DOCSLIB.ORG

Supplementary Information

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Information Immune differentiation regulator p100 tunes NF-κB responses to TNF Budhaditya Chatterjee,1, 2* Payel Roy,1, # * Uday Aditya Sarkar,1 Yashika Ratra,1 Meenakshi Chawla,1 James Gomes,2 Soumen Basak1§ 1Systems Immunology Laboratory, National Institute of Immunology, Aruna Asaf Ali Marg, New Delhi-110067, India. 2Kusuma School of Biological Sciences, Indian Institute of Technology Delhi, India. #Current address: La Jolla Institute for Allergy and Immunology, USA *These authors contributed equally to this work. §Corresponding author. Email: [email protected] Supplementary Information I. Supplementary Fig. S1 – Fig. S4 and corresponding figure legends II. Supplementary Tables III. Detailed description of global gene expression analyses IV. A description of the mathematical model and related parameterization V. Supplementary References 1 I. Supplementary Fig. S1 – Fig. S4 and corresponding figure legends a Theoretical IKK2 activity inputs b Theoretical IKK2 activity inputs of varying peak amplitude of varying durations 60 100 50 30 NEMO-IKK2(nM) 0 NEMO-IKK2 (nM) 0 simulated NF-κB activities simulated NF-κB activities 100 100 (nM) (nM) 50 50 Bn Bn κ κ NF NF 0 0 0 2 4 6 8 0 2 4 6 8 time (hr) time (hr) c experimentally-derived IKK2 activity inputs 100 TNFc TNFp 50 NEMO-IKK2 activity(nM) 0 0 2 4 6 8 0 2 4 6 8 time (hr) Figure S1: In silico studies of the NF-κB system: a) A library of twelve theoretical IKK2 activity profiles with an invariant signal duration of 8 hr and peak amplitude uniformly varying from 10 nM to 100 nM was used as model inputs (top) for simulating NF-κBn responses in a time course (bottom). These IKK2 activity profiles had identical 0.5 hr onset time. b) Thirteen IKK2 activity profiles with an identical 60 nM peak amplitude but total duration varying from 10 min to 480 min were similarly used in our simulation studies. We additionally used two IKK2 profiles with 60 nM peak amplitude, 5 min onset time and a total 10 min of duration or 60 nM peak amplitude, 10 min onset time and 20 min of duration as inputs. c) Plots showing interpolated IKK2 activity curves generated using experimental data obtained from MEFs subjected to TNFc or TNFp stimulations (Shih et al., 2009). 2 Nfkb2-/- MEFs a b Ab Nfkbia-/- Nfkb2-/- (-) αRelA αRelB TNFc 0 .5 1 3 8 0 .5 1 3 8 hr TNFp 0 .5 1 3 8 16 0 .5 1 3 8 16 0 .5 1 3 8 16 hr NF-κBn NF-κBn Oct1 Oct1 c 30min pulse duration Nfkb2-/- MEFs RelA cRel RelB Ab (-) α α α all RelA RelB IL-1β, 8hr Figure S2: Analyzing TNF-induced NF-κB signaling in mutant cells: a) EMSA comparing NF-κBn induced in a time-course in Nfkbia-/- and Nfkb2-/- MEFs in response to TNFc. The data represents three independent experiments. b) EMSA demonstrating total, RelB-containing and RelA-containing NF-κB activities induced in a time-course in response to TNFp. Dynamical RelB activity was unmasked in EMSA by ablating RelA DNA binding with an anti-RelA antibody. Similarly, RelA activity was unravelled by ablating RelB DNA binding. The