DOCSLIB.ORG

Artificial Mirnas Mitigate Shrna-Mediated Toxicity in the Brain: Implications for the Therapeutic Development of Rnai

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Artificial Mirnas Mitigate Shrna-Mediated Toxicity in the Brain: Implications for the Therapeutic Development of Rnai Artificial miRNAs mitigate shRNA-mediated toxicity in the brain: Implications for the therapeutic development of RNAi Jodi L. McBride*, Ryan L. Boudreau*, Scott Q. Harper*†, Patrick D. Staber*, Alex Mas Monteys*, Ineˆ s Martins*, Brian L. Gilmore*, Haim Burstein‡, Richard W. Peluso‡, Barry Polisky§, Barrie J. Carter‡, and Beverly L. Davidson*¶ʈ** Departments of *Internal Medicine, ¶Molecular Physiology and Biophysics, and ʈNeurology, University of Iowa, Iowa City, IA 52242; ‡Targeted Genetics, 1100 Olive Way, Suite 100, Seattle, WA 98101; and §Sirna Therapeutics, 1700 Owens Street, San Francisco, CA 94158 Communicated by David E. Housman, Massachusetts Institute of Technology, Cambridge, MA, February 27, 2008 (received for review February 10, 2008) Huntington’s disease (HD) is a fatal, dominant neurodegenerative in the setting of two normal mouse HD homolog (HDh) alleles. disease caused by a polyglutamine repeat expansion in exon 1 of Although allele-specific targeting of disease transcripts for HD the HD gene, which encodes the huntingtin protein. We and others therapy would be ideal, to date no prevalent SNP residing on the have shown that RNAi is a candidate therapy for HD because mutant transcript has been identified. Therefore, we undertook expression of inhibitory RNAs targeting mutant human HD trans- studies to identify inhibitory RNAs that would target both mouse genes improved neuropathology and behavioral deficits in HD HDh and human HD transcripts, with the intention of testing the mouse models. Here, we developed shRNAs targeting conserved efficacy of reducing the expression of both alleles in a knockin sequences in human HD and mouse HD homolog (HDh) mRNAs to model of HD (10). Here we describe the surprising finding of initiate preclinical testing in a knockin mouse model of HD. We neurotoxicity in mouse brain caused by some, but not all, shRNA screened 35 shRNAs in vitro and subsequently narrowed our focus expression vectors screened in vivo and the notable reduction in to three candidates for in vivo testing. Unexpectedly, two active toxicity after moving those toxic inhibitory RNAs into miRNA- shRNAs induced significant neurotoxicity in mouse striatum, al- based delivery systems. though HDh mRNA expression was reduced to similar levels by all three. Additionally, a control shRNA containing mismatches also Results induced toxicity, although it did not reduce HDh mRNA expression. shRNAs Cause Striatal Toxicity in Mice. We first designed and Interestingly, the toxic shRNAs generated higher antisense RNA screened shRNAs (driven by the mouse U6 promoter) that target levels, compared with the nontoxic shRNA. These results demon- conserved sequences spanning human HD and mouse HDh strate that the robust levels of antisense RNAs emerging from mRNAs [Fig. 1A and supporting information (SI) Table S1], shRNA expression systems can be problematic in the mouse brain. taking into consideration the most recent siRNA design rules Importantly, when sequences that were toxic in the context of (11–13). Silencing of HD mRNA measured by quantitative shRNAs were placed into artificial microRNA (miRNA) expression real-time PCR (QPCR) and dot blot analysis revealed a decrease systems, molecular and neuropathological readouts of neurotox- in huntingtin protein expression after transfection of shRNA icity were significantly attenuated without compromising mouse expression plasmids into mouse C2C12 and human-derived HEK HDh silencing efficacy. Thus, miRNA-based approaches may pro- 293 cell lines (data not shown). Of the 35 shRNAs tested, three vide more appropriate biological tools for expressing inhibitory were chosen for further