sign in sign up
<<
Home , Antigone (bird), Balearica, Black crowned crane, Brolga, Common crane, Crane (bird)

The Auk 111(2):351-365, 1994

PHYLOGENY OF CRANES (: GRUIDAE) BASED ON CYTOCHROME-B DNA SEQUENCES

CAREY KRAJEWSKIAND JAMESW. FETZNER,JR. • Departmentof Zoology,Southern Illinois University, Carbondale,Illinois 62901-6501, USA

ABS?RACr.--DNAsequences spanning 1,042 nucleotide basesof the mitochondrial cyto- chrome-b gene are reported for all 15 speciesand selected subspeciesof cranes and an outgroup, the (Aramusguarauna). Levels of sequencedivergence coincide approxi- mately with current taxonomicranks at the ,, and subfamilial level, but not at the generic level within Gruinae. In particular, the two putative speciesof (B. pavoninaand B. regulorum)are as distinct as most pairs of gruine species.Phylogenetic analysisof the sequencesproduced results that are strikingly congruentwith previousDNA- DNA hybridization and behavior studies. Among gruine cranes, five major lineages are identified. Two of thesecomprise single species( leucogeranus, G. canadensis), while the others are speciesgroups: Anthropoides and Bugeranus;G. ,G. rubicunda,and G. vipio; and G. grus,G. monachus,G. nigricollis,G. americana,and G. japonensis.Within the latter group, G. monachusand G. nigricollisare sisterspecies, and G. japonensisappears to be the sistergroup to the other four species.The data provide no resolutionof branchingorder for major groups, but suggesta rapid evolutionary diversification of these lineages. Received19 March 1993, accepted19 August1993.

THE 15 EXTANTSPECIES of cranescomprise the calls.These behavior patternsinclude both ste- nominate (Gruidae) of the Grui- reotyped movements and vocalizations, and are formes,and are currentlydivided into two sub- mostelaborately developed in gruines.Notable families, Balearicinae and Gruinae (Brodkorb among Archibald's conclusionsis the postulat- 1967).Balearicine cranes are anatomicallyun- ed closerelationship between the Siberian(Grus specializedrelative to gruines and are repre- leucogeranus)and Wattled (Bugeranuscaruncula- sentedby only two extant speciesin the tus) cranes.Both specieslack the elaboratetra- Balearica(the crowned cranesof ). Gruines cheal coiling found in other gruines, although share derived anatomical features such as an both show the characteristicsculpted . Ar- anteriorly sculpted sternum (often associated chibald'sfindings were generally supportedby with trachealcoiling inside keel) in which the the anatomical-pheneticstudy of Wood (1979) furcular processis fused to the anteroventral and the recent allozyme survey of Dessaueret tip of the keel. Three extant gruine generaare al. (1992). recognized: Grus (10 species),Anthropoides (2 Ingold et al. (1987b)examined allozyme vari- species),and Bugeranus(1 species).These genera ation among cranes, and Ingold et al. (1989) are defined on the basis of soft anatomical fea- reportedthe resultsof selectedcomparisons us- tures,although their monophyly has not been ing microcomplement fixation and DNA-DNA addressedby phylogeneticanalysis. bal- hybridization.Both these studies, however, were earicines are known from the lower and inadequatelydesigned for phylogeneticrecon- later depositsin ,whereas Gruines date struction (Krajewski 1989). from the late Miocene (Brodkorb 1967). phylogeny was estimatedfrom a com- Evolutionaryrelationships among cranes have plete matrix of DNA-DNA hybridization com- been addressedwith a variety of different ap- parisonsby Krajewski (1989; for a refinement proachesduring the past two decades.Archi- of the analysis,see Krajewskiand Dickerman bald (1976) derived the speciesgroups shown 1990). DNA-DNA hybridization (Fig. 1) con- in Table 1 on the basis of similarities in unison firmedthe distinctnessof balearicineand gruine cranes,and supportedArchibald's (1976) gruine speciesgroups. An exception is the placement • Present address:Alaska Department of and of G. leucogeranusas an isolatedlineage among Game,333 RaspberryRoad, Anchorage, Alaska 99518, gruines, perhaps representing the oldest phy- USA. logeneticbranch within the . Among 351 352 KRAJEWSKIAND FETZNER [Auk, Vol. 111

T^BLEI. Crane speciesand subspeciesstudied. Spe- s• ciesgroups are thoseidentified by Archibald(1976) on basis of unison-call similarities. •. Japonensts

G. ntgrtco111s Family Gruidae (Cranes) Subfamily Balearicinae Genus Balearica B. pavonina() A. virgo B. regulorum(Gray Crowned Crane) A. paradlsea Subfamily Gruinae Genus Bugeranus G. antigone B. carunculatus() ß a. vtpto Genus Anthropoides G. rubicunda A. virgo() 't A. paradisea(Stanley Crane) Genus Grus Fig. 1. Bootstrapconsensus tree for DNA-DNA SpeciesGroup Leucogeranus• hybridization distancesamong cranes (redrawn from G. leucogeranus() Krajewski and Dickerman 1990). Nodal value shows SpeciesGroup Canadensis frequency eachputative clade representedamong 100 G. canadensis() b bootstrap pseudoreplicates.Bifurcating nodes with- G. c. canadensis(Lesser Sandhill Crane) out bootstrapvalues appear in 100%of pseudorepli- G. c. tabida(Greater Sandhill Crane) cates;polytomies have bootstrap values less than 50%. G. c. rowani (Canadian Sandhill Crane) G. c. pratensis( Sandhill Crane) prevented phylogenetic resolution. Poor reso- SpeciesGroup Antigone lution between groupsmay indicatea relatively G. antigone() rapid evolutionaryradiation of the majorgruine G. a. antigone(Western SarusCrane) G. a. sharpei(Eastern Sarus Crane) lineages (Krajewski 1989, 1990). Further reso- lution of crane relationships, as well as testing G. rubicunda() G. vipio(White-naped Crane) the DNA-DNA hybridization results, requires an additional and independent type of com- SpeciesGroup Americanac G. monachus() parative genetic data. G. grus() In this study we report sequencesof the mi- G. americana() tochondrial cytochrome-bgene for all crane G. japonensis(Japanese Crane) species and selected subspecies.A mitochon- G. nigricollis(Black-necked Crane) drial sequencewas chosen to complement the "Archibald(1976) placed Siberian Crane in Bugeranus.Species Group nuclear data derived from DNA-DNA - Leucogeranuswas suggested by Krajewski(1989). • Mississippi(G. c. pulla)and Cuban (G. c, nesiotes)Sandhill Cranes ization, as well as to exploit the advantagesof were not included in study. mitochondrialDNA (mtDNA) for phylogenetic ßKrajewski (1989) suggested that this group be renamedSpecies Group inference (Moritz et al. 1987). We chosethe cy- Grus. tochrome-bgene becausepreliminary compar- isons indicated that divergences were in the other gruines,Anthropoides and Bugeranusform range of 1 to 10%. Such divergencesare suffi- a clade,as do three Australasianspecies of Grus cient to distinguish species,but not so large as (G. antigone,G. rubicunda,and G. vipio).The larg- to be distortedby multiple substitutions(Moritz est assemblageof Grusincludes four Eurasian et al. 1987). species(G. grus,G. japonensis,G. monachus,and G. nigricollis),as well as the North American METHODS WhoopingCrane (G. americana).The Sandhill Laboratoryprocedures.--DNA was extracted from Crane (G. canadensis)shows no close affinities whole blood samplesusing standardmethods of cell with other gruine groups. lysis,Proteinase K and RNaseA digestion,extraction DNA-DNA hybridization, however, was un- with phenol and chloroform, and ethanol precipita- able to resolve relationships either within or tion (Sambrook et al. 1989). Voucher information for betweenmajor clades. Within groups,small in- the specimensemployed is given in Appendix A. We terspecificgenetic distances (< 1% divergence) included subspeciesrepresentatives for the polytypic April 1994] CranePhylogeny 353