data represents two biological replicates. c) Composition of NF-κBn induced after 8 hr of IL-1β treatment in Nfkb2-/- MEFs was determined in the shift-ablation assay. The data represents two biological replicates. a b 8 hr post-TNFp stimulation 1 * p<0.05 * 3.2 Relb 2.4 * *** *** 1.6 0 0.8 * ** * * *** relative * ** 0X TNFp 5X TNFp mRNA abundance mRNA 0 standardized B tg RelB κ promoter const. -1 NF- regressioncoefficient 1 10 20 30 40 parameter groups responsive -/- Relb -/- Nfkb2 Figure S3: Investigating the mechanism underlying late-acting RelB:p50 response to TNFp in the absence of p100: a) Graph plot describing the standardized regression coefficients of the parameter groups subjected to the Variance-based multiparametric sensitivity analysis. The asterisk indicates statistically significant deviation (P <0.001) from the null sensitivity for certain parameter groups, as determined by two-tailed Student’s t test. b) qRT-PCR analysis revealing the expression of Relb mRNA after 8 hr of the -/- -/- commencement of TNFp treatment in Relb Nfkb2 MEFs stably expressing RelB from a transgene (tg) either constitutively (const.) or from an NF-κB responsive promoter (top panel). Data are means ± SEM of four biological replicates. 3 Nfkb2-/- MEFs a b 0 1 3 Nfkb2-deficient 2 ×10 time ( 4 3 4 5 hr (AU) 6 2 ) measuredat6-8 7 cell 8 harvesting nRelB u tp sp 0 dp 2 6 p<0.05 4 Relb Relb 2 1 mRNA 0 sp dp tp hr 0 total after 1 mRNA (AU) mRNA 0 RelB ×103 9 RelA st proteins 7 TNFp Actin 5 0 sp dp tp 0 1 total RelB 2 protein (AU) protein 3 0 p<0.05 4 RelB protein p<0.05 u sp dp Figure S4: Investigating the Nfkb2-deficient system in a repeated TNF pulse regime: a) Computational simulation studies predicting nRelB activity (top panel), abundances of Relb mRNA as well as RelB protein in Nfkb2-deficient system subjected to a single TNFp (sp) or successive two TNFp separated by 4 hr (dp). The activities and abundances were estimated at 6-8 hr after the commencement of the -/- first pulse. u denote untreated system. b) Nfkb2 MEFs were treated with either a single TNFp (single pulse, sp) or two successive TNFp separated by 4 hr (double pulse, dp) or three successive TNFp where these pulses were separated by 2 hr (tp). Cells were harvested 8 hr after the commencement of the first pulse and subjected to either qRT-PCR analyses of Relb mRNA abundances (top bargraph) or Western Blotting analysis with antibodies against the indicated proteins (bottom panels). Densitometric analysis of the relative abundances of RelB protein has been also presented in a bargraph (bottom). mRNA data are means ± SEM of four biological replicates, protein data are means ± SEM of three experimental repeats. 