because both media have less nutrient than the Hoagland-E medium. Duckweeds grown in the half-strength of MS or SH medium also sustained chlorosis and decreased in growth after 14 day of cultivation. In addition, duckweeds grown in MS medium for a long time tent to have short roots and small fronds. 80
Kittiwongwattana and Vuttipongchaikij (2013) suggested that MS media had more vitamin content. Furthermore, MS medium which could be used to maintain a large collection of stock cultures where slower growth was preferred to reduce the amount of labor required for sub-culturing. In contrast, the Hoagland-E medium was suitable for frond proliferation and biomass production as it supported root elongation. 5.3.2 L. aequinoctialis is the fastest growing duckweed in the laboratory Among three duckweed species cultured in the media, L. aequinoctialis has the shortest doubling time at 2.6 days similar to that of L. minor which is 2.3-2.5 days (Cifrek, Soric, & Babic, 2013; Kittiwongwattana & Vuttipongchaikij, 2013). Unlike L. aequinoctialis, S. polyrhiza has longer doubling time at 3.2 days close to the previous report in S. polyrhiza 7110 which is 4.1 days (Ziegler, Adelmann, Zimmer, Schmidt, & Appenroth, 2014). Surprisingly, W. globosa, despite its tiny size, has the longest doubling time at 3.6 days compared to L. aequinoctialis and S. polyrhiza. These results suggest that L. aequinoctialis is favorable for biomass production.
5.4 Carbohydrate, Protein and Oxalate content in duckweeds To use duckweeds as alternative food and energy sources, it is required to know their biochemical properties, especially carbohydrate and protein content. The carbohydrate content was measured with Anthrone method and the protein content was measured with Lowry’s method, which is widely used to determine the protein content of biological samples. However, duckweeds usually accumulate oxalate in their special cells, called idioblasts. If human and animal consume the high level of oxalate, this may lead to the occurrence of hyperoxaluria disease. To address this problem, oxalate content was semi-quantitatively measured by Thin-layer chromatography (TLC) method. 5.4.1 S. polyrhiza and W. globosa have high carbohydrate and protein content S. polyrhiza grown in E, E+ or SH media accumulate the highest carbohydrate content at approximately 40%, about four-fold higher than previous reports by Tang et al. (2015) and Li et al. (2016) which are 11.14% and 13.97%, respectively. Surprisingly, S. polyrhiza has carbohydrate content even higher than that of cassava (30.15%; Karim, Fasasi, & Oyeyinka, 2009) and about two-thirds of 81
cassava peels (64.60%; Oboh, 2006) which is used for bioethanol production. Not only S. polyrhiza has high carbohydrate content, but it also has high level of protein content up to 30% which is similar to the previous reports by Rusoff et al. (1980) and Fasakin et al. (1999) at 29.10% and 30.03%, respectively. In terms of animal feed, carbohydrate content in S. polyrhiza is greater than that of soybeans (Glycine max (L.) Merr.) about two-fold (20.3%; Stevenson, Doorenbos, Jane, & Inglett, 2006) though its protein content is about a quarter less than that of soybeans (35.4%-39.8%; Ciabotti et al., 2016). W. globosa grown in 0.5xE+ or E+ media has the highest carbohydrate content at about 30% as described previously (Chantiratikul & Chumpawadee, 2011). In addition, W. globosa also has maximum protein content, nearly at 30%, when grown in full-strength or half-strength concentration of E media as reported by Chantiratikul et al. (2010) at 29.6%, indicating the consistency of carbohydrate and protein content in this duckweed species. Taken together, these findings suggest that S. polyrhiza and W. globosa are potential candidates for an animal feed alternative. 5.4.2 L. aequinoctialis has high protein content but low in carbohydrate L. aequinoctialis grown in MS or E media has the highest protein content at about 25% which is in the range of previous reports in Lemna spp. between 20.50% (Noor, Hossain, Bari, & Azimuddin, 2000) and 36.16% (Li et al., 2016). Nevertheless, it has protein content higher than other energy crops such as cassava (8.20%; Oboh, 2006), maize and sorghum (8.75% and 9.10%, respectively; David, Nwanyinnaya, Ezekiel, & Chinelo, 2016). In contrast, L. aequinoctialis has significantly less carbohydrate content ranging from 3%-7% when compared to the S. polyrhiza (40%) and W. globosa (30%). When compared to the previous reports, L. aequinoctialis in this study has carbohydrate content less than Tang et al. (2015) and Li et al. (2016) which are 11.61% and 12.49%, respectively. This result suggests that L. aequinoctialis turns its carbohydrate storage into biomass resulting in the fastest growing duckweed in the laboratory. 5.4.3 All three species of duckweed have significant amount of oxalate Duckweeds usually accumulate oxalate in their special cells called idioblasts. High level of oxalate consumption may lead to the occurrence of 82
hyperoxaluria disease in human and animals. Interestingly, S. polyrhiza, L. aequinoctialis, and W. globosa accumulate oxalate in the range from 3.21% to 4.30% which is close to the oxalate content in taro leaves (5.13%) but much less than that of spinach leaves (12.57%) (Savage & Martensson, 2010). Furthermore, it has been suggested that the raphide crystals of oxalate observed in idioblasts of duckweeds are the result of bulk Ca deposition in plants rather than oxalate detoxification as they store Ca in the form of calcium oxalate (Mazen et al., 2003) which may be used for Ca sink and herbivore protection purpose, concurrently. 5.4.4 Duckweeds as alternative food and energy sources To evaluate the possibility of using duckweeds as alternative food and energy sources, the variability of biochemical composition in these three species of duckweeds was analyzed and compared across all media (Table 4-6). In terms of biomass, L. aequinoctialis is preferred as it has the shortest doubling time. Since all duckweeds have average protein content at approximately 20%, their application is mostly based on carbohydrate and oxalate content. In one case, S. polyrhiza may be suitable for bioethanol production (Cui & Cheng, 2014) due to its high carbohydrate content. The ethanol yield produced from S. polyrhiza was substantially higher than that of the maize (corn) grain (Xu, Cui, Cheng, & Stomp, 2011) and corn kernel (Lee, Yangcheng, Cheng, & Jane, 2016). Furthermore, duckweeds can also be used as feedstuff due to their high protein content. Fasakin et al. (1999) increased tilapia growth rate and reduced cost of feedstuff production by replacing protein from fish with S. polyrhiza. Furthermore, L. minor was also used as a dietary protein source for Cyprinus carpio (Yilmaz, Akyurt, & Güna, 2004) and W. globosa was used as a substitute of soybean for increasing of skin pigmentation in broilers (Chantiratikul et al., 2010). Intriguingly, W. globosa has already been found in some Thai cuisines, especially in the north and north-east of Thailand, as it is highly nutritious and has less oxalate content compared to S. polyrhiza and L. aequinoctialis.
5.5 Optimization of Agrobacterium growth and growth inhibition Agrobacterium is a group of gram-negative soil bacteria found associated with plants. Infections of wound sites by Agrobacterium tumefaciens cause crown gall tumors on a wide range of plants, including most dicots, some monocots, and some 83
gymnosperms (Matthysse, 2005). Thus, A. tumefaciens is commonly used in Agrobacterium-mediated transformation as a biological vector transferring and inserting gene of interest into the plant genome. A. tumefaciens GV-3101 was used in this study. It was shown previously that A. tumefaciens preferred mannitol as a carbon source in which using YEM medium led to shorter doubling time and higher cell density (Matthysse, 2005). However, results suggested that A. tumefaciens GV-3101 grew well in regular LB medium despite a concern about irregular cell division (Morton & Fuqua, 2012). The post-agroinfection procedure involves double selection in which the growth of Agrobacterium is inhibited by antibiotics, mostly cefotaxime, and non- transgenic duckweeds are suppressed by other selective agents such as kanamycin, hygromycin or phosphinothricin (Miki & McHugh, 2004). In this study, ceftriaxone was used to inhibit Agrobacteriun growth. Thus, the minimal effective dose of ceftriaxone was evaluated and determined at 250 mg/L which was unharmed to duckweeds.
5.6 Salicylic acid induces flowering in S. plyrhiza The Lemnaceae family rarely flowers in nature. However, previous works had shown that SA (salicylic acid) induced flowering in several species of the Lemnaceae in vitro (Pieterse, 2013). For example, Cleland and Ajami (1974) reported that SA was the flower-inducing factor in L. gibba G3. It appeared that SA induced flowering in this plant under both long-day and short-day conditions. Subsequently, Tanaka and Cleland (1980) demonstrated that effect of SA on flowering induction in L. gibba G3 was enhanced by ferricyanide. In this work, SA was used to induce flowering in S. plyrhiza cultured in liquid flowering induction medium containing various concentrations of SA and different light regimes. Interestingly, the highest flowering percentage was observed when cultured S. plyrhiza in medium supplemented with 3µM SA with a continuous irradiance at 110 µmol.m-2s-1. However, Khurana and Mahesshwari (1980) reported that more than 70% flowering was observed in S. polyrrhiza SP20 when grown in Bonner and Devirian medium supplemented with 50 µM SA and cultured under 84
16L: 8D photoperiod with 10.22 Wm-2 light intensity. Moreover, the fronds of S. polyrrhiza SP20 treated with SA (>50 µM) became gibbous (large air-chambers formed). A similar situation also occurred in L. gibba G3 and S. punctata where SA, in addition to inducing flowering, also caused an increase in gibbosity (Pieterse & Muller, 1977; Scharfetter, Rottenburg, & Kandeler, 1978). It has been proposed that SA regulates transcription factors involving in defence mechanisms (Maier et al., 2011) which share a common pathway for flowering induction (Pieterse, 2013). Thus, these results suggest that not only SA is a key factor that induces flowering in duckweeds, but other factors, including light and developmental stage of duckweeds also contribute to the decision for flowering in duckweeds.
5.7 2,4-D induces callus formation in L. aequinoctialis To induce callus formation, explants from S. polyrhiza and L. aequinoctialis, whole intact plant or surgically injured, were cultured in solid MS medium containing various concentration of 2,4-D. Unexpectedly, S. polyrhiza exposed to 2,4-D were undergone chlorosis and died. In contrast, 2,4-D at 2 to 5 µM were highly effective for callus induction in L. aequinoctialis (>80%). Similarly, low concentration of 2,4-D (2 to 9 µM) was successfully used to induce callus formation in L. minor (Frick, 1991) and L. gibba (Moon & Stomp, 1997). Curiously, natural auxins (i.e. IAA and IBA) were not effective for producing callus in L. gibba (Moon & Stomp, 1997). However, the MS medium containing 3% sucrose and auxins was suggested to be the optimal media for callus induction in Lemna spp. (Moon & Stomp, 1997; Stefaniak et al., 2002). In addition, the regeneration in L. gibba was reported to require a combination of cytokinin and auxin (Chang & Chiu, 1978), but in the absence of plant growth regulators, Moon and Stomp (1997) successfully regenerated L. gibba on SH medium (Schenk & Hildebrandt, 1972), indicating that endogenous plant growth regulators might play a role in regeneration in the latter circumstances.