TABLE2. Cytochrome-bprimer sequencesand sources.

Primer name' Sequence Source L14841 5'~CCATCCAACATCTCAGCCATGATGAAA-3' Kocher et al. (1989) L15087 5'-TACTTAAACAAAGAAACCTGAAA-3' Edwardset al. (1991) L15136 5'-ATAGCAACAGCATTTGTAGG-3' Krajewskiet al. (1992) L15418 5'-GATAAAATCCCATTCCACCCCTA-3' This study L15615 5'-GTTCAATCCCAAACAAACTAGGA-3' This study H15149 5'-TGCAGCCCCTCAGAATGATATTTGTCCTCA-3' Kocher et al. (1989) H15498 5'-GGAATAAGTTATCTGGGTCTC-3' Krajewskiet al. (1992) H15767 5'-ATGAAGGGATGTTCTACTGGTTG-3' Edwardset al. (1991) H15915 5'-AACTGCAGTCATCTCCGGTTTACAAGAC-3' Edwards et al. (1991) • H and L refer to heavyand light strandsof mtDNA, respectively,and numberscorrespond to positionof eachprimeKs 3' basein human mitochondrialgenome (Anderson et al. 1981).Corresponding positions in chickenmitochondrial genome (Desjardins and Morals1990) can be obtainedby adding149 to humanposition number. Primer H15915 lies in threoninetRNA gene3' to cytochrome-b.

Sarus(G. antigone)and Sandhill (G. canadensis)cranes graphwere aligned manually with previousoverlap- in order to assessthe effect, if any, of intraspecific ping sequencesfrom the sameDNA sampleto ensure polymorphism on phylogenetic inferences (Smouse accuracy.After resolutionof base-callingerrors and et al. 1991).A Limpkin (Aramusguarauna, Aramidae) sequencingartifacts, sequences for eachspecies were served as an outgroup. aligned with one another. Manual alignment pre- Portionsof the cytochrome-bgene were isolated sentedno difficultiesbecause the sequencesare high- and amplifiedvia the polymerasechain reaction (PCR; ly similar,and no gapsare requiredto maintainthe Innis and Gelfand 1990). PCR reactions were done in reading frame. 100 #1 volumesusing 1.5 mM Mg2+. 1.0 #M concen- Dataanalysis.--Methods of phylogeneticinference trationsof eachprimer, and 1.0 U of Taq polymerase have been the subjectof considerabledebate in recent (PromegaCorp.). A thermal cyclebegan with 2.5 min ,particularly as regards DNA sequencedata (Fel- at 94'C for initial denaturation,followed by 35 cycles senstein1988, Penny et al. 1992).For datasets of more of denaturation(94øC, 40 s), primer annealing(48øC, thana few species,analytical options are largelyre- 1 min), and polymeraseextension (68-72øC, 3.5 min). strictedto parsimonymethods and methodsthat em- A final extension for 7 min was included to minimize ploy geneticdistances (Swofford and Olsen 1990).We the number of partial strands. Primers and their usedboth strategies in analysisof the cranesequences sourcesare given in Table 2. The primers span 1,042 and contrast the results of each below. basepairs (bp) of cytochromeb, coveringall but the Geneticdistances were computedusing Kimura's first (5') 98 bp of the gene sequence. (1980)two-parameter model to correctfor multiple Balanced-primerreaction productswere purified substitutions at individual sites. Because observed dis- by electrophoresisthrough a 2.5% low-melting aga- similaritiesbetween sequences were generallysmall rosegel, stainedwith ethidium bromide, excised,and (< 10%),distance estimates should not be grosslydis- stored in 250-1,000 #1 of deionized water. Gel slices torted by multiple substitutions.However, the crane were melted at 65'C for 3 to 5 min and 5 to 10 #1 were sequencesdo show a substantial transition bias and removed for asymmetricPCR (McCabe 1990). Reac- Kimura's(1980) correction is clearly appropriate. Phy- tion mixturesand thermal-cycleparameters for asym- logenetic relationshipsfrom distancematrices were metric amplification were identical to those given estimatedusing the methodof Fitchand Margoliash above,except that primer amountswere setto 50 pmol (1967).Levels of resolutionin the estimatedphylog- (excessprimer) and 1 pmol (limiting primer). An 8 #l eny were assayedby bootstrapresampling of sites portionof eachasymmetric reaction product was elec- (Felsenstein1985,1988). Pseudoreplicate distance ma- trophoresedthrough 2.5%agarose and visualizedby tricesand associatedbest-fit trees were generatedand ethidium bromide staining to checkfor the presence summarizedas a majority-rule consensustree, on of a visible single-strandedDNA band. Successful which node valuesgive the frequencywith which reactions were precipitated in 2.5 M ammonium ac- eachputative clade is observedamong the pseudo- etate and two volumes of cold 95% ethanol, dried, and replicates.Distance analyses were carriedout using rehydrated in 10 #l of deionized water for sequenc- programs SEQBOOT, DNADIST, FITCH, and CON- ing. Dideoxy sequencingfollowed the protocol for SENSEin Felsenstein'sPHYLIP package(1991, ver- the Sequenaseenzyme system ( Bio- sion 3.4). chemical;Sambrook et al. 1989) using [35S]dATP.Gel In parsimonyanalyses, equal weight was given to drying and autoradiographyfollowed standard pro- all codonposition sites. Although the sequences show tocols. a strongbias in favor of third-codon-positionsubsti- DNA sequences obtained from each autoradio- tutions,divergence is sufficientlylow that few first 354 ICa•l•wsraAND F•'rzNER [Auk,Vol. I I1