4 II. Supplementary tables Table S1: List of the primers used in our quantitative real-time PCR Table S1 – List of the primers used in our quantitative real-time PCR mRNA Forward (5’ – 3’) Reverse (5’ – 3’) Actin CCAACCGTGAAAAGATGAC GTACGACCAGAGGCATACAG Csf1 CGGGCATCATCCTAGTCTTGCTGACTGT ATAGTGGCAGTATGTGGGGGGCATCCTC C3 TCAGATAAGGAGGGGCACAA ATGAAGAGGTACCCACTCTGGA Klf5 GGTCCAGACAAGATGTGAAATGG TTTATGCTCTGAAATTATCGGAACTG Me2 TTCTTAGAAGCTGCAAAGGC TCAGTGGGGAAGCTTCTCTT Nfkbia AGACTCTCGTTCCTGCACTTG AGTCTGCTGCAGGTTGTTC Psmc4 TGGTCATCGGTCAGTTCTTG CGGTCGATGGTACTCAGGAT RelB CCGAGCTAGGGGCCTTGGGTTCC AGCTCGATGGCGGGCAGGGTCTTG Tlr2 GCAAACGCTGTTCTGCTCAG AGGCGTCTCCCTCTATTGTATT Table S2: A description of genes belonging to various gene-clusters and gene-groups presented in Figure 4. Gene symbols Cluster Group id id 1110008P14Rik, 2500002L14Rik, 5133401N09Rik, Adam17, Adrb2, Agrn, Brp17, Cd82, Creld2, Ddit4, Dennd3, Fbn1, Fndc3b, Gphn, Gpt2, H2afy, H2- M3, Hagh, Hn1l, Ifngr1, Lhfpl2, LOC100044190, LOC100044322, Mcc, Ndrl, A Gr-I Plcd1, Prkcd, Psmd10, Rab8b, Rhou, Rnaset2, Slc29a1, Snx10, Surf4, Tlr2, Vdac3, Yaf2 0610010E21Rik, Abcb1b, Ass1, Axud1, Bmper, Csf1, Ehd1, Enpp4, Ext1, Mvp, Nfkb1, Nfkbia, Nfkbib, Parp8, Plscr1, Psmb10, Rab32 B 1110018G07Rik, 1110019N10Rik, 9430029K10Rik, Actr1b, Aftph, Akr1b3, Akr1b8, Arid3a, AU019823, AU022252, B9d2, C3, Calr, Chac1, Cib1, Clic4, Cyfip1, D3Ucla1, Dhps, Dnajc15, Erich1, Fktn, Fstl1, G6pdx, Gadd45b, Ghitm, Gr-II Gnptab, Gp38, Gpc1, Hmgn3, Hsd17b12, LOC668492, Lrp11, Map3k3, Mdh2, Med11, Mocs2, Mrps12, Msi2, Nadk, Ndrg1, Nfe2l1, Nrbf2, Nudt8, Nup93, C Ostf1, P4ha2, Pdgfa, Pelo, Plekhb2, Pnpla2, Pomp, Ppp1r16a, Prdx5, Psma7, Psmb6, Psmd13, Psme1, Ralb, Rassf1, Rela, Rnf145, Rpl24, Rrbp1, Sec23ip, Sec63, Slc25a5, Slc38a10, Slmo2, Sod2, Srp54, Srpr, Tbc1d15, Tbcb, Tceb1, Tgoln1, Tm9sf4, Tmem183a, Tnfaip8, Ubl4, Uso1, Uxt, Yif1b 1110008F13Rik, Actr3, AI846148, Atp2b1, Bcl10, Bud31, Cdc42ep3, Chic2, Chuk, Ciapin1, Cmtm6, Coq10b, Cyba, D15Ertd621e, D630048P19Rik, Dcbld1, Dcun1d3, Dcun1d5, EG433923, Eif4g2, Eif5a, Eif6, Fcf1, Fscn1, Fubp1, Galk1, Grpel1, Hspd1, Hspe1, Htra2, Jtv1, Klf5, LOC100042777, Gr-III LOC100047794, LOC100048413, LOC674706, Mapkapk2, Mpp6, Mrpl12, D Mrpl16, Mrpl20, Mrpl4, Mtf2, Nomo1, Orai1, Pa2g4, Picalm, Ppm1g, Psmb5, Psmc4, Psmd14, Rab21, Rap1b, Rhob, Rhog, Rps6ka4, Ruvbl2, Sdc4, Slc11a2, Slc25a39, Slc30a7, Slc35a3, Slc35b1, Srebf2, Stip1, Tatdn2, Tmem97, Trp53, Ube2m, Ublcp1, Uck2, Zfp263, Zfpm2 2310047D13Rik, 2400010D15Rik, 2610204L23Rik, Aacs, AI480653, Alas1, Arhgap29, Cebpb, Cstf2, Ctps, Cyld, Cyp51, Dcxr, Dnajb2, Fam162a, Fdps, Hist2h3b, Hnrnpf, Hrmt1l2, Ifitm2, Iscu, Jmjd6, LOC216443, LOC677317, Mid1ip1, Mras, Mrps34, Nedd4l, Nt5c3, Nubp1, Parl, Pcgf5, Pgam1, Pgp, E Plod2, Psmb3, Rala, Rb1, Rps3a, Sec13, Slc39a11, Snrpd3, Snx13, Snx18, Spr, Sqle, Ssu72, Stard4, Stk39, Tbl2, Tmem128, Tmem38b, Tsg101, Ube1c, Vdac1, Gr-IV Vps36, Zfp131 2310008H04Rik, 4933426M11Rik, Abcb6, Arhgef2, Bbs5, Bcl3, Cd47, Dnajc3, Fam102a, Fnbp1l, Gadd45g, Itpk1, Llgl2, LOC100046120, Lxn, Map3k8, Me2, Necap2, Nub1, Osmr, Pdk1, Pdk3, Pex16, Pgm2, Pld1, Plekha2, Ppp3cc, F Samd9l, Scamp1, Sccpdh, Setdb1, Socs3, Syvn1, Tspo, Ufsp2, Ugt1a10, Zfp810 5 III. Detailed description of global scale gene expression analyses Microarray mRNA analyses For microarray mRNA analyses, labelling, hybridization to the Illumina MouseRef-8 v2.0 Expression BeadChip, data processing, and quantile normalization were performed by Sandor Pvt Ltd (Hyderabad, India). We used a rank-based method for selecting genes with essentially zero detection p-value (Li et al., 2011). Among these reproducibly expressed genes, we further considered genes whose expressions were induced at least 1.3 fold at upon 6 hr of TNFc treatment in Nfkb2-/- MEFs, but not in Rela-/-Relb-/-Rel-/- cells. Our analyses led us to a list of 304 NF-κB-dependent genes. Subsequently, we utilized
