Characterization of Ectomesenchymal Cells Isolated from the First Branchial Arch During Multilineage Differentiation

http://www.paper.edu.cn Original Paper

Cells Tissues Organs 2006;183:123–132 Accepted after revision: July 18, 2006 DOI: 10.1159/000095986

Characterization of Ectomesenchymal Cells Isolated from the First Branchial Arch during Multilineage Differentiation

a, b c b c d Zhengbin Yan Yunfeng Lin Xiaohui Jiao Zhiyong Li Ling Wu c c c c c c, d Wei Jing Ju Qiao Lei Liu Wei Tang Xiaohui Zheng Weidong Tian

a b c Daqing Oilfields General Hospital, Daqing , Harbin Medical University, Harbin , Department of Oral and d Maxillofacial Surgery, West China College of Stomatology, and Key Laboratory of Oral Biomedical Engineering, Ministry of Education, Sichuan University, Chengdu , China

Key Words The adipogenic ectomesenchymal cells showed accumula- Craniofacial development Stem cell differentiation tion of lipid vacuoles and expression of lipoprotein lipase and Mesenchymal stem cells Cranial neural crest cells peroxisome proliferator-activated receptor 2 . Following os- First branchial arch teoinduction, the fibroblast-like cells became cuboidal and formed mineralized nodules. In addition, the expression of mRNA encoding osteocalcin and osteopontin proved osteo- Abstract genesis at the molecular level. Chondrogenic lineage ex- Ectomesenchymal cells isolated from the first branchial arch pressed collagen type II, aggrecan and Sox9 with a low level have the potential to differentiate into a variety of cell lineag- of collagen type I in monolayer culture. Odontogenesis was es both in vitro and in vivo. This study was aimed to confirm determined by dentin sialophosphoprotein, collagen type I the plasticity of multilineage differentiation with molecular and dentin matrix protein 1 expression. Therefore, we have and cellular characterization. Monolayer cultures of ectomes- demonstrated that ectomesenchymal cells from the first enchymal cells harvested from the first branchial arch primordia in embryonic day 9.5 BALB/c mice were passaged 3 times before analysis. Staining with antibodies against S-100, p75 and vimentin suggested that the population of stem cells Abbreviations used in this paper originated from ectomesenchyme, with few contaminating cells stained for cytokeratin. Then, cells were transferred to BMSSCs bone marrow stromal stem cells CNCCs cranial neural crest cells adipogenic, osteogenic, chondrogenic and odontogenic me- Col-I collagen type I dia. The initiation of controlled differentiation was deter- Col-II collagen type II mined with histological assays, and the expression of tissue- DMP1 dentin matrix protein 1 specific genes was detected using immunocytochemical DSPP dentin sialophosphoprotein staining and reverse transcription polymerase chain reaction. ECM extracellular matrix OCN osteocalcin RT-PCR reverse transcription polymerase chain reaction Z.Y. and Y.L. contributed equally to this study.

