HOST-PATHOGEN INTERACTIONS IN PSEUDMONAS AERUGINOSA
INFECTION
By
CHAIRUT CHARLES VAREECHON
Submitted in partial fulfillment of the requirements for the degree of Doctor of
Philosophy
Department of Pathology
CASE WESTERN RESERVE UNIVERSITY
August 2017
Case Western Reserve University
School of Graduate Studies
We hereby approve the thesis/dissertation of
Chairut Charles Vareechon
Candidate for the degree of Doctor of Philosophy in Pathology
Committee Chair:
Man-Sun Sy
Committee Members:
Clive Hamlin
Derek Abbott
Arne Rietsch
Eric Pearlman
Date of Defense:
May 15th, 2017
We also certify that written permission has been obtained for any proprietary
material contained therein
2
Table of Contents
List of Tables………………………………………………………………………….. 6 List of Figures...... 7 Acknowledgements………………………………………………………………….10 List of Abbreviations….….….….….….….….….….….….….….….……….….…11 Abstract….….….….….….….….….….….….….….….….….…....….….….……...14
Chapter 1: Introduction Pseudomonas aeruginosa and Disease………….………...... ….….….18
Pseudomonas aeruginosa Type III Secretion System and Virulence...…19
Targeted cells of the P. aeruginosa T3SS...….….….….….….….….….…19
T3SS the molecular syringe…………………………….……….….…..…...20
The apparatus………………………………………...….………..…..21
The translocon…………………………………………………………22
The secreted effectors……………………………….……………….23
ExoS……………………………….…………………………….24
ExoT……………………….…………………………………….26
ExoU……………….…………………………………………….27
ExoY……….…………………………………………………….28
The chaperones…….………………………………………….…….29
Pseudomonas aeruginosa genome……….………………….………..…..29
Genomic islands………….…………………………………………....……..30
Neutrophils………………………………………………………………….…31
Neutrophil recruitment………………………………………………………..32
Neutrophil Antimicrobial Mechanisms…………………………...…...…….35
Neutrophil Granules………………………………………………….…….…36
Azurophil (Primary) Granules………………………………….……….38
3
Specific (Secondary) Granules…………………………………………38
Gelatinase (Tertiary) Granules…………………………………………39
NADPH oxidase System and ROS………………………………………….40
NADPH oxidase and susceptibility to P. aeruginosa infection……………45
PI3Kγ-mediated activation of ROS production……………………………..46
Neutrophils and Ras…………………………………………………………..47
Bacterial keratitis………………………………………………………………48
Clinical features of Pseudomonas aeruginosa keratitis……………...... 49
P. aeruginosa keratitis and neutrophils……………………………...... 51
Chapter 2: Pseudomonas aeruginosa ExoS inhibits NADPH oxidase assembly and ROS production in human neutrophils through ADP ribosylation of Ras………………………………………………………………………………………53
Abstract…………………………………………………………………………54
Introduction………………………………………………………………….....55
Material and Methods…………………………………………………………57
Results………………………………………………………………………….71
Discussion……………………………………………………………………...82
Supplemental Figures……………………………………………………...... 86
Chapter 3: The ExoU genomic island of strain 19660 modulates type III secretion-dependent virulence…………………………………………….…………………………………90
Abstract…………………………………………………………………………91
Introduction…………………………………………………...………………..92
Material and Methods…………………………………………………………95
4
Results………………………………………………………………………...101
Discussion…………………………………………………………………….115
Supplemental Figure……………………………………………………...... 118
Chapter 4: Data Summary, Future Directions and Preliminary Data……………………………………………………………………………………119
Data Summary……………………………………………………………….120
Future Studies on ADP-ribosylation by ExoS and ExoT (Chapter 2)…..122
Future experiments: Possible additional substrates of ExoS………123
Ezrin, radixin, and moesin………………………………………..123
Potential ADPRT substrate: Ral…………………………………128
Rab5 as a target for ADP-ribosylation…………………………..131
Rap1a as a target for ADP-ribosylation…………………………134
Rac as a substrate for ExoS………………………………..……134
Unknown Substrates………………………………………...……137
Targeted Substrates of ExoT………………………………………….138
CrkI/II as a substrate in neutrophils……………………………..138
Gelsolin as a potential substrate for ExoT…………….…….….140
Unknown Substrates…………………………………….…….….141
Characterization of 14-3-3 Proteins in Neutrophils…………………142
Identify neutrophil PRR that recognize P. aeruginosa……………..143
Future Studies based on Chapter 3………………………………………144