a. japonensis I 95.5I 98.5 I G. nigrieollis

•-• G. a. sharpei •00 I O.a. ant•gone

•. •ub•aunda

•.5 A. v•go • A. pa•ad•sea

56.51 •. •. aanadens•s

ß•0 B. •egu•o•u•

Fig. 2. Bootstrappeddistance tree based on 1,042 bp of crane cytochrome-bDNA sequence.Distances calculatedwith Kimura's(1980) two-parametermethod for 200 random samplesof sitesin cranealignment, and treesconstructed using Fitch-Margoliash(I 967) methodas implemented by SEQBOOT,DNADIST, FITCH, and CONSENSEprograms of PHYLIP 3.4. Branch-lengthunits are substitutionsper site. Nodal valuesshow percentageof pseudoreplicatetrees in which each putativeclade occurs. Best-fit tree has an associatedsum- of-squaresvalue of 0.8966(average percent standard deviation = 4.8702,global searchoption in effect). and second positionsare representedin the set of (1980) method. Divergencesbetween cranesand phylogeneticallyinformative sites (see below). We the Limpkin are in the range of 8.93 to 12.28%, reasonedthat differentialweighting of thesefew sites thosebetween gruine and balearicinecranes in would only exaggeratethe stochasticelement in se- the range 9.16 to 12.25%.The two speciesof quence variation and would not substantially im- Balearicashow a divergence of 3.54%, while prove the phylogeneticestimate. among gruine species distances range from Similarly, we treated transition and transversion substitutionsas equally informative, becausetrans- 1.36% (G. monachusand G. nigricollis)to 8.15% versionparsimony would be forcedto operateon only (G. japonensisand Bugeranus).At the subspecies a small fraction of the data (see below). Moreover, level, distancesare 0.58 to 0.97% among Sand- the low divergenceobserved between most sequences hill Crane (G. canadensis)sequences and 0.77% indicates that transition differencesstill carry sub- between the two SarusCrane (G. antigone)se- stantial phylogeneticinformation (i.e. mosthave not quences. been"concealed" by superimposedtransversions). As As expected,third-position substitutionsare for distanceanalyses, parsimony estimates were as- the most common among crane cytochrome-b sayedfor resolutionby bootstrapping.These analyses sequences(71.9% of polymorphic sites are in employedthe DNAPARS and DNABOOT programs of PHYLIP 3.4. third position), followed by first (18.9%of poly- morphicsites) and secondpositions (9.2%). The ratio of transition to transversion differences

RESULTS betweensequences ranges from approximately 5.0 (G. grusvs. G. monachus)to 2.5 (gruines vs. The aligned cytochrome-bsequences for all balearicines). taxa employed in this study are given in Ap- Best-fitand bootstrappeddistance analyses of pendix B. Table 3 shows pairwise distances the data in Table 3 yielded the tree shown in among sequencescalculated with Kimura's Figure 2. Bootstrapvalues on nodesof the tree April 1994] CranePhylogeny 355 indicate the relative amounts of resolution im- plied by the sequence-distancedata, but should not be interpreted as statistical confidence in- tervals (Krajewski and Dickerman 1990). Bal- earicinesare separatedfrom gruinesat the base of the distancetree as expectedfrom all pre- vious studies.Among gruines, there are three major species groups, two of which appear highlyresolved by thedata. One of theseis the Antigonegroup of Archibald(1976), in which theBrolga (G.rubicunda) andWhite-naped Crane (G.vipio) appear as sister species. The two spe- ciesthe associationofAnthropoides of theseare clearlywith thesisters, Wattledalthough Crane (Bugeranuscarunculatus) isless well resolved. The thirdputative clade includes allmembers ofthe Grusspecies group. Within this group some re- lationshipsare highly resolved,including Black- necked(G. nigricollis) andHooded (G. monachus) cranesassister species, andthe monophyly of thesewith the Common (G. grus) and Whooping (G. americana)cranes apart from the Japanese Crane(G.japonensis). Acluster containing all Sandhill Crane (G. canadensis)subspecies occurs withperfect consistency among bootstrap rep- licates.The SiberianCrane (G. leucogeranus)ap- pearsas the to all othergruines. Bootstrapvalues, however, indicate that rela- tionshipsamong these five major lineages can- notbe resolvedby the sequencedistances. The cranecytochrome-b sequences contain 171 phylogeneticallyinformative sites for parsi- monyanalysis. Most of these (137 sites, 80.1%) areat thirdpositions, although some informa- tivevariation isalso found at first (28 sites, 16.4%) andsecond (6 sites,3.5%) positions. If only transversionsareconsidered, the number of in- formativesites drops to 26,only 15.2% of the totalset of informative sites. Given these values, wechose toinclude allinformative positions in our parsimonyanalysis rather than usingonly conservativesites(first and second positions) or changes(transversions). Bootstrappedparsimony analysis of the crane cytochrome-bsequences yields the topology shownin Figure3. Thistree is nearly identical to that obtainedby distanceanalysis (Fig. 2), the only differences being minor rearrange- mentsinthe Grus species group and among G. canadensissubspecies. Levels of bootstrapreso- lutionon the parsimony tree are also similar to those from distanceanalysis and indicate that relationshipsamong species groups are not re- solved. 356 K•in•sra •4D F•rzNER [Auk, Vol. 111