85
5.8 Starvation induces turion formation in S. plyrhiza Turions are special organs of some species of duckweed developed for survival during unsuitable condition. In this study, fronds of S. polyrhiza were placed in distilled water (starvation condition). After 14 d, turions were observed as dark green color organs attached to the mother fronds. It was shown previously that the lack of nutrients, such as phosphorus, nitrate, sulfate (Malek & Cossins, 1982; Appenrothet, Hertel, Jungnickel, & Augsten1989), and the addition of abscisic acid (Thomas & Byrne, 1969) would induce turion formation in duckweeds. Furthermore, low temperature (15º C) also enhanced turion yield in S. polyrhiza (Appenroth, 2002). Strikingly, it was suggested that turions of S. polyrhiza accumulated high starch content (70%) rendering them to be a good source for bioethanol production in the future (Cui & Cheng, 2014). Moreover, turions are easy to manipulate as they can withstand extreme condition and regenerate to new fronds immediately once the condition is adequate. This feature makes S. polyrhiza turions attractive as the novel explants for genetic transformation.
5.9 Herbicide tolerance of target tissues The herbicide-resistance Bialaphos (bar, also known as glufosinnate) is widely use as a selection marker in transgenic plants. Bialaphos, a non-selective herbicide, is a tripeptide composed of two L-alanine residues and an analogue of glutamic acid called phosphinothricin (PPT) (Thompson et al., 1987). Inhibition of glutamine synthetase by PPT renders a rapid buildup of intracellular ammonia levels, disrupting chloroplast structure, resulting in an inhibition of photosynthesis and leading to death (Tachibana, Watanabe, Sekizawa, & Takematsu, 1986). The glufosinate selection approach is simple and reproducible which have been extensively used in numerous herbicide-resistant transformed crops e.g. oilseed rape (Block, Brouwer, & Tenning, 1989; Kopertekh, Broer, & Schiemann, 2009), and sugarcane (Joyce, Kuwahata, Turner, & Lakshmanan, 2010). Interestingly, glufosinate at 0.010 mM started to have a detrimental effect on S. polyrhiza and its turions. Meanwhile, L. aequinoctialis was able to tolerate glufosinate slightly higher than S. polyrhiza but its callus failed to regenerate to form frond when cultured in any 86
given concentrations of glufosinate. These results suggest that duckweeds are drastically susceptible to glufosinate as the whole plants are exposed directly to this herbicide. Effective concentration of glufosinate to inhibit growth of duckweeds would range between 0.01–0.05 mM.
5.10 Turion transformation by Agroinfiltration Agroinfiltration is an effective method for rapid transformation and transient transgene expression in many plant species. Bringing A. tumefaciens into contact with susceptible host plant cells is the principle of agroinfiltration. One strategy is to conduct the vacuum infiltration, in which this approach increases level of transient expression when compare to infiltration at atmospheric pressure (Joh, Wroblewski, Ewing, & Vander, 2005). This method has been successfully applied to the transformation of Nicotiana benthamiana (Matsuo et al., 2016), Oryza sativa L. (Andrieu et al., 2012), and Brassica napus (Wang, Menon, & Hansen, 2003). To this regard, A. tumefaciens GV-3101 harboring pB7WG was used together with vacuum infiltration to mediate T-DNA insertion into target tissues, turions of S. polyrhiza, by immerging turions in Agrobacterium suspension and infiltrating in vacuum. However, several factors, including Agrobacterium strains, inoculation time, co-cultivation time and acetosyringone concentrations directly affect the achievement of Agrobacterium-mediated transformation of S. polyrhiza turions. 5.10.1 Optimization of transformation protocol 5.10.1.1 Agrobacterium strains Agrobacterium strains play an important role in the efficiency of turion transformation. A. tumefaciens GV-3101 was used in this study. Nada (2016) reported that A. tumefaciens GV-3101 and LBA4404 were the most effective strains producing the highest GUS positive transformants in Arabidopsis, Egyptian wheat and barley. In contrast, A. tumefaciens EHA105 produced the highest GUS positive transformants in banana (Subramanyam et al., 2011). Degree of activation of genes in virulence region, different in each strain, is thought to be a critical internal factor influencing the infectious ability of A. tumefaciens (Wang & Fang, 1998). This concept addresses the importance of strain selection to infect specific plant tissues. 87
5.10.1.2 Surfactants Nonionic surfactants normally improve the efficiency of transient Agrobacterium-mediated transformation in wheat (Wu, Sparks, Amoah, & Jones, 2003) and Arabidopsis (Kim, Baek, & Park, 2009). Chhabra et al. (2011) reported that addition of Tween 20 at low concentration, i.e. 0.2%, significantly elevated the level of transient expression. However, concentration higher than 0.2% caused a drastic reduction in transient expression. 5.10.1.3 Acetosyringone Agrobacterium is attracted to a wounded plant in response to phenolic compounds secreted by the plant cells to which it attached (Zambryski, 1992). These phenolic compounds activate vir genes present on the Ti plasmid of A. tumefaciens (Stachel, Messens, Van, & Zambryski, 1985). In general, monocotyledons produce less phenolic compounds insufficient to serve as signals (Smith & Hood 1995). Thus, exogenous application of acetosyringone in the co-cultivation medium remarkably improves the transformation efficiency in several monocotyledonous plants. Hiei, Ohta, Komari, and Kumashiro (1994) and May et al. (1995) successfully produced transformed rice and banana using 100 µM of acetosyringone. Furthermore, Chhabra et al. (2011) demonstrated that acetosyringone at 100 µM was adequate for a successful transformation of Lemna minor. 5.10.1.4 Co-cultivation time Co-cultivation time can also lead to the success or failure of transformation of any given plants. This factor needs to be pre-determined to avoid Agrobacterium overgrowth due to the prolonged co-cultivation time. A co-cultivation time of 2-3 days provided best results in Agapanthus praecox (Suzuki et al., 2001; Nandakumar et al., 2004). Chhabra et al. (2011) reported that maximum frequency of transient GUS expression in L. minor was observed when nodular calli were co- cultured with Agrobacterium for three days. Since the transfer of T-DNA from Agrobacterium to the plant genome occurs during the S-phase of the cell cycle, it is essential to establish an optimal co-culture condition of explants and the Agrobacterium at the very beginning of the genetic transformation protocol (Koetle et al., 2015).
88
5.10.1.5 Vacuum infiltration Vacuum infiltration is one of the key steps in Agrobacterium-based transformation procedure, successfully used to produce all kind of transgenic plants, including rice and wheat (Dong, Kharb, Teng, & Hall, 2001; Amoah, Wu, Sparks, & Jones, 2001). This process increases gene transfer efficiency by improving penetration of Agrobacterium cells into the plant tissues. However, transformation by vacuum- infiltration has never been carried out with turions of S. polyrhiza. Surprisingly, our results suggested that vacuum infiltration for 5 min delivered highest transformation frequency upto 75%, consistent with the previous report which observed up to 76% in Medicago truncatula (Trieu et al., 2000) when vacuum infiltrated seedlings for 3 min at 250 mm of Hg. Furthermore, it was shown that combination of sonication and vacuum infiltration treatment increased the transformation efficiency in banana (Subramanyam et al., 2011). 5.10.2 Verification of transformation Glufosinate resistance gene, Bar, and enhanced green fluorescent protein gene, Egfp, found in the T-DNA of the binary vector, pB7WG, were likely inserted into the duckweed genome via vacuum infiltration assisted Agrobacterium- mediated transformation. The transgenic duckweeds were scored from T0 (potential transgenic turions) regenerating to fronds on selective media containing 0.010 mM glufosinate. The regeneration percentage ranged between 86.15%–100.00%. Even though it was shown that T1 (first generation of transgenic duckweeds) vacuum-infiltrated with Agrobacterium were PCR-positive for Bar, Egfp and Actin loci, the detection might be a result of the carry-over DNA contamination from Agrobacterium. To address this question, further investigation on Egfp expression was performed by observing fluorescence of EGFP in transgenic duckweeds (T1) under fluorescence microscope. As expected, the transgenic duckweeds produced the green signals from EGFP when combined with the red autofluorescence from chlorophyll generated the orange color. This is significantly different from wild-type duckweeds as the wild-type show only the red color. However, the confirmative way to answer this curiosity is to perform a western blot using anti-GFP.
89
5.10.3 Transmission of transgenes Even though we have succeeded in developing transformation protocol by using agroinflitration approach and turions of S. polyrhiza as recipients, we failed to produce stable transgenic duckweeds. The transmission of transgenes to their offspring via vegetative proliferation (budding) was futile as the detection frequency of Bar and Egfp loci dropped drastically in the second generation of transgenic duckweeds (T2). This result implies that S. polyrhiza has a mechanism to remove the inserted foreign genes in its genome. In accordance with the unlikely sexual reproduction in nature, the genome of S. polyrhiza is most likely immune to genetic alteration thereby rendering it the only one species in the genus.
5.11 Conclusion & Significance We identify three duckweed species in Burapha University, S. polyrhiza, L. aequinoctialis and W. globosa. They grow rapidly in Hoagland’s E medium having minimal doubling times of 2-4 days in the laboratory. Of all duckweeds, L. aequinoctialis grows fastest though it has less carbohydrate content. On the other hand, S. polyrhiza has the highest carbohydrate and protein content, up to 40% and 30%, respectively. Furthermore, S. polyrhiza can be triggered to flower by addition of salicylic acid whereas L. aequinoctialis can be induced to form callus using 2,4-D. We also established the simple yet novel transformation protocol of S. polyrhiza using Agrobacterium-mediated transformation by agroinfiltration of its turions. However, the transgenic duckweeds are unstable resulting in the lost of transgenes during asexual reproduction. These findings will pave the way for applying duckweeds as a tool in biotechnology, including tissue culture, aquaculture, plant breeding, and molecular farming.