Putative NADH:flavin oxidoreductase and H2O-forming oxidases..145
Pathogenicity island screening………..………………………………147
ExoU and Impairment of Neutrophil Oxidative Burst………………..147
5
Preliminary Data..………………………………………………………….150
References……………………………………………………………………….….151
6
List of Tables
Table 1.1 Type III secretion effector proteins 28
Table 2.1 Reagents and Strains 66
Table 3.1 Strains and plasmids 97
Table 3.2 Primers Used 99
7
List of Figures
Figure 1.1: Type III secretion system of P. aeruginosa….….….…….….….….…20
Figure 1.2: Model of translocon organization and function….…….….….….……23
Figure 1.3: Molecular structures of ExoS, ExoT, ExoU, and ExoY.……………...24
Figure 1.4: Neutrophil extravasation….….….….….….….….….…….….….….….34
Figure 1.5: Microbicidal functions of neutrophil….….….….….….…….….….…...36
Figure 1.6: Granule fusion with the pathogen-containing phagosome....….….…37
Figure 1.7: Neutrophil granule contents and characteristics….….….….….….….40
Figure 1.8: Assembly of NADPH oxidase system….….….….….….…….….……41
Figure 1.9: Structures of cytosolic NADPH oxidase components….…….….…...43
Figure 1.10: p47phox structure and activation….….….….….….….….……..….…..44
Figure 1.11: Clinical characteristics of P. aeruginosa keratitis……………………51
Figure 2.1: NADPH oxidase mediates ROS production by neutrophils and facilitates clearance of P. aeruginosa during bacterial keratitis….………..….…..70
Figure 2.2: ExoS and ExoT ADPRT activities inhibit ROS production in human neutrophils...….….….….….….….….….….….….….….….….….….…..73
Figure 2.3: ExoS and ExoT ADP-ribosyl transferase activities interfere with PI3K signaling in neutrophils….….….….….…………..….….….…..….……..78
Figure 2.4: Tat-Ras(R41K) rescues ROS production in human neutrophils, resulting in increased killing of P. aeruginosa………………………………….…..81
Figure S2.1: NADPH oxidase mediates ROS production by neutrophils facilitate clearance of exoST(A-) strain during bacterial keratitis….….….…...….86
8
Figure S2.2: The type-III secretion system does not affect
initial neutrophil phagocytosis or cell death….….…….…...….….….….….….…..87
Figure S2.3: ROS production in neutrophils infected by the ∆pscD mutant strain requires PI3-kinase, but ExoS ADP-ribosylation does not affect the GTP-Ras/Ras ratio in infected neutrophils…….……....….….88
Figure S2.4: Tat-Ras(R41K) and Tat-GFP do not induce ROS production in human neutrophils, nor does Tat-GFP restore ROS production in infected neutrophils………………………………………………………………………...……89
Figure 3.1: P. aeruginosa strain 19660 has greater virulence than PAO1….…103
Figure 3.2: Corneal virulence of strain 19660 depends on both ExoU and ExoT……………………………….……………………………….………………….105
Figure 3.3: P. aeruginosa 19660 is more virulent than PAO1 when
expressing only ExoT….….….…..….….……………………...….….….….….…..107
Figure 3.4: The ExoU genomic island, though not the putative nitric oxide reductase, confers corneal virulence…….….….….…....….…...…...110
Figure 3.5: The role of NADH-flavin oxidoreductase in P. aeruginosa keratitis……………………………………………………………….112
Figure 3.6: EXB41 is not a secreted effector……………………………..….…...114
Figure S3.1: EXB35 and EXB39 complementation….….….…..….….….….…..119
Figure 4.1: The role of ExoS and ExoT in inhibiting ROS production…..……...121
Figure 4.2: ERM domain structure….….….….….….….….….….….…...….……124
9
Figure 4.3: Proposed model of ERM regulating granule fusion and protein trafficking………….….….……….….….….….….….….….….….….….…128
Figure 4.4: Proposed model of Ral regulating secondary granule mobilization……………………….…………………………………………131
Figure 4.5: Proposed model of Rab5 regulating granule mobilization………….133
Figure 4.6: Rac activation of NADPH oxidase complex….….….….….………...137
Figure 4.7: Proposed model of Crk signaling and ExoT mediated inhibition…..140
Figure 4.8: T3SS-dependent inhibition of granule fusion by strain PAO1……..150
10
Acknowledgements
I want to say thank you to Dr. Trine Jorgensen and Dr. Alan Levine. Your guidance and tough love given during my undergraduate years were instrumental in my decision to pursue a Ph.D. in immunology. The mentorship provided by both of you two will never be forgotten or taken for granted.