study based on silencing efficacy. The RNAs in the brain, the implications of which are crucial to the shRNAs target sequences in exons 2, 8, and 30 of HD mRNAs development of RNAi for both basic biological and therapeutic and are henceforth referred to as sh2.4, sh8.2, and sh30.1, applications. respectively (Fig. 1B). Western blot analysis demonstrated that these shRNAs, but not mismatch (mis) control shRNAs, reduce gene therapy ͉ Huntington’s disease ͉ RNAi ͉ AAV endogenous huntingtin protein expression in mouse C2C12 cells (Fig. 1C). Similar results were seen in human-derived HEK 293 he ability of siRNAs to silence target genes was first demon- cells. Tstrated in 1998 by Andrew Fire et al. (1) and has since emerged To examine the long-term effects of brain-delivered shRNAs in as a revolutionary strategy to reduce target gene expression. RNAi the CAG140 knockin mouse model of HD (10), U6-shRNA occurs naturally in cells as a posttranscriptional regulatory mech- expression cassettes were cloned into adeno-associated viral vectors anism mediated by endogenous miRNAs (2–5). RNAi is hypoth- (AAV serotype 2/1) (Fig. 2A). AAVs also contained a humanized esized to have evolved as a cellular coping mechanism providing the Renilla GFP (hrGFP) expression cassette to identify the distribu- cell a means to decrease the expression of various deleterious tion and types of cells transduced. Five-week-old CAG140 knockin viruses and transposons (6, 7). In recent years, scientists have mice were injected bilaterally into the striatum with AAVsh2.4- coopted this biological process to reduce the expression of target GFP, AAVsh8.2-GFP, AAVsh30.1-GFP, or AAV-GFP (viral con- mRNAs by using exogenously applied siRNAs, shRNAs, or artifi- trol) and killed 15 weeks later. Robust expression of GFP was cial miRNAs. Aside from the widespread basic biological applica- tions of RNAi, the ability to reduce gene expression marks a major Author contributions: J.L.M., R.L.B., and S.Q.H. contributed equally to this work; J.L.M., advance toward the development of disease therapies, particularly R.L.B., S.Q.H., B.P., B.J.C., and B.L.D. designed research; J.L.M., R.L.B., S.Q.H., P.D.S., A.M.M., for dominantly inherited disorders. I.M., B.L.G., H.B., and R.W.P. performed research; J.L.M., R.L.B., S.Q.H., and B.L.D. analyzed Among the dominant diseases that may benefit from RNAi- data; and J.L.M., R.L.B., S.Q.H., and B.L.D. wrote the paper. based therapies is Huntington’s disease (HD). Our laboratory (8) Conflict of interest statement: B.L.D. was a consultant for Sirna Therapeutics, Inc.. and others (9) have previously demonstrated that partial reduction †Present address: Center for Gene Therapy, Department of Pediatrics, Ohio State University, of mutant huntingtin expression by viral delivery of shRNAs is Columbus, OH 43205. efficacious in preventing the development of motor deficits and **To whom correspondence should be addressed. E-mail: [email protected]. neuropathology in transgenic mouse models of HD. In these This article contains supporting information online at www.pnas.org/cgi/content/full/ proof-of-principal studies, the therapeutic effect on disease pheno- 0801775105/DCSupplemental. type was studied by knocking down a mutant human HD transgene © 2008 by The National Academy of Sciences of the USA 5868–5873 ͉ PNAS ͉ April 15, 2008 ͉ vol. 105 ͉ no. 15 www.pnas.org͞cgi͞doi͞10.1073͞pnas.0801775105 Downloaded by guest on September 27, 2021 AAVshRNA-GFP A A ITR ITR 1 2 8 30 U6shRNA TTTT CMV hrGFP polyA B sh2.4 B Anterior U U 5‘ C C GACCGUGUGAAUCAUUGUCUA C CUGGCACACUUAGUAACAGAU U 3‘-UU A G C U striatum striatum striatum striatum sh8.2 U U 5‘ C C CAGCUUGUCCAGGUUUAUGAA C GUCGAACAGGUCCAAAUACUU U 3‘-UU A G striatumglobus pallidus globus pallidus globus pallidus C U C 1.0 sh30.1 U U 5‘ C C GGAUACCUGAAAUCCUGCUUU C 0.8 CCUAUGGACUUUAGGACGAAA U 3‘-UU A G C U 0.6 * * * C 0.4 0.2 Relative HDh mRNA Untreatedsh8.2 sh2.4mis sh30.1 mis sh8.2 missh2.4sh30.1shLacZ 0 