gencebetween crowned cranesusing allozyme techniques. Relationships.--Themost striking feature of the trees in Figures2 and 3 is their congruence with the DNA-DNA hybridization results of Krajewski(1989) shown in Figure I. Both DNA- DNA hybridization and cytochrome-bsequence studiesidentify the samespecies groups within Gruinae:the Anthropoidesgroup, the Antigone group, the Grus group, and isolated branches bearing the Siberian (G. leucogeranus)and Sand- hill (G. canadensis)cranes. Bootstrap values on the cytochrome-btrees indicate that relation- ships between these groups are unresolved, a pattern also observedin DNA-DNA hybridiza- tion analyses. DNA-DNA hybridization provided no reso- lution of branchingorder within speciesgroups. Fig. 3. Bootstrappedparsimony tree for crane cy- Cytochromeb, however, offersmore resolution tochrome-bDNA sequencesbased on 200 pseudorep- at this level. In the Grusgroup, the Hooded (G. licates and carried out by DNABOOT program of PHYLIP 3.4 (For labelling conventions,see Fig. 2). monachus)and Black-necked(G. nigricollis)cranes The most-parsimonioustree found by DNAPARS dif- are sisterspecies. There is virtually no literature fered from bootstrapconsensus in placementof Buge- on the evolutionary relationships of G. nigri- ranus(which appearedas sister to Grusspecies group). coilis,beyond the general conclusionsof Ar- chibald (cited in Johnsgard,1983) and Wood DISCUSSION (1979) that it falls in the Grus speciesgroup. Peters (1934) placed G. nigricollisin sequence Levelsof divergence.--Observedlevels of cy- between G. grusand G. monachus.Black-necked tochrome-bsequence divergence among cranes and Hooded cranesare allopatric, with the for- correlatewell with someaspects of their current mer occurringin southwesternChina, and the .All subspecificdistances are less than latter in easternmost and . The low I%, whereasinterspecific distances within sub- level of genetic divergence (1.36%) between families are from 1 to 9%. Haplotypes of Sarus them suggestsa relatively recent speciation, (G. antigone)and Sandhill (G. canadensis)crane probably in the . subspeciesform separatemonophyletic groups, Also within the Grusgroup, G. grus,G. amer- suggestingthat ancestralmtDNA polymor- icana,G. monachus,and G. nigricollisform a mono- phism doesnot complicatephylogenetic esti- phyletic lineage apart from G. japonensis.Love mationfor thesespecies. Divergence at the ge- and Deninger (1992) reachedthe sameconclu- nus level within gruines, however, does not sion on the basis of similarities among these showa clearpattern; the rangewithin Grus(I speciesfor a short satelliteDNA sequence.The to 8%) encompassesall distancesbetween An- affinities of G. grusand G. americanawithin this thropoides,Bugeranus, and Grus(5 to 8%).This subgroup are not resolved by cytochromeb, pattern reflectsthe uncertaintaxonomic status though Love and Deninger (1992) argued that of gruinegenera as discussed above and by Kra- thesetwo are sisterspecies. The branchingor- jewski (1989). der in Figures2 and 3 is not consistentwith the In the caseof crowned cranes(Balearica), how- scenarioof Archibald (cited in Krajewski 1989) ever, cytochrome-bdivergences support rec- that G. grusrepresents a widespread,ancestral ognitionof B. pavoninaand B. regulorumas dis- lineage from which the remaining four species tinctspecies. Although genetic divergence alone in the group were derived by successivehabitat providesno basisfor speciesrecognition, the specializations. relativelylarge divergence (3.5%) between these Although bootstrap resolution is low, the two taxasupports the arguments of Walkinshaw Brolga(G. rubicunda) and White-napedCrane (G. (1964)in favor of speciesstatus. Ingold et al. vipio)appear to be sister species.This contra- (1987a) found a similarly large genetic diver- dicts the conclusionof Archibald (1976) that the April 1994] CranePhylogeny 357

Brolgais mostclosely related to the SarusCrane Foundationfor their continued support of our crane (G. antigone).The latter two speciesare sym- molecular systematicsresearch. George Gee of the patric in northern , may hybridize (al- U.S. Fish and Wildlife Service Patuxent Wildlife Re- thoughno hybrid specimensexist in museums), searchCenter provided our sample of G. americana; our sample of G. c. canadensiswas provided by the and have quite similar unison calls.Arguments Akron Zoo. We thank Liann McDonald and Daniel from distributional, reproductive, and pheno- Nickrent for technical assistance, and Bob Zink for typic similarity to phylogeny, however, always commentson the manuscript.This researchwas sup- beg the question of distinguishing primitive ported by an SIUC Summer ResearchFellowship, an from derived resemblance. Given the genetic SIUC Special ResearchProjects Grant, and a National and other datacurrently available,it is probably ScienceFoundation grant (BSR-9102842)to C.K. bestto suspendjudgement on the Brolga'ssister group. LITERATURE CITED Patternsof cladogenesis.--Unisoncall charac- teristics (Archibald 1976), DNA-DNA hybrid- ALDRICH, J.W. 1979. Status of the Canadian Sandhill ization (Krajewski 1989), and cytochrome-b Crane. Pages139-148 in Proceedingsof the 1978 mtDNA sequences(this study) suggestnearly craneworkshop (J. C. Lewis, Ed.). ColoradoState identical phylogeneticrelationships of cranes. Univ. Printing Service,Fort Collins. The similarity among these independent data ANDERSON,S., A. T. BANKER,B. O. BARRELL,M. H. L. DEBRuIJN, H. R. COULSON, J. DROUIN, I. C. setsis remarkablenot only for those relation- EPWERON,D. P. NIERLtCH, B. A. ROE, F. SANGER, shipsthey elucidate,but also for those they do P. H. SCHREIER,A. J. J. SMITH, R. STADEN,AND I. not. In particular, no data set has shown any G. YOUNG. 1981. Sequenceand organizationof indication of resolving the branching order of the human mitochondrial genome. Nature 290: the five majorgruine lineages (an exceptionmay 457-465. be G. leucogeranus,but behaviorand geneticdata ARCHIBALD,G.W. 1976. Crane taxonomy as revealed show no congruencerelative to this enigmatic by the unison call. Pages225-251 in Crane re- species).This fact and the branch lengths on search around the world (J. C. Lewis and H. Mas- the tree of Figure 2 (seealso Krajewski 1989:fig. atomi, Eds.). International Crane Foundation, Baraboo, . 5) indicate a rapid diversificationof gruine lin- BRODKORB,P. 1967. Catalogueof fossilbirds. Part 3 eages. Becausethe subfamily seems to have (Ralliformes, Ichthyornithiformes, Charadri- originated in the late Miocene (Krajewski1990) iformes). Bull. Fl. State-Mus., Biol. Sci. 2:99-220. and Pleistocene are known from most DESJARDINS,P., AND R. MORAIS. 1990. Sequenceand extant species (Brodkorb 1967), this radiation gene order of the chicken mitochondrial ge- mostlikely occurredduring the early nome: A novel gene order in higher vertebrates. or late Miocene. Given that a putative fossil J. Mol. Biol. 212:599-634. humerus of G. canadensis has been found in DESSAUER,H. C., G. F. GEE, AND J. S. ROGERS. 1992. North American Pliocene deposits (Brodkorb Allozyme evidence for crane systematicsand 1967), an earlier date seemsmore likely, per- polymorphisms within populations of Sandhill, haps around five million years ago near the Sarus,Siberian, and Whooping cranes.Mol. Phyl. Evol. 1:279-288. Miocene-Plioceneboundary. Lacking addition- EDWARDS, S. V., P. ARCTANDER, AND A. C. WILSON. al fossils,however, such attemptsat dating are 1991. Mitochondrial resolutionof a deep branch speculative. in the genealogicaltree for perching . Proc. Classification.--Wesuggest no modifications R. Soc. Lond. B Biol Sci. 243:99-107. of the crane classificationscheme of Krajewski FELSENSTEIN,J. 1985. Confidencelimits on phylog- (1989). This reflects the lack of a well-resolved enies: An approach using the bootstrap. Evolu- branching order among gruine speciesgroups, tion 39:783-791. as noted above.Indeed, the suggestionby Kra- FELSENSTEIN,J. 1988. Phylogeniesfrom molecular jewski (1989) that Anthropoidesand Bugeranusbe sequences:Inference and reliability. Annu. Rev. Genet. 22:521-565. mergedinto Grusmay have been prematurein FELSENSTEIN,J. 1991. PHYLIP (phylogenyinference light of the cytochrome-bresults. package)version 3.4. Distributed by the author. Department of Genetics,Univ. Washington, Se- ACKNOWLEDGMENTS attle. FITCH, W. M., AND E. MARGOLIASH. 1967. Construc- We thank GeorgeArchibald, Claire Mirande, Scott tion of evolutionary trees. Science155:279-284. Swengel and the staff of the International Crane INGOLD, J. L., S. I. GUTTMAN, AND D. O. OSBORNE. 358 KRAIEWSI•AND F•rz• [Auk,Vol. 111