I want to say thank you to Dr. Eric Pearlman and Dr. Arne Rietsch for being amazing co-mentors during my Ph.D. I am the scientist I am today because of the training provided by both you two. I will always be thankful for the advice, support, and whiskey you two provided.
Thank you to all my friends and members of the Pearlman and the Rietsch lab for providing support, laughter, and memories throughout the years. Thank you Tatiane Soares De Lima for the support and love these last two years. I would not be a clinical microbiology fellow at Children’s Hospital Los Angeles without your inspiration and persistence.
Lastly, this Ph.D. is dedicated to the Vareechon family. Family is everything. Without my family, I would not have completed this long journey. Mom and Dad, thank you for all the sacrifices that were made to ensure that both of your boys received a higher education and better life opportunities. Giving up a life in Thailand and immigrating to the US with nothing on your backs has paid off. I am indebted to both of you and will always strive to make you two proud. Today, and as always, I am proud to be a Vareechon.
Perge!
11
List of abbreviations
ADPRT - ADP-ribosyl transferase
AIR - auto-inhibitory region
CDC42 - cell division cycle 43
Crk - Ct10 regulator kinase
CF – Cystic Fibrosis
CGD - chronic granulomatous disease
ERM - ezrin, radixin, moesin
GAP - GTPase activating protein
MLD - membrane localization domain
MPO - myeloperoxidase
PAPI-1 - P. aeruginosa pathogenicity island 1
PAPI-2 - P. aeruginosa pathogenicity island 2
PAGI-5 - P. aeruginosa genomic island 5
PB1 - phox and bem1 domain
PI3K - phosphoinositol-3-kinase
PLA2 - phospholipase A2
PRR - proline rich domain
PtdIns(4,5)P2 - phosphatidylinositol 4,5-biphosphate
PtdIns(3,4,5)P3 - phosphatidylinositol 4,5-biphosphate
PX - phox homology domain
RGP- region of genomic plasticity
ROS - reactive oxygen species
SOD - super oxide dismutase
12
T3SS - type III secretion system
TPR - tertricopeptide repeat
13
Host-Pathogen Interactions in Pseudomonas aeruginosa Infection
Abstract
by
CHAIRUT CHARLES VAREECHON
Pseudomonas aeruginosa is a common opportunistic pathogen that is a
major cause of acute infections, such as hospital-acquired pneumonia, blood
stream infections, and microbial keratitis. P. aeruginosa relies on a type III
secretion system (T3SS) to directly inject effector proteins into the cytoplasm of
targeted host cells. These effectors paralyze normal cellular functions, thereby enabling successful establishment of infection. To date four effector proteins
have been described in P. aeruginosa: ExoS, ExoT, ExoU, and ExoY. We
investigated the molecular mechanisms by which ExoS and ExoT impair
neutrophil killing. Furthermore, we studied the role of ExoU in P. aeruginosa
keratitis infection.