90
REFERENCES
Amoah, B. K., Wu, H., Sparks, C., & Jones, H. D. (2001). Factors influencing Agrobacterium-mediated transient expression of uidA in wheat inflorescence tissue. Journal of Experimental Botany, 52, 1135–1142. Appenroth, K. J., Hertel, W., Jungnickel, F., & Augsten, H. (1989). Influence of nutrient deficiency and light on turion formation in Spirodela polyrhiza (L.) Schleiden. Journal of Biochemie und Physiologie der Pflanzen, 184, 395-403. Appenroth, K. J. (2002). Co-action of temperature and phosphate in inducing turion formation in Spirodela polyrhiza (Great duckweed)*. Journal of Plant Cell and Environment, 25, 1079–1085. Arazi, T., Lee Huang, P., Huang, P. L., Zhang, L., Moshe Shiboleth, Y., Gal-On, A., & Lee-Huang, S. (2002) Production of antiviral and antitumor proteins MAP30 and GAP31 in cucurbits using the plant virus vector ZYMV-AGII. Journal of Biochemical and Biophysical Research Communications, 292, 441–448. Armstrong, W. P. (2004). Flow chart of dichotomous key to Lemnaceae in California. Retrieved from https://www2.palomar.edu/users/warmstrong/1flowcht.htm Armstrong, W. P. (2007). Species of Lemnaceae in Western North America. Retrieved from https://www2.palomar.edu/users/warmstrong/1wayindx.htm#difficult Andrieu, A., Christophe, J. B., Siré, C., Meynard, D., Gantet, P., & Guiderdoni, E. (2012). An in planta, Agrobacterium-mediated transient gene expression method for inducing gene silencing in rice (Oryza sativa L.) leaves. Rice a Springer Open journal, 23(5), 1-12. Block, D. M., Brouwer, D. D., & Tenning P. (1989). Transformation of Brassica napus and Brassica oleracea using Agrobacterium tumefaciens and the expression of the bar and neo genes in the transgenic plants. Journal of Plant Physiology, 91, 694–701. CBOL Plant Working Group. (2009). A DNA barcode for land plants. Proceeding of the National Academy of Sciences of the United States of America, 106, 12794-12797. 91
Casal, J. A., Vermaata, J. E., & Wiegman, F. (2000). A test of two methods for plant protein determination using duckweed. Journal of Aquatic botany, 67(1), 61-67. Cifrek, Z. V., Soric, S., & Babic, M. (2013). Growth and photosynthesis of Lemna minor L. exposed to different light conditions and sucrose supplies. Journal of Acta Botanica Croatica, 72(2), 211-219. Cui, W., & Cheng, J.J. (2014). Growing duckweed for biofuel production: a review. Journal of Plant Biology, 17(1), 16-23. Chang, W. C., & Chiu, P. L. (1978). Regeneration of Lemna gibba G 3 through Callus Culture. Journal of Zeitschrift für pflanzenphysiologie, 89 (1), 91-94. Chantiratikul, A., & Chumpawadee, S. (2011). Effect of heat-treatment on ruminal protein degradability of Wolffia meal (Wolffia globosa L. Wimm). Asian Journal of Animal Science, 5, 1-7. Chantiratikul, A., Pooponpan, P., Santhaweesuk, S., Chantiratikul, P., Sangdee, A., Maneechote, U., Bunchasak,C., & Chinrasri, O. (2010). Effect of Wolffia meal (Wolffia globoa (L). Wimm.) as a dietary protein replacement on performance and carcass characteristics in broilers. International Journal of Poultry Scientific, 9, 664-668. Chen, Q., Jin, Y., Zhang, G., Fang, Y., Xiao, Y., & Zhao, H. (2012). Improving Production of Bioethanol from Duckweed (Landoltia punctata) by Pectinase Pretreatment. Journal of Energy Research, 5, 3019-3032. Cleland, C. F., & Ajami, A. (1974). Identification of the Flower-inducing Factor Isolated from Aphid Honeydew as being Salicylic Acid. Journal of Plant Physiology, 54(6), 904-906. Cleland C. F., & Ben-Tal Y. (1982). Influence of giving salicylic acid for different time periods on flowering and growth in the long-day plant Lemna gibba G3. Journal of Plant Physiology, 70(1), 287-90. Cleland C. F., & Briggs, W. R. (1967). Flowering Responses of the Long-day Plant Lemna gibba G3. Journal of Plant Physiology, 42, 1553-1561.
92
Cleland, C. F., & Tanaka, O. (1979). Effect of daylenght on the ability of salicylic acid to induce flowering in the long-day plant Lemna gibba G3 and short- day plant Lemna paucicostata 6746. Journal of Plant Physiology, 64, 421-424. Chhabra, G., Chaudhary, D., Sainger, M., & Jaiwalcorresponding, P. K. (2011). Genetic transformation of Indian isolate of Lemna minor mediated by Agrobacterium tumefaciens and recovery of transgenic plants. Journal of Physiology and Molecular Biology of Plants, 17(2), 129–136. Ciabotti, S., Silva, A. C. B. B., Juhasz, A. C. P., Mendonça, C. D., Tavano, O. L., Mandarino, J. M. G., & Gonçalves, C. A. A. (2016). Chemical composition, protein profile, and isoflavones content in soybean genotypes with different seed coat colors. International Food Research Journal, 23(2), 621-629. David, I. A., Nwanyinnaya, N., Ezekiel, I. U., & Chinelo, S. I. (2016). Comparative Proximate Analysis of Maize and Sorghum Bought from Ogbete Main Market of Enugu State, Nigeria. Greener Journal of Agricultural Sciences, 6(9), 272-275. Dong, J. J., Kharb, P., Teng, W., & Hall, T. C. (2001). Characterization of rice transformed via an Agrobacterium-mediated inflorescence approach. Journal of Molecular Breeding, 7, 187–194. Edwards, K., Johnstone, C., & Thompson, C. (1991). A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Journal of Nucleic Acids Research, 19(6), 1349. Etiosa, O. R., Chika, N. B., & Benedicta, A. (2017). Mineral and proximate composition of soya bean. Asian Journal of Physical and Chemical Sciences, 4(3), 1-6. Fasakin, E. A., Balogun, A. M., & Fasuru, B. E. (1999). Use of duckweed, Spirodela polyrrhiza L. Schleiden, as a protein feedstuff in practical diets for tilapia, Oreochromis niloticus L. Journal of Aquaculture, 30, 313-318. Frick, H. (1991). Callogenesis and carbohydrate utilization in Lemna minor. Journal of Plant Physiology, 137, 397-401. Franceschi, V. R. (1987). Oxalic acid metabolism and calcium oxalate formation in Lemna minor. Journal of Plant, Cell and Environment, 10(5), 397-406. 93
Fujita, M., Mori, K., & Kodera, T. (1999). Nutrient removal and starch production through cultivation of Wolfla arrhiza. Journal of Biosicience and Bioengineering, 87(2), 194-198. Gamborg, O. L., Miller, R. A., & Ojima, K. (1968). Nutrient requirements of suspension culture of soybean root cells. Journal of Experimental Cell Research, 50, 15-158. Gaigher, L. G., & Short, R. (1986) An evaluation of duckweed (Lemnaceae) as a candidate for aquaculture in South Africa. Journal of aquaculture research, 15, 81-90. Gayatri, M. C., & Kavyashree, R. (2015). Plant tissue culture : protocols in plant biotechnology. England: Alpha Science International Ltd Press. Gupta, S., & Maheshwari, S. C. (1970). Growth and flowering of Lemna paucicostata. General aspects and role of chelating agents in flowering. Journal of Plant and Cell Physiology, 11, 83–94. Hajibabaei, M., Singer, G. A. C., Hebert, P. D. N., & Hickey, D.A. (2007). DNA barcoding: how it complements taxonomy, molecular phylogenetics and population genetics. Trends in Genetics, 23, 167-172. Hansen, G., & Wright, M. S. (1999). Recent advances in the transformation of plants. Journal of Trends in Plant Sciences, 4(6), 226-231. Hassan M. S., & Edwards P. (1992). Evaluation of duckweed (Lemna perpusilla and Spirodela polyrrhiza) as feed for Nile tilapia (Oreochromis niloticus). Journal of Aquaculture, 104, 315-326. Hebert, P. D. N., Ratnasingham, S., & Waard, J. R. (2003). Barcoding animal life:cytochrome c oxidase subunit 1 divergences among closely related species, Proceedings of the Royal Society, 270, 1471-2954. Hiei, Y., Ohta, S., Komari, T., & Kumashiro, T. (1994). Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Journal of Plant, 6, 271–282. Hoagland, D. R., & Arnon, D. I. (1950). The water-culture method for growing plants without soil. Berkeley, California: College of Agriculture, Agricultural Experiment Station. 94
Hubenova, Y., & Mitov, M. (2012). Conversion of solar energy into electricity by using duckweed in direct photosynthetic plant fuel cell. Journal of Bloelectrochemistry, 87, 185-191. Hrzenjak, V. M., Kristl, J., & Krajncic, B. (2008). The effects of jasmonic acid and ethylenediamine-di-o-hydroxyphenyl-acetic acid on floral induction and induction of turions in Spirodela polyrhiza Schleiden. Journal of Acta Botanica Croatica, 67(2), 131–138. Ilarslan, H., Palmer, R.G., Imsande, P., & Horner, H. T. (1997). Quantitative determination of calcium oxalate and oxalate in developing seeds of soybean (leguminosae). American Journal of Botany, 84(9), 1042–1046. IIT Guwahati (2012). Module 3: Broad Title: Plant Genetic Engineering and Production of Transgenic Plants. Retrieved from http://nptel.ac.in/courses/102103016/module3/lec24/2.html Joh, L., Wroblewski, T., Ewing, N., & Vander, G. J. (2005). High-level transient expression of recombinant protein in lettuce. Journal of Biotechnology and Bioengineering, 91(7), 861–871. Joyce, P., Kuwahata, M., Turner, N., & Lakshmanan, P. (2010). Selection system and co-cultivation medium are important determinants of Agrobacterium- mediated transformation of sugarcane. Journal of Plant Cell Report, 29, 73–183. Karim, O. R., Fasasi, O. S., & Oyeyinka, S. A. (2009). Gari yield and chemical composition of cassava root stored using traditional methods. Pakistan Journal of Nutrition, 8(12), 1830-1833. Khurana, J. P., & Maheshwari, S. C. (1980). Some effects of salicylic acid on growth and flowering in Spirodela polyrrhiza SP20. Journal of Plant and Cell Physiology, 21(5), 923-927. Khvatkov, P., Chernobrovkina, M., Okunev, A., Pushin, A., & Dolgov, S. (2015). Transformation of Wolffia arrhiza (L.) Horkel ex Wimm. Journal of Plant Cell, Tissue and Organ Culture, 123(2), 299-307. King, J. L., Finer, J. J., & McHale, L. K. (2015). Development and optimization of agroinfiltration for soybean. Journal of Plant Cell Reports, 34, 133-140. 95
Kim, M. J., Baek, K., & Park, C. M. (2009). Optimization of conditions for transient Agrobacterium-mediated gene expression assays in Arabidopsis. Journal of Plant Cell Report, 28, 1159–1167. Kittiwongwattana, C., & Vuttipongchaikij, S. (2013). Effect of nutrient media on vegetative growth of Lemna minor and Landoltia punctata during in vitro and ex vitro cultivation. Maejo international journal of science and technology, 7(1), 60-69. Klaus J. A., Nikolai B., & Eric L. (2013). Telling Duckweed Apart: Genotyping Technologies for the Lemnaceae. Chinese Journal of Applied and Environmental Biology, 19(1), 1-10. Koetle, M. J., Finnie, J. F., Balázs, E., & Van Stadena, J. (2015). A review on factors affecting the Agrobacterium-mediated genetic transformation in ornamental monocotyledonous geophytes. South African Journal of Botany, 98, 37–44. Komori, T., Ishida, Y., & Hiei, Y. (2004). Plant transformation technology: Agrobacterium-Mediated transformation. Handbook of plant biotechnology (vol 1, 233-261). England: John Wiley & Sons Ltd Press. Kopertekh, L., Broer, I., & Schiemann, J. (2009). Developmentally regulated site- specific marker gene excision in transgenic B. napus plants. Journal of Plant Cell Report, 28, 1075–1083. Kress, W. J., & Erickson D. L. (2012). DNA barcodes: Method and protocol (Vol. 858). Washington, DC: Humana Press. Landolt, E., & Kandeler, K. R. (1987). The family of Lemnaceae – A monographic study. (2nd ed.). Zurich, Switzerland: Veroff. Geobot Inst. ETH. Leblebici, Z., & Aksoy, A. (2011). Growth and lead accumulation capacity of Lemna minor and Spirodela polyrhiza (Lemnaceae): interactions with nutrient enrichment. Journal of Water, Air, & soil pollution, 214(1-4), 175–184. Lee, C. J., Yangcheng, H., Cheng, J. J., & Jane, J. L. (2016). Starch characterization and ethanol production of duckweed and corn kernel. Journal of Starch Stärke, 68, 348-354.