1987a. Biochemical systematicsof the crowned (M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. cranes.Pages 317-322 in Proceedingsof the 1983 J. White, Eds.). Academic Press,San Diego. international crane workshop (G. W. Archibald MORITZ, C., T. E. DOWLING, AND W. M. BROWN. 1987. and R. F. Pasquier, Eds.). International Crane of mitochondrial DNA: Rele- Foundation, Baraboo, Wisconsin. vance for population biology and systematics. INGOLD, J. L., S. I. GOTTMAN, AND D. O. OSBORNE. Annu. Rev. Ecol. Syst. 18:269-292. 1987b. Biochemicalsystematics and evolution of PENNY, D., M.D. HENDY, AND M. A. STEEL. 1992. the cranes(Aves: Gruidae). Pages575-584 in Pro- Progresswith methods for constructing evolu- ceedings of the 1983 international crane work- tionary trees. Trends Ecol. & Evol. 7:73-79. shop (G. W. Archibald and R. F. Pasquier,Eds.). PETERS,J.L. 1934. Check- of the world, International Crane Foundation, Baraboo, Wis- vol. 2. Harvard Univ. Press,Cambridge, Massa- consin. chussets. [NGOLD,J. L., J. C. VAUGHN, S. I. GUTTMAN,AND L. R. SAMBROOK,J., E. F. FRITSCH,AND t. MANIATIS. 1989. MAXSON. 1989. Phylogeny of the cranes(Aves: Molecular cloning: A laboratory manual. Cold Gruidae) as deduced from DNA-DNA hybridiza- Spring Harbor Laboratory Press, Cold Spring tion and albumin micro-complement fixation Harbor, New York. analyses.Auk 106:595-602. SMOUSE,P. E., T. E. DOWLING, J. A. TWOREK,W. R. INNIS,M. A.,ANDD. H. GELFAND.1990. Optimization HOEH, AND W. M. BROWN. 1991. Effects of in- of PCRs. Pages3-12 in PCR protocols:A guide traspecificvariation on phylogeneticinference: to methodsand applications(M. A. Innis, D. H. A likelihood analysis of mtDNA restriction site Gelfand, J. J. Sninsky, and T. J. White, Eds.). Ac- data in cyprinid .Syst. Zool. 40:393-409. ademic Press,San Diego. SWOFFORD,D. L., ANDG. J. OLSEN.1990. Phylogeny JOHNSGARD,P.A. 1983. Cranes of the world. Indiana reconstruction.Pages 411-501 in Molecular sys- Univ. Press,Bloomington. tematics (D. M. Hillis and C. Moritz, Eds.). Sin- LovE, J., AND P. DENINGER. 1992. Characterization auer Associates, Sunderland, Massachussets. and phylogeneticsignificance of a repetitiveDNA WALKINSHAW, L. H. 1964. The African crowned sequence from Whooping Cranes (Grus ameri- cranes. Wilson Bull. 76:355-377. cana). Auk 109:73-79. WOOD,D.S. 1979. Phenetic relationshipswithin the KIMURA,M. 1980. A simple method for estimating family Gruidae. Wilson Bull. 91:384-399. evolutionary rate of base substitution through comparativestudy of nucleotidesequences. J. Mol. Evol. 16:111-120. KOCHER, T. D., W. K. THOMAS, A. MEYER, S. V. ED- WARDS,S. P'•d4BO,F. X. VILLABLANCA,AND A. C. WILSON.1989. DynamicsofmitochondrialDNA APPENDIXA. Voucher specimenswith institution and evolution in :Amplification and sequenc- identification number. DNA samplesderived most- ing with conservedprimers. Proc.Natl. Acad. Sci. ly from captivecranes, with blood or tissuesamples USA 86:6196-6200. provided by institutions listed. Canadian Sandhill KRAJEWSKI,C. 1989. Phylogenetic relationships Crane (G. canadensisrowani) specimen was a wild among cranes (Gruiformes: Gruidae) based on shotby sporthunters in Manitoba.Subspecific DNA hybridization. Auk 106:603-618. identification of this individual based on skull mor- KRAIEWSI•,C. 1990. Relativerates of single-copyDNA phometric data in Aldrich (1979). Abbreviations: evolution in cranes. Mol. Biol. Evol. 7:65-73. ICF, International Crane Foundation; PWRC, Pa- tuxent Wildlife Research Center; AZ, Akron Zoo; KRAJEWSKI,C., AND A. W. DICKERMAN. 1990. Boot- UWZM, University of Wisconsin Zoological Mu- strap analysisof phylogenetic trees derived from seum. DNA hybridization distances.Syst. Zool. 39:383- 390. Aramusguarauna, UWZM 198;Balearica pavonina, ICF KRAJEWSKI,C., A. C. DRISKELL, P. R. BAvERSTOCK,AND 1-09; B. regulorum,ICF 2-18; Anthropoidesvirgo, ICF M. J. BRAUN. 1992. Phylogenetic relationships 3-12; A. paradisea,ICF 4-07; Bugeranuscarunculatus, ICF of the thylacine (Marsupialia: Thylacinidae) 5-07; Grus leucogeranus,ICF 6-06; G. canadensiscana- among dasyuroidmarsupials: Evidence from cy- densis,AZ; G. c. rowani, Manitoba (wild); G. c. tabida, tochrome-b DNA sequences.Proc. R. Soc. Lond. ICF 7-79; G. c. pratensis,ICF 7-31; G. antigoneantigone, B Biol. Sci. 250:19-27. ICF 8-45; G. a. sharpei,ICF 8-28;G. rubicunda,ICF 9-08; MCCABE,P.C. 1990. Production of single-stranded G. vipio, ICF 10-02;G. grus,ICF 11-16;G. monachus, ICF 12-21; G. americana,PWRC 83004;G. nigricollis,ICF 14- DNA by asymmetric PCR. Pages 76-83 in PCR 02; G. japonensis,ICF 15-38. protocols:A guide to methods and applications April 1994] CranePhylogeny 359