© 2006 S. Karger AG, Basel Dr. Weidong Tian 1422–6405/06/1833–0123$23.50/0 Department of Oral and Maxillofacial Surgery, West China College of Stomatology Fax +41 61 306 12 34 Sichuan University E-Mail [email protected] Accessible online at: Chengdu 610041 (China) www.karger.com www.karger.com/cto Tel. +86 28 8550 3406, Fax +86 28 8550 2117, E-Mail [email protected] 转载中国科技论文在线 http://www.paper.edu.cn branchial arch are capable of extensive multilineage differen- Considerable progress has been made in recent years tiation in vitro, controllable by the culture environment. This in understanding the biology of pluripotent cells in the makes them a relevant and valuable source of stem cells for early embryo and how genetic and epigenetic mecha- research of craniofacial development and tissue engineering nisms mediate their subsequent lineage segregation, dif- of restoration. Copyright © 2006 S. Karger AG, Basel ferentiation and final contribution to a particular cell type [Soo et al., 2002; Tian et al., 2004]. Several studies have significantly advanced our understanding of migration and development pathways of the ectomesenchymal Introduction cells during embryogenesis [Pasqualetti and Rijli, 2002; Cobourne and Sharpe, 2003]. However, the multilineage Cranial neural crest cells (CNCCs) contribute signifi- differentiation potential of these cells isolated from the cantly to the formation of craniofacial structures during first branchial arch has not yet been studied in detail, as embryonic development. CNCCs disperse from the dorsal they terminally differentiate to multiple phenotypes. surface of the neural tube and migrate extensively through Here, we report that ectomesenchymal cells can be in- the embryo, giving rise to a wide variety of differentiated duced to express multiple lineage-specific genes and pro- cell types [Stemple and Anderson, 1992; Jiang et al., 2005]. teins in differentiation-inducing culture systems sim- These cells migrate into the first branchial arch from the ilar to those used with bone marrow stromal stem cells midbrain and anterior hindbrain around the 4-somite (BMSSCs). These results confirm the multipotential dif- stage and are then termed ‘ectomesenchymal cells’ [Osu- ferentiation capability of these cells and show that it can mi-Yamashita et al., 1994; Yan et al., 2004]. be controlled by culture conditions. This will aid the elu- Ectomesenchymal cells from cranial neural crest mi- cidation of the mechanisms of craniofacial development, grate ventrolaterally as they populate the branchial arch- as well as point to avenues for stem cell manipulation that es during craniofacial development [Epperlein et al., may be useful in tissue engineering. 2000]. The proliferative activity of these cells produces the discrete swellings that demarcate each branchial arch. Postmigratory ectomesenchymal cells differentiate into Materials and Methods an array of phenotypes following the proper epithelial- Isolation and Culture of Ectomesenchymal Cells mesenchymal interaction and contribute to the forma- Eight-week-old BALB/c mice were used to generate embryos, tion of various head and neck structures [Garcia-Castro and embryonic day 0.5 was taken as noon of the day on which and Bronner-Fraser, 1999; Zhang et al., 2003]. They can vaginal plugs were detected. The first branchial arch primordia give rise to progeny including adipogenic, osteogenic, from embryonic day 9.5 mice were dissected under a microscope chondrogenic, neurogenic, myogenic and odontogenic ( fig. 1 A), minced and incubated in a 0.125% trypsin and 1-mmol/l EDTA solution for 5 min at 37 ° C with gentle agitation. The en- lineages, which form most of the oral and dental tissues zyme digestion was neutralized with fresh Dulbecco’s modified except the enamel organ [Chai et al., 2000; Christiansen Eagle’s medium (Gibco) containing 10% fetal bovine serum (Gib- et al., 2000; Sharpe, 2001]. The detailed morphogenesis co). Released cells were filtered and then collected by centrifuga- of ectomesenchymal structures (e.g., size, shape and tion at 1,000 g for 3 min. The pellet was resuspended, washed 3 2 number of teeth) is also determined by epithelial-mesen- times with medium and seeded on the 25-cm plastic culture f lasks (Corning Company, USA) in medium Dulbecco’s modified chymal interactions [Thesleff and Sharpe, 1997; Tucker Eagle’s medium/F12 (1: 1), containing 10% fetal bovine serum, and Sharpe, 1999]. 10 6 U/l leukemia inhibitor factor (Chemicon International, Te- Various growth factors (such as transforming growth mecula, Calif., USA), 100 U/ml penicillin and 100 g/ml strepto- factor- ) and transcription factors (such as Msx1 and mycin. After 20 min of incubation, most of the cells attached to Msx2) have been implicated in the specification, fate de- the flasks were ectomesenchymal cells, but fewer epithelial cells had attached due to their longer attachment time. The nonat- termination and pattern formation of ectomesenchymal tached cells were discarded, and fresh medium was transferred to cells [Chai et al., 1999; Semba et al., 2000; Takahashi et the flasks. Cells were maintained in a humidified atmosphere of al., 2001]. For instance, fibroblast growth factor 8, which 5% CO 2 at 37 ° C and passaged 3 times prior to specific induction is expressed in the anterior surface ectoderm of the first in different culture systems. arch, is essential for the polarity of the branchial arch Identification of Cultured Cells [Tucker et al., 1999; Irving and Mason, 2000]. Hence, Immunostaining with antibodies against vimentin (1: 50), S- many regulatory molecules play an important role in pat- 100 (1: 100; Dako Cytomation, Carpinteria, Calif., USA) and p75 terning the branchial arch derivatives. (1: 100; Boehringer Mannheim, Mannheim, Germany) was per-

124 Cells Tissues Organs 2006;183:123–132 Yan /Lin /Jiao /Li /Wu /Jing /Qiao /Liu /

Tang /Zheng /Tian 中国科技论文在线 http://www.paper.edu.cn

F i g . 1 . First branchial arch primordia under a microscope (A ). Primary cells showed a fibroblast-like morphology with 2–4 processes ( B ). After 3 passages and expansion for 14 days, most of the cells were positively immunostained with markers of undifferentiated ectomesenchymal and neural crest cells, including p75 (C ), vimentin (D ) and S-100 (E ). Few cells in the culture were labeled with antibody to cytokeratin (F ). Scale bar = 50 m.