96
Leng, R. A., Stambolie, J. H., & Bell, R. (1995). Duckweed - a potential high-protein feed resource for domestic animals and fish. Livestock Research for Rural Development, 1(7). Centre for Duckweed Research & Development University of New England Armidale. Les, D. H., Landolt, E., & Crawford, D. J. (1997). Systematics of the Lemnaceae (duckweeds): inferences from micromolecular and morphological data. Journal of Plant Systematics and Evolution. 204, 161-177. Li, J., Jain, M., Vunsh, M., Vishnevetsky, J., Hanania, U., Flaishman, M., Peri, A., & Edelman, M. (2004). Callus induction and regeneration in Spirodela and Lemna. Journal of Plant Cell Reports, 22, 457-464. Li, Y., Zhang. F., Daroch, M., & Tang, J. (2016). Positive effects of duckweed polycultures on starch and protein accumulation. Journal of Bioscience Reports, 36(5), 1-8. Lkeuchi, M. Sugimoto, K., & Iwase, A. (2013). Plant Callus: Mechanisms of Induction and Repression. Journal of The Plant Cell, 25, 3159-3173. Lu, G., Zou, Q., Guo, D., Zhuang, X., Yu, X., & Xiang, J. C. (2007). Agrobacterium tumefaciens mediated transformation of Narcissus tazzeta var. chinensis. Journal of Plant Cell Reports. 26, 1585–1593. Maheswari, S. C., & Seth, P. N. (1966). Induction of flowering in Wolffia microscopica by the iron salt of ethylenediamine-di-o-hydroxyphenylacetic acid (Fe-EDDHA). Journal of Zeitschrift für Pflanzenphysiologie, 55, 89-91. Makkar , H. P .S., Siddhuraju, P., & Becker, K. (2007). Method in molecular biology:Plant Secondary Metabolites. (Vol.393). Totowa, New Jersey: Humana Press. Malek, L., & Cossins, E. A. (1982). Senescence, turion development, and turion formation germination in nitrate- and sulfate-deficient Spirodela polyrhiza. Relationships between nutrient availability and exogenous cytokinins. Canadian Journal of Botany, 61, 1887-1897. Maier, F., Zwicker, S., Hückelhoven, A., Meissners, M., Funk, J., Pfitzner, A. J. P., & Pfitzner, U. M. (2011). Nonexpressor of pathogenesis-related proteins 1 (NPR1) and some NPR1-related proteins are sensitive to salicylic acid. Journal of Molecular Plant Pathology, 12, 73–91. 97
Mariashibu, T, H., Subramanyam, K., Arun, M., Mayavan, S., Rajesh, M., Theboral, J., Manickavsagam, M., & Ganapathi, A. (2013) Vacuum infiltration enhances the Agrobacterium-mediated genetic transformation in Indian soybean cultivars. Journal of Acta Physiologiae Plantarum, 35, 41-45. Marshall, T., & Williams, K. (1991). “Drug Interference in the Bradford and 2,2’-bicinchoninic acid protein assays,” Journal of Analytical Biochemistry, 198(2), 352-354. Mathur, J., & Koncz, C. (1998). Arabidopsis Protocols. Method in molecular biology (Vol 82, 267-276). USA: Humana Press. Matsuo, K., Fukuzawa, N., & Matsumura,T. (2016). A simple agroinfiltration method for transient gene expression in plant leaf discs. Journal of Bioscience and Bioengineering, 122(3), 351-356. Matthysse, A. G. (2005). The prokaryotes ‘The Genus Agrobacterium’ (Vol 5, 91-95). USA: Springer Press. May, G., Afza, R., Mason, H., Wiecko, A., Novak, F., & Arntzen, C. (1995). Generation of transgenic banana (Musa acuminata) plants via Agrobacterium-mediated transformation. Journal of Nature Biotechnology, 13, 486–492. Mazen A. M. A., Zhang D., & Franceschi V. R. (2003). Calcium oxalate formation in Lemna minor: Physiological and ultrastructural aspects of high capacity calcium sequestration. Journal of New Phytologist, 161, 453-448. Meyer, P., Heidmann, I., & Niedenhof, I. (1992). The use of African cassava mosaic virus as a vector system for plants. Journal of Gene, 110(2), 213-217. Michael, D. A., Paulo, J. M., & Sunanda, J. R. (2004). Image Processing with ImageJ. Biophotonics International, Laurin Publishing Co. Inc. Miki, B., & McHugh, S. (2004). Selectable marker genes in transgenic plants: applications, alternatives and biosafety. Journal of Biotechnology, 107, 193-232. Murashige, T., & Skoog, F. (1962). A revised medium for rapid growth and bioassays with tobacco tissue cultures. Journal of Physiologia Plantarum, 15, 473-479. 98
Moon, H. K., & Stomp, A. M. (1997). Effects of medium components and light on callus induction, growth, and frond regeneration in Lemna gibba (Duckweed). Journal of In Vitro Cellular & Developmental Biology, 33(1), 20-25. Morton, E. R., & Fuqua, C. (2012). Laboratory Maintenance of Agrobacterium. Journal of Current Protocols in Microbiology, 24(1), 3D.1.1-3D.1.6. Nabeshima, T., Doi, M., & Hosokawa, M. (2016). Agrobacterium-mediated inoculation of chrysanthemum (Chrysanthemum morifolium) plants with chrysanthemum stunt viroid. Journal of Virological Methods, 234, 169-173. Nada, R. M. (2016). Novel recombinant binary vectors harbouring Basta (bar) gene as a plant selectable marker for genetic transformation of plants. Journal of Physiology and Molecular Biology of Plants, 22(2), 241-251. Nandakumar, R., Chen, L., & Rogers, S. M. D. (2004). Factors affecting the Agrobacterium mediated transient transformation of the wetland monocot, Typha latifolia. Journal of Plant Cell, Tissue and Organ Culture, 79, 31–38. Noor, J., Hossain, M. A., Bari, M. M., & Azimuddin, K. M. (2000). Effects of duckweed (Lemna minor) as dietary fishmeal substitute for silver barb (Barbodes gonionotus Bleeker). Bangladesh Journal of Fisheries, 4(1), 35-42. Oboh, G. (2006). Nutrient enrichment of cassava peels using a mixed culture of Saccharomyces cerevisae and Lactobacillus spp solid media fermentation techniques. Electronic Journal of Biotechnology, 9(1), 1-4. Ohta, M., Hayashi, Y., Nakashima, A., Hamada, A., Tanaka, A., Nakamura, T., & Hayakawa, T. (2002). Introduction of a Na+/H+ antiporter gene from Atriplex gmelini confers salt tolerance to rice. Journal of Federation of European Biochemical Societiesis, 532, 279-282. Otani, M., Meguro, S., Gondaira, H., Hayashi, M., Saito, M., Hana, D., Inthima, P., Supaibulwatana, K., Moric, S., Jikumaru, Y., Kamiya, Y., Li, T., Niki, T., Nishijima, T.,Koshioka, M., & Nakano, M. (2013). Overexpression of the gibberellin 2-oxidase gene from Torenia fournieri induces dwarf phenotypes in the liliaceous monocotyledon Tricyrtis sp. Journal of Plant Physiology, 170, 1416–1423. 99
Poeaim, A., Wongkankha, T., & Jayasuta, S. (2007). Efficiency of gene transformation by Agrobacterium tumefaciens in Japan lawngrass (Zoysia japonica) cv. F60. Department of Applied Biology, Faculty of Science, King Mongkut’s Institute of Technology Ladkrabang. (in Thai) Pooponpan P., & Chantiratikul A. (2010). The utilization of the duckweed family as a protein source in poultry rations. Journal of Science and Technology MSU, 29(1), 73-78. (in Thai) Pieterse Arnold H. (2013). Is flowering in Lemnaceae stress-induced? A review. Journal of Aquatic Botany, 104, 1-4. Pieterse, A. H., & Muller, L. J. (1977). Induction of flowering in Lemna gibba G3 under short-day conditions. Journal of Plant and Cell Physiology, 18(1), 45-53. Rashid, H., Yokoi, S. I., Toriyama, K., & Hinanta, K. (1996).Transgenic plant production mediated by Agrobacterium in indica rice. Journal of Plant Cell Reports, 15, 727-730. Reid, M. S., & Bieleski, R. L. (1970). Response of Spirodela oligorrhiza to phosphorus deficiency. Journal of Plant Physiology, 46, 609-613. Richard N. Arteca. (1996). Plant growth substances principles and applications. New York: Chapman and Hall Press. Rival S., Wisniewski, J. P., Langlais, A., Kaplan, H., Freyssinet, G., Vancanneyt, G., Vunsh, R., Perl, A., & Edelman, M. (2008). Spirodela (duckweed) as an alternative production system for pharmaceuticals: a case study, aprotinin, Journal of Transgenic, 17(4), 503-513. Rod-in, W., Sujipuli, K., & Ratanasut, K. (2014). The floral-dip method for rice (Oryza sativa) transformation. Journal of Agricultural technology, 10(2), 467-474. Roughan, P. G., & Slack C.R. (1973). Simple method for routine screening and quanitative estimation of oxalate content of tropical grasses. Journal of Science of Food and Agriculture, 24, 803-811. Rusoff, L. L., Blakney, E. W., & Culley, D. D. (1980). Duckweeds (Lemnacae Family): A Potential Source of Protein and Amino Acids. Journal of Agriculture Food Chemistry, 28(4), 848-850. 100
Rustagi, A., Jain, S., Kumar, D., Shekhar, S., Jain, M., Bhat, V., & Sarin, N. B. (2015). High efficiency transformation of banana [Musa acuminata L. cv. Matti (AA)] for enhanced tolerance to salt and drought stress through overexpression of a peanut salinity-induced pathogenesis-related class 10 protein. Journal of Molecular Biotechnology, 57(1), 27-35. Saad, A. I. M., & Elshahed A. M. (2012). Plant Tissue Culture Media, IntechOpen publisher. Retrieved from https://cdn.intechopen.com/pdfs-wm/40181.pdf Savage, G.P., & Martensson, L. (2010). Comparison of the estimates of the oxalate content of taro leaves and corms and a selection of Indian vegetables following hot water, hot acid and in vitro extraction methods. Journal of Food Composition and Analysis, 23, 113–117. Scharfetter, E., Rottenburg, T., & Kandeler, R. (1978). The effect of EDDHA and salicylic acid on flowering and vegetative development in Spirodela punctata. Journal of Zeitschrift für Pflanzenphysiologie, 87(5), 445-454. Schenk, R.U., & Hildebrandt, A.C. (1972). Medium and techniques for induction and growth of monocotyledonous and dicotyledonous plant cultures. Canadian Journal of Botany, 50, 199–204. Sekomo, C. B., Rousseau, D. P. L., Saleh, S. A., & Lens, P. N. L. (2012). Heavy metal removal in duckweed and algae ponds as a polishing step for textile wastewater treatment. Journal of Ecological Engineering, 44, 102-110. Shimakawa, A., Shirayab, T., Ishizukac, Y., Wadaa, K. C., Mitsuia, T., & Takenoa, K. (2012). Salicylic acid is involved in the regulation of starvation stress-induced flowering in Lemna paucicostata. Journal of Plant Physiology, 169(10), 987-991. Shrawat, A. K., Becker, D., & Lorz, H. (2007). Agrobacterium tumefaciens-mediated genetic transformation of barley (Hordeum vulgare L.). Journal of Plant Science, 172(2), 281–290. Silva, J. A., & Uchida, R. (2000). Plant Nutrient Management in Hawaii’s Soils, Approaches for Tropical and Subtropical Agriculture. Manoa, Hawaii: College of Tropical Agriculture and Human Resources. 101