Neutrophils are the first responders in bacterial infections and are the
primary target of injection by the T3SS in early stages of P. aeruginosa
infections. Injection of ExoS and ExoT promotes survival of P. aeruginosa murine
keratitis, as well as in neutrophils in vitro. Using peripheral blood human
neutrophils from healthy volunteers, we found that the injection of ExoS or ExoT into the cytoplasm of neutrophils result in inhibition of reactive oxygen species
14
(ROS) production. We demonstrate that P. aeruginosa targets the Ras-mediated
PI3K signaling cascade that is responsible for the assembly of NADPH oxidase complex which leads to ROS production. Specifically, in human neutrophils,
ExoS and ExoT, prevent the phosphorylation of the PI3K associated regulatory kinase Akt and the cytosolic NADPH oxidase component p40phox thereby
rendering both inactive and preventing ROS generation. Importantly, in a murine
model of corneal infection and in vitro, preventing ROS production by neutrophils
lead to increased survival of P. aeruginosa. Our in vitro studies revealed that
ExoS targets Ras for ADP-ribosylation in human neutrophils. ExoS had been
shown previously to ADP-ribosylate Ras in epithelial cells at either Arg41 or
Arg128. Intracellular delivery of a mutated Ras (R41K), which is unable to be
ribosylated at Arg41, rescued ROS production in neutrophils infected with P.
aeruginosa. This increase in ROS production was accompanied by a decrease in
intracellular survival of P. aeruginosa in human neutrophils harboring Ras
(R41K).
Among the effector proteins, ExoU contributes the most to disease
severity, in both the clinic and P. aeruginosa infection models. ExoU is encoded
on a genomic island, provoking the notion that additional virulence factors found
on the island may also contribute to the virulence of ExoU-producing strains.
Using a murine model of keratitis, we found that ExoU expression lowers the
minimal dose required to cause corneal disease. In addition, we found that other
genes on the exoU-genomic island of strain 19660 contribute to the severity of
the infection.
15
In conclusion, our data indicae that P. aeruginosa utilizes its T3SS to inject ExoS into the neutrophil cytoplasm which directly targets Ras. Riboyslation of Ras at Arg41 leads to the inhibition of ROS production and, therefore, increased intracellular survival within the neutrophil. We also demonstrate that exoU and the genes on the ExoU island increases the virulence of strain 19660.
16
Chapter 1: Introduction
17
Pseudomonas aeruginosa and Disease
Pseudomonas aeruginosa is a ubiquitous Gram-negative bacterium
commonly found in soil, water, and plants. P. aeruginosa also is an opportunistic pathogen that is the major cause of nosocomial infections. Most P. aeruginosa nosocomial infections occur in patients with compromised host defenses, including patients with AIDS, cystic fibrosis (CF), neutropenia, cancer, or burn wounds [1-3]. Common infection sites of P. aeruginosa include the respiratory tract, blood, skin, and eye, and can cause bacteremia, pneumonia, microbial keratitis, and dermatitis [4-6]. P. aeruginosa infections demonstrate high mortality rates with cases of nosocomial pneumonia (45-70%) and cases of bacteremia in neutropenic patients (30-50%) having the highest recorded rates [7-9]. Given its adaptation to the respiratory tract, P. aeruginosa is the predominant cause of lung infections in CF patients and of nosocomial ventilator-associated pneumonia
[10, 11]. In addition, P. aeruginosa causes chronic colonization of the airways in
CF patients resulting in airway blockage. In cancer patients, who are neutropenic due to chemotherapy, P. aeruginosa is the most common causative agent of bacteremia [12]. Patients with AIDs or severe burns are also susceptible to bacteremia [13, 14]. P. aeruginosa is the third leading cause of hospital-acquired urinary tract infections and are secondary to urinary tract catheterization or surgery [15, 16]. P. aeruginosa is also the predominant infective agent of ear infections (otitis externa) and corneal infections (bacterial keratitis) [17, 18].