formed to identify the undifferentiated characters of primary ec- positive staining divided by the total number of cells counted and tomesenchymal cells. Contaminating dental epithelial cells were expressed as a percentage, was calculated. detected with antibody against cytokeratin (1: 100; Dako Cytoma- tion). The proportion of positive staining cells was quantitatively Multilineage Differentiation of Ectomesenchymal Cells analyzed with a color image analysis system (Media Cybernetics, Ectomesenchymal cells at passage 3 were induced toward the Image-Pro Plus 5.0). At least 50 different regions of cells were adipogenic, osteogenic, chondrogenic and odontogenic lineages counted per slide. These regions were equally distributed across in specific media, as detailed in table 1. The preparation of dental the slides. The positive ratio, defined as the number of cells with matrix noncollagen proteins applied in odontogenic induction

Characterization of Ectomesenchymal Cells Tissues Organs 2006;183:123–132 125 Cells from the First Branchial Arch 中国科技论文在线 http://www.paper.edu.cn

Table 1. Lineage-specific differentiation induced by media supplementation

Medium Media Serum Supplementation

Control DMEM FBS (10%) 1% antibiotic/antimycotic

Adipogenic DMEM FBS (10%) 1 M dexamethasone, 10 M insulin, 200 M indomethacin, 0.5 mM isobutyl-methylxanthine, 1% antibiotic/antimycotic

Osteogenic DMEM FBS (10%) 50 M ascorbate-2-phosphate, 10 mM -glycerophosphate, 0.01 M 1,25-dihydroxyvitamin D3, 1% antibiotic/antimycotic

Chondrogenic DMEM FBS (10%) 50 nM ascorbate-2-phosphate, 6.25 g/ml insulin, 10 ng/ml transforming growth factor-, 1% antibiotic/antimycotic Odontogenetic DMEM FBS (10%) 2 ng/ml transforming growth factor-, 300 g/ml bone morpho genetic protein 2, 200 g/ml dental matrix noncollagen proteins1, 1% antibiotic/antimycotic

1 The preparation of dental matrix noncollagen proteins was done according to Smith and Leaver [1979]. DMEM = Dulbecco’s modified Eagle’s medium.

was done according to a previous study [Smith and Leaver, 1979]. In all the experiments, the proportion of positively stained Each medium has been previously described and induced con- cells was measured quantitatively in 50 different regions with an trolled differentiation of BMSSCs, which were taken as positive image analysis system (Media Cybernetics, Image-Pro Plus controls. Negative controls were ectomesenchymal cells main- 5.0). taining in control medium. The medium was replaced every 3–4 days, and confluent differentiated ectomesenchymal cells were I m m u n o c y t o c h e m i c a l A n a l y s i s passaged at 5-day intervals in a 1: 3 ratio. Slides of differentiated monolayer cells were prepared for immunocytochemical analysis and fixed in 4% buffered parafor- Histological Confirmation of Multilineage Differentiation maldehyde. Fixed glass slides were incubated with 3% hydrogen During culture in vitro, differentiated phenotypes of variant peroxide in methanol for 30 min to inhibit endogenous peroxi- cells were viewed and compared by phase-contrast microscopy. dase activity. After having been washed with PBS, they were At the end of this study, the cells in monolayers were fixed in 4% blocked in 1% bovine serum albumin and 1.5% normal goat se- formaldehyde for 30 min at 4 ° C for the next step of histological rum at room temperature for 30 min. Slides were then incubated staining. The cellular morphological features were determined overnight at 4 ° C, with antibodies to collagen type I (Col-I), col- with standard hematoxylin and eosin staining. lagen type II (Col-II), aggrecan and osteocalcin (OCN) at 1: 100 Adipogenesis. This was assessed with oil red O stain as an in- dilutions and antibody to dentin sialophosphoprotein (DSPP) at dicator of intracellular lipid accumulation, after induction in ad- 1: 150 dilution. Sequentially, slides were incubated with secondary ipogenic medium for 2 weeks. Fixed cells were washed with 70% biotinylated antibodies and horseradish peroxide-conjugated ethanol and then incubated in 2% (wt/vol) oil red O reagent for streptavidin to detect the primary antibodies. The peroxidase re- 5 min at room temperature. Excess stain was removed by washing action was developed using 3,3 -diaminobenzidine tetrahydro- with 70% ethanol followed by several changes of distilled water. chloride as chromogens. After rinsing in distilled water, slides The cells were counterstained for 2 min with hematoxylin. were dehydrated in ascending ethanol solutions, cleared in xylene Osteogenesis. The cells were incubated in osteogenic medium and covered with slips for microscopy. All the antibodies were for 4 weeks and fixed. The extracellular matrix (ECM) calcifica- obtained from Dako Cytomation except for Col-I (Sigma, St. Lou- tion was examined with alizarin red staining. The osteogenic cells is, Mo., USA) and DSPP (Fourth Military Medical University, were rinsed with distilled water and overlaid with a 1% (wt/vol) Xi’an, China). alizarin red staining solution for 5 min. Then, they were rinsed 5 times in water followed by a 15-min PBS washing with rotation to RNA Isolation and Reverse Transcription Polymerase Chain reduce nonspecific stain. Reaction Chondrogenesis. Ectomesenchymal cells were induced in Total RNA was extracted from the differentiated cells after 2 chondrogenic medium for 2 weeks. The expression of aggrecan weeks of induction using the Trizol reagent (Life Technologies, and collagen was assayed by immunocytochemical staining. Rockville, Md., USA) according to the protocol. About 1 g of Odontogenesis. After 2 weeks of induction, the formation of total RNA was reverse transcribed by murine leukemia virus re- calcium nodules during odontogenesis was labeled with alizarin verse transcriptase (TaKaRa, Japan), and polymerase chain reac- red staining protocol. tion (PCR) amplification of target mRNA was performed by the TaKaRa PCR kit (TaKaRa). PCR oligonucleotide primers and an-