APPENDIXB. Crane cytochrome-bDNA sequences.Sequences below show light-strand(L) nucleotidesof eachtaxon used in study.Numbers above each line referto positions in chickenmtDNA sequence (Desjardins and Morals 1990).Dots indicate match to G. vipioreference sequence. Position 14991 is a third-codonposition; readingframe can be translatedfrom position14992. Phylogenetic analyses did not includeterminal stop codon (TAA).

1 1 1 1 1 1 1 1 5 5 5 5 5 5 5 5 0 0 0 0 0 0 0 0 0 1 2 3 4 5 6 7 0 0 0 0 0 0 0 0

CTTCGGATCTCTCCTAGGCATCTGC CT•GCAACACAAATCCTAAC CGGC CTACTACTAGC CGCACACTACACCGCAGACA G. leucogeranus ß . .T ...... T ..... A.T ...... T ...... T ...... T ...... G. americana ß..T ...... T ...... T ..... A ...... T ...... T..C ...... T ...... G. a. sharpei G. japonensis ß..T ...... g ..... T ..... A ...... T ...... T ...... G. c. pratensis ...... T...T.A ...... T ...... G. rubicunda B. regulorum A. paradisea ...... T ..... AA ...... T ...... A. virgo ...... T ..... A ...... T ...... G. grus ß..T ...... A ...... T ...... T ...... T ...... Bugeranus ...... A ...... G ...... g ...... T ...... T ...... G. monachus ß..T ...... T ..... A ...... T ...... T ...... T ...... Aramus ...... C ...... A.T ...... T ...... T ...... T ...... G. nigricollis ...... T ..... A ...... T ...... T ...... T ...... G. a. antigone B. pavonina ...... C ...... T ...... AA.C ...... T ...... T ...... G. c. tabida ...... T...T.A ...... T ...... G. c. canadensis ...... T...T.A ...... T ...... G. c. rowani ...... T...T.A ...... T ......

1 1 1 i 1 ]. 1 1 5 5 5 5 5 5 5 5 0 0 i i i i i 1 8 9 0 i 2 3 4 5 0 0 0 0 0 0 0 0

CAACCCTAGC CTTCTCATCCGTTGCCCACACATGC CGAAACGTACAACACGGCTGACTAATCCGCAACCTACATGCAAAT G. leucogeranus ...... T ...... GT.T ...... C ..... T ...... T ...... GT.T ...... C G. a. sharpei ...... C ...... T ...... C G. japonensis ß .G..T.G ...... C..T..T ...... T .... T ...... C G. c. pratensis ...... T..T ...... T..T ...... C G. rubicunda ...... T ...... T ...... C B. regulorum ...... T ...... T ...... C A. paradisea ...... T..T ...... T ...... C A. virgo G. grus ..... T ...... T ...... GT.T ...... C Bugeranus ...... T..T ...... T ...... C G. monachus ..... T ...... T ...... GT.T ...... C ...... A ...... T ...... g ...... T ...... C G. nigricollis ..... T ...... T ...... GT.T ...... C G. a. antigone ...... C ...... T ...... C B. pavonina ...... T ...... T ...... C G. c. tabida ...... T..T ...... T..T ...... C G. c. canadensis ...... T..T ...... T..T ...... C G. c. rowani ...... T..T ...... T..T ...... C 360 KRAJEWSKIAND FLerZNER [Auk, Vol. 111

APP•,SDXX B. Continued.

1 1 1 1 1 1 1 1 5 5 5 5 5 5 5 5 1 1 1 1 2 2 2 2 6 7 8 9 0 1 2 3 0 0 0 0 0 0 0 0

G. vipio GGAGCATCATTCTTCTTTATCTGCATCTACCTCCACATTGGACGAGGCCTATACTACGGCTCATATCTGTACAAAGAAAC G. leucogeranus G. americana G. a. sharpei G. japonensis ..... C ...... T..C ...... C ...... G.. G. c. pratensis ..... C ...... C ..... T ...... CT.A ...... G. rubicunda ...... T ...... B. regulorum ..... T ...... C ...... A.G ..... C ...... T..C ..... T ...... C..A ...... A. paradisea ..... C ...... C ...... C ...... TT ...... T ...... C ...... A. virgo ..... C ...... C ...... T. .C ...... T .... T ...... C. .A ...... G. grus ..... C ...... C ...... G ...... T ...... Bugeranus ..... C ...... C..T ...... C ...... G. monachus ..... C ...... C ...... G ...... T ...... Aramus G. nigricollis ..... C ...... C ...... G ...... T ...... G. a. antigone B. pavonina ..... T ...... C ...... A.G. . .G.C ...... T. .C ..... T ...... C. .A ...... G. c. tabida ..... C ...... C ..... T ...... CT.A ...... G. c. canadensis ..... C ...... C ..... T ...... CT.A ...... G. c. rowani ..... C ...... C ..... T ...... CT.A ......

1 1 1 1 i 1 1 1 5 5 5 5 5 5 5 5 2 2 2 2 2 2 3 3 4 5 6 7 8 9 0 1 0 0 0 0 0 0 0 0

G. vipio CTGAAATACAGGAGTTATCCTCCTACTTACCCTCATAGCTACCGCCTTCGTAGGCTATGTCCTACCATGAGGAC•ATAT G. leucogeranus G. americana ...... C ...... C ...... A ...... C ...... G. a. sharpei G. japonensis ...... C ...... C ...... C ...... G ...... G. c. pratensis ...... T ...... C ..... G ...... G. rubicunda B. regulorum ...... C..T..T ..... A ...... C ...... A. paradisea ...... C ...... T ...... C ...... G. A. virgo ...... C ...... T ...... C ...... G ...... G. G. grus ...... C ...... C ...... A ...... C ...... G ...... G. Bugeranus ...... C ...... T ...... C ...... G ...... G. monachus ...... C ...... C ...... G ...... A ...... C ...... C ...... C ...... C ...... C ...... G. nigricollis ...... C ...... C ...... g ...... A ...... C ...... G. a. antigone B. pavonina ...... C ...... C..T..T ..... A ...... G ...... G. c. tabida ...... T ...... CA ...... G. c. canadensis ...... G ...... T ...... C ...... G ...... G. c. rowani ...... G ...... T ...... C ..... G ...... April 1994] CranePhylogeny 361

APPENDIX B. Con%inued.