Load more

Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • ROS Production Induced by BRAF Inhibitor Treatment Rewires
    Cesi et al. Molecular Cancer (2017) 16:102 DOI 10.1186/s12943-017-0667-y RESEARCH Open Access ROS production induced by BRAF inhibitor treatment rewires metabolic processes affecting cell growth of melanoma cells Giulia Cesi, Geoffroy Walbrecq, Andreas Zimmer, Stephanie Kreis*† and Claude Haan† Abstract Background: Most melanoma patients with BRAFV600E positive tumors respond well to a combination of BRAF kinase and MEK inhibitors. However, some patients are intrinsically resistant while the majority of patients eventually develop drug resistance to the treatment. For patients insufficiently responding to BRAF and MEK inhibitors, there is an ongoing need for new treatment targets. Cellular metabolism is such a promising new target line: mutant BRAFV600E has been shown to affect the metabolism. Methods: Time course experiments and a series of western blots were performed in a panel of BRAFV600E and BRAFWT/ NRASmut human melanoma cells, which were incubated with BRAF and MEK1 kinase inhibitors. siRNA approaches were used to investigate the metabolic players involved. Reactive oxygen species (ROS) were measured by confocal microscopy and AZD7545, an inhibitor targeting PDKs (pyruvate dehydrogenase kinase) was tested. Results: We show that inhibition of the RAS/RAF/MEK/ERK pathway induces phosphorylation of the pyruvate dehydrogenase PDH-E1α subunit in BRAFV600E and in BRAFWT/NRASmut harboring cells. Inhibition of BRAF, MEK1 and siRNA knock-down of ERK1/2 mediated phosphorylation of PDH. siRNA-mediated knock-down of all PDKs or the use of DCA (a pan-PDK inhibitor) abolished PDH-E1α phosphorylation. BRAF inhibitor treatment also induced the upregulation of ROS, concomitantly with the induction of PDH phosphorylation.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Profiling Data
    Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8
    [Show full text]
  • Tricarboxylic Acid (TCA) Cycle Intermediates: Regulators of Immune Responses
    life Review Tricarboxylic Acid (TCA) Cycle Intermediates: Regulators of Immune Responses Inseok Choi , Hyewon Son and Jea-Hyun Baek * School of Life Science, Handong Global University, Pohang, Gyeongbuk 37554, Korea; [email protected] (I.C.); [email protected] (H.S.) * Correspondence: [email protected]; Tel.: +82-54-260-1347 Abstract: The tricarboxylic acid cycle (TCA) is a series of chemical reactions used in aerobic organisms to generate energy via the oxidation of acetylcoenzyme A (CoA) derived from carbohydrates, fatty acids and proteins. In the