126 Cells Tissues Organs 2006;183:123–132 Yan /Lin /Jiao /Li /Wu /Jing /Qiao /Liu /

Tang /Zheng /Tian 中国科技论文在线 http://www.paper.edu.cn

Table 2. Specific primers for PCR amplification listed with expected fragment size and optimal annealing temperature

Gene Primers Annealing Frag- GenBank No. tempera- ment

ture, ° C bp

LPL 5ATGAGATCAACAAGGTCAGAGCCAAGA3 67 678 NM_008509 5TAAACGGTGGCTAACCCAGGGTG3 PPAR-2 5 AAGACCACTCGCATTCCTTTGAC3 64 472 NM_011146 5TCTCACAATGCCATCAGGTTTGG3 Osteopontin 5ACTTGGTGGTGATCTAGTGGTGC3 60 337 NM_009263 5TCCAAGCAATTCCAATGAAAGCCAT3 OCN 5AACATAGTGTCGTCGTTTCTTTCTG3 60 360 NM_031368 5TATCAAACCAGTATGGCTTAAAGACC3 Sox9 5CGCTCGCAATACGACTACGC3 57 571 NM_011448 5CATGGAGGACGATTGGAGAA3 Col-II 5CTCGCACTTGCCAAGACCTGAAA3 69 456 NM_031163 5GAGGGCAACAGCAGGTTCACATACA3 DSPP 5GAATAGCACCAACCATGAGG3 63 313 NM_010080 5 TCTAACGGAAGTGACGAAAG3 DMP1 5GTGGAGATGACACCTTTGGCGATGA3 58 546 NM_016779 5TATGAGGTCGGAAGAATCTAAAGG3 GAPDH 5CCATCACTGCCACCCAGAAGACT3 56 486 NM_001001303 5GGAGTAAGAAACCCTGGACCACC3

LPL = Lipoprotein lipase; PPAR-2 = peroxisome proliferator-activated receptor 2.

nealing temperature are listed in table 2. The products were elec- mal cells. After 3 passages, more than 90% of the cells trophoresed on 1.5% agarose gels, stained with ethidium bromide showed positive immunostaining with antibodies to p75 and visualized with Quantity One software (Bio-Rad). (fig. 1C), vimentin (fig. 1D) and S-100 (fig. 1E), and less than 3% of the cells were epithelial on the basis of cytokeratin staining results ( fig. 1F). These results indicated R e s u l t s that the cultured cells were predominantly ectomesenchymal cells from the embryonic first branchial arch Characteristics of Cultured First Branchial Arch which maintained an undifferentiated state over at least Ectomesenchymal Cells 1 month of expansion in control medium with no spon- Most of the primary cells harvested from the first taneous differentiation. branchial arch showed a fibroblast-like morphology after 2–4 processes ( fig. 1 B). The different attachment time for A d i p o g e n e s i s the ectomesenchymal and epithelial cells led to most of After 2 weeks of adipogenic induction, about 25% of the ectomesenchymal cells attaching after 20 min of the ectomesenchymal cells displayed accumulation of incubation, whereas most epithelial cells remained lipid vacuoles (fig. 2A), as detected by red oil O (fig. 2B). suspended in the medium. During trypsinization for They were scattered across the slides surrounded with subsequent passaging, longer detachment time of ecto- undifferentiated cells. No lipid droplets were observed in mesenchymal cells compared with epithelial cells also undifferentiated ectomesenchymal cells. Reverse tran- contributed to further purification of the ectomesenchy- scription (RT)-PCR analysis of mRNA encoding lipopro-

Characterization of Ectomesenchymal Cells Tissues Organs 2006;183:123–132 127 Cells from the First Branchial Arch 中国科技论文在线 http://www.paper.edu.cn

F i g . 2 . After 2 weeks of adipogenic induction, ectomesenchymal cells displayed accumulation of lipid vacuoles ( A), as detected by red oil O ( B ). Cultured in osteogenic medium for 4 weeks, ectomesenchymal cells expressed OCN positively at protein level (C ), and the calcification in ECM was also detected with alizarin red stain (D ). After having been placed into chondrogenic medium for 2 weeks, the specific ECM molecules of chondrocytes, aggrecan and Col-II were immunocytochemi- cally positively stained in the ECM ( E, F ). Scale bar = 50 m.