Smith, R. H., & Hood, E. E. (1995). Review and interpretation: Agrobacterium tumefaciens transformation of monocotyledons. Journal of Crop Science, 35, 301–309. Stachel, S. E., Messens, E., Van, M. M., & Zambryski, P. C. (1985). Identification of the signal molecules produced by wounded plant cells that activate Agrobacterium tumefaciens. International journal of science, 318, 624–629. Stephenson, M. G., Turner, G., Pope, P., Colt, J., Knight, A., & Tchobanoglous, G. (1980). The use and potential of aquatic species for wastewater treatment. California: CRC press. Stefaniak, B., Woźny, A., & Budna, I. (2002). Callus induction and plant regeneration in Lemna minor L. Journal of Biologia Plantarum, 45(3), 469-472. Stevenson, D. G., Doorenbos, R. K., Jane. J., & Inglett, G. E. (2006). Structures and Functional Properties of Starch From Seeds of Three Soybean (Glycine max (L.) Merr.) Varieties*. Journal of Starch/Stärke, 58, 509-519. Subramanyam, K., Subramanyam, K., Sailaja, K. V., Srinivasulu, M., & Lakshmidevi, K. (2011). Highly efficient Agrobacterium-mediated transformation of banana CV. Rasthali (AAB) via sonication and vacuum infiltration. Journal of Plant Cell Reports, 30(3), 425-436. Suzuki, S., Supaibulwatana, K., Mii, M., & Nakano, M. (2001). Production of transgenic plants of Liliaceous ornamental plants Agapanthus praecox ssp. orentalis (Leighton) Leighton via Agrobacterium-mediated transformation of embryogenic calli. Journal of Plant Science, 161, 89–97. Tachibana, K., Watanabe, T., Sekizawa, T., & Takematsu, T. (1986). Action mechanism of bialaphos II: accumulation of ammonia in plants treated with bialaphos. Journal of Pest Science, 11, 33–37. Tague B.W., & Mantis J. (2006). In Planta Agrobacterium-Mediated Transformation by Vacuum Infiltration. Arabidopsis ProtocolsMethods in Molecular Biology™, vol 323. New York: Humana Press. Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013). MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Journal of Molecular Biology and Evolution, 30(12), 2725-2729. 102
Tang, J., Li, Y., Ma, J., & Cheng, J. J. (2015). Survey of duckweed diversity in Lake Chao and total fatty acid, triacylglycerol, profiles of representative strains. Journal of Plant Biology, 17, 1066-1072. Taiz, L., & Zeiger, E. (2006). Plant physiology (4th ed.). U.S.A.: Sinauer University Press. Tanaka O., & Cleland CF. (1980). Comparison of the ability of salicylic acid and ferricyanide to induce flowering in the long-day plant, Lemna gibba G3. Journal of Plant physiology, 65(6), 1058-1061. Thomas, B. (1993). Internal and external controls flowering. The molecular biology of flowering, CAB International. Trowbridge, England: Red Wood Books. Thomas, O. P., & Byrne, O. R. (1969). Turion Induction in Spirodela polyrrhiza by Abscisic Acid. Journal of Plant physiology, 44, 784-785. Thompson, C. J., Movva, N. R., Tizard, R., Crameri, R., Davies, J. E., Lauwereys, M., & Botterman, J. (1987). Characterization of the herbicide-resistance gene bar from Streptomyces hygroscopicus. Journal of European Molecular Biology Organization, 6(9), 2519-2523. Trieu, A. T., Burleigh, S. H., Kardailsky, I.V., Maldonado-Mendoza, I.E., Versaw, W. K., Blaylock, L. A., Shin, H., Chiou, T. J., Katagi, H., Dewbre, G. R., Weigel, D., & Harrison, M. J. (2000). Transformation of Medicago truncatula via infiltration of seedlings or flowering plants with Agrobacterium. The Plant Journal, 22(6), 531–541. Trigiano, R. N., & Gray, D. J. (2000). Plant tissue culture concepts and laboratory exercises (2nd ed.). New York: CRC press. Wang, W., Wu, Y., Yan Y., Ermakov, M., Kerstetter, R., & Messing, J. (2010). DNA barcoding of the Lemnaceae, a family of aquatic monocots. Journal of BioMed Central Plant Biology, 10, 205. Wang, Y. (2016). Callus Induction and Frond Regeneration in Spirodela polyrhiza. Czech journal genetics plant breeding, 52(3), 114-119. Wang, W. C., Menon, G., & Hansen, G. (2003). Development of a novel Agrobacterium-mediated transformation method to recover transgenic Brassica napus plants. Journal of Plant Cell Report, 22, 274–281. 103
Wang, G. L., & Fang, H. J. (1998). Mechanism and technology of plant genetic engineering, Beijing: Science Publisher. White, P. R. (1943). A Handbook of Plant Tissue Culture. Lancaster, U.S.A.: Jacques Cattell Press. Wilmink, A., van de Ven, B. C. E., & Dons, J. J. M. (1992). Expression of the GUS- gene in the monocot tulip after introduction by particle bombardment and Agrobacterium. Journal of Plant Cell Reports, 11, 76–80. Wongkhamprai, B., Sangsavang, K., Sriboonler, A., & Huehne., P. S. (2011). Efficiency of Agrobacterium transformation of pinene synthase gene isolated from kaffir lime in Arabidopsis thaliana. Thai Journal of Genetics, 4(2), 85-93. Wu, H., Sparks, C., Amoah, B., & Jones, H. D. (2003). Factors influencing successful Agrobacterium-mediated genetic transformation of wheat. Journal of Plant Cell Report, 21, 659–668. Xu, J., Cui, W., Cheng, J. J., & Stomp, A. M. (2011). Production of high-starch duckweed and its conversion to bioethanol. Journal of Biosystems Engineering, 110(2), 67-72. Yadav, S., Sharm, P., Srivastav, A., Desai, P., & Shrivastava, N. (2014). Strain specific Agrobacterium-mediated genetic transformation of Bacopa monnieri. Journal of Genetic Engineering and Biotechnology, 12(2), 89-94. Yamamoto, Y. T., Rajbhandri, N., Lin, X., Bergmann, B. A., Nishimura, Y., & Stomp, A. M. (2001). Genetic transformation of duckweed Lemna gibba and Lemna minor. Journal of In Vitro Cellular & Developmental Biology, 37, 349-353. Yang, L., Han, H., Zuo, Z., Zhou, K., Ren, C., Zhu, Y., Bai, Y., & Yongwang A. (2014). Enhanced plant regeneration in Lemna minor by amino acid. Pakistan Journal of Botany, 46(3), 939-943. Yilmaz, E., Akyurt, I., & Güna, G. (2004). Use of Duckweed, Lemna minor, as a Protein Feedstuff in Practical Diets for Common Carp, Cyprinus carpio, Fry. Turkish Journal of Fisheries and Aquatic Sciences, 4, 105-109. Zambryski, P. (1992). Chronicles from the Agrobacterium-plant cell DNA transfer story. Journal of Annual Review of Plant Physiology, 43, 465–490. 104
Ziegler, P., Adelmann, K., Zimmer, K., Schmidt, C., & Appenroth, K. J. (2014). Relative in vitro growth rates of duckweeds (Lemnaceae) – the most rapidly growing higher plants. Journal of Plant Biology, 1435-8603. Zhao, X., Moatesa, G. K., Wellnera, N., Collinsa, S. R. A., Colemanb, M. J., & Waldrona, K. W. (2014). Chemical characterisation and analysis of the cell wall polysaccharides of duckweed (Lemna minor). Journal of Carbohydrate polymer, 111, 410-418. Zhang, Y., Hu,Y. Yang,B., Ma, F., Lu, P., Li. L., Wan, C., Rayner, S., & Chen, S. (2010). Duckweed (Lemna minor) as a Model Plant System for the Study of Human Microbial Pathogenesis. Public Library of Science (PLOS one), 5(10), 1-11.
105
APPENDIX
106
APPENDIX 1 Instrument and Chemicals
107
Instrument 1. Autoclave HIRAYAMA HA-300 MII 2. Auto pipette GILSON 3. Centrifuge HERMLE z 323 k 4. Centrifuge HERMLE LTD 8000 serie 5. Shacker Heidolph unimax 6. Cuvette Hellma 7. Digital balance METTLER AE 200 and OHAUS Adventurer 8. Desiccator vacuum 9. Hot air oven SHEL LAB SL 1375 FX Sheldon manufacturing. Inc 10. Hot plate VELP scientific
Chemicals 1. Agar 2. Agrose
3. Ammonium nitrate (NH4NO3)
4. Ammonium dihydrogen phosphite (NH4)H2PO3 5. 10% w/v povidone-iodine (Betadine®,Thailand)
6. Boric acid (H3BO3) 7. Bovine serum albumin (BSA)
8. Calcium chloride (CaC12·2H2O)
9. Calcium nitrate (Ca(NO3)2·4H2O) 10. 99.8% Chlorform
11. Cobalt chloride (CoCl2 ·6H2O)
12. Copper (II) sulfate (CuSO4·5H2O) 13. Ethylenediaminetetra acetic acid (EDTA)
14. Ferrous sulfate (FeSO4·7H2O)
15. Ferric chloride (FeCl3·6H20) 16. Folin Ciocalteae
17. Galactose (C6H12O6)
108
APPENDIX 2 Preparation of culture medium
109
Culture medium
1. Hoagland’s E-medium (E) Adjust the pH to 5.8 with 1 M KOH or 1 N HCI
Stock solution Use Composition (g/100ml) ml/L
MgSO4·7H2O 24.60 1.00
Ca(NO3)2·4H2O 23.60 2.30
KH2PO4 13.60 0.50
KNO3 10.10 2.50 Micronutrients Micronutrient Solution (see below) 0.50 Fe·EDTA Fe·EDTA Solution (added last, see below) 20.00
Preparation of Micronutrient and Fe·EDTA solution
Addition Stock solution (g/L) Micronutrient solution
H3BO3 2.86
MnCl2·4H2O 1.82
ZnSO4·7H2O 0.22
Na2MoO4·2H2O 0.09
CuSO4·5H2O 0.09 Fe·EDTA solution
FeCl3·6H20 0.48 EDTA 1.50
110
2. Hoagland E+-medium (E+) Adjust the pH to 4.6 with 1M KOH or 1N HCI
Stock Solution, Use Composition g/100 ml ml/L
Ca(NO3)2·4H2O 5.90 KNO3 7.58 KH2PO4 3.40 20.00 6 mL 6N HCl Tartaric acid 0.30 1.00
FeCl3·6H20 0.54 1.00 EDTA 0.90 100 8 mL 6N KOH
MgSO4·7H2O 5.00 10.00
H3BO3 0.29
ZnSO4·7H2O 0.02 1.00 Na2MoO4·2H2O 0.01
CuSO4·5H2O 0.008
MnCl2·4H2O 0.36
111
3. Shenk and Hidebrandt medium (SH) Adjust the pH to 5.8 with 1M KOH or 1N HCI
Stock solution Use Composition (g/100ml) ml/L
CaC12 2.00 10
KNO3 25.00 g
MgSO4·7H2O 4.00 g 10.00 (NH4)H2PO4 3.00 g
MnSO4·H2O 0.10 g
H3BO3 0.05 g
ZnSO4·7H2O 0.01 g
KI 0.01 g 10.00 CuSO4·5H2O 0.002 g
Na2MoO4·2H2O 0.001 g
CoCl2·6H20 0.001 g Fe·EDTA
FeSO4·7H2O 0.15 g 10.00
Na2EDTA 0.20 g Myo-Inositol 10.00 g Thiamine·HCl 0.05 g Nicotinic acid 0.05 g 10.00 Pyridoxine·HCl 0.005 g
112
4. Murashige and skoog (MS) Adjust the pH to 5.8 with 1M KOH or 1 N HCI
Stock solution Use Composition (g/100ml) (ml/L)
NH4NO3 16.50
CaCl2 3.32
KNO3 19.00 50.00
KH2PO4 1.70
MgSO4 1.80
CoCl2 0.0025
CuSO4∙6H2O 0.0025
H3BO3 0.62
MnSo4∙H2O 1.69 10.00
Na2MoO4∙2HO 0.025 Kl 0.083
ZnSO4∙H2O 0.86
FeSO4∙7H2O 2.78
Na2EDTA 3.73 10.00 Myo-Inositol 10.00 Nicotinic Acid 0.05 Pyridoxine∙HCl 0.05 10.00 Thiamine∙HCl 0.01 Glycine 0.20 Agar 8.00 g
113
5. Flowering induction medium (Hoagland’s E-medium + Salicylic acid)
Stock solution Use Composition (g/100ml) ml/L
MgSO4·7H2O 24.60 1.00
Ca(NO3)2·4H2O 23.60 2.30
KH2PO4 13.60 0.50
KNO3 10.10 2.50 Micronutrients Micronutrient Solution 0.50 Fe·EDTA Fe·EDTA Solution 20.00
Adjust the pH to 5.8 with 1M KOH or 1N HCl
500 µM Salicylic acid (SA), MW. = 138.12 g/mole Dissolve 0.0069 g of SA in a few drops of absolute alcohol until clear solution appeared and adjust the final volume to 100 ml with dH2O.
