14
MITOCHONDRIAL AND NUCLEAR GENES FROM
THE EXTINCT BALEARIC BOVID MYOTRAGUS BALEARlCUS
Carles LALUEZA-Fox, Lourdes SAMPJETRO, Tomàs MARQuÈs, Josep Antoni ALcovER & Jaume BERTRANPETIT
LALUEZA-Fox, C, SAM PIETRO, L., MARQuÈs, T., ALCOVER, J. A. & BERTRANPETIl; J. 2005. Mitochondrial and nuclear genes [TOm the extinct Balearic bovid Myotragus balearicus. In ALCOVER, JA & BOVER, P. (eds.): Proceedings of the International Symposium "Insular Vertebrate Evolution: the Palaeontological Approach". Monografies de la Societat d'Història Natural de les Balears, 12: 145-154.
Resum Myotragus balearicus és un bòvid extingit de les lIJes Balears Orientals o Gimnèsies (Mallorca, Menorca i illots que les envolten). Myotragus presenta nombroses novetats evolutives que enfosqueixen el seu emplaçament taxonòmic dintre dels Caprinae. A un projecte desenvolupat els darrers anys hem analitzat diferents mostres d'ossos de Myotragus i hem recupe rat el gen cytb mtDNA complet, una seqüència del gen 12S mtDNA, una seqüència de la regió D-Ioop, i una seqüència d'un gen nuclear multi-còpia (el rDNA 28 S), emprant tècniques de DNA antic. Diferents controls experimentals, incloent-hi un laboratori dedicat, obtenció independent de rèpliques, solapament de fragments, extraccions múltiples i clonatge de pro ductes PCR, donen suport a l'autenticitat de les seqüències. Els arbres filogenètics nous situen consistentment Myotragus a una posició basal al clade Ouis-Budorcas. Emperò, alguns gèneres de Caprinae, tals com Otearnnos i Amnotragus, presenten posicions inestables a tots els arbres. La branca llarga observada a Myotragus correspon a una taxa evolutiva elevada a aques ta línia que podria estar associada a la seva petita mida corporal. A més, la recuperació de gens nuclears per primera vegada d'una espècie extingida de la Mediterrània obre noves possibilitats de recerca sobre els trets genòmics i fenotípics. Paraules clau: Myotragus balearicus, DNA antic, Caprinae, DNA mitocondrial, DNA nuclear, filogènia.
Abstract Myotragus balearicus was an extinct endemic bovid from some of the Balearic Islands (Mallorca and Menorca). Myotragus had many evolutionary novelties that obscure its phylogenetic placement among the extant Caprinae. In a pro ject developed during the last years, we have analyzed several Myotragus fossil bones, and have retrieved the complete mtDNA cyt b gene (1143 bp in length), a sequence from the mtDNA 12S gene, a sequence from the D-Ioop region, and a sequence from a multi-copy nuclear gene (the 28 S rDNA), using ancient DNA techniques. Different experimental controls, including a dedicated laboratory, independent replication, overlapping fragments, multiple extractions and cloning of PCR products, support the authenticity of the sequences. The new phylogenetic trees consistently place Myotragus in a position basal to the Ouis-Budorcas clade. However, some Caprinae species, such as Oreamnos and Ammotragus, show unstable posi tions in all trees, attributable to a quick initial radiation of the Caprinae lineages. Moreover, the retrieval of nuclear genes for first time from an extinct species from the Mediterranean area opens new possibilities of research on comparative genomics and genetic bases of phenotypic traits. Key words: Myotragus balearicus, ancient DNA, Caprinae, mitochondrial DNA, nuclear DNA, phylogeny.
INTRODUCTION of sequences from nuclear DNA genes from Siberian mammoths, the ground sloth and the cave bear (Greenwood et al., 1999; Orlando et al., 2002; Poinar et DNA sequences have been retrieved from extinct al.,2003). species in the last two decades (see Hofreiter etal., 2001). In this study, we have retrieved mitochondrial and Almost all the ancient DNA studies, including the first nuclear DNA sequences from the extinct Myotragus complete extinct genome (Cooper et al., 2001) have been balearicus, a bovid that evolved in isolation in the based on the analysis of mitochondrial DNA (mtDNA), Balearic Islands (Bate, 1909). Myotragu.s is a extremely the genome of the organelles that provide energy to the modified Caprinae, characterized by a series of unusual cells. The reason of this identification between ancient morphological traits developed throughout more than DNA and mtDNA is due to the fact that the DNA is che three million years of evolution (Alcover et al., 1981; mically degraded; since there are thousands of mtDNA Bover & Alcover 1999a; 1999b; Alcover et al., 1999a; copies in each cell, it is much more easier to retrieve 1999b), that became extinct between 3,640 and 2,135 mitochondrial than nuclear DNA. To date, only few stu years cal BC (Ramis & Alcover, 2001), probably after the dies have been able to soundly demonstrate the retrieval arrival of first humans to these islands. The morphologi-
MITOCHONDRIAL AND NUCLEAR GENES FROM MYOTRAGUS BALEARICUS _ 145 cal peculiarities of Myotragus, including extreme size advantage to the fact that there are some hundreds of reduction, a single evergrowing lower incisor, modified copies of this gene in the vertebrate genome (Laudien limb bones and frontal eyes (Alcover et al., 1981), makes Gonzalez et al., 1985). Om future aims are to try to it difficult to clarify its taxonomic position. retrieve single copy nuclear genes from this species. In previous studies (Lalueza-Fox et al., 2000; 2002), we obtained bits of the mtDNA cytochrome b (cyt b) gene from two different Myotragus bone specimens from MATERIALS AND METHODS Mallorca island, one found in Cava Estreta (Pollença) and the other found in Cava des Gorgs (Escorca). The cyt b sequences indicated that Myotragus seems to be genet - ically close to the Takin (Budorcas) and the Sheep (Ovis). A left tibiae (MNIB 60176) bone from Myotragus Moreover, the quick radiation of all the Caprinae, rough balearicus from Cova des Gorgs (Escorca, Mallorca), ly 20 Mya (Vrba, 1985) and the short cyt b fragment dated to 6,01O-5,830 cal BC 2s (Beta-177239) was chosen retrieved made the previous analysis unable to fully for DNA analysis because of its excellent external preser resolve the phylogeny of this group. To try to fully resolve vation. its phylogeny, we decided to retrieve the complete cyt b DNA was extracted following standard procedures gene and some other genetic markers of Myotragus; to do described elsewhere (Lalueza-Fox et al., 2002). The sam this, we selected a third Myotragus sample, excavated in pie was demineralized overnight, incubated overnight 2002 from Cava des Gorgs, that looked macroscopically with a lysis solution, extracted with phenol-chloroform very well preserved; we have designed different sets of and concentrated and desalinized with centricon overlapping primers for retrieving the complete cyt b columns. Several fragments of mtDNA cyt b gene were gene, as well as a fragment from another mtDNA gene, successfully amplified and sequenced until complete the the 12 S, and a fragment from the mtDNA HVR I. In addi whole gene (Table 1). tion, we retrieved a nuclear gene from the same extract, The cyt b sequences matched the sequence pre 28 S rDNA (located in the 10 chromosome), taking viously retrieved from another Myotragus bone from the
� SAIGA
� SOS OAMUSIMON
...-- NEMORHAEDUS
CAPRICORNIS OVIGNEI �
'-- OVISOS
,- AMMOTRAGUS 100 B.BEDFORDI 100 t------RUPICAPRA
B.TAXICOLOR ...------MYOTRAGUS
�------MYOTRAGUS
...------PANTHOLOPS
'------RUPICAPRA
�------OVIBOS
�---- CAPRICORN IS
61
,------CAPRA
�---- HEMITRAGUS ,------PSEUDOIS
�------PSEUDOIS ...------HEMITRAGUS
'------OREAMNOS �---CAPRA f------SAIGA PANTHOLOPS
� ------BOS
______y'------_- -_- -_- -_--E:...-'_- __ __-_-__ __-_- -_- OREAMNOS D.l
Fig. 1. Maximum likelihood tree of the entire cyt b (1143 bp) of all Caprinae species in databases. Nodes with bootstrap support Fig.2. Bayesian tree of the entire cyt b (1143 bp) of all Caprinae species. greater than 50% are depicted. Nodes with bootstrap support greater than 50% are depicted.