eukaryotic system, the TCA cycle occurs completely in mitochondria, while the intermediates of the TCA cycle are retained inside mitochondria due to their polarity and hydrophilicity. Under cell stress conditions, mitochondria can become disrupted and release their contents, which act as danger signals in the cytosol. Of note, the TCA cycle intermediates may also leak from dysfunctioning mitochondria and regulate cellular processes. Increasing evidence shows that the metabolites of the TCA cycle are substantially involved in the regulation of immune responses. In this review, we aimed to provide a comprehensive systematic overview of the molecular mechanisms of each TCA cycle intermediate that may play key roles in regulating cellular immunity in cell stress and discuss its implication for immune activation and suppression. Keywords: Krebs cycle; tricarboxylic acid cycle; cellular immunity; immunometabolism 1. Introduction The tricarboxylic acid cycle (TCA, also known as the Krebs cycle or the citric acid Citation: Choi, I.; Son, H.; Baek, J.-H. Tricarboxylic Acid (TCA) Cycle cycle) is a series of chemical reactions used in aerobic organisms (pro- and eukaryotes) to Intermediates: Regulators of Immune generate energy via the oxidation of acetyl-coenzyme A (CoA) derived from carbohydrates, Responses.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2003/0082511 A1 Brown Et Al
    US 20030082511A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2003/0082511 A1 Brown et al. (43) Pub. Date: May 1, 2003 (54) IDENTIFICATION OF MODULATORY Publication Classification MOLECULES USING INDUCIBLE PROMOTERS (51) Int. Cl." ............................... C12O 1/00; C12O 1/68 (52) U.S. Cl. ..................................................... 435/4; 435/6 (76) Inventors: Steven J. Brown, San Diego, CA (US); Damien J. Dunnington, San Diego, CA (US); Imran Clark, San Diego, CA (57) ABSTRACT (US) Correspondence Address: Methods for identifying an ion channel modulator, a target David B. Waller & Associates membrane receptor modulator molecule, and other modula 5677 Oberlin Drive tory molecules are disclosed, as well as cells and vectors for Suit 214 use in those methods. A polynucleotide encoding target is San Diego, CA 92121 (US) provided in a cell under control of an inducible promoter, and candidate modulatory molecules are contacted with the (21) Appl. No.: 09/965,201 cell after induction of the promoter to ascertain whether a change in a measurable physiological parameter occurs as a (22) Filed: Sep. 25, 2001 result of the candidate modulatory molecule. Patent Application Publication May 1, 2003 Sheet 1 of 8 US 2003/0082511 A1 KCNC1 cDNA F.G. 1 Patent Application Publication May 1, 2003 Sheet 2 of 8 US 2003/0082511 A1 49 - -9 G C EH H EH N t R M h so as se W M M MP N FIG.2 Patent Application Publication May 1, 2003 Sheet 3 of 8 US 2003/0082511 A1 FG. 3 Patent Application Publication May 1, 2003 Sheet 4 of 8 US 2003/0082511 A1 KCNC1 ITREXCHO KC 150 mM KC 2000000 so 100 mM induced Uninduced Steady state O 100 200 300 400 500 600 700 Time (seconds) FIG.