Concentration(µM) 500 µM SA 0 - 1 1 ml 3 3 ml 5 5 ml
Add corresponding volume to 500 ml of flowering induction medium and adjust pH to 5.8
114
6. Selection medium for transformation Adjust the pH with 1M KOH or 1N HCl
Media Composition
MS1 MS+1%sucrose+100µM acetosyringone+ 0.2%tween-80, pH 5.84
MS1* MS+1%sucrose+100µM acetosyringone, pH 5.84
MS+1%sucrose+100µM acetosyringone+250 mg/L ceftriaxone+ MS2 0.8%Agar, pH 5.84
MS+1%sucrose+100 µM acetosyringone+250 mg/L ceftriaxone+ MS3 0.01 mMGlufosinate + 0.8%Agar, pH 5.84
Glufosinate (MW. 198.16 g/mole)
Stock solution of glufosinate 15% w/v (15 g glufosinate solute in 100 ml)
n = g. n = 15g. = 0.07569 mole
MW. 198.16
100 ml have 0.07569 mole
1,000 ml have 0.07569 mole × 1,000 ml = 0.757 M 100 ml
So, 15% w/v glufosinate = 0.757 M
Preparation of 1 mM Glufosinate (from stock = 0.757 M)
Pipet stock solution 132 µl and adjust the final volume to 100 ml. Then, sterilize the solution with 0.22 µm filter before use. 115
7. Yeast extract mannitol medium (YEM) Yeast extract 3.0 g Mannitol 10.0 g NaCl 5.0 g
MgSO4.7H2O 0.2 g
K2HPO4 0.5 g Agar 15.0 g Adjust volume to 1,000 ml, pH 7.2 with 1M NaOH or 1N HCl
8. LB agar Tryptone 10.0 g Yeast extract 5.0 g NaCl 5.0 g Agar 15.0 g Adjust volume to 1,000 ml, pH 7.2 with 1M NaOH or 1N HCl
116
APPENDIX 3 Preparation of chemicals
117
Chemical preparation
Edward’s buffer Contain 1 M Tris HCL 2.0 ml 1 M NaCl 2.5 ml 0.1 M EDTA 2.5 ml 2% SDS 2.5 ml Adjust volume to 10 ml with sterile water
10x TAE Buffer Contain Tris (Hydroxymethylamine) 4.9 g EDTA 0.4 g Glacial Acetate 1.1 ml Adjust volume to 100 ml with water, pH 8.0
TE buffer Contain 10 mMTris (Hydroxymethylamine) 0.6057 g 1 mM EDTA 0.1861 g Adjust volume to 500 ml with water (autoclave before to use)
Loading dye Contain Sucrose 4.0 g Food-grade dye 2.0 ml Adjust volume to 10 ml with sterile water
Electrophoresis gel Weigh 0.6 g agrose and adjust the volume to 60 ml with 1X TAE buffer. Then melt agrose using microwave and set up the gel. 118
2.5 N HCl Pipet 37% HCl 10.42 ml and adjust the volume to 50 ml
0.1 N HCl Pipet 37% HCl 417 µl and adjust the volume to 50 ml
Anthrone reagent
Dissolve 100 mg anthrone in 50 ml of 98% H2SO4. Prepare fresh before use.
Lowry’s reagent
1. Reagent A : 2% Na2CO3 in 0.12 N NaOH
2. Reagent B : 0.5% CuSO4·5H2O in 1% NaK Tratrate 3. Reagent C : 50 ml of Reagent A + 1 ml of Reagent B (prepare fresh) 4. Folin-ciocaltue reagent
EMS 98% Sulphuric acid 5.0 ml 99.8% Chlorfom 66.6 ml 99.8%Methanol 33.3 ml
Hydroxylamine- FeCl3
FeCl3 0.15 g Hydroxylamine 1.0 g Adjust volume to 30 ml with water
10%Tween-80 Pipet 10 ml of Tween-80 and adjust thevolume to 100 ml. Then, Tween-80 solution was sterilized with 0.22 µm filter before use.
119
Antibiotic solution
Antibiotic Stock solution Amplicilin Stock solution at 100 mg/ml Dissolve 0.1 g antibiotic in 1 ml distilled Spectinomycin water, then sterilize antibiotic solution with Gentamycin 0.22 µm filter before use. Stock solution at 200 mg/ml Dissolve 1.0 g antibiotic in 5 ml distilled Ceftriaxone water, then sterilize antibiotic solution with 0.22 µm filter before use.
2,4-dichlorophenoxyacetic acid (2,4-D), 1mM, MW. 221.04 g/mole Weigh 0.0221 g of 2,4-D and dissolve in 10-15 ml of absolute alcohol. Then a few drops of warm dH2O was gradually added till the solution became milky white. Then again a few drops of ethanol were added and heated till the whitish color faded away and clear solution was obtained. The procedure was repeated till the solution did not turn milky on addition of warm dH2O. The final volume was made to 100 ml.
2,4-D (stock = 1mM) Final volume in MS media (500 ml) pH 5.8±0.5 0 µM - 2 µM 1.0 ml 3 µM 1.5 ml 4 µM 2.0 ml 5 µM 2.5 ml
120
Glufosinate solution
Glufosinate (stock = 1mM or 10 mM) Final volume in media (30 ml) 0 mM - 0.001 mM 30 µl stock = 1mM 0.005 mM 150 µl 0.01 mM 300 µl 0.05 mM 1,500 µl 0.10 mM 300 µl stock = 10 mM 0.50 mM 1,500 µl 1.00 mM 3,000 µl
121
APPENDIX 4 Preparation of PCR and Phylogenetic analysis
122
Preparation of PCR
PCR solution
Taq polymerase Pfu polymerase PCR solution 25 µl Final conc. 25 µl Final conc.
1. dH2O 17.9 - 17.6 - 2. 10XbufferA 2.5 1X 2.5 1X 3.10mMdNTPs 0.3 120 µM 0.5 200 µM
4. 50mM MgCl2 1.0 2 mM 1.0 2 mM 5.10µM Primer (F+R) (0.5+0.5) 0.2 µM (0.5+0.5) 0.2 µM 6.5U/µl Taq/ Pfu 0.3 1.5 Unit 0.4 2 Unit 7. Template 2.0 - 2.0 -
Programmed thermocycler
Taq polymerase Pfu polymerase PCR setup T(oC) Time T(oC) Time
Initial Denaturation 94 2 min 95 2 min
Denaturation 94 30 sec 94 20 sec
Annealing 55 30 sec 55 30 sec
Extension 72 30 sec 72 2 min
Cycle 30 30
Final Extension 72 7 min 72 7 min
123
Sequencing primers
TE Primer pair Primer sequences Tm nmole buffer Forward: 61.8 32.6 326ul atpF-atpH 5’ACTCGCACACACTCCCTTTCC-3’
Reverse: 53.5 25.0 250ul
5’GCTTTTATGGAAGCTTTAACAAT-3’
Stock primer concentration is 100 uM, dilute before use to 10X (10µl primer : 90µl dH2O )
Phylogenetic analysis
Phylogenetic analysis procedure
1. Nucleotide sequences of BUU1, BUU2 and BUU3 (www.wardmedic.com) were blasted to NCBI database (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch) 2. Selected nucleotide sequences from blast, approximately 10 sample, were used for building phylogenetic tree > save >data.fas 3. Analyses were done in MAGA6> file data.fas> Edit> Select All> Alignment> Align by Muscle> Compute> save data.mas
124
4. Continued to Model> Fine best DNA/Protein models> compute
5. Continued to Phylogeny> Construct/Test UPGMA Tree> Bootstrap 1,000> Model Tamura3-parameter model (T92)> compute
6. Phylogenetic tree was constructed as the followings:
125
APPENDIX 5 Effect of sterilizing agents, medium, carbohydrate, protein, and oxalate content in duckweeds
126
Effect of sterilizing agents on duckweeds Sterilizing Time agent S. polyrhiza L.aequinoctialis W. globosa % % % % % % Survival Contamination Survival Contamination Survival Contamination 0.12% 30 sec - - - - 22.2±6.4h 55.6±6.42i NaClO 1 min - - - - 22.2±12.8h 11.1±6.42i 0.18% 1min 88.9±6.4a 66.7±11.1c 88.9±6.4d 55.6±17.0g - - NaClO 3min 88.9±6.4a 55.6±6.4c 77.8±6.4de 33.3±11.1g - -
5 min 88.9±6.4a 55.6±6.4c 66.7±11.1def 0.0±0.0g - - 0.30% 30 sec - - - - 11.1±6.4h 33.3±11.11i NaClO 1 min 77.8±6.4a 66.7±0.0c 66.7±11.1def 22.2±6.4g 22.2±12.8h 11.1±6.42i
3 min 88.9±6.4a 44.4±17.0c 77.8±12.8de 0.0±0.0g - -
5 min 55.6±12.8ab 44.4±12.8c 77.8±6.4de 0.0±0.0g - - 0.42% 30 sec - - - - 11.1±6.4h 22.2±12.83i NaClO 1 min 88.9±6.4a 44.4±12.8c 77.8±6.4de 44.4±6.4g 33.3±19.2h 0±0.00i
3 min 77.8±6.4a 33.3±11.1c 77.8±6.4de 11.1±6.4g - -
5 min 66.7±11.1ab 11.1±6.4c 66.7±11.1def 0.0±0.0g - - 0.54% 1 min 77.8±6.4a 22.2±6.4c 88.9±6.4d 44.4±6.4g - - NaClO 3 min 44.4±12.8ab 55.6±12.8c 55.6±6.4def 11.1±6.4g - -
5 min 33.3±11.1ab 33.3±11.1c 0.0±0.0f 0.0±0.0g - - 0.66% 1 min 55.6±6.4ab 22.2±6.4c 55.6±12.8def 22.2±12.8g - - NaClO 3 min 66.7±11.1ab 33.3±11.1c 11.1±6.4ef 11.1±6.4g - -
5 min 22.2±6.4ab 22.2±12.8c 11.1±6.4ef 0.0±0.0g - - 0.90% 1 min 33.3±11.1ab 0.0±0.0c 55.6±6.4def 0.0±0.0g - - NaClO 3 min 0.0±0.0b 0.0±0.0c 0.0±0.0f 0.0±0.0g - -
5 min 0.0±0.0b 0.0±0.0c 0.0±0.0f 0.0±0.0g - - 0.5% PVP-I 30 sec - - - - 33.3±11.1h 55.6±6.4i
1 min - - - - 44.4±17.0h 77.8±12.8i 1.0% PVP-I 30 sec - - - - 44.4±12.8h 44.4±17.0i
1 min - - - - 44.4±17.0h 33.3±19.2i 1.5% PVP-I 30 sec - - - - 44.4±17.0h 66.7±19.2i
1 min - - - - 22.2±12.8h 11.1±6.4i 2.0% PVP-I 30 sec - - - - 33.3±11.1h 11.1±6.4i 127
Effect of medium on vegetative frond proliferation and doubling time in duckweeds (S. polyrhiza, L. aequinoctialis and W. globosa).