huntingtin sh2.4 sh8.2 sh30.1 GFP beta-catenin D GFP sh2.4 sh8.2 sh30.1 Fig. 1. In vitro screening of shRNAs targeting human HD and mouse HDh transcripts. (A) Thirty-five shRNAs (bars above cartoon) targeting conserved sequences (Table S1) spanning human HD and mouse HDh mRNAs were generated with consideration for sequences that promote proper loading of AAVsh8.2-GFP the antisense strands into the RISC. Plasmids expressing U6-driven shRNAs DARPP-32 were transfected into HEK 293 cells, and HD gene silencing was evaluated by QPCR and protein dot blot analyses 48 h after transfection. (B) Three candidate shRNAs targeting sequences in exons 2 (sh2.4), 8 (sh8.2), and 30 (sh30.1) were Iba1 chosen for further study (red bars above cartoon in A). (C) shRNA expression plasmids were transfected into mouse C2C12 cells, and endogenous hunting- Fig. 2. HD shRNAs cause sequence-specific striatal toxicity in mice. (A) tin protein levels were evaluated by Western blot analyses 48 h after trans- Diagram of the recombinant AAV2/1 viral vectors containing shRNA and fection. Mismatch (mis) controls contain 4-bp changes that render the shRNAs hrGFP expression cassettes. (B) Photomicrographs represent the rostral-to- ineffective. ␤-Catenin serves as the loading control. caudal distribution of hrGFP-positive cells in mouse brain after direct injection of virus into the striatum. (Scale bar: 500 ␮m.) (C) QPCR analysis measuring HDh mRNA levels in shRNA-treated mouse striata demonstrates similar silenc- observed in cells throughout the rostral/caudal extent of the stria- ing efficacies among sh2.4, sh8.2, and sh30.1. Mice were injected into the tum and within fibers of the globus pallidus (Fig. 2B). Immuno- striatum with AAVsh2.4-GFP, AAVsh8.2-GFP, AAVsh30.1-GFP, or AAV-GFP, fluorescence analyses indicated that GFP-positive cells colocalized and RNA was harvested 4 months later from GFP-positive striata. All values with a neuronal marker (NeuN), but not with markers for astrocytes were normalized to ␤-actin and are shown relative to AAV-GFP-treated brains.
Load more

Recommended publications
  • Trans-Acting Antisense Rnas Mediate Transcriptional Gene Cosuppression in S
    Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press Trans-acting antisense RNAs mediate transcriptional gene cosuppression in S. cerevisiae Jurgi Camblong,1 Nissrine Beyrouthy, Elisa Guffanti, Guillaume Schlaepfer, Lars M. Steinmetz,2 and Francxoise Stutz3 Department of Cell Biology and NCCR ‘‘Frontiers in Genetics’’ Program, University of Geneva, 1211 Geneva 4, Switzerland Homology-dependent gene silencing, a phenomenon described as cosuppression in plants, depends on siRNAs. We provide evidence that in Saccharomyces cerevisiae, which is missing the RNAi machinery, protein coding gene cosuppression exists. Indeed, introduction of an additional copy of PHO84 on a plasmid or within the genome results in the cosilencing of both the transgene and the endogenous gene. This repression is transcriptional and position-independent and requires trans-acting antisense RNAs. Antisense RNAs induce transcriptional gene silencing both in cis and in trans, and the two pathways differ by the implication of the Hda1/2/3 complex. We also show that trans-silencing is influenced by the Set1 histone methyltransferase, which promotes antisense RNA production. Finally we show that although antisense-mediated cis-silencing occurs in other genes, trans- silencing so far depends on features specific to PHO84. All together our data highlight the importance of noncoding RNAs in mediating RNAi-independent transcriptional gene silencing. [Keywords: Antisense RNA; cis and trans transcriptional gene silencing; PHO84; cosuppression; RNAi-independent TGS; noncoding RNA; S. cerevisiae] Supplemental material is available at http://www.genesdev.org. Received January 15, 2009; revised version accepted May 18, 2009. Eukaryotic gene expression is a complex process regu- recently reported (Camblong et al.