    [Show full text]
  • Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association Between BMI and Adult-Onset Non- Atopic
    Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association between BMI and Adult-Onset Non- Atopic Asthma Ayoung Jeong 1,2, Medea Imboden 1,2, Akram Ghantous 3, Alexei Novoloaca 3, Anne-Elie Carsin 4,5,6, Manolis Kogevinas 4,5,6, Christian Schindler 1,2, Gianfranco Lovison 7, Zdenko Herceg 3, Cyrille Cuenin 3, Roel Vermeulen 8, Deborah Jarvis 9, André F. S. Amaral 9, Florian Kronenberg 10, Paolo Vineis 11,12 and Nicole Probst-Hensch 1,2,* 1 Swiss Tropical and Public Health Institute, 4051 Basel, Switzerland; [email protected] (A.J.); [email protected] (M.I.); [email protected] (C.S.) 2 Department of Public Health, University of Basel, 4001 Basel, Switzerland 3 International Agency for Research on Cancer, 69372 Lyon, France; [email protected] (A.G.); [email protected] (A.N.); [email protected] (Z.H.); [email protected] (C.C.) 4 ISGlobal, Barcelona Institute for Global Health, 08003 Barcelona, Spain; [email protected] (A.-E.C.); [email protected] (M.K.) 5 Universitat Pompeu Fabra (UPF), 08002 Barcelona, Spain 6 CIBER Epidemiología y Salud Pública (CIBERESP), 08005 Barcelona, Spain 7 Department of Economics, Business and Statistics, University of Palermo, 90128 Palermo, Italy; [email protected] 8 Environmental Epidemiology Division, Utrecht University, Institute for Risk Assessment Sciences, 3584CM Utrecht, Netherlands; [email protected] 9 Population Health and Occupational Disease, National Heart and Lung Institute, Imperial College, SW3 6LR London, UK; [email protected] (D.J.); [email protected] (A.F.S.A.) 10 Division of Genetic Epidemiology, Medical University of Innsbruck, 6020 Innsbruck, Austria; [email protected] 11 MRC-PHE Centre for Environment and Health, School of Public Health, Imperial College London, W2 1PG London, UK; [email protected] 12 Italian Institute for Genomic Medicine (IIGM), 10126 Turin, Italy * Correspondence: [email protected]; Tel.: +41-61-284-8378 Int.
    [Show full text]
  • R Graphics Output
    TNF signaling pathway all genes sink node genes ● ●● ●● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ●● ● ●●● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ●● ● ● ● ● ● ●● ●●● ● ●● ● ● ● ● ● ● ●● ●● ● ● ● ● ●● ● ● ● ● ●● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ●● ● ●● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●●● ● ● ●● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ●● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ●● ● ●● ● ● ● ● ● ● ●● ● ● ●● ●●● ●●● ●●● ● ● ● ●●● ● ●●● ● maximum = 3 maximum = 2 2 1 s> 10 0 <log −1 −2 2 1 x a m s 0 10 log −1 −2 group 1 group 2 group 3 group 4 group 5 group 6 group 7 group 8 TNF_signaling_pathway genes with data CASP10 CCL2 CCL5 CCL20 CASP7 FADD CXCL1 CXCL1 CXCL1 CASP3 CASP8 CXCL5 CXCL10 CX3CL1 CSF1 CSF2 BIRC2 ITCH CFLAR FAS IL18R1 JAG1 MAP3K5 IL1B IL6 IL15 LIF LTA TAB1 MAP2K7 MAPK8 FOS BCL3 NFKBIA SOCS3 TNFAIP3 TRAF1 TRAF2 MAP3K7 TNF TNFRSF1A TRADD RIPK1 MAP2K3 MAPK14 CEBPB MAP3K8 NFKB1 RPS6KA4 CREB3 BAG4 MAP3K14 MAP2K1 MAPK1 FOS JUN JUNB MMP3 MMP9 MMP14 IKBKB NFKBIA CHUK EDN1 VEGFC IKBKG NFKB1 NOD2 RIPK1 RIPK3 MLKL PGAM5 ICAM1 SELE VCAM1 DNM1L PGAM5 PTGS2 PIK3CA AKT3 NFKB1 MAP3K14 CHUK NFKBIA TRAF1 LTA TNFRSF1B TRAF2 BIRC2 RIPK1 MAP2K3 MAPK14 TRAF3 DAB2IP MAPK8 JUN IRF1 IFNB1 TNF_signaling_pathway sink nodes CASP10 CCL2 CCL5 CCL20 CASP7 FADD CXCL1 CXCL1 CXCL1 CASP3 CASP8 CXCL5 CXCL10 CX3CL1 CSF1 CSF2 BIRC2 ITCH CFLAR FAS IL18R1 JAG1 MAP3K5 IL1B IL6 IL15 LIF LTA TAB1 MAP2K7 MAPK8 FOS BCL3 NFKBIA SOCS3 TNFAIP3 TRAF1 TRAF2 MAP3K7 TNF TNFRSF1A TRADD
    [Show full text]