Fig. 1. Arbre de màxima probabilitat del cyt b (1143 parells de bases) de Fig. 2. Arbre Bayesià del eyt b (1143 parells de bases) de totes les espècies de totes les de els nodes un espècies Caprinae. S'indiquen amb suport Caprinae. S'indiquen els nodes amb un suport de bootstrap supe de bootstrap superior alSO%. rioralSO%.
146 ------INSULAR VERTEBRATE EVOLUTION same site (Lalueza-Fox et al., 2000); multiple controls, were also generated for the cyt busing PHYLIP v3.6. A such as independent replication of the results in two dif Bayesian inference of phylogeny was also performed with ferent laboratories and cloning of different, overlapping MrBayes v.2.01 programme (Huelsenbeck & Ronquist, PCR products, contributed to the authentication of the 2001), using general time reversible (GTR) model, parti sequences. All the work was carried out in a dedicated tion defined for each base position within codons, sites ancient DNA laboratory, with UV lights, air-positive pres specific rates estimated for each partition and estimated sure and regular bleaching of the working surfaces. No proportion of base types from the data. 500,000 trees signs of contamination with exogenous DNA were were generated, with burning completed by the 5,000th observed along the study. For the 12 S gene, some tree; thus, the first 5,000 trees were discarded. primers were designed to match the previous Caprinae sequences published by Gatesy et al. (1997). Due to the exceptional quality of this extract, a pilot REsULTS project was launched for trying to retrieve a fragment of a nuclear gene. The 28 S rDNA was chosen because it is present in some hundreds of copies in the genome. The primers used to amplify the 28 S rDNA were those The complete cyt b gene (Table 2) was retrieved in 11 designed by Greenwood et al. (1999) to be vertebrate overlapping fragments (see Table 1), including the 338 specific (Table 1). 5 ul of extract were added to 20 ul PCR section already retrieved in Lalueza-Fox et al. (2002). All reactions, containing Ix reaction buffer, 1 unit of taq cyt b fragments were routinely cloned (not shown), DNA polymerase, 2.5 mM of MgCI2, 25 pmol of each although very few heteroplasmies were detected in the primer. Forty cycles of 1 min at 94°C, 1 min at 50°C and 1 direct sequencing, attributable to both the exceptional min at noc were performed. PCR products were preservation of the sample and the short lengths of the resolved in 1% low-melting agarose gels in a TA buffer; fragments; consequently, the error rates (number of subs bands were excised from the gel and subjected to a se titutionsll,OOO bp) are very low «2). cond 30 cycles of PCR with limiting reagents. PCR product The 12 S gene sequence (Table 4) was retrieved in was cloned with the SureClone Ligation Kit (Pharmacia, three overlapping fragments (Table 1), and the short HVRl Upsala, Sweden) following supplier's intructions. Inserts sequence (Table 3) in a single amplification (Table 1). The were sequenced with 3100 Gene Analyzer (Applied 12 S sequence displays a substitution diagnostic of all Biosystems). Caprinae, a G in np 732 of the Ouis mtDNA genome Several phylogenetic analyses were performed with (Gatesy et al., 1997). There are fewer sequences available the Myotragus sequences; the whole cyt b of all Caprinae for the 12 S and HVRI region than for the cyt b gene; there genera (including subspecies of Ouis and Budorcasï, were fore, we focused the analysis mainly in the latter gene. obtained from the GenBank, and a maximum likelihood The PCR of the 28 S nuclear gene yielded a very faint analysis (ML) was performed using PHYLIP v3.6 band around 140 bp and was subsequently cloned and (Felsenstein, 1993) package. The analysis considered Bas sequenced (Table 1). The 96 bp sequence obtained from as outgroup, although it could be observed that Saiga Myotragus is similar to that found in other Caprinae behaved also as a perfect outgroup. To test the robustíci (Table 5), and clearly different to the human one. ty of the tree clades, a 1,000 bootstrap repeats were per Moreover, no other bovids, extinct or living, had been formed. A maximum parsimony (MP) and NJ tree from a analyzed in the same laboratory; therefore, the 28 S distance matrix (using Kimura two parameters model) sequence seems to be endogenous of Myotragus. The
C b 12 S Ll4136 5'-GCTTGATATGAAAAACCATCGTTG-3' L599 5'-CTCAAAGGACTTGGCGGTGC-3'
H14313 5' - TGTGTCGGATGTATAGTGTATTG-3' H673 5'-GAAGATGGCGGTATATAGAC-3' Ll4310 5'-ATCCTAACAGGCCTATTCCT-3' L671 5'-TCACCAATCCTTGCTAATAC-3' H144815'-CCGATGTTTCATGTTTCTAGGA-3' H805 5' -AATGGCTTTCGTATTAAATT-3' Ll44755'-CGAGGCCTGTACTACGGATC-3' L7335'-AACAAGAGTAAGCTCAATCA-3' H14650 5' -AACTGAGAATCCGCCTCAG-3' H8915'-CGGTGTGTGCGTGCTTCATG-3' Ll4631 5'-GCTATCCCATACATTGGAAC-3' H14813 5'-GTATARTARGGGTGAAATGG�3' HVRl
Ll4792 5' - TCCAACAACCCCTCAGGAATTC-3' Ll6,125 5'-CCTTCTTCTCGCTCCGGGCC-3' H14987 5'-TTGATCGTARGATTGCGTATGC-3' H16,227 5' -AATTAGTCCATCGAGATGTC-3' Ll4973 5'-CCTCACATCAAACCCGAATG-3' H151595'-TCCTCCAATTCATGTGAGTG-3' 28 S Ll5152 5 'TTCTGAATCCTAGTAGCCGACC-3' L28S 5' -GGTCGTCCGACCTGGGTATA-3'
H15327 5'-TGCAGTCATCTCCGGTTTACAAGAC-3' H28S 5' - TCTAATCATTCGCTTTACCGGAT-3'
Table 1. Primer sequences used in this study for different mtDNA and Taula 1. Segúències de cebadots emprades a aquest estudi per a diferents nuclear genes; Land H refer to Light and heavy strand, respective gens de DNA mitocondrial i nuclear; L i H es refereixen a filaments ly, and numbers refers to the 3' position of the Ovis mtDNA lleugers i pesats, i els nombres es refereixen a la posició 3' de la sequence. seqüència de DNA mitocondrial dOvis.