    [Show full text]
  • Exploring the Structure of Long Non-Coding Rnas, J
    IMF YJMBI-63988; No. of pages: 15; 4C: 3, 4, 7, 8, 10 1 2 Rise of the RNA Machines: Exploring the Structure of 3 Long Non-Coding RNAs 4 Irina V. Novikova, Scott P. Hennelly, Chang-Shung Tung and Karissa Y. Sanbonmatsu Q15 6 Los Alamos National Laboratory, Los Alamos, NM 87545, USA 7 Correspondence to Karissa Y. Sanbonmatsu: [email protected] 8 http://dx.doi.org/10.1016/j.jmb.2013.02.030 9 Edited by A. Pyle 1011 12 Abstract 13 Novel, profound and unexpected roles of long non-coding RNAs (lncRNAs) are emerging in critical aspects of 14 gene regulation. Thousands of lncRNAs have been recently discovered in a wide range of mammalian 15 systems, related to development, epigenetics, cancer, brain function and hereditary disease. The structural 16 biology of these lncRNAs presents a brave new RNA world, which may contain a diverse zoo of new 17 architectures and mechanisms. While structural studies of lncRNAs are in their infancy, we describe existing 18 structural data for lncRNAs, as well as crystallographic studies of other RNA machines and their implications 19 for lncRNAs. We also discuss the importance of dynamics in RNA machine mechanism. Determining 20 commonalities between lncRNA systems will help elucidate the evolution and mechanistic role of lncRNAs in 21 disease, creating a structural framework necessary to pursue lncRNA-based therapeutics. 22 © 2013 Published by Elsevier Ltd. 24 23 25 Introduction rather than the exception in the case of eukaryotic 50 organisms. 51 26 RNA is primarily known as an intermediary in gene LncRNAs are defined by the following: (i) lack of 52 11 27 expression between DNA and proteins.
    [Show full text]
  • The Excludon: a New Concept in Bacterial Antisense RNA-Mediated
    Nature Reviews Microbiology | AOP, published online 24 December 2013; doi:10.1038/nrmicro2934 PROGRESS this paradigm in the context of other, better characterized asRNA-mediated regulatory The excludon: a new concept in mechanisms. The excludon concept describes unusually long asRNAs that inhibit the bacterial antisense RNA-mediated expression of one group of genes while enhancing the expression of a second group gene regulation of genes. Thus, single transcripts have the ability to control divergent operons that often have opposing functions. Nina Sesto, Omri Wurtzel, Cristel Archambaud, Rotem Sorek and Pascale Cossart asRNAs in microbial transcriptomes Abstract | In recent years, non-coding RNAs have emerged as key regulators of gene asRNAs are encoded on one strand of the DNA and overlap a gene that is encoded on expression. Among these RNAs, the antisense RNAs (asRNAs) are particularly the opposite strand. Therefore, these cis- abundant, but in most cases the function and mechanism of action for a particular encoded asRNAs have perfect complementa‑ asRNA remains elusive. Here, we highlight a recently discovered paradigm termed rity to the sense transcript from the opposite the excludon, which defines a genomic locus encoding an unusually long asRNA that DNA strand. The regulatory role of asRNAs spans divergent genes or operons with related or opposing functions. Because these was first reported more than 30 years ago, in the case of plasmid- and transposon-encoded asRNAs can inhibit the expression of one operon while functioning as an mRNA for asRNAs in Escherichia coli, when the asRNAs the adjacent operon, they act as fine-tuning regulatory switches in bacteria.