  • Involvement of Inhibitor Kappa B Kinase 2 (IKK2) in the Regulation of Vascular Tone
    Laboratory Investigation (2018) 98:1311–1319 https://doi.org/10.1038/s41374-018-0061-4 ARTICLE Involvement of inhibitor kappa B kinase 2 (IKK2) in the regulation of vascular tone 1 1 1 1 Youngin Kwon ● Soo-Kyoung Choi ● Seonhee Byeon ● Young-Ho Lee Received: 6 November 2017 / Revised: 22 March 2018 / Accepted: 23 March 2018 / Published online: 21 May 2018 © United States & Canadian Academy of Pathology 2018 Abstract Inhibitor kappa B kinase 2 (IKK2) plays an essential role in the activation of nuclear factor kappa B (NF-kB). Recently, it has been suggested that IKK2 acts as a myosin light chain kinase (MLCK) and contributes to vasoconstriction in mouse aorta. However, the underlying mechanisms are still unknown. Therefore, we investigated whether IKK2 acts as a MLCK or regulates the activity of myosin light chain phosphatase (MLCP). Pressure myograph was used to measure vascular tone in rat mesenteric arteries. Immunofluorescence staining was performed to identify phosphorylation levels of MLC (ser19), MYPT1 (thr853 and thr696) and CPI-17 (thr38). SC-514 (IKK2 inhibitor, 50 μM) induced relaxation in the mesenteric arteries pre-contracted with 70 mM high K+ solution or U-46619 (thromboxane analog, 5 μM). The relaxation induced by SC-514 + 1234567890();,: 1234567890();,: was increased in the arteries pre-contracted with U-46619 compared to arteries pre-contracted with 70 mM high K solution. U-46619-induced contraction was decreased by treatment of SC-514 in the presence of MLCK inhibitor, ML-7 (10 μM). In the absence of intracellular Ca2+, U-46619 still induced contraction, which was decreased by treatment of SC-514.
    [Show full text]
  • The Mtor Substrate S6 Kinase 1 (S6K1)
    The Journal of Neuroscience, July 26, 2017 • 37(30):7079–7095 • 7079 Cellular/Molecular The mTOR Substrate S6 Kinase 1 (S6K1) Is a Negative Regulator of Axon Regeneration and a Potential Drug Target for Central Nervous System Injury X Hassan Al-Ali,1,2,3* Ying Ding,5,6* Tatiana Slepak,1* XWei Wu,5 Yan Sun,5,7 Yania Martinez,1 Xiao-Ming Xu,5 Vance P. Lemmon,1,3 and XJohn L. Bixby1,3,4 1Miami Project to Cure Paralysis, University of Miami Miller School of Medicine, Miami, Florida 33136, 2Peggy and Harold Katz Family Drug Discovery Center, University of Miami Miller School of Medicine, Miami, Florida 33136, 3Department of Neurological Surgery, University of Miami Miller School of Medicine, Miami, Florida 33136, 4Department of Molecular and Cellular Pharmacology, University of Miami Miller School of Medicine, Miami, Florida 33136, 5Spinal Cord and Brain Injury Research Group, Stark Neurosciences Research Institute, Department of Neurological Surgery, Indiana University School of Medicine, Indianapolis, Indiana 46202, 6Department of Histology and Embryology, Zhongshan School of Medicine, Sun Yat-sen University, Guangzhou, Guangdong 510080, China, and 7Department of Anatomy, Histology and Embryology, School of Basic Medical Sciences, Fudan University, Shanghai, 200032, China Themammaliantargetofrapamycin(mTOR)positivelyregulatesaxongrowthinthemammaliancentralnervoussystem(CNS).Althoughaxon regeneration and functional recovery from CNS injuries are typically limited, knockdown or deletion of PTEN, a negative regulator of mTOR, increases mTOR activity and induces robust axon growth and regeneration. It has been suggested that inhibition of S6 kinase 1 (S6K1, gene symbol: RPS6KB1), a prominent mTOR target, would blunt mTOR’s positive effect on axon growth. In contrast to this expectation, we demon- strate that inhibition of S6K1 in CNS neurons promotes neurite outgrowth in vitro by twofold to threefold.