MITOCHONDRIAL AND NUCLEAR GENES FROM MYOTRAGUS BALEAR/CUS ------�- 147 JIC CAT CTATTAGI: TGGT TCCCT CCGAlGT TTCCCT CFGG MAGC TGGC GC TCTCGCACGCGAAC CCJIC GCN; T TTTATC ) 30 40 50 60 70 80 90 10
lCCAT CTJN TAG3:TGG TT CCCT CO:;A1G TTTCCCT CPGG F 23 Fig. 3. Sequence chromatogram of the diagnostic fragment of the Pig. 3. Cromatograma de la seqüència del fragment diagnòstic del gen amb l'humà Myotragus28 S nuclear gene (top), as compared to human (bottom). nuclear 28 S cie Myotragus (a dalt) comparat (a sota). cloning of the 28 S PCR product showed that two of the cluster basal to the Capricornis- Ouibos-Nemorhaedus sequences (about 20% of the clones) are human conta clade instead of with Ovis. This discrepancy most likely minants; this accounts for the noise observed in the direct can be attributed to its basal placement in the sequencing of the PCR product. Most likely, the human Budorcas-Ouis clade in tlle cyt b tree, which cause un DNA comes from handling of the Myotragus bones du stability in the Myotragus placement when fewer spe ring its excavation and posterior morphological study. cies and shorter DNA sequences are consider, as it is the The cyt b ML tree (Fig. 1) shows a topology roughly case with the 12 S gene. In the HVRI sequence (not similar to that found in previous studies on Caprinae shown), Myotragus shows the highest homology with phylogeny (e.g., Hassanin & Douzery, 1999; Lalueza-Fox Budorcas (85%). et al., 2002); some of the clades, that were already sup ported by high bootstrap figures, are present, specially Capricornis+Ovibos+Nemorhaedus (74,3%) and Hemi DISCUSSION tragus-Pseudois-Capra (79,8%). Some species show unstable positions in the trees, especially Ammotragus, Pantholops, Rupicapra and Oreamnos (with Saiga in a basal position and likely to be not a Caprinae); again, Different genetic trees support the phylogenetic posi the problematic position of these taxa have been tion of Myotragus as closely related to Ovis and Budorcas. already reported (e.g., Groves & Shields, 1996; From its basal position at the Ouis-Budorcas clade, it can Hassanin & Douzery, 1999). However, our tree has been be deduced that both taxa diverged after the divergence of finally able to resolve the phylogenetic position of the Myotragus lineage, likely to have occurred around 5.35 Myotragus, which it is now basal to the Budorcas-Ouis million years ago, when the Myotragus ancestors became clade; the bootstrap value for the Myotragus isolated in the emerging Balearic Islands. However, the Budorcas- Ouis grouping is 53,1 %. The MP and NJ trees complete resolution of the Caprinae phylogeny cannot be produced an identical tree topology for Myotragus, achieved with the cyt b gene alone, as some species of the Budorcas and Ovis, although the already mentioned subfamily (specially Oreamnos) still have an unstable unstable species differ in their placement among dif position. This is likely to be due to the initial evolutionary ferent trees. In the Bayesian tree (Fig. 2), the three sta radiation of the Caprinae. ble Caprinae clades (Capricomis+Ovibos+Nemor A fairly long genetic branch of Myotragus in the ML haedus, Hemitragus -Pseudois- Capra and Ovis and NJ trees was previously detected in the short cyt b Budorcas; have bootstrap values of 100; the position of fragment (Lalueza-Fox etal., 2002) and was attributed to Myotragus basal to the latter species is supported by a a faster substitution rate in this species with respect to lower bootstrap figure of 80. other Caprinae. This different rate was initially explained The ML tree with the 12 S fragment produced a by a putative early age of first reproduction and a shorter slightly different topology (not shown); the Capricor generation time in Myotragus than in other Bovids nis+Ouibos+Nemorhaedus and Hemitragus-Pseudois (Lalueza-Fox et al., 2002). In mammals, the generation =Capra clades are well supported by bootstrap analysis and gestation time are usually related to the body size (85.4% and 70.8%, respectively), while Myotragus tend to (see, for instance, Martin & MacLarnon, 1985). 148 ------INSULAR VERTEBRATE EVOLUTION Myotragus is the smallest Caprine known; some adult REFERENCES specimens reached only 22 cm in height. The ratio of neonate to adult has been estimated, Myotragus weight Alcover, 1.A., Moyà-Solà, S. & Pons-Moyà, 1. 1981. Les quimeres del from found neonate bone remains, to be recently only passat. Els vertebratsfòssils del Plio-Ouatemati de les Balears i 2%, again the smallest ratio ever described in Bovids les Pitiüses. Ed. Moll. Palma de Mallorca. 