tein lipase and peroxisome proliferator-activated recep- O s t e o g e n e s i s tor 2 showed high-level expression in ectomesenchymal Treated with low concentrations of ascorbate-2-phos- cells cultured in adipogenic medium for 2 weeks ( fig. 3 ). phate, 1,25-dihydroxyvitamin D 3 and -glycerophos- Taken together, the results indicate that ectomesenchy- phate, ectomesenchymal cells were induced to differenti- mal cells undergo adipogenic differentiation. These re- ate into osteoblasts in vitro. The cell morphology of in- sults were similar to those of BMSSCs in adipogenic me- duced ectomesenchymal cells underwent significant dium. changes consistent with differentiation along the osteo-

128 Cells Tissues Organs 2006;183:123–132 Yan /Lin /Jiao /Li /Wu /Jing /Qiao /Liu /

Tang /Zheng /Tian 中国科技论文在线 http://www.paper.edu.cn

tive of a calcified ECM, were observed in the cells treated in osteogenic medium for 4 weeks (fig. 2D). RT-PCR ABC analysis of OCN and osteopontin showed positive ex- LPL pression in the cells cultured in osteogenic medium for 2 weeks ( fig. 3 ). In contrast, expression of these osteogenic genes and calcified ECM were not observed in PPAR- 2 the cells incubated in the control medium. These results were similar to those of BMSSCs in osteogenic Osteopontin medium.

C h o n d r o g e n e s i s OCN After chondrogenic medium for 7 days, the ectomesenchymal cells exhibited changes in cell structure, Sox9 modulating from an elongated fibroblastic appearance to a polygonal shape. Two weeks after initial induction, we observed that the cells tended to form aggregates in Col-II high density, even in monolayer culture, and had large nuclei with multiple nucleoli similar to normal chon- DSPP drocytes. Immunocytochemical assay of aggrecan and Col-II was also strongly positive at over 85% of the surface ( fig. 2 E, F); however, the secretion of Col-I was at a DMP1 lower level. RT-PCR analysis of mRNA using Col-II and Sox9-specific primers showed a high-level expression in GAPDH the differentiated cells after culture in chondrogenic medium for 2 weeks (fig. 3). These results were not observed in the cells incubated in the control medium, and they were similar to those of BMSSCs in chondrogenic medium. F i g . 3 . Expression of specific genes was analyzed by RT-PCR in three groups. Line A = Gene expression of various differenti- O d o n t o g e n e s i s ated ectomesenchymal cells from the first After 2 weeks of odontogenic inductive cultivation, branchial arch; line B = positive control ectomesenchymal cells from the first branchial arch group of BMSSCs; line C = negative con- changed into large polygonal shape characterized by long trol group of noninduced ectomesenchymal cells. The results in each group were processes and a relatively large nucleus in cytoplasm rich reproducible. A representative example in organelles (fig. 4A). Immunostaining demonstrated of loading controls is GAPDH expres- odontogenic markers Col-I and DSPP in the ECM sur- sion. LPL = Lipoprotein lipase; PPAR- 2 = rounding 60% of cells (fig. 4B, C) compared with only peroxisome proliferator-activated recep- about 2% of positive expression in the control cells. The tor . 2 formation of calcium nodules was observed in monolayer odontogenic cells after 2 weeks, and the mineralized ECM-entrapping cells were intensely stained with alizarin red ( fig. 4 D). DSPP and dentin matrix protein 1 (DMP1) mRNA was expressed at a high level in cells in genic lineage. The immunocytochemical staining of odontogenic conditions ( fig. 3 ). Based on these results, it OCN is a practically unique marker of osteogenic differ- was confirmed that the ectomesenchymal cells could be entiation (fig. 2C). About 80% of the cells were detected induced to become odontoblasts. Interestingly, BMSSCs with synthesis of OCN, and their aggregates were dis- did not express odontogenic markers under the same tributed evenly across the slides. To further confirm os- conditions of culture ( fig. 3 ). teogenic differentiation, the ECM calcification was assessed by alizarin red stain. Several red regions, indica-

Characterization of Ectomesenchymal Cells Tissues Organs 2006;183:123–132 129 Cells from the First Branchial Arch 中国科技论文在线 http://www.paper.edu.cn

F i g . 4 . After 2 weeks of odontogenic cultivation, ectomesenchymal cells from the first branchial arch changed into polygon shape and were characterized by long processes (A ). Immunocytochemical staining demonstrated that Col-I and DSPP ap- peared positive (B , C ). The formation of calcium nodules was observed after 14 days of inducing culture (D ). Scale bar = 50 m.