1 1 1 1 1 1 1 1 5 5 5 5 5 5 5 5

2 • 4 5 6 7 8 9 0 0 0 0 0 0 0 0

CATTTTGAGGGGCTACAGTCATCACCAATCTCTTCTCAGCCGTCCCCTACATCGGCCAAACCCTTGTAGAATGAGCTTGA G. leucogeranus ...... T ...... A ...... A.C ...... G. a. sharpei G. japonensis .C ...... T ...... A ...... C ...... G. c. pratensis .... C ...... T ..... C ...... A ...... C ...... G ...... G. rubicunda B. regulorum .... C ..... A..C ...... C..A ...... A .... G ...... A.C ..... G ..... C... A. paradisea A. virgo G. grus Bugeranus G. monachus ...... T ...... C ...... A ...... C ...... A ...... T ...... C ...... A ...... C..G..G ...... G. nigricollis ...... T ...... C ...... A ...... C ...... G. a. antigone B. pavonina G. c. tabida .... C ...... T ..... C ...... A ...... C ...... G ...... G. c. canadensis .... C ...... T ..... C ...... A ...... C ...... G ...... G. c. rowani .... C ...... T ..... C ...... A ...... C ...... G ......

1 i i i i i i 1 5 5 5 5 5 5 5 5 4 4 4 4 4 4 4 4 0 1 2 • 4 5 6 7 0 0 0 0 0 0 0 0

•CTTCTCAGTAGACAATCCCACATT•CTCGATTCTTCACTTTACACTTCCTCCTCCCATTCATAATCATA•CCT G. leucogeranus G. americana G. a. sharpei ...... T ...... G. japonensis G. c. pratensis G. rubicunda B. regulorum ..A..T ...... C ...... C .... C ...... C ...... C ...... A. paradisea ..... T ...... T ...... T..G ..... A. virgo ..... T..T ...... T ...... G ...... T ...... T..G ..... G. grus Bugeranus ...... T ...... C ...... T ...... T ...... G. monachus Aramus ..A..G ...... C ...... C ...... C ...... G. nigricollis G. a. antigone B. pavonina ..... T ...... C ...... C .... C ...... C ...... G. c. tabida G. c. canadensis G. c. rowani 362 KRAJEWSKIANOF•TZNER [Auk,Vol. III

APPENDIX B. Continued.

1 1 1 1 1 1 1 1 5 5 5 5 5 5 5 5 4 4 5 5 5 5 5 5 8 9 0 1 2 3 4 5 0 0 0 0 0 0 0 0

G. vipio CACCCTAATCCACCTCACCTTCCTTCACGAATCCGGCTCA•CAACCCCCTAGGCATTGTATCAAACTGCGATAA•TTC G. leucogeranus G. americana G. a. sharpei G. japonensis ...... T ..... T ..... C ...... C ...... T ...... C. G. c. pratensis G. rubicunda ...... T ...... G ...... C. B. regulorum ...... T ..... A ...... T ...... T ...... T..C ...... C ..... C. A. paradisea A. virgo G. grus Bugeranus ...... T ...... T ...... C ...... C. G. monachus Aramus ...... T.A ...... T ...... C ...... C. G. nigricollis G. a. antigone B. pavonina ...... T ..... A ...... T ...... T ...... T..C ...... C ..... C. G. c. tabida G. c. canadensis G. c. rowani ...... T ...... C.

1 1 1 1 1 1 1 1 5 5 5 5 5 5 5 5 5 5 5 5 6 6 6 6 6 7 8 8 0 1 2 3 0 0 0 0 0 0 0 0

CATTCCACCCCTATTTTTCCTTAAAAGATATCCTAGGATTCATACTCATACTATTTCCACTCATAACCCTAGCTCTATTC G. leucogeranus ...... C ...... G ...... C ...... T .... C ...... G. americana ...... C ...... C ...... T..C ...... T G. a. sharpei ...... C ...... C ...... C ...... C ...... G. japonensis ...... T ...... T.C ...... T. .C ...... C ...... G. c. pratensis ...... G ...... c ...... T G. rubicunda B. regulorum ...... C ...... C ...... C.C ...... T.CC.C ..... A ...... C..C ...... A. paradisea A. virgo G. grus ...... G ...... T..C ...... T Bugeranus G. monachus ...... T ..... T..C ...... T Aramus ...... T ...... GC ...... T.CC.C ..... A ...... C ...... G. nigricollis ...... C ...... T ..... T..C ...... T G. a. antigone B. pavonina ...... C ...... C ...... C ...... T.CC ...... A ...... C. .C ...... G. c. tabida ...... G ...... C ...... T G. c. canadensis ...... G ...... C ...... T ...... G. c. rowani ...... G ...... C ...... T April 1994] CranePhylogeny 363

APPENDIX B. Continued.

1 1 1 1 1 1 1 1 5 5 5 5 5 5 5 5 6 6 6 6 6 6 7 7 4 5 6 7 8 9 0 1 0 0 0 0 0 0 0 0

TCACCAAACCTACTAGGAGACCCAGAAAACTTCACCCCAGCAAACCCCCTAGTCACAC•TCCCCATATCAAACCAGAATG G. leucogeranus ...... T ...... T ...... A ..... C..A ..... T ...... C...C ...... T ...... G ...... T.C,G..G ..... G. a. sharpei G. japonensis ...... T ...... G ...... T ...... T..G..G ..... G. c. pratensis G. rubicunda ...... G ...... TGG ...... G ...... A.T ...... B. regulorum ...... T ...... AT .... A ..... C..A..C ...... A. paradisea A. virgo ...... T ...... C ...... T ...... T .... T ...... G. grus ...... T ...... T ...... T..G..G ..... Bugeranus ...... T.G ...... G ...... T ...... TT ..... T..G ...... G. monachus ...... T ...... T ..... T ..... G ..... Aramus ...... T ...... T ..... T ...... A ..... C..A ..... G ...... G. nigricollis ...... T ...... T..G..G ..... G. a. antigone B. pavonina ...... T ...... G ...... T.T .... T..C ..... G ...... G. c. tabida G. c. canadensis G. c. rowani