261 pags. (Baver & Alcover, 1999a). Although the reproductive Alcover, J.A., Perez-Obiol, R, Yll, E-I. & Bover, P. 1999a. The diet of strategy and gestation time in Myotragus are currently Myotragus balearicus Bate 1909 (Artiodactyla: Caprinae), an extinct bovid from the Balearic Islands: evidence from unknown, it seems clear that the extreme reduction in copro lites. Biol.I. Linn. Soc., 66: 57-74. body size affected both biological processes. From the Alcover, J.A., Seguí, B. & Baver, I' 1999b. Extinctions and Local correlation between time and size generation body Disappearances of Vertebrates in the Western Mediterranean recorded in mammals & a (Martin MacLarnon, 1985) Islands. In MacPhee, R.D.E. (ed.), Extinctions in near time. reduction both in the age of the first reproduction and in 165-188. Kluwer Academic/Plenum Publishers, New York. the generation time would seem to be the expected Bate, D.M.A. 1909. A new artiodactyle from Majorca. Geol. Mag. result of such a dwarfism process. The long-term isola N.S., 6: 385-388. P. & 1999a. characteristics of ted evolution towards dwarfism not only occurred in the Baver, Alcover, J.A. Estimating physical neonate balearicus In Balearic Islands, but also in other Mediterranean Islands, Myotragus (Artiodactyla, Caprinae). Reumer, J.WF & De Vas, J. (eds.), Elephants have a snorkel! where endemic mammals like dwarf deers, dwarf hippos Papers in honour of Paul Y. Sondaat. Natuurmuseum were until and dwarf elephants present the arrival of Rotterdam. Rotterdam. Deinsea, 7: 33-54. humans (Burness et al., 2001). Therefore, this an evolu Bover, I' & Alcover, J.A. 1999b. The evolution and ontogeny of the den tionary hypothesis that could be tested with the retrieval tition of Myotragus balearicus Bate, 1909 (Artiodactyla, Caprinae): of DNA from other dwarf endemics and the comparison evidence from new fossil data. Biol.]. Linnean Soc., 68: 401-428. & F 2001. of evolutionary rates of related extant species. However, Burness, G.P., Diamond, J. Flannery, Dinosaurs, dragons, and dwarfs: the evolution of maximal body size. Proc. Nat. several tests we applied with the complete cyt b data, Acad. Sci. USA, 98 (25): 14518-14523. based on the ratio of synonymous (Ks and parameter) Cooper, A. & Poinar, H.N. 2000. Ancient DNA: Do it right or not at non synonymous substitutions (Ka parameter) between all. Science, 289: 1139. Myotragus and related Caprinae tBudorcas and Ovis), Cooper, A., Lalueza-Fox, C, Anderson, S., Rambaut, A., Austin, 1. & failed to find statistically significant differences in the Ward, R. 2001. Complete mitochondrial genome sequences of Myotragus branch length. two extinct moas clarify ratite evolution. Nature, 409: 704-707. PHYLIP Inference version An alternative explanation for the long branch of Felsenstein, 1.1993. (Phylogeny Package) 3.6. Distributed by the author. Department of Genetics, Myotragus is that the sub-structuring of its evolutionary University ofWashington, Seattle. is in this there were other lineage missing; sense, Gatesy, r. Amato, G., Vrba, E., Schaller.,G. & DeSalle, R 1997. A Caprinae endemics in Europe and in other Medi cladistic analysis of mitochondrial ribosomal DNA from the terranean islands (e.g. Nesogoral and Gallogoralï that Bovidae. Mol. Phylogenet. Evol., 7 (3): 303-319. could be closely related to Myotragus. The inclusion of Greenwood, A., Capelli, C, Possnert, G. & Pààbo, S. 1999. Nuclear genetic data from these lineages, if technically possible, DNA sequences from Late Pleistocene megafauna. Mol. Bioi. Evol., 16 (1l): 1466-1473. might significantly alter the Myotragus branch pattern Hassanin, A. & Douzery, E.J.P. 1999. The tribal radiation of the fami we found. ly Bovidae (Artiodactyla) and the evolution of the mitochon this is one of the few instances where Finally, study drial Cytochrome b gene. Mol. Phylogenet. Evol., 13 (2): 227-243. ancient nuclear DNA has been recovered, and the first Hofreiter, M., Serre, D., Poinar, H.N., Kuch, M. & Paabo, S. 2001. one in which nuclear DNA has been retrieved from an Ancient DNA. Nature Reuieuis, 2: 353-359. extinct species from the Mediterranean area. The possi Huelsenbeck, J.I' & Ronquist, F 2001. MRBAYES: Bayesian inference of trees. Notes, 17: bility of retrieving nuclear sequences, with a wide range phylogenetic Bioinformatics Application 754-755. of genetic markers available, could finally allow to clarify Lalueza-Fox, c. Bertranpetit, J., Alcover, J.A., Shailer, N. & the position of Myotragus as well as the phylogenetic Hagelberg, E. 2000. Mitochondrial DNA from Myotragus extant with a Also, our Caprinae problematic position. balearicus, an Extinct Bovid from the Balearic Islands. ]. Exp. research demonstrates the potential interest of this Zool. (Mol. Dev. Evol.), 288: 56-62. approach in comparative genomics; our future goals are Lalueza-Fox, C, Shapiro, B., Bover, P, Alcover, J.A. & Bertranpetit, J. to retrieve single copy nuclear genes that can be infor 2002. Molecular phylogeny and evolution of the extinct bovid balearicus. Mol. 501-510. mative of phenotypic aspects of Myotragus. MyolTagus Ptiylogenet. Evol., 25(3): Laudien Gonzalez, L, Gorski, l.L, Campen, T.)