Discussion er cell culture. Given the importance of the origin of multipotent cells, we first identified the proportion of In mammals, the ectomesenchymal cells of the first cells in the undifferentiated cultures. After 3 passages of branchial arch originate from the rostral hindbrain and in vitro expansion, the total of epithelial cells stained caudal midbrain. Like many developmental processes, with the antibody to cytokeratin was less than 10%. Cy- the development of facial structures is dependent upon tokeratin is taken as a typical molecular marker of epi- the successful contribution of ectomesenchymal cells thelial cells. This indicates that the contaminating non- [Prince and Lumsden, 1994; Cobourne, 2000]. Ectomes- ectomesenchymal cells were far fewer than the ectomesenchymal cells are multipotential stem cells that exten- enchymal cells. On the other hand, more than 90% of the sively contribute to vertebrate development and give rise cells showed positive immunostaining with antibodies to various cell and tissue types, such as dental mesen- to p75, vimentin and S-100. Though vimentin is a gen- chyme, dental papilla, odontoblasts, dentine matrix, pulp, eral mesenchymal marker that is not specific to neural cementum, periodontal ligaments, chondrocytes in crest, S-100 and p75 staining indicated that the cultured Meckel’s cartilage, mandible, the articulating disc of the cells were ectomesenchymal cells from the embryonic temporomandibular joint and branchial arch nerve gan- first branchial arch. Their capacity of self-renewal was glia [Sohal et al., 1999; Zhang et al., 2003]. manifested since they maintained an undifferentiated We attempted to isolate ectomesenchymal cells of the and proliferative state after at least 1 month of expansion embryonic first branchial arch and differentiate them in control medium with no spontaneous differentia- into several terminal differentiated lineages in monolay- tion.

130 Cells Tissues Organs 2006;183:123–132 Yan /Lin /Jiao /Li /Wu /Jing /Qiao /Liu /

Tang /Zheng /Tian 中国科技论文在线 http://www.paper.edu.cn

Explicitly, stem cells cannot only generate daughter initiation of tooth development requires oral epithelium cells identical to their mother cells (self-renewal), but also and that other embryonic epithelium will not support produce progeny with more restricted potential (differ- tooth formation [Jowett et al., 1993]. Besides the growth entiated cells). The biological function of the CNCCs has factors and transcriptional factors, the components in- been studied in a variety of animal models. Recent stud- volved in the cell-cell and cell-ECM interactions, such as ies have shown that these cells acquire positional identity integrins and ECM molecules, also play a key role in the at the time they reach their final destination and contrib- determination of the fate of ectomesenchyme cells. In ute to the formation of various craniofacial structures. this study, the participation of dental matrix noncollagen Regulated with certain growth and transcription factors, proteins in the inductive system for odontogenesis was an the multipotent CNCCs become progressively restricted example that cell-ECM interactions had great effects on to form neural crest derivatives and eventually develop the differentiation of stem cells. into individual cell types [Tucker and Sharpe, 1999; Deng Here, we reported the multiple lineage capabilities of et al., 2004]. In agreement with these findings, we suc- ectomesenchymal cells from the first branchial arch. cessfully induced multiple phenotypes of differentiation Thus, ectomesenchymal cells could be regarded as a in cultured ectomesenchymal cells. Incubated in adipo- source of seed cells for basic research in several fields, genic medium, cells gradually metamorphosed into mul- particularly the development of orofacial structure and tilocular adipogenic lineage in vitro. Stained positively tissue engineering for restoration. These cells seemed with oil red O, these multilocular cells could be consid- broadly similar in potentiality to BMSSCs, with the ex- ered as preadipocytes with the obvious increase in lipid ception that the latter were unable to express odontogen- accumulation. Moreover, expression of peroxisome pro- ic markers. Currently, the source of the odontoblasts has liferator-activated receptor 2 and lipoprotein lipase at been an obstacle to study tooth repair and tooth regen- the mRNA level confirmed the adipogenic differentia- eration. In addition, large clinical defects of bone or car- tion [Kang et al., 2005; Schadinger et al., 2005] of experi- tilage have often limited potential for repair, and hence, mental cells in comparison with no transcription in the large lesions never heal spontaneously in orthopedic pa- controls. In chondrogenic medium, the expression of ag- tients [Beris et al., 2005]. Stem cell therapy is one of the grecan, Col-II and Sox9 are early and practically unique most promising methods for tooth tissue engineering be- markers of chondrocyte differentiation. As to the osteo- cause the transplantation of materials containing odon- genic lineage, the positive immunostaining of OCN, the togenic stem cells provides an excellent inductive means formation of mineralized nodes and the expression of os- to regenerate new tooth tissues [Smith and Leaver, 1979; teoblast marker genes at the mRNA level presented the Begue-Kirn et al., 1992; Young et al., 2002; Shi and Gron- proof of osteogenesis in induced ectomesenchymal cells. thos, 2003; Ohazama et al., 2004]. In further studies, we Furthermore, after having been cultured in an inductive will continue to explore the most suitable culture systems system, active synthesis of ECM and mineralization dem- for the controlled and efficient induction of ectomesen- onstrated the onset of overt odontogenesis, coincident chymal cells to various specific lineages and their bio- with DSPP and DMP secreted by differentiated cells. logical behavior in three-dimensional culture. Odontoblasts express DMP1 and DSPP at a high level, the latter turning to dentin sialoprotein and dentin phospho- protein after proteolytic cleavage. These ECM proteins Acknowledgements appear to be most characteristically expressed in dentin even though they can be found, albeit at lower levels, in We thank Shengwei Li for the excellent technical support and Lei Liu for helping with manuscript preparation. This work was other tissues. supported by a generous grant from the Special Project of Na- Thus, we concluded that the ectomesenchymal cells tional Grand Fundamental Research Program of China from the embryonic first branchial arch had the capacity (2002CCC00700) and the Teaching & Research Award for Out- to sense a broad range of growth factors and signaling standing Young Teachers in Higher Education Institutions of PR molecules and differentiate into downstream lineages China (2003682). under modulation with various specific signal transduc- tion pathways. In another way, it is well established that teeth develop via interactions between oral epithelium and underlying ectomesenchyme cells [Thesleff, 1995]. Recombination experiments have determined that the