1 1 1 1 1 1 1 1 5 5 5 5 5 5 5 5 7 7 7 7 7 7 7 7 2 3 4 5 6 7 8 9 0 0 0 0 0 0 0 0

G. vipio ATACCTCTTATTTGCATACGCCATCCGACGTTCAAT•CCAAACAAACTAC•GAC•G•GTACTAGCCTTAGCCGCCTCCGTAC G. leucogeranus .T..C ...... C ...... T .... .T.T ...... T ...... C.G ...... G. a. sharpei .T.T ...... T ...... T ...... T ...... G. japonensls .T ...... T..T.TG ...... T ...... G. c. pratensis .T.T ...... C ...... TT...C ...... T ...... C ...... G. G. rubicunda .T..C ...... T ...... T..G ...... B. regulorum .T..C .... C ...... G.T...T...C ...... T ...... • ...... C ...... TA... A. paradisea .TT ...... G..T ...... T ...... T ...... T ...... T ...... A. virgo .TT ...... T ...... T ...... G ...... C .... T ...... G. grus .T.T ...... TC ...... T...T ..... C ...... Bugeranus .T.T ...... G ...... G...T ...... G ...... T ..... C .... T ...... G. monachus .T.TC ...... A.G...T ...... C ...... T ...... G ..... T .... TG.TA ...... A ...... C ...... G. nigricollis .T.TC ...... T .... T ...... A ...... G. a. antigone .T.T ...... T.T ...... T ...... T ...... B. pavonina .T..C .... C ...... T .... T...C ...... T ...... C.G ...... A... G. c. tabida .T.T ...... C...T ..... TT...C ...... T ...... C ...... G. G. c. canadensis .T.T ...... C ...... TT...C ...... T ...... C ...... G. G. c. rowani .T.T ...... C ...... TT...C ...... T ...... T.C ...... G. 364 KP.Amwsm AND F•rz• [Auk,Vol. 111

APPENDIX B. Continued.

1 1 1 1 1 1 1 1 5 5 5 5 5 5 5 5 8 8 8 8 8 8 8 8 0 1 2 3 4 5 6 0 0 0 0 0 0 0 0

TAATCCTCTTTCTAGCTCCACTCCT•CATAAATCTAAACAACGTACAATAACCTTCCGCCCATTCTCCCAACTCCTATTC G. leucogeranus ...... C..G .... T...T ...... G ..... C ...... T ...... C ...... T ...... C ...... C ...... CC ...... G. a. sharpei G. japonensis ...... C ..... C..G ...... C ...... G. c. pratensis .G ...... C ...... T..CO ...... G. rubicunda B. regulorum ...... C ...... C ...... TC ...... T ...... A. paradisea ...... G..C ...... C ...... CC ...... A. virgo G. grus Bugeranus G. monachus ...... C.C. . .ATC. .C ..... T. .C ..... C ...... T..T..TC.A..T ...... G. nigricollis ...... C ...... C ...... CC...T ...... G. a. antigone B. pavonina ß .G ...... C ...... C..G ...... CC ...... T ...... G. c. tabida .G ...... C ...... T..CO ...... G. c. canadensis ...... C ...... T..CC ...... T ..... G. c. rowani .G ...... C ...... T..CO ......

1 1 1 1 1 1 1 1 5 5 5 5 5 5 5 5 8 8 9 9 9 9 9 9 8 9 0 1 2 3 4 5 0 0 0 0 0 0 0 0

TGAACCCTAGCCGCCAACCTCCTTATCCT•CATGAGTT•CAGCCAACCAGTAGAACACCCCTTTATCATTATCGGCCA G. leucogeranus ..... T ...... A ...... C ..... C ...... G. americana ...... G ...... T..C ...... G ...... T ..... G ...... A..C ..... C ...... G. a. sharpei ...... A ...... T ...... A..C..A..C ...... G. japonensis ...... A ...... C ...... G ...... A..G..G..C ...... G. c. pratensis ..... T...A.T ...... T..C ...... T ...... C ..... C ...... G. rubicunda ...... A ...... T ...... A ..... G..C ...... B. regulorum ...... A.T ...... C..T ...... C ...... A..C ..... C ...... A. paradisea ...... A ...... T ...... G ...... TA..C..G..C ...... A. virgo ...... A ...... T ...... G ..... T..A..C..G..C ...... G. grus ...... A ...... T ...... T .... G ...... A..C..G..A...A .... Bugeranus ...... A ...... G.T..C...T ...... C ...... GT ..... C ..... C ...... G. monachus ...... A ...... T..C ...... G ...... A..C ..... C ...... T.A ...... A ...... T ...... G..T..A..C ..... C ...... G. nigricollis ...... A ...... T..C ...... G ...... C ..... C ...... G. a. antigone ...... A.T ...... C ..... C...C .... B. pavonina ...... A.T ...... C..T ...... G..C ...... A..C..A..C ...... G. c. tabida ..... T.. .A.T ...... T..C ...... T ...... C ..... C ...... G. c. canadensis ..... T.. .A.T ...... T. .C ...... T ...... C ..... C ...... G. c. rowani ..... T...A.T ...... T..C ...... T ...... C ..... C ...... April 1994] CranePhylogeny 365

APPENDIX B. Continued.

1 1 1 1 1 1 1 1 5 5 5 5 6 6 6 6 9 9 9 9 0 0 0 0 6 7 8 9 0 1 2 3 0 0 0 0 0 0 0 0

ACTAGCTTCCCTTACCTACTTCACTATTCTCCTAATCCTTTTCCCCATCATCGGGGCCCTAGAAAACAAAATACTAAACTACTAA G. leucogeranus G. americana ...... C ...... C ...... C ...... A ...... TC ...... G. a. sharpei ...... C ..... C ...... C ...... A ...... G. japonensis ...... C ...... C ...... C ...... A ...... T ...... G. c. pratensis G. rubicunda ...... C ..... A ..... C ...... A ...... B. regulorum ...... C ...... T..T..C..C ...... T..C ...... A.C...A ...... A. paradisea ...... A ..... A, .C ...... g ...... g .... C ...... A. virgo ...... A..C ...... G .... C ...... C ...... G. grus ...... C ...... C ...... C ...... A ...... T ...... Bugeranus ...... C ...... A ...... T ...... G. monachus ...... C ...... C ...... C ...... A ...... T ...... Aramus .T.G..A ..... A ...... C ...... A..T ..... TGC...A ...... T ...... G. nigricollis ...... C ..... G ...... C ...... A ...... T ...... G. a. antigone ...... C ..... C ...... C ...... A ...... B. pavonina ...... C ...... T..T ..... C ...... T..C ...... C...C...A ...... G. c. tabida G. c. canadensis G. c. rowani