., Dorney, Df., Erickson, 1.M., Sylvester, 1.E. & Schmickel, RD. 1985. Variation among human 28 S ribosomal RNA genes. Proc. Natl.Acad. Sci. USA,82:7666-7670. ACKNO�EDGEMENTS Orlando, L., Bonjean, D., Bocherens, H., Thenot, A., Argant, A., Otte, M., & Hanni, C. 2002. Ancient DNA and the population gene tics of cave bears (Ursus spelaeus) through space and time. Mol. BioI. Evol., 11:1920-1933. This research was supported by the Dirección Poinar, H., Kuch, M., McDonald, G., Martin, P. & Paabo, S. 2003. General de Investigación Científica y Técnica in Spain Nuclear gene sequences from a Late Pleistocene sloth copro We are to Alan and Beth (project). grateful Cooper lite. Curt: BioI., 13: 1150-1152. (Ancient Biomolecules Center, for his Saphiro Oxford), Ramis, D. & Alcover, l.A. 2001. Revisiting de earliest human pre technical support in the partial replication of some sence in Mallorca, Western Mediterranean. Proc. Prehistoric ancient sequences and to Alexandre Hassanin (Muséum Soc., 67: 261-269. National d'Histoire Naturelle, Paris) for advice in the Vrba, E.S. 1985. Africa Bovidae: evolutionary events since the Miocene. S. 81 : 263-266. designing of the 12 S Myotragus primers. Aft: I. Sci., MITOCHONDRIAL AND NUCLEAR GENES FROM MYOTRAGUS BALEARICUS _ 149 Capricornis ATG ATT AAC ATT CGA AAA ACT CAC CCA CTA ATA AAA ATT GTA AAT AAT GCA TTT ATT GAT .. C Nemorhaedus .CC .. C .. C · .. .. C .C Oreamnos .CC .. C · .C C · •• C .• C .C Rupicapra .CC .. T •• C •• C • .C Ammotragus •• C •• C • .C • • .. C .. C C.C .C Budorcas •• C •• C .C •• C •• G • .C Ovibos .CC .. T .. C •• •• •• C •• C C Pseudois .CC • .C •• G •• C C · •• •• C .C · C Hemitragus .CC • .C .C • •• •• .C •• C •• •• C Capra .CC • .C G C T •• C •• C • .C Ovis • .C · .C • .C •••• Pantholops .CC •• C •• C •• C G C •• C Saiga · .C · .C • .C • .T • .C •• •• •• C •• C C •• •• C MYOTRAGUS . CC T.C C A Capricornis CTC CCA ACC CCA TCA AAC ATC TCA TCA TGA TGA AAC TTC GGC TCC CTC CTG GGC ATC TGC .. A Nemorhaedus C.. .TG .. G .. •• • .T T.A T Oreamnos · .T •• T T • .A Rupicapra G.T .. G • .T Ammotragus •• T •• A •• •• A .CT Budorcas · .T •• T A Ovibos •• A •• T •• A Pseudois G.T •• T •• A •• •• A •• A •• T Hemitragus • .T T •• A •• A •• T •• Capra •• T •• A G •• •• A •• T Ovis G.T •• T •• T •• T T •• A •• T Pantholops G •• • .T Saiga G •• •• MYOTRAGUS G •• ..A G Capricornis CTA ATT CTA CAA ATC CTA ACA GGC CTA TTC CTA GCA ATA CAC TAC ACA TCC GAT ACA ACG Nemorhaedus T •• • .C ..A Oreamnos T .. T.. ..T • .C •• A Rupicapra T .. T •••• G •• G G.A Ammotragus T.. T .. · .T • .C .TA Budorcas T •• GC. T •• • .A Ovibos T •• · .T • .C • .A Pseudois T ••• C. · .G · .T • .C .TA Hemitragus •• G T •• • .G · .G • .C .TA Capra •• C T •• • .G · .T · .C .TA Ovis T.. T .. •• G •• T · .T C •••• C •• A Pantholops T.G G .. T .. • .T • .A ·saiga · .C •• T G.T .. C G.A MYOTRAGUS T •••. C T .. • .T • .C • .A Capricornis ACA GCA TGT TCT TCT GTA ACA CAC ATT TGC CGA GAC GTA AAC TAC GGC TGA ATT ATC CGA Nemorhaedus .. C .. T .. T Oreamnos •• C •• C •• C •• T · .T Rupicapra •• C •• C · .C •• T • .C Ammotragus .TC .. C G.C · .C Budorcas .T. •• C •• C G.C · .T • .T · .C Ovibos .TC •• G •• T •• C •• T Pseudois .TC .. C •• G •• T • .C •• G •• T •• C •• T Hemitragus .TC · .C .. T .. T .. T · .C Capra .T ... C •• T •• T .. T .. T .. T C Ovis .TC .. C • .C •• G •• T Pantholops .TC • .C .. T .. T .. T •• T •. T •• •• Saiga .TC CAC C C •• T MYOTRAGUS •• C .• C .. C G.C .. T · .T Capricornis TAT ATA CAC GCA AAC GGA GCA TCA ATA TTC TTT ATC TGC CTA TTC ATA CAC GTA GGA CGA Nemorhaedus •• C •• T •• C Oreamnos •• T •• C •• T •• C · .T · .C · .T •• T •• •• Rupicapra T C · .T Ammotragus · .G •• T Budorcas • · · .G .G .T •• T •• G •• T Ovibos •• C .