Number of Fronds Doubling time Duckweeds Medium 0 day 7 day 14 day (day) a S. polyrhiza dH2O 2.3±0.2 4.4±0.5 5.9±0.7 12.3±1.5 E 3.1±0.3 13.0±1.4 42.7±3.7 3.2±0.1d 0.5xE 3.1±0.3 14.6±1.6 42.4±4.7 3.5±0.2d E+ 3.1±0.3 9.0±1.3 19.9±4.0 4.1±0.7cd 0.5xE+ 2.7±0.2 12.1±1.6 35.4±5.1 3.8±0.8d SH 2.9±0.3 13.1±1.9 41.7±5.0 3.5±0.6d 0.5xSH 2.8±0.3 12.6±1.5 41.1±3.6 3.5±0.7d MS 2.4±0.2 11.0±0.4 35.9±0.8 3.5±0.3d 0.5xMS 2.3±0.2 11.0±0.6 39.6±2.3 3.4±0.4d b L. dH2O 3.0±0.2 9.8±0.7 14.6±0.9 6.1±0.4 aequinoctialis E 2.7±0.2 25.8±2.8 158.6±7.4 2.4±0.1d 0.5xE 3.0±0.2 25.0±2.0 126.7±11.3 2.6±0.2d E+ 3.0±0.3 24.6±2.7 108.9±7.4 2.7±0.3d 0.5xE+ 2.8±0.1 24.7±1.3 138.8±8.4 2.5±0.1d SH 2.8±0.2 24.4±2.1 129.7±9.2 2.6±0.1d 0.5xSH 3.1±0.2 29.1±2.1 121.9±5.1 2.6±0.1d MS 2.8±0.2 26.1±3.2 117.1±6.8 2.7±0.1d 0.5xMS 2.6±0.2 29.1±2.7 115.3±4.8 2.6±0.2d bc W. globosa dH2O 2.8±0.2 8.7±0.6 17.3±1.8 5.7±0.7 E 2.3±0.2 8.9±0.8 36.1±3.8 3.6±0.4d 0.5xE 2.4±0.2 10.7±1.0 42.9±4.3 3.3±0.1d E+ 2.4±0.2 9.2±0.9 39.9±6.8 3.6±0.4d 0.5xE+ 24±0.2 7.3±0.6 30.6±3.7 3.8±0.3d SH 2.2±0.1 10.0±1.0 42.1±4.5 3.2±0.2d 0.5xSH 2.3±0.2 9.8±1.2 39.0±3.6 3.3±0.5d MS 2.3±0.2 8.2±1.2 32.7±4.2 3.8±0.4d 0.5xMS 2.6±0.2 11.2±1.0 41.3±2.7 3.4±0.5d
Mean ± SEM with different letters are significantly different at 0.05 level by the Tukey’s test (n=3) and Minitab version 17.
128
Preparation of standard curve Glucose standard curve 1. Dissolve 0.1 g glucose in 10 ml distilled water giving a concentration of 1 mg/ml glucose solution 2. Pipet glucose solution as the followings (see table below)
Stock solution glucose OD. Tube Glucose (µg) dH2O (µl) = 200 µg/ml (µl) 630 nm. 1 0 (blank) 0 500 0.000 2 10 50 450 0.193 3 20 100 400 0.425 4 30 150 350 0.568 5 40 200 300 0.750 6 50 250 250 0.951 7 60 300 200 1.080 8 80 400 100 1.403
3. Add 2 ml anthrone reagent and mix immediately within 5 minute and heat for 8 minute in a boiling water bath. After that cool rapidly and read the green to dark green color at 630 nm. Then, draw a standard curve by plotting concentration of the standards on the X-axis and absorbance of samples on the Y-axis.
Glucose standard curve
1.6 1.4 y = 0.0175x + 0.0362 R² = 0.996
1.2 1.0 0.8 0.6
Abs. Abs. nm. 630 0.4 0.2 0.0 0 20 40 60 80 100 Glucose (µg)
129
BSA standard curve 1. Dissolve 0.1 g BSA in 10 ml distilled water giving a concentration of 1,000 µg/ml BSA solution and pipet BSA solution as the followings (see table below). 2. Add 1 ml reagent C amd incubate in dark at room temperature for 30 minute. After that, rapidly add 100 µl Folin-ciocalteu reagent and mix immediately within 30 second and incubate at room temperature for 30 minute. An absorbance at 750 nm is measured. 3. Draw a standard curve by plotting concentration of the standards on the X-axis and absorbance of the samples on the Y-axis.
BSA Stock solution BSA (µl) OD. Tube dH2O (µl) 0.12N HCl (µl) (µg) 1,000 µg/ml 750nm. 1 0 0 200 200 0.000 2 20 20 180 200 0.144
3 40 40 160 200 0.286
4 60 60 140 200 0.387 5 80 80 120 200 0.490
6 100 100 100 200 0.582
7 200 200 0 200 1.000
BSA standard curve
1.2 y = 0.0049x + 0.0632
1.0 R² = 0.9846
0.8 0.6
0.4 Abs. Abs. nm. 750 0.2 0.0 0 50 100 150 200 250 BSA (µg)
130
Example % Efficiency of Anthrone method Average SD #1 #2 #3 #4 #5 1% Starch 106.98 95.31 91.68 91.20 85.32 94.10 8.04 1% glucose 108.17 94.86 111.16 111.01 97.97 104.63 7.68
Example % Efficiency of Lowry's method Average SD #1 #2 #3 #4 #5 1% BSA 94.57 91.83 107.64 100.00 112.02 101.21 8.54
Calculation of carbohydrate and protein content
1. Std. Glucose y = 0.0166X + 0.0306 OD. 630 nm of BUU1 (E- media) = 1.142 1.142 = 0.0166X + 0.0306 X = 68.795 µg/250µl So, in 250µl had carbohydrate = 68.795 µg
5,000µl had carbohydrate = = 1.376 mg/5 ml
2. %Dry weight Dry weight of BUU1 (E-media) = 3.4828 mg dw.
In Dry weight of BUU1 (E-media) 3.4828 mg dw. had carbohydrate = 1.376 mg
If 100 mg dw had carbohydrate =
= 39.51 mg
So, 100 mg dw. of BUU1 (E-media) had the carbohydrate content at 39.51 mg
131
Calculation of oxalate content
1. Open program Image J > File > Open
2. Select Icon > Ctrl 1
132
3. Select Icon > Analyze > Measure > Use area for calculate oxalate content
4. Calculate as the followings 4.1 Std. 1% Oxalic acid 100 ml had oxalate 1g
Pipate 0.5 ml had oxalate = 5 mg
So, 0.5 ml had 1% Oxalic acid 5 mg.
4.2 Area of Std. 1% Oxalic acid form image J had 89831 = 5 mg
Area of BUU2 (E-media) 30861 = =1.7177 mg
4.3 %Dry weight Moisture of BUU2 (E-media) = 97.93 (100- 97.93 = 2.07) Fresh weight of BUU2 (E-media) = 2.2689 g Dry weight of BUU2 (E-media) = 46.876 mg dw.
In Dry weight of BUU2 (E-media) 46.876 mg dw. had oxalate = 1.7177 mg
If 100 mg dw had oxalate =
= 3.664 mg
So, 100 mg dw. of BUU2 (E-media) had oxalate 3.664 mg
133
APPENDIX 6 Developing techniques for duckweed transformation
134
1. Preparation of A. tumefaciens GV-3101 1.1. Resistance of A. tumefaciens GV-3101 to gentamycin and spectinomycin antibiotic Streak 1-2 colonies Agrobacterium into agar LB medium containing gentamycin and spectinomycin, incubate at room temperature for 2 days. The result showed that Agrobacterium can grow in agar LB medium containing 50 or 1,000 µg/ml gentamycin while it cannot grow in agar LB medium containing 50 µg/ml gentamycin and 200µg/ml spectinomycin (Figure 1). So, the LB medium containing 50 µg/ml gentamycin and 200µg/ml spectinomycin is used as selected medium for selecting transformants after transferring plasmid pB7WG and pB7WG2D-X into A. tumefaciens GV-3101.
LB LB + 50µg/ml Gentamycin
LB + 1,000µg/ml Gentamycin LB + 50µg/ml Gentamycin + 50µg /ml Spectinomycin 135
LB + 50µg /ml Gentamycin + LB + 50µg/ml Gentamycin + 100µg /ml Spectinomycin 200µg/ml Spectinomycin
Figure 1. Colonies of A. tumefaciens GV-3101 grown in LB medium containing selective antibiotics.
1.2. The transfer of plasmid pB7WG and pB7WG2D-X into A. tumefaciens GV-3101 by heat shock technique The binary vector pB7WG or pB7WG2D-X contain streptomycin- spectinomycin-resistance gene (Spr), phosphinothricin acetyltransferase gene (Bar) and green fluorescent protein gene (Egfp), under the control of the CaMV35S promoter (Figure 2).
Figure 2 Schematic diagram of the pB7WG or pB7WG2D-X T-DNA region. The Egfp gene are under the control of the CaMV35S promoter.
136
Competent cells of A. tumefaciens GV-3101 1. Agrobacterium grown on solid LB medium was transferred into liquid LB medium containing 50 µg/ml gentamycin and shaking at 200 rpm at room temperature overnight. 2. 5% seed inoculums of Agrobacterium were then transferred to LB medium containing 50 µg/ml gentamycin and shaking at 200 rpm at room temperature for 5-6 hours. Absorbance at 600 nm was measured until ≈ 0.6 – 0.8 (early log phase). 3. After that, cell culture was centrifuged at 10,000 rpm for 5 minutes.