    [Show full text]
  • Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression
    Vol. 1:7-15 Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression Ji, Tom, Lu, Aneka, Wu, Kaylee Department of Microbiology and Immunology, University of British Columbia Regulatory RNA molecules are common tools used in bacterial gene regulation. This paper focuses on the steps in designing an antisense RNA component for insertion into a plasmid in order to silence a gene in the plasmid host cell. By hybridizing to the ribosomal binding site of the target gene mRNA transcript, the antisense RNA transcript from the plasmid is able to inhibit gene translation and lead to eventual mRNA degradation. By regulating or silencing the gene of interest, further experiments could be used to confirm or reject proposed roles for undefined genes. In this paper, wecD silencing using pHN678 plasmid in Escherichia Coli will be used as an example. The design of the antisense RNA component involves three main steps: identification of the gene of interest, selection of the antisense target sequence of the gene, and modification of the target sequence to generate the antisense sequence. In addition, a sense RNA insert could be used as an orientation control in the experiment. The vector plasmid without any sequence insertion should also be included as a negative control. As a result, a successfully designed antisense RNA insert should allow knockdown of the target gene through hybridization to the mRNA transcript and therefore inhibiting gene translation. INTRODUCTION Bacteria possess many diverse means of gene regulation regions containing the ribosomal binding site (RBS) and using RNA molecules. More specifically, RNA the start site of the wecD mRNA.
    [Show full text]
  • Assembly and Function of Gonad-Specific Non-Membranous
    non-coding RNA Review Assembly and Function of Gonad-Specific Non-Membranous Organelles in Drosophila piRNA Biogenesis Shigeki Hirakata and Mikiko C. Siomi * Department of Biological Sciences, Graduate School of Science, The University of Tokyo, Tokyo 113-0032, Japan; [email protected] * Correspondence: [email protected]; Tel.: +81-3-5841-4386 Received: 27 September 2019; Accepted: 4 November 2019; Published: 6 November 2019 Abstract: PIWI-interacting RNAs (piRNAs) are small non-coding RNAs that repress transposons in animal germlines. This protects the genome from the invasive DNA elements. piRNA pathway failures lead to DNA damage, gonadal development defects, and infertility. Thus, the piRNA pathway is indispensable for the continuation of animal life. piRNA-mediated transposon silencing occurs in both the nucleus and cytoplasm while piRNA biogenesis is a solely cytoplasmic event. piRNA production requires a number of proteins, the majority of which localize to non-membranous organelles that specifically appear in the gonads. Other piRNA factors are localized on outer mitochondrial membranes. In situ RNA hybridization experiments show that piRNA precursors are compartmentalized into other non-membranous organelles. In this review, we summarize recent findings about the function of these organelles in the Drosophila piRNA pathway by focusing on their assembly and function. Keywords: PIWI; piRNA; transposon; Yb body; Flam body; Dot COM; nuage; mitochondrion; Drosophila; ovary 1. Introduction piRNAs are 24–35-nucleotide (nt) long non-coding RNAs that specifically associate with members of the PIWI subclade of the Argonaute protein family in a stoichiometric manner [1–7]. The association between PIWI and piRNA produces the piRNA-induced silencing complex (piRISC), the core engine of piRNA-mediated transposon silencing.