•• G Pseudois • .C •• C • .T •• G • .C •• Hemitragus G •• T A.C · .C Capra •• T A.C Ovis • • .G .T •• T •• G •• T Pantholops · .C · .T Saiga · .T •• C MYOTRAGUS · .T •• •• T •• •• C C G ..T •• G •• G • .G TableZ 150 ._�------.... INSULAR VERTEBRATE EVOLUTION Capricornis GGC CTA TAC TAC GGA TCG TAC ACT TTC TTA GM ACA TGG MC ATC GGG GTA ATT CTC CTA Nemorahedus •• A •• T •• A G.C Oreamnos .. T .. T .. A .. T .. C .. T .. A .. T .. A .. C T .. Rupicapra .. T .. A .. T C.. ..A .. A .. C Ammotragus · .T .. A •• T C •• .. A .. T G.A .. A .. G .. C Budorcas •• G •• T •• A •• C · .A • .A Ovibos •• A · .A •• A · .T Pseudois • .T •• A •• T •• C •• T C •• · .G · .A .. A A.C Hemitragus • .T •• A •• C C •• · .A •• T •• A •• C Capra .. T .. T .. T •• A •• T •• C •• T C •• · .A •• T •• A •• C · .G Ovis •. T •• T •• A •• T •• C C •• •• A ..A .. C pantholops · .T .. A .TC · .G •• A •• C Saiga •• T •• T •• C •• T •• A C •• • .A •• T •• A •• T · .T MYOTRAGUS •• A C •• · .A •• AA •••• C Capricornis CTC ACA GCG ATA GCC ACA GCA TTC ATA GGC TAT GTC CTA CCA TGA GGA CM ATA TCA TTC Nemorhaedus T.T G .. A.A .. G Oreamnos · .T A.A • .G Rupicapra A.A •• G •• T •• G · .C · .G Ammotragus T .. G .. A.A •• A · .G • .G Budorcas T.T G .. A.A T •• · .T Ovibos .T. A.A · .T Pseudois T •• G •• A.A • .C T.G • .T Hemitragus A.A T •• · .G Capra G.G A.A .. G •• T T •• Ovis T.T G.G A.A T .• pantholops T.T G .. A.T •• T T •• Saiga T •• G •• A.A •• A MYOTRAGUS T.. A.A · .T •• T •• C •• T T •• •• T •• T Capricornis TGA GGG GCT ACA GTT ATT ACC MC CTC CTC TCA GCA ATC CCA TAC ATT GGC ACA MC CTA Nemorhaedus • .A •• T •• T • .T Oreamnos · .A •• C •• C •• T • .C Rupicapra • .C •• C •• C •• T · .C Ammotragus • .A •• C •• C •• T G •••• G Budorcas •• A •• A • .C Ovibos • .A •• C •• C •• T • .C Pseudois • .A •• C •• C · .T •• C •• T • .T Hemitragus • .A •• C •• C •• T • .T •• T •• C Capra • .A .. C .. C .. T .. T .. T • .T Ovis •• A •• A · .T · .T · .T Pantholops •• A •• A •• A · .T G •• Saiga •• A •• A •• C •• C •• T · .T •• T •• C G •• MYOTRAGUS •• A •• A •• C · .C · .T •• A •• C •• T •• T Capricornis GTA GM TGA ATC TGA GGA GGA TTC TCC GTA GAC AM GCC ACC CTC ACC CGA TTC TTT GCC Nemorhaedus •• C •• G •• A •• T •• T •• C Oreamnos •• C •• G •• G •• A •• T •• C Rupicapra .. C .. G .. G .. C .. G .. T Ammotragus •• C •• G •• A •• T •• T •• C Budorcas •• T •• G • .A •• A T •• Ovibos · .C •• T • .T Pseudois · .C · .G • .G · .A · .G •• T · .C Hemitragus • .C •• A · .T •• A •. C •• T Capra • .C •• A •• T · .C Ovis • .C · .G •• A • .T •• T •• C Pantholops • .C • .G · .A • .T · .T Saiga •• G •• T •• T •• A · .T •• A · .C MYOTRAGUS • .A • .G •• A •• C •• T Capricornis TTC CAT TTC ATT CTC CCA TTC ATC ATC ACA GCC CTC GCC ATA GTG CAC CTA CTT TTC CTC Nemorhaedus .. C .. C .. T .. T .. T ACT .. T .. C Oreamnos .. C •. T G.. ..C T •• Rupicapra .. T .. C .. C .. T G.. T.A .. C .. C Ammotragus .. C .. C .. T G.A G.. ..A .. C T .. Budorcas .. T .. C .. C .. T G.. ..C .. T T .. Ovibos •• C ... T •• C •. T GT. • .T .. A .. T T.G .. C Pseudois •• C •• C .. T .. T .. T .T. • .C Hemitragus • .C •• T G •• ..C •• G •. C Capra •• C •• T •• C •• T G •• • .T ..C •• G •• C Ovis •• T •• C •• TT •• G •• ..T .• C Pantholops G •• •• C •• C Saiga •• C •• C .• T •• T G •• · .T · .T • .C .. T .. T MYOTRAGUS •• T •• C •• C •• T •• T • .C •• A Table2 MITOCHONDRIAL AND NUCLEAR GENES FROM MYOTRAGUS BALEARICUS _.::::======151 Capricornis CAC GAA ACA GGA TCC AAC AAC CCC ACA GGA ATC TCA TCA GAC ACA GAC AAA ATC CCA TTC • .T Nemorhaedus •• T •• G .T. ..T C.. .T. ..T •• A Oreamnos •• T •• T •• A •• T .T. G.. •• T •• T •• ..T Rupicapra T •• A C.. G.G •• Ammotragus •• T •• G •• T G •••• T •• T •• T Budorcas •• T C.G •• T G Ovibos •• T C.. ..G Pseudois •• T C •• • .T · Hemitragus · .G •• G •• T C •• .T • .T Capra •• T C •. · ..T •• C •• .T Ovis T C •••• G · •• •• T G •• .T Pantholops •• T C •• •• TT •• Saiga •• T C · •• .T MYOTRAGUS T •• •• T C .• G Capricornis CAC CCC TAC TAC ACA ATC AAA GAT ATC CTA GGC ATC GTG CTA CTA ATC CTC ACC CTC ATA •• T •• T Nemorhaedus .• T •• T •• T •• T GCT A.A •• · .T .• C Oreamnos •• T •• T T GC. A.A · .T Rupicapra •• T •• C •• T •• C •• T GC •• T . .C. •• · A •• Ammotragus •• T C .T GC. ..G •. GT. Budorcas •• T •• T •• C •• T •• A G A.A • .T · .T Ovibos • .T •• C •• T GC. A.A •• G •• • .G Pseudois •• T •• C •• T • .T GCT .CA G •• •• T • •• A .. T GT Hemitragus •• T •• C •• T •• T T GC. A.A • •• •• •• ..T •• T GT A Capra .• T •• C •• T T A .T. • .G Ovis •• T •• T •• C •• T · .C •• T GCT A.C •. A .T • Pantholops •• T •• C •• T · .C GCT A.A •• T •• T •• A .T. Saiga •• C •• T •• C •• T GC. C.A •• T.A .T. • MYOTRAGUS •• T •• C •• T • .C •• G A.A T .G Capricornis CTA CTA GTA CTG TTC ACA CCC GAC CTA CTC GGA GAC CCA GAC AAC TAC ACT CCA GCA AAC •• Nemorhaedus T •••• G T.A •• TT •••• T •• T •• T C Oreamnos T.A T •• T •• •• •• · •• T •• C · Rupicapra • .G •• A T T .T .G · •• •• •• •• T •• C .T Ammotragus •• A T T G Budorcas T.G •• A •. T .T •• TT G •••• T •• T •• T •• T •• C • .T Ovibos T.A •• T •• T •• C Pseudois T .