The pellet was resuspended in 500 µl of ice-cold 20 mM CaCl2 4. Cometent cells were aliquoted into 1.5 ml microfuge tubes, 50 µl each. Transformation of Agrobacterium with pB7WG and pB7WG2D-X 1. 5 µl plasmid pB7WG and pB7WG2D-X was added to 50 µl of competent cells of Agrobacterium. 2. The suspension was incubated at 42°C water for 2 minutes and put subsequently on ice for 30 minutes. 3. Transformed cells were spread on LB agar plate containing 50 µg/ml gentamycin and 200 µg/ml spectinomycin and incubated at room temperature for 2 days. The result showed that, plasmid pB7WG and pB7WG2D-X were successfully transferred into Agrobacterium (Figure 3). Agrobacterium harboring pB7WG or pB7WG2D-X was subsequently used for duckweed transformation.
pB7WG pB7WG2D-X
Figure 3 Colonies of transformed A. tumefaciens GV-3101 grown on selective medium (LB medium containing 50 µg/ml gentamycin and 200 µg/ml spectinomycin) 137
2. Growth rate of A. tumefaciens GV-3101 harboring pB7WG
Growth rate of A. tumefaciens GV-3101 (Wild type)
Time (h) OD600 Average SD #1 #2 #3 0 0.186 0.188 0.191 0.188 0.003 3 0.385 0.388 0.398 0.390 0.007 6 0.862 0.875 0.885 0.874 0.012 9 1.718 1.702 1.708 1.709 0.008 12 2.098 2.084 2.078 2.087 0.010 15 2.540 2.480 2.525 2.515 0.031 18 2.835 2.785 2.805 2.808 0.025 21 2.740 2.650 2.730 2.707 0.049 24 2.700 2.765 2.770 2.745 0.039 27 2.675 2.635 2.600 2.637 0.038 30 2.730 2.590 2.680 2.667 0.071 36 2.565 2.485 2.525 2.525 0.040 42 2.440 2.255 2.365 2.353 0.093 48 2.443 2.265 2.380 2.363 0.090 66 2.290 2.250 2.200 2.247 0.045 72 2.275 2.200 2.000 2.158 0.142
Growth rate of A. tumefaciens GV-3101 harboring pB7WG
Time (h) OD600 Average SD #1 #2 #3 0 0.186 0.188 0.186 0.187 0.001 3 0.396 0.386 0.392 0.391 0.005 6 0.901 0.884 0.886 0.890 0.009 9 1.692 1.716 1.732 1.713 0.020 12 2.078 2.058 2.088 2.075 0.015 15 2.510 2.450 2.525 2.495 0.040 18 2.605 2.655 2.695 2.652 0.045 21 2.575 2.515 2.645 2.578 0.065 24 2.590 2.580 2.565 2.578 0.013 27 2.365 2.430 2.410 2.402 0.033 30 2.390 2.375 2.405 2.390 0.015 36 2.245 2.290 2.345 2.293 0.050 42 2.185 2.135 2.185 2.168 0.029 48 2.265 2.225 2.265 2.252 0.023 66 2.125 2.085 2.185 2.132 0.050 72 2.085 2.145 2.175 2.135 0.046
138
3. Effect of ceftriaxone ono A. tumefaciens GV-3101 harboring pB7WG
Ceftriaxone (mg/l) Time (h) OD600 Average SD #1 #2 50 mg/l 0 0.133 0.132 0.133 0.001 6 0.402 0.409 0.406 0.005 12 0.391 0.395 0.393 0.003 18 0.292 0.292 0.292 0.000 24 0.220 0.218 0.219 0.001 30 0.229 0.227 0.228 0.001 36 0.213 0.204 0.209 0.006 100 mg/l 0 0.132 0.133 0.133 0.001 6 0.295 0.297 0.296 0.001 12 0.185 0.187 0.186 0.001 18 0.153 0.154 0.154 0.001 24 0.115 0.116 0.116 0.001 30 0.091 0.093 0.092 0.001 36 0.084 0.083 0.084 0.001
250 mg/l 0 0.133 0.132 0.133 0.001 6 0.083 0.081 0.082 0.001 12 0.034 0.032 0.033 0.001 18 0.029 0.032 0.031 0.002 24 0.031 0.030 0.031 0.001 30 0.029 0.030 0.030 0.001 36 0.022 0.021 0.022 0.001 500 mg/l 0 0.131 0.132 0.132 0.001 6 0.123 0.120 0.122 0.002 12 0.034 0.036 0.035 0.001 18 0.026 0.025 0.026 0.001 24 0.028 0.027 0.028 0.001 30 0.023 0.021 0.022 0.001 36 0.023 0.025 0.024 0.001 1,000 mg/l 0 0.132 0.134 0.133 0.001 6 0.072 0.070 0.071 0.001 12 0.023 0.025 0.024 0.001 18 0.019 0.020 0.020 0.001 24 0.021 0.023 0.022 0.001 30 0.019 0.022 0.021 0.002 36 0.019 0.021 0.020 0.001
139
4. Effect of herbicide (glufosinate) on S. polyrhiza.
Morphology of S. polyrhiza
Glufosinate 0 Days 5 Days 7 Days 14 Days (mM)
0.000
0.001
0.005
0.01
0.05
0.10
Duckweeds cultured in MS media contain different concentration of glufosinate. The growth condition was the 16L: 8D photoperiod with an irradiance of 55 µmol.m-2s-1 from fluorescent light bulbs at 25±2°C for 14 d. (scale bar = 0.5 cm) 140
5. Effect of glufosinate on L. aequinoctialis. Morphology of L. aequinoctialis
Glufosinate 0 Days 5 Days 7 Days 14 Days (mM)
0.000
0.001
0.005
0.01
0.05
0.10
Duckweeds cultured in MS media contain different concentration of Glufosinate. The growth condition was the 16L: 8D photoperiod with an irradiance of 55 µmol.m-2s-1 from fluorescent light bulbs at 25±2°C for 14 d. (scale bar = 0.5 cm) 141
6. Effect of glufosinate on turions of S. polyrhiza. Morphology of regenerated S. polyrhiza
Glufosinate 0 Days 5 Days 7 Days 14 Days (mM)
0.000
0.001
0.005
0.01
0.05
0.10
Duckweeds cultured in MS media contain different concentration of glufosinate. The growth condition was the 16L: 8D photoperiod with an irradiance of 55 µmol.m-2s-1 from fluorescent light bulbs at 25±2°C for 14 d. (scale bar = 0.5 cm) 142
7. Effect of glufosinate on calli of L.aequinoctialis. Morphology of L. aequinoctialis calli
Glufosinate 0 Days 5 Days 7 Days 14 Days (mM)
0.000
0.001
0.005
0.01
0.05
0.10
Duckweeds cultured in MS media contain different concentration of glufosinate. The growth condition was the 16L: 8D photoperiod with an irradiance of 55 µmol.m-2s-1 from fluorescent light bulbs at 25±2°C for 14 d. (scale bar = 0.5 cm) 143
8. Effect of ceftriaxone on growth of L.aequinoctialis.
Growth of L. aequinoctialis Ceftriaxone (mg/L) 0 Day 14 Day 0
50
100
250
500
1,000
Duckweeds cultured in Hoagland’s E- media contain different concentration of ceftriaxone. The growth condition was the 16L: 8D photoperiod with an irradiance of 55 µmol.m-2s-1 from fluorescent light bulbs at 25±2°C for 14 d. (scale bar = 0.5cm)
144
APPENDIX 7 Preparation of PCR for genotyping GFP, BAR, and ActSP genes in transgenic duckweed (T1 and T2)
145
Preparation of PCR
PCR solution Taq polymerase PCR solution 25 µl reaction Final conc.
16.9 - 1. dH2O
2. 10XbufferA 2.5 1X
3.10mMdNTPs 0.3 120 µM
1.0 2 mM 4. 50mM MgCl2
5.10µM Primer (F+R) (0.5+0.5) 0.2 µM
6.5U/5 µl Taq/ Pfu 0.3 1.5 Unit
7. Template 3.0 -
Programmed thermocycler
Taq polymerase PCR setup o T( C) Time
Initial Denaturation 94 2 min
Denaturation 94 30 sec
Annealing 60 30 sec
Extension 72 30 sec
Cycle 40
Final Extension 72 7 min
146
Genotyping primers
TE Primer pair Primer sequences Tm nmole buffer Forward: 55.8 19.8 198ul 5’GACGTAAACGGCCACAAGTT-3’ EGFP Reverse: 57.1 21.7 217ul 5’GAACTCCAGCAGGACCATGT-3’
Forward: 56.4 25.4 254ul 5’GACAAGCACGGTCAACTTCC-3’ Bar Reverse: 57.2 23.0 230ul 5’ACCCACGTCATGCCAGTT-3’
Forward: 60.3 29.7 297ul 5’CAGGTATTGTGCTGGATTCTGG-3’ ActinSP Reverse: 59.3 33.1 331ul 5’TGTAGGTCGTCTCGTGGATG-3’
Stock primers are 100 uM. Working primers were diluted 10X before use
(10 µl prime:90 µl dH2O )
Electrophoresis Weigh 0.6 g agrose and adjust volume to 60 ml with 1X TAE buffer. Heat agrose-buffer solution using microwave and set up gel electrophoresis (at 100 V). The ratio of PCR product to Dye is 25µl: 6.25µl.
147
Detection of GFP, BAR, and ActSP in transgenic duckweeds (T1 and T2)
%Transgenic %Gene detection in T1 Infiltrated time frond proliferation of T1 BAR GFP ActSP
0 min 100.00±0.00 50.00±0.71ab 0.00±0.00c 100.00±0.00e
5 min 96.88±0.06 75.00±0.50ab 100.00±0.00d 100.00±0.00e
10 min 86.15±0.20 0.00±0.00b 33.3±0.58cd 100.00±0.00e
20 min 96.88±0.06 75.00±0.50ab 50.00±0.58cd 100.00±0.00e
b c f Control (dH2O) - 0.00±0.00 0.00±0.00 0.00±0.00
Pure plasmid - 100.00±0.00a 100.00±0.00d 0.00±0.00f
%Transgenic frond proliferation %Gene detection in T2 Infiltrated of T2 time 0 mM 0.005 mM 0.01 mM BAR GFP ActSP Glufosinate Glufosinate Glufosinate
V0 95.00±7.07 85.00±7.07 0.00±0.00 100.00±0.00 0.00±0.00 100.00±0.00
V5 100.00±0.00 100.00±0.00 0.00±0.00 0.00±0.00 0.00±0.00 100.00±0.00
V10 90.00±0.00 85.00±7.07 0.00±0.00 100.00±0.00 0.00±0.00 100.00±0.00
V20 100.00±0.00 90.00±14.14 0.00±0.00 0.00±0.00 0.00±0.00 100.00±0.00
Vcontrol 95.00±7.07 80.00±0.00 0.00±0.00 0.00±0.00 0.00±0.00 0.00±0.00
Pure plasmid - - - 100.00±0.00 100.00±0.00 100.00±0.00
148
Scale bar = 1.0 cm MS1: MS+ 1%sucrose MS2: MS+ 1%sucrose+100µM actosyringone+250 mg/L ceftriaxone MS3: MS+ 1%sucrose +100µM actosyringone+250 mg/L ceftriaxone+ 0.01 mM Glufosinate
149
Scale bar = 1.0 cm MS1: MS+ 1%sucrose MS2: MS+ 1%sucrose+100µM actosyringone+250 mg/L ceftriaxone MS3: MS+ 1%sucrose +100µM actosyringone+250 mg/L ceftriaxone+ 0.01 mM Glufosinate