    [Show full text]
  • The Specifics of Small Interfering RNA Specificity
    COMMENTARY The specifics of small interfering RNA specificity Andrew Dillin* Molecular and Cell Biology Laboratory, The Salk Institute for Biological Studies, 10010 North Torrey Pines Road, La Jolla, CA 92037 he discovery of transgene silenc- ing in plants and double- stranded RNA (dsRNA) inter- ference in the worm TCaenorhabditis elegans has led to the latest revolution in molecular biology, RNA interference (RNAi). Over 10 years ago it was noted that several trans- genic plant lines each containing the same ectopic transgene not only failed to be expressed but also inhibited the expression of the endogenous gene (1). Similarly, a determined Craig Mello and Andy Fire (2), attempting to reduce gene function using antisense RNA in the worm, discovered a minor contami- nant in their antisense RNA prepara- tions effectively and repeatedly reduced expression of the endogenous gene. In both cases, dsRNA homologous to the gene of interest was responsible for these observations. In the last 4 years, these discoveries have been extended to include protozoa, fungi, and mammals. What is RNAi? RNAi is a highly con- served mechanism found in almost all eukaryotes and believed to serve as an antiviral defense mechanism. The mo- lecular details are becoming clear from combined genetic and biochemical ap- proaches (reviewed in refs. 3 and 4). On entry into the cell, the dsRNA is cleaved by an RNase III like enzyme, Dicer, into small interfering (21- to 23- nt) RNAs (siRNAs) (5–8) (Fig. 1). Bio- chemical evidence indicates the siRNAs are incorporated into a multisubunit protein complex, the RNAi-induced si- Fig. 1.
    [Show full text]
  • Silent Mutations in the Escherichia Coli Ompa Leader Peptide Region
    4778–4782 Nucleic Acids Research, 1998, Vol. 26, No. 20 1998 Oxford University Press Silent mutations in the Escherichia coli ompA leader peptide region strongly affect transcription and translation in vivo Atilio Deana1,*, Ricardo Ehrlich1 and Claude Reiss Centre de Génétique Moléculaire, Laboratoire Structure et Dynamique du Génome, CNRS, F91198 Gif-sur-Yvette, France and 1Sección Bioquímica, Facultad de Ciencias, Iguá 4225, Montevideo 11400, Uruguay Received January 6, 1998; Revised May 18, 1998; Accepted August 26, 1998 ABSTRACT traffic of ribosomes on the mRNA. Accordingly, passage from a segment carrying frequent codons to one carrying rare codons In order to test the effect of silent mutations on the would provide a bottleneck to ribosome traffic and could produce regulation of gene expression, we monitored several jamming, which in turn could reduce the level of gene expression steps of transcription and translation of the ompA and waste part of the cellular resources invested. gene in vivo, in which some or all codons between The ompA gene of E.coli exhibits a strong bias for major codons codons 6 and 14, frequently used in Escherichia coli, and is expressed at a high level (3% of total soluble protein). We had been exchanged for infrequent synonymous focus here on the possible effects due to major to minor codons. Northern blot analysis revealed an up to 4-fold synonymous codon exchanges near the N-terminus of the ompA reduction in the half-life of the mutated messengers and coding sequence. Introduction of slow codons at the very a >10-fold reduction in their steady-state amounts.
    [Show full text]
  • Studies on Natural Antisense Rnas and Micrornas Studies on Natural Antisense Rnas and Micrornas
    Thesis for doctoral degree (Ph.D.) 2007 Thesis for doctoral degree (Ph.D.) 2007 Studies on Natural Antisense RNAs and microRNAs Studies on Natural Antisense RNAs and microRNAs RNAs Antisense Natural on Studies Omid Reza Faridani Omid Reza Faridani From the Programme for Genomics and Bioinformatics Department of Cell and Molecular Biology Karolinska Institutet, Stockholm, Sweden STUDIES ON NATURAL ANTISENSE RNAS AND MICRORNAS Omid Reza Faridani Stockholm 2007 All previously published papers were reproduced with permission from the publisher. Published by Karolinska Institutet. Printed by [name of printer] © Omid Reza Faridani, 2007 ISBN 978-91-7357-412-9 Printed by 2007 Gårdsvägen 4, 169 70 Solna ABSTRACT Regulatory RNAs are found in all kingdoms of life and involved in regulation of gene expression at various steps including RNA splicing, editing, stability, modification, export, translation and chromatin remodelling. A large number of regulatory RNAs have been described recently. Natural antisense RNAs are examples of regulatory RNAs that contain complementary sequences to other transcripts. They can be transcribed in cis from opposing DNA strands at the same locus or in trans from separate loci. Some natural antisense RNAs hybridise to their target RNA, forming double-stranded RNA. MicroRNAs are well known examples of trans acting natural antisense transcripts that partially hybridise to targets. To study regulatory RNAs, appropriate molecular tools are needed. Therefore, in this thesis we developed methods to detect physical RNA::RNA interactions, double-stranded RNA and microRNAs. We next applied these methods in a variety of biological systems. To study physical RNA::RNA interactions in growing cells, we considered the hok/sok toxin–antitoxin plasmid stabilization locus of the R1 plasmid in Escherichia coli as a paradigm.