• T.A •• T • .C Hemitragus T •• ..A .. T .T. . .T •• T •• C · .T Capra T •• ..A •• G •• T •• T •• C Ovis •• A •• G •• T T •• • .C Pantholops T •• ..A •. TT .. ..T •• T •• C Saiga •• T •• C •• A •• TT •••• A •• G •• T • .R MYOTRAGUS •• A .• A •• T •• T •• T •• A • .C Capricornis CCA CTC AAC ACA CCC CCT CAC ATC AAG CCC GAG TGA TAC TTC CTA TTT GCA TAC GCA ATC Nemorhaedus .G. ..T •• A •• T •• A •• T •• T Oreamnos •• G •• A •• T •• T •• C •• T •• A Rupicapra •• A •• A .• T T.G •• T •• G Ammotragus •• T •• T •• A •• T •• A Budorcas •• A •• T •• A •• T Ovibos •• T •• A •• A Pseudois •• T •• A Hemitragus •• T •• A •• T •• A •• T •• T • .G Capra •• T •• A •• T •• G •• G •• T Ovis · .T · .T •• A •• T •• A • .G Pantholops •• C •• A •• C •• T •• A •• T •• Pi. •• G • .T Saiga · .T •• A •• T •• T •• A •• A · .C MYOTRAGUS •• A _,.A • .C • .T Capricornis CTA CGA TCA ATC CCC AAC AAA CTA GGC GGA GTT TTA GCC CTA GTC CTC TCA ATT CTA ATC Nemorhaedus T.. ..T •• C C.. ..G T ••.• T •• •• · Oreamnos T T .A •• C C •• .C. · .C G.A • •• •• Rupicapra .T T A •• C C •• •• A · .C •• T •• •• •• •• •• •••. Ammotragus T G A C CC A .. C T .. T •• • •• Budorcas .A ..C C.C A · .C G •• •. •• Ovibos T T C •• C .• · .T · •• .T • •• •• .• Pseudois G .A C C A · .C T •• · .T •• •• •• Hemitragus A C C · .C • .T •• A •• •• Capra C C · .C T •• ..T •• T •• •• Ovis A C C.C A.. ..C G .• · .• .A •• •• Pantholops C C.G G •• C T •• C •• T •• T •• T · .A •• •• Saiga C C •• A •• C MYOTRAGUS •• T •• A •• C • .G Table2 152 ------.... INSULAR VERTEBRATE EVOLUTION Capricornis CTA GCA CTC GTA CCC TTC CTC CAC ACA TCC AAA CM CGA AGC ATA ATA TTC CGA CCA ATC Nemorhaedus A.T •• T C.. ..G Oreamnos AT. T.T •• T •• T •• T .T. ..T .. G · .T Rupicapra .. G .T. C ..•. T · .G Ammotragus AT. ..T •• G •• G Budorcas .T. A •• A.G C.. ..A •• G Ovibos •• T Pseudois .T ••• T A .. · .T •• G Hemitragus T •• A •••• T · .T Capra T ••• T ••• T •• T · .T · .C Ovis .T. A.T A •• C.. ..T ..A •• G •• G Pantholops .T. •• T •• T .T. · .G ..T •• T •• T Saiga .TC A •• •• G · .T •• G •• T MYOTRAGUS • TG •• T A •• C.. .A . T •• .AG •• T Capricornis AGC CM TGT ATA TTC TGA ATC CTA GTA GCA GAT TTA CTT ACA CTC ACA TGA ATT GGA GGA Nemorhaedus •• C T.. .CT •• A G •• Oreamnos •• T •• C G.. .C. ..C C •••• A G.. ..C Rupicapra · .C • .T •• CC •• T.A Ammotragus · .C •• G •• C •• A Budorcas · .C · .T •• C •• CC •••• A • .C Ovibos •• A •• C •• G Pseudois • .C •• CC •••• A • .C Hemitragus • .C .C ••• G •• C •• G Capra •• C G •• C •• T.A Ovis · .T •• C •• CC •• T.A Pantholops · .T • .C •• CC •• T.A · .T · .C Saiga •• CC •• G.T •• C C •••• A MYOTRAGUS · .T C •• G •• •• T T.. ..C C .... A • .C Capricornis CAG CCA GTC GM CAC CCC TAC ATT ATT ATT GGA CM CTA GCA TCC ATC ATA TAC TTC CTA Nemorhaedus •• A T.T •• T •• C •• G •• T •• T T.C Oreamnos • .A · .T •• A G.C •• C •• G •• T •• C Rupicapra •• T •• C •• T •• C Ammotragus • .A A.. ..T •• A •• C · .T •• T •• C Budorcas • .T • .T •• G •• T •• T •• C Ovibos •• G •• T •• T •• C · .C Pseudois •• A •• T •• C · .T • .T Hemitragus • .A •• T •• T •• T •• C •• G •• T •• T •• C Capra •• T •• T •• T •• T · .C Ovis • .T •• C •• T •• T •• T •• T Pantholops •• A •• T •• T •• C •• T Saiga •• A · .T T.T •• A •• T .CA •• C •• A •• T •• T •• T MYOTRAGUS · .T · .T •• G •• T •• T •. T •• T Capricornis ATC ATC CTA GTA CTG ATG CCA GTA GCT AGT ACC ATC GM MC MC CTC CTA AAA TGA AGA AAA Nemorhaedus •• T •• A •• A G.C •• T Oreamnos · .T A.A •• A •• C •• T Rupicapra · .T A.A •• A • .C .A. T •• Ammotragus • .T A.A •• A • .C •• G •• T T •• Budorcas · .T •• T A.A •• A • .C • .T Ovibos •• G •• G •• A A.G •• C •• T Pseudois •• TT •• A.A •• A •• C .G ••• T • N. C •• Hemitragus •• T •• T A.A •• A • C ••• C •• C •• T •• G C •• Capra •• T •• T A.A •• A •• C •• T •• T C •• Ovis · .T •• C A.A •• A .. C .T . C •• Pantholops · .T T.A •• A •• C •• C •• T C •• Saiga C.T •• T •• A •• A •• C •• T •• T •• T •• G .A. T .