18
Pseudomonas aeruginosa Type III Secretion System and Virulence
P. aeruginosa employs a wide range of virulence determinants to survive and establish infection, including the type III secretion system (T3SS). The T3SS is a molecular syringe composed of more than 20 proteins that allows P. aeruginosa to directly inject effector proteins into the cytoplasm of host cells to modulate cellular functions [19]. Production of a functional T3SS is linked to
increased morbidity and mortality in patients with systemic infections [20-22], and
to ventilator associated pneumonia [23]. Expression of the T3SS in P.
aeruginosa clinical isolates from ventilator-associated pneumonia is associated
with increased bacterial survival, higher relapse rates of infection, and cell death
of immune cells [24]. Furthermore, type III secretion is a crucial virulence factor
in P. aeruginosa animal models of lung infection [25-30], burn wound infection
[31, 32], blood stream infection [30], peritonitis [33] and corneal infections [34,
35].
Targeted Cells of the P. aeruginosa T3SS
Cells targeted by P. aeruginosa T3SS include epithelial cells, endothelial
cells, macrophages and neutrophils [26, 35-37]. Neutrophils play a critical role in
eradicating P. aeruginosa from the lungs during pneumonia and from the cornea
during keratitis, and are the first to arrive at the site of infection [35, 38, 39]. In
both murine corneal infection and acute lung infection models, recruited
neutrophils are targeted for injection by the T3SS [35, 38, 40]. By targeting
neutrophils, the T3SS promotes P. aeruginosa intracellular survival within in the
cell, inhibits antimicrobial activity, and induces cell death [35, 38]. The
19
inactivation of neutrophils by the T3SS results in an immune-suppressed environment in which even non-pathogenic bacteria can thrive [38, 41].
Conversely, T3SS-null mutants are effectively cleared by neutrophils, resulting in decreased severity of disease compared with T3SS+ strains. Notably, enhanced
virulence associated with T3SS expression during early infection in the lung and
eye is virtually absent in the absence of neutrophils. Moreover, P. aeruginosa
does not require the T3SS for survival if neutrophils are not recruited to the site
of infection [35].
T3SS the Molecular Syringe
The T3SS can be functionally divided into five parts: apparatus,
translocon, regulatory proteins, chaperones and effector proteins (Figure 1.1).
Figure 1.1: Type III secretion system of P. aeruginosa
20
The apparatus
The structure and function of the apparatus is conserved among the
different T3SS found in Yersinia spp., Salmonella spp., Shigella spp., and
Chlamydia spp [42]. The apparatus is composed of two parts: a basal apparatus and a needle. The basal apparatus spans across the cytoplasmic membrane, peptidoglycan layer, and outer membrane of P. aeruginosa with the needle protruding from the bacterial surface. The function of the apparatus allows for
T3SS substrates to bypass the bacterial envelope [43-47].
The basal apparatus is composed of an outer membrane ring, inner membrane rings, an inner rod, and elements for protein export. In P. aeruginosa,
PscC (outer membrane ring), PscD (inner membrane ring), PscJ (inner
membrane ring), and Pscl (inner rod) comprise the main structure of the
apparatus [42]. PscU, PcrD, PscR, PscS, and PscT are intracellular proteins associated with the inner membrane, and are critical for secretion of T3SS
substrates.
The needle is a ~60-80 nm hollow tube connected to the basal apparatus
with an inner diameter of ~2-3 nm. Assembly of the needle protein (PscF) is
thought to occur through individual needle proteins interacting and forming a
helical structure through anti-parallel α-helicases. Among other T3SS, the length of the needle can vary from 48-58 nm in Yersinia to 150 nm in S. enterica (SPI-
2). In P. aeruginosa, the needle length is thought to be regulated by PscP as a physical molecular ruler or substrate specificity switch.
21
The translocon
The T3SS translocon is composed of three units: two pore forming
proteins and one protein located at the tip of the needle. In P. aeruginosa, PopB
and PopD are the two pore forming proteins, and PcrV is the needle tip protein
(Figure 1.2). All three proteins are secreted by the T3SS and, collectively, are
essential for accepting secreted substrates from the needle and delivering them
across the host cell plasma membrane and into the cytosol [48-51]. Triggering of
secretion is dependent upon either a physiological stimulus, contact with host
cell, or exposure of the bacteria to Ca2+-depleted medium accompanied by the
presence of certain amino acids such as glutamate [52-54].