    [Show full text]
  • IL-4 Inhibits the Biogenesis of an Epigenetically Suppressive PIWI
    IL-4 Inhibits the Biogenesis of an Epigenetically Suppressive PIWI-Interacting RNA To Upregulate CD1a Molecules on Monocytes/Dendritic Cells This information is current as of September 28, 2021. Xue Zhang, Xin He, Chao Liu, Jun Liu, Qifei Hu, Ting Pan, Xiaobing Duan, Bingfeng Liu, Yiwen Zhang, Jingliang Chen, Xingru Ma, Xu Zhang, Haihua Luo and Hui Zhang J Immunol 2016; 196:1591-1603; Prepublished online 11 January 2016; Downloaded from doi: 10.4049/jimmunol.1500805 http://www.jimmunol.org/content/196/4/1591 http://www.jimmunol.org/ Supplementary http://www.jimmunol.org/content/suppl/2016/01/09/jimmunol.150080 Material 5.DCSupplemental References This article cites 49 articles, 17 of which you can access for free at: http://www.jimmunol.org/content/196/4/1591.full#ref-list-1 Why The JI? Submit online. by guest on September 28, 2021 • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606.
    [Show full text]
  • Antisense DNA And
    Downloaded from genesdev.cshlp.org on September 27, 2021 - Published by Cold Spring Harbor Laboratory Press COMMENTARY Antisense DNA and RNA: progress and prospects Using antisense DNA or RNA fragments to block the School of Medicine), to enhance the activity of oligonu­ expression of selected genes, and thereby assess their cleotide methylphosphonates, have prepared derivatives function, is a powerful new tool for the molecular biolo­ that are further modified with psoralen. Irradiation with gist. It is an approach that promises to be particularly 365-nm light results in irreversible cross-linking of the useful in higher eukaryotes, where the genetic tools ap­ oligonucleotide to the target sequence. Such derivatives plicable to yeast and bacteria are not available. There are block protein synthesis very effectively—in in vitro also obvious therapeutic implications in the use of translation systems inhibition occurs in the micromolar antisense inhibition to block the expression of targeted concentration range. Claude Helene (INSERM) described viral genes or oncogenes. Last December a conference at a similar approach in which iron and copper chelate the Banbury Center of Cold Spring Harbor Laboratory complexes were covalently attached to oligonucleotides. explored these aspects of antisense RNA and DNA. In the presence of reducing agents and oxygen, these A number of years before antisense RNA became fash­ complexes generate hydroxyl radicals that cleave the ionable, Paul Zamecnik and Mary Stephenson demon­ complementary strand to which the oligonucleotide is strated the feasibility of using short antisense oligodeoxy- hybridized. This approach has many interesting applica­ nucleotides to block the expression of targeted genes tions in vitro.