• MYOTRAGUS · .T •• C A.A •• A •• G •• G •• C C •• Table 2 [pages O-OI. Myotragus sequence of the complete mtDNA cyt b, Taula 2 [pàgines O-Ol. Seqüència completa del mtDNA eyt b de Myotragus, aligned with the sequence of all Caprinae species. Dots indicate alineat amb la seqüència de totes les espècies de Caprinae. Els sequence identity. punts indiquen identitat a la seqüència. BOS CATAAACCGTGGGGGTCGCTATCCAATGAATTTTACCAGGCATCTGGTTCTTTCTTCAGGGCCATCTCACC CAPRA ••• T •••••••••••• A. A ••• TG •••••• CC ••• TA •• AG ••••••••••••••••••••••••••••• T MYOTRAGUS ••• T •••• T ••••••• A •••• AAG. G •••• CCG •• TA •• A •••••••••••••••••••••••••••• G •• OVIS ••• T •• T ••••••••• A. A ••• TG ••••••• C ••• TA •• AG ••••••••••••••••••••••••••••• T CAPRICORNIS ••• T •• TT •••••••• A ••••• TT ••••••••••• T ••• A •••••••••••••.••••••••••••••.•• BUDORCAS ••• T •• T ••••••••• A ••••• TG ••••••••••• T ••••••••••••••••••••••••••••••••••• BOS TAAAACAGTCCATTCTTTCCTCTTAAATAA Table 3. Myotragus sequence of a mtDNA HVRI fragment, aligned with CAPRA • ••••• C. C ••••••••••••••••••••• sequences found in GenBank of other Caprinae (including Bas MYOTRAGUS • ••••••• C •••••••• C •• C ••••••••• for comparison). OVIS • ••••• C. C ••••••••••• C ••••••••• CAPRICORNIS • •••• TC • C ••• CA •••••• C ••••••••• Taula 3. Seqüència d'un fragment del gen mtDNA I-IVRJ de Myotragus, BUDORCAS •••••• C.C .••...... C . alineada amb les seqüències d'altres Caprinae trobades al Banc de Gens (incloent-hi Bas per comparació). MITOCHONDRIAL AND NUCLEAR GENES FROM MYOTRAGUS BALEARICUS _ 153 BOS TTTATATCCTTCTAGAGGAGCCTGTTCTA-TAATCGATAAACCCCGATAAACCTCACCAATTCTTGCTAATACAG - G.C G . PANTHOLOPS .... C.C .. C - C ••••••••• T ••• OVIBOS • ••••• C •••••••••••••••••••••• ••••••••••••••••••••••••••••••• C T . NEMORHAEDUS · C .. AC G- - C . OREAMNOS ...... C .. C T - C ••••••••••••• CAPRA •••••• C •••••••••••••••••••••• ••••••••••••••••••••••••••••••• - C . PSEUDOIS .. C C · .C T . MYOTRAGUS · .C C G- - C ••••••••••••• OVIS ARIES •••••• C •••••••••••••••••••••• ••••••••••••••••••••••••••••••• C G T . AMMOTRAGUS · C GA - C ••••••••••••• O.DALLI •••••• C •••••••••••••••••••••• ••••••••••••••••••••••••••••••• - C ••••••••••••• O.CANADENSIS •••••• C •••••••••••••••••••••• ••••••••••••••••••••••••••••••• - C T . CAPRICORNIS ...... AC - C ••••••••••••• HEMITRAGUS • ••••• C •••••••••••••••••••••• ••••••••••••••••••••••••••••••• BOS TCTATATACCGCCATCTTC-AGCAAACCCTAAAAA--GGAAAAAAAGTAAGCGTAATTATGATACATAAAAACGT _ -- C .. C G . PANTHOLOPS · G TC _ -- C .. AT.G G . OVIBOS · T TC - -- TC C .. AT G . NEMORHAEDUS · C. G C C - -- C C G . OREAMNOS · T C TC _ - - C . CA. C G . CAPRA · C TC _ -- TC C. CAGC G . PSEUDOIS · C - -- . .. C. CATC G MYOTRAGUS · C G TC - . .. A .. A. C G OVIS ARIES · A- G. C TC .. AGC G . AMMOTRAGUS · C GG C TC C - -- A .. A G . O.DALLI ...... C TC - -- .. A G . O.CANADENSIS ...... C TC A - -- C .. AT G . CAPRICORNIS ...... T T - - - . CA . . HEMITRAGUS · C TC C C G BOS TAGGTCAAGGTGTAACCTATGAAATGGGAAGAAATGGGCTACATTCTCTACACCAAGAGAATCAA-GCACGAAAG TT. -AT . PANTHOLOPS · G T CT A . OVIBOS · G.G T TC .. T A TT. CAT . NEMORHAEDUS · A G T TTT. T A TT. TAT - . OREAMNOS · G T C .A. .. AT .. TT. -AT CAPRA · C G T CTT A T-. -AT . . PSEUDOIS · C G.G T CT A TT. -A MYOTRAGUS · G T CTT A TC. -A . - OVIS ARIES · G. G T C. A. .. A TT. -AT . AMMOTRAGUS · G T CT A TC. -AT . O.DALLI .G. .T ... C.A.- .. A - O.CANADENSIS G T T A · A CAPRICORNIS G T TCT T · A HEMITRAGUS C G T TT · A BOS TTATTATGAAACCAATAACCAAAGGAGGATTTAGCAGTAAACTAAGAATAGAGTGCTTAGTT-GAATTAGGC - PANTHOLOPS CC TT G C . - ·OVIBOS CC T GG C . - NEMORHAEDUS CC T GG.T C . ' OREAMNOS CC T GG T C . - CAPRA CC TT G T . - PSEUDOIS · C TT G T G C . - MYOTRAGUS CC T GG . T . - OVIS ARIES CC TT G C . - AMMOTRAGUS CC TT GG T CC . Table 4. Myotragus sequence of a mtDNA12 S fragment, aligned with Taula 4. Seqüència d'un fragment del gen mtDNA12 S de Myotragus, alineada sequences found in GenBank of other Caprinae (including Bas for amb les seqüències d'altres Caprinae trobades al Banc de Gens (incloent comparison). Sequences of Oidalli, o. canadensis, Capricarnis and hi Bas per comparació). No es disposa de les seqüències de O.dalli, O. Hemitragus are not available for the whole fragment considered. canadensis, Capricornis i Hemitragus per a tot elfragment considerat. BOS GGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCC CAPRA MYOTRAGUS OVIS RUPICAPRA BOS TCAGGATAGCTGGCGCTCTCGCA-AACGC-ACAG-ACCC-----ACGCAGTTTT - CAPRA ... C------. ----- MYOTRAGUS .--- ... G----A. OVIS .------. RUPICAPRA .G.- .. -G ... AG. Table 5. Myotragus sequence of the nuclear gene 28 S rONA, aligned with Taula 5. Seqüència del gen nuclear 28 S rDNA de Myotragus, alineada sequences of Capra, Ovis and Rupicapra obtained in dus study amb les seqüències de Capra, avis i Rupicapra obtingudes a aquest (including Bas for comparison). estudi (incloent-hi Bas per comparació). 154 ------..... INSULAR VERTEBRATE EVOLUTION