The needle tip protein, PcrV, assembles as a multimer at the needle tip,
and is required for the assembly and insertion of PopB and PopD in host cell
membranes [50, 55]. P. aeruginosa strains that are pcrV-null are unable to assemble PopB and PopD and are non-cytotoxic [50, 56]. PopB and PopD interact with each other to form a channel that is responsible for forming a pore in the host cell membrane. Pore formation via the translocon requires both PopB and PopD [50, 57]. The two pore forming proteins differ in size with PopD as the small pore forming protein and the PopB as the large pore forming protein. The estimated inner diameter of PopB/PopD pore in the cell host membrane is ~3-4 nm [58].
PcrV controls effector secretion by constraining the T3SS in an effector secretion off conformation [49]. It is proposed that an unknown trigger results in a conformational change of the translocation pore (PopB/PopD). Through its
22 interaction with the N-terminal domain of PcrV, the structural change in PopD relieves the PcrV mediated constraint on the T3SS allowing for effector secretion
(Figure 1.2).
Figure 1.2: Model of translocon organization and function. A) PopD C- terminal residues 228-274 interact with residues 274-297 of PopB. The N- terminal globular domain of PcrV binds to residues 269-295 of PopD. B) An unknown trigger causes a conformational change in PopB/D which is then transmitted to PcrV. Reprint permission obtained from the publisher.
The Secreted Effectors
Effectors are proteins that are translocated by the T3SS from the bacterial cytoplasm into the host cell cytoplasm. Four effector proteins of P. aeruginosa have been identified: ExoS, ExoT, ExoY, and ExoU [59]. Although almost all P. aeruginosa strains contain the genes to encode the T3SS, most strains do not carry a complete set of genes that encode the effectors. In isolates from acute infections, the exoS gene is found in 58-72% of isolates, the exoT gene in 92-
100%, exoY gene in 89%, and exoU gene in 28-42% [60]. Typically, the effector genes, exoS and exoU, are mutually exclusive such that a strain harboring exoU does not harbor exoS, and vice versa [60] The P. aeruginosa strains used in our studies, PAO1, has three T3SS effectors, ExoS, ExoT, and ExoY whereas, strain
23
19660 has ExoT and ExoU. It remains unclear why majority of strains have either exoS or exoU but not both.
Figure 1.3: Molecular structures of ExoS, ExoT, ExoU, and ExoY. S, secretion signal; CBD, chaperone binding domain; GAP, GTPase activating protein domain; ADPRT, ADP-ribosyl transferase activity
ExoS. ExoS is a bifunctional protein that contains both GTPase activating protein (GAP) and ADP ribosyl transferase (ADPRT) activities (Figures 1.3). At the N-terminus of ExoS, the first 15 amino acids carries the necessary information for its targeting to the T3SS apparatus [61]. Residues 15-51 constitute a binding site for the chaperone SpS [62]. Residues 51-72 contain a leucine-rich motif that forms the membrane localization domain (MLD) and is responsible for the initial localization of ExoS to the host cell plasma membrane
[63]. Plasma membrane localization of ExoS is vital for post-translational modifications of substrates by the GAP and ADPRT activities [64, 65].
24
The GAP domain (aa96-233) of ExoS targets the small GTPases Rac1,
Rho and cell division cycle 42 (CDC42) in the host cell (Table 1.1). Small
GTPases typically switch between an inactive, GDP-bound state, and an active
GTP-bound form. The GAP activity promotes hydrolysis of the GTP-bound
GTPase to a GDP-bound form, thereby, inactivating the activity of the targeted
GTPase [66, 67]. The GAP activity of ExoS results in GDP-bound Rac
predominating, which leads to diminished Rac signaling in murine macrophages
[67, 68]. In addition, the cell actin cytoskeleton of the host cell is disrupted by the
GAP activity of ExoS, resulting in cell rounding [67].
Residues 233-453 form the ADPRT domain of the ExoS [69]. Activation of
the ADPRT activity of ExoS requires eukaryotic co-factor 14-3-3 proteins from
the host cell [70-72]. 14-3-3 proteins are regulatory factors that are involved with
a wide range of eukaryotic cellular functions, including cell cycle and intracellular
trafficking, and bind to the C-terminus of ExoS [73]. The requirement of a co-
factor from the host cell prevents P. aeruginosa from targeting self proteins prior
to ExoS being injected into the host cell. The ADPRT activity of ExoS catalyzes the transfer of a mono-ADP-ribose from NAD+ onto an arginine of the targeted
substrate. Once in the cell, the ADPRT activity of ExoS can promote actin
cytoskeleton disruption, cell death, and inhibit vesicular trafficking, DNA
synthesis, and endocytosis [68, 74-76].
Over twenty substrates can be ADP-ribosylated by ExoS ,including Ras- family proteins, ezrin, radixin, moesin (ERM) proteins, and vimentin (Table 1.1)
[59]. Understanding how ADP-ribosylation of a substrate affects molecular
25
pathways that lead to disrupted cellular functions has been a challenge.
However, studies of the ezrin, radixin, and moesin (ERM) family of proteins, and
the Ras small GTPase have been more fully investigated,. The ERM proteins
bind actin and play an important role in numerous actin processes, such as
motility, adhesion, and phagocytosis. ADP ribosylation of ERM proteins on
specific C-terminal arginines prevents activation of the proteins and consequently
cell rounding [77]. Ras signaling has been linked to cell survival, reactive oxygen
species (ROS) production, cell proliferation, and modifications in the cytoskeletal
structure. The modification of Ras Arg41 with a mono ADP-ribose results in the inhibition of GDP- GTP exchange that is normally catalyzed by a guanine exchange factor (GEF) [78]. As a result, Ras mediated signaling is disrupted due to the protein’s inability to associate with the downstream effector, Raf1 [79]. The importance of ExoS localization was demonstrated when ExoS lacking the MLD was found to localize in the cytosol where is unable to ADP ribosylate membrane bound Ras [64, 80]. The effects of ExoS have been studied primarily in macrophages and epithelial cells, but not in neutrophils.
ExoT. The effector protein ExoT has N-terminal GAP activity and a C- terminal ADPRT activity, and shares a 76% amino acid identity with ExoS
(Figure 1.3). Similar to ExoS, residues 1-50 encode the secretion and chaperone binding information, and residues 51-72 encode the MLD. In addition, like ExoS, residues 78-235 form a GAP domain that targets Rho, Rac, and CDC42 [62].
ExoT GAP activity towards is similar to that of the ExoS , and causes actin
cytoskeleton disruption, cell rounding and inhibits cell division [59].
26
ExoT encodes an ADPRT domain at residues 235-457, and requires binding of host cell cofactor 14-3-3 for activation. Despite those similarities, ExoT
differs from ExoS in regards to targeted host cell substrates. A limited number of
proteins have been identified to be ADP-ribosylated by ExoT: Ct10 regulator of
kinase (Crk) I, CrkII, and phosphoglycerate kinase (Table 1.1). The addition of a
mono ADP-ribose at Arg20 on CrkI interferes with the Crk signaling by preventing
the association of CrkI with the focal adhesion proteins paxillin and p130cas [81].
In epithelial cells and macrophages, disruption of Crk signaling by ExoT has
multiple effects, including blockage of cell division and inhibition of phagocytosis
through disruption of signaling to Rac1 [82]. The effects of ExoT have been
studied primarily in macrophages and epithelial cells, and remain unknown in
neutrophils.
ExoU. ExoU contains a chaperone-binding site in its N-terminus (residues
3-123) and immediately adjacent is a patatin-like domain that confers phospholipase A2 (PLA2) activity (Figure 1.3). The phospholipase activity allows
ExoU to hydrolyze phospholipids to fatty acids and lysophospholipids [83, 84]
resulting in rapid cell death in eukaryotic cells [85] Phospholipase activity of
ExoU is dependent on eukaryotic factors ubiquitin or ubiquitinated proteins [83,
84, 86]. The