    [Show full text]
  • Cell-Free Reconstitution Reveals the Molecular Mechanisms for the Initiation of Secondary Sirna Biogenesis in Plants
    Cell-free reconstitution reveals the molecular mechanisms for the initiation of secondary siRNA biogenesis in plants Yuriki Sakuraia,b,1, Kyungmin Baega,1, Andy Y. W. Lama,b, Keisuke Shojia, Yukihide Tomaria,b,2, and Hiro-oki Iwakawaa,c,2 aInstitute for Quantitative Biosciences, The University of Tokyo, Bunkyo-ku, Tokyo 113-0032, Japan; bDepartment of Computational Biology and Medical Sciences, Graduate School of Frontier Sciences, The University of Tokyo, Bunkyo-ku, Tokyo 113-0032, Japan; and cPrecursory Research for Embryonic Science and Technology (PRESTO), Japan Science and Technology Agency (JST), Saitama 332-0012, Japan Edited by R. Scott Poethig, University of Pennsylvania, Philadelphia, PA, and approved June 23, 2021 (received for review February 11, 2021) Secondary small interfering RNA (siRNA) production, triggered by (1, 2, 12). However, the molecular details of these critical silencing primary small RNA targeting, is critical for proper development and amplification steps are not well understood due to their complexity. antiviral defense in many organisms. RNA-dependent RNA poly- Phased siRNAs (phasiRNAs) are plant secondary siRNAs that merase (RDR) is a key factor in this pathway. However, how RDR regulate development and stress responses. PhasiRNA biogenesis specifically converts the targets of primary small RNAs into double- is triggered by the recruitment of primary miRNA-loaded RISCs, stranded RNA (dsRNA) intermediates remains unclear. Here, we de- the majority of which are 22-nt miRNA-loaded AGO1-RISCs, to velop an in vitro system that allows for dissection of the molecular the phasiRNA generating (PHAS) precursor transcripts (PHAS mechanisms underlying the production of trans-acting siRNAs, a transcripts) (13–15).
    [Show full text]
  • Antisense December 2019
    www.nature.com/collections/antisense December 2019 Antisense RNA Produced by: With support from: Nature Structural & Molecular Biology, Nature Reviews Molecular Cell Biology and Nature Communications MILESTONES IN ANTISENSE RNA RESEARCH 1970s Antisense cellular RNA and synthetic oligonucleotides inhibit mRNA translation (MILESTONE 1) 1990 RNA-mediated post-transcriptional gene silencing (PTGS) in petunia (MILESTONE 2) 1993 microRNAs emerge as novel post-transcriptional regulators of gene expression (MILESTONE 3) 1998 Double-stranded RNA mediates sequence-specific gene silencing in animals (MILESTONE 4) FDA approval of the first antisense oligonucleotide drug (MILESTONE 5) 1999 Small RNAs trigger different types of PTGS in plants (MILESTONE 6) 2000 Elucidation of the molecular mechanism of RNA interference (MILESTONE 7) 2001 First demonstration that small interfering RNAs trigger gene-specific silencing in mammals (MILESTONE 8) Discovery of PIWI-interacting RNAs (piRNAs) (MILESTONE 9) 2002 Advent of plasmid-based gene silencing and large-scale RNA interference screens (MILESTONE 10) 2005 Targeted gene silencing in vivo by antibody-mediated siRNA delivery (MILESTONE 11) 2012 Gene editing by CRISPR–Cas9, from bacteria to humans (MILESTONE 12) 2014 Chemical optimization enables targeted delivery of siRNA drugs to the liver (MILESTONE 13) 2016 FDA approval of an antisense oligonucleotide drug to treat spinal muscular atrophy (MILESTONE 14) 2018 First RNAi-based therapeutic agent approved by the FDA (MILESTONE 15) S4 | DECEMBER 2019 www.nature.com/collections/antisense MILESTONES ‘Waltz of the polypeptides’ by Mara G. Haseltine, Cold Spring Harbor Laboratory, NY, USA. Credit: Ivanka Kamenova / Springer Nature Limited MILESTONE 1 First signs of antisense RNA activity The first reports of antisense RNA activity in to sequestering the inhibitory RNA through replication and oncogenic transformation eukaryotes were published when the efforts base-pairing.
    [Show full text]