    [Show full text]
  • Microrna‑186‑5P Downregulation Inhibits Osteoarthritis Development by Targeting MAPK1
    MOLECULAR MEDICINE REPORTS 23: 253, 2021 MicroRNA‑186‑5p downregulation inhibits osteoarthritis development by targeting MAPK1 QING LI1, MINGJIE WU1, GUOFANG FANG1, KUANGWEN LI1, WENGANG CUI1, LIANG LI1, XIA LI2, JUNSHENG WANG2 and YANHONG CANG2 1Department of Orthopedics, Shenzhen Hospital of Southern Medical University, Shenzhen, Guangdong 518101; 2Department of Orthopedics, The Second People's Hospital of Huai'an, Huai'an, Jiangsu 223002, P.R. China Received February 26, 2020; Accepted September 11, 2020 DOI: 10.3892/mmr.2021.11892 Abstract. As a chronic degenerative joint disease, the char‑ expression, suggesting that miR‑186‑5p may be used as a acteristics of osteoarthritis (OA) are degeneration of articular potential therapeutic target for OA. cartilage, subchondral bone sclerosis and bone hyperplasia. It has been reported that microRNA (miR)‑186‑5p serves a key Introduction role in the development of various tumors, such as osteosar‑ coma, non‑small‑cell lung cancer cells, glioma and colorectal As a chronic degenerative joint disease, the characteristics cancer. The present study aimed to investigate the effect of of osteoarthritis (OA) are degeneration of articular cartilage, miR‑186‑5p in OA. Different concentrations of IL‑1β were subchondral bone sclerosis and bone hyperplasia (1). OA used to treat the human chondrocyte cell line CHON‑001 affects an estimated 10% of men and 18% of women >60 years to simulate inflammation, and CHON‑001 cell injury was of age, worldwide (2). OA is affected by multiple factors, such assessed by detecting cell viability, apoptosis, caspase‑3 as age, sex, trauma history, obesity, heredity and joint defor‑ activity and the levels of TNF‑α, IL‑8 and IL‑6.
    [Show full text]
  • Upregulation of SLC2A3 Gene and Prognosis in Colorectal Carcinoma
    Kim et al. BMC Cancer (2019) 19:302 https://doi.org/10.1186/s12885-019-5475-x RESEARCH ARTICLE Open Access Upregulation of SLC2A3 gene and prognosis in colorectal carcinoma: analysis of TCGA data Eunyoung Kim1†, Sohee Jung2†, Won Seo Park3, Joon-Hyop Lee4, Rumi Shin5, Seung Chul Heo5, Eun Kyung Choe6, Jae Hyun Lee7, Kwangsoo Kim2* and Young Jun Chai5* Abstract Background: Upregulation of SLC2A genes that encode glucose transporter (GLUT) protein is associated with poor prognosis in many cancers. In colorectal cancer, studies reporting the association between overexpression of GLUT and poor clinical outcomes were flawed by small sample sizes or subjective interpretation of immunohistochemical staining. Here, we analyzed mRNA expressions in all 14 SLC2A genes and evaluated the association with prognosis in colorectal cancer using data from the Cancer Genome Atlas (TCGA) database. Methods: In the present study, we analyzed the expression of SLC2A genes in colorectal cancer and their association with prognosis using data obtained from the TCGA for the discovery sample, and a dataset from the Gene Expression Omnibus for the validation sample. Results: SLC2A3 was significantly associated with overall survival (OS) and disease-free survival (DFS) in both the discovery sample (345 patients) and validation sample (501 patients). High SLC2A3 expression resulted in shorter OS and DFS. In multivariate analyses, high SLC2A3 levels predicted unfavorable OS (adjusted HR 1.95, 95% CI 1.22–3.11; P = 0.005) and were associated with poor DFS (adjusted HR 1.85, 95% CI 1.10–3.12; P = 0.02). Similar results were found in the discovery set.
    [Show full text]