Characterization of Ectomesenchymal Cells Tissues Organs 2006;183:123–132 131 Cells from the First Branchial Arch 中国科技论文在线 http://www.paper.edu.cn

References

Begue-Kirn, C., A.J. Smith, J.V. Ruch, J.M. Jiang, H.B., W.D. Tian, W. Tang, L. Liu, X.D. Li Sohal, G.S., M.M. Ali, A.A. Ali, D. Dai (1999) Wozney, A. Purchio, D. Hartmann, H. Lesot (2005) In vitro study on cranial neural crest Ventrally emigrating neural tube cells con- (1992) Effects of dentin proteins, transform- differentiating into ectomesenchymal cell of tribute to the formation of Meckel’s and ing growth factor 1 (TGF 1 ) and bone mor- the first branchial arch by FGF8. Zhonghua quadrate cartilage. Dev Dyn 216: 37–44. phogenetic protein 2 (BMP2) on the differen- Kou Qiang Yi Xue Za Zhi 40: 319–322. Soo, K., M.P. O’Rourke, P.L. Khoo, K.A. Steiner, tiation of odontoblast in vitro. Int J Dev Biol Jowett, A.K., S. Vainio, M.W. Ferguson, P.T. N. Wong, R.R. Behringer, P.P. Tam (2002) 36: 491. Sharpe, I. Thesleff (1993) Epithelial-mesen- Twist function is required for the morpho- Beris, A.E., M.G. Lykissas, C.D. Papageorgiou, et chymal interactions are required for msx 1 genesis of the cephalic neural tube and the al. (2005) Advances in articular cartilage re- and msx 2 gene expression in the developing differentiation of the cranial neural crest pair. Injury 36(suppl 4): S14–S23. murine molar tooth. Development 117: 461– cells in the mouse embryo. Dev Biol 247: 251– Chai, Y., X. Jiang, Y. Ito, P. Bringas, Jr., J. Han, 470. 270. D.H. Rowitch, P. Soriano, A.P. McMahon, Kang, X., Y. Xie, D.A. Kniss (2005) Adipose tis- Stemple, D.L., D.J. Anderson (1992) Isolation of H.M. Sucov (2000) Fate of the mammalian sue model using three-dimensional cultiva- a stem cell for neurons and glia from the cranial neural crest during tooth and man- tion of preadipocytes seeded onto fibrous mammalian neural crest. Cell 71: 973–985. dibular morphogenesis. Development 127: polymer scaffolds. Tissue Eng 11: 458–468. Takahashi, K., G.H. Nuckolls, I. Takahashi, K. 1671–1679. Ohazama, A., S.A. Modino, I. Miletich, P.T. Nonaka, M. Nagata, T. Ikura, H.C. Slavkin, Chai, Y., J. Zhao, A. Mogharei, B. Xu, P. Bringas, Sharpe (2004) Stem-cell-based tissue engi- L. Shum (2001) Msx2 is a repressor of chon- Jr., C. Shuler, D. Warburton (1999) Inhibi- neering of murine teeth. J Dent Res 83: 518– drogenic differentiation in migratory crani- tion of transforming growth factor- type II 523. al neural crest cells. Dev Dyn 222: 252–262. receptor signaling accelerates tooth forma- Osumi-Yamashita, N., Y. Ninomiya, H. Doi, K. Thesleff, I. (1995) Tooth morphogenesis. Adv tion in mouse first branchial arch explants. Eto (1994) The contribution of both fore- Dent Res 9: 12. Mech Dev 86: 63–74. brain and midbrain crest cells to the mesen- Thesleff, I., P. Sharpe (1997) Signalling networks Christiansen, J.H., E.G. Coles, D.G. Wilkinson chyme in the frontonasal mass of mouse em- regulating dental development. Mech Dev (2000) Molecular control of neural crest for- bryos. Dev Biol 164: 409–419. 67: 111–123. mation, migration and differentiation. Curr Pasqualetti, M., F.M. Rijli (2002) Developmental Tian, W.D., H.B. Jiang, L. Liu, W. Tang, X.D. Li Opin Cell Biol 12: 719–724 biology: the plastic face. Nature 416: 493. (2004) In vitro culture and biological char- Cobourne, M.T. (2000) Construction for the Prince, V., A. Lumsden (1994) Hoxa-2 expres- acteristics of cranial neural crest stem cell. modern head: current concepts in craniofa- sion in normal and transposed rhombo- Hua Xi Kou Qiang Yi Xue Za Zhi 22: 229– cial development. J Orthod 27: 307–314. meres: independent regulation in the neural 231. Cobourne, M.T., P.T. Sharpe (2003) Tooth and tube and neural crest. Development 120: Tucker, A.S., P.T. Sharpe (1999) Molecular genet- jaw: molecular mechanisms of patterning in 911–923. ics of tooth morphogenesis and patterning: the first branchial arch. Arch Oral Biol 48: Schadinger, S.E., N.L. Bucher, B.M. Schreiber, the right shape in the right place. J Dent Res 1–14. S.R. Farmer (2005) PPAR 2 regulates lipo- 78: 826–834. Deng, M.J., Y. Jin, J.N. Shi, H.B. Lu, Y. Liu, D.W. genesis and lipid accumulation in steatotic Tucker, A.S., G. Yamada, M. Grigoriou, V. Pach- He, X. Nie, A.J. Smith (2004) Multilineage hepatocytes. Am J Physiol Endocrinol Metab nis, P.T. Sharpe (1999) Fgf-8 determines ros- differentiation of ectomesenchymal cells 288: E1195–E1205. tral-caudal polarity in the first branchial isolated from the first branchial arch. Tissue Semba, I., K. Nonaka, I. Takahashi, K. Taka- arch. Development 126: 51–61. Eng 10: 1597–1606. hashi, R. Dashner, L. Shum, G.H. Nuckolls, Yan, Z.B., W.D. Tian, L. Liu, J.Q. Hou, X.Z. Chen, Epperlein, H., D. Meulemans, M. Bronner-Fra- H.C. Slavkin (2000) Positionally dependent Z.Y. Li (2004) Establishment of a culture sys- ser, H. Steinbeisser, M.A. Selleck (2000) chondrogenesis induced by BMP4 is co-reg- tem of chick embryo for mouse tooth germ Analysis of cranial neural crest migratory ulated by Sox9 and Msx2. Dev Dyn 217: 401– development. Hua Xi Kou Qiang Yi Xue Za pathways in axolotl using cell markers and 414. Zhi 22: 232–234. transplantation. Development 127: 2751– Sharpe, P.T. (2001) Neural crest and tooth mor- Young, C.S., S. Terada, J.P. Vacanti, M. Honda, 2761 phogenesis. Adv Dent Res 15: 4–7. J.D. Bartlett, P.C. Yelick (2002) Tissue engi- Garcia-Castro, M., M. Bronner-Fraser (1999) In- Shi, S., S. Gronthos (2003) Perivascular niche of neering of complex tooth structure on biode- duction and differentiation of the neural postnatal mesenchymal stem cells identified gradable polymer scaffolds. J Dent Res 81: crest. Curr Opin Cell Biol 11: 695–698 in human bone marrow and dental pulp. J 695–700. Irving, C., I. Mason (2000) Signalling by FGF8 Bone Miner Res 18: 696–704. Zhang, Y., S. Wang, Y. Song, J. Han, Y. Chai, Y. from the isthmus patterns anterior hind- Smith, A.J., A.G. Leaver (1979) Non-collagenous Chen (2003) Timing of odontogenic neural brain and establish the anterior limit of Hox components of the organic matrix of rabbit crest cell migration and tooth-forming capa- gene expression. Development 127: 177– incisor dentine. Arch Oral Biol 24: 449– bility in mice. Dev Dyn 226: 713–718. 186. 454.

132 Cells Tissues Organs 2006;183:123–132 Yan /Lin /Jiao /Li /Wu /Jing /Qiao /Liu /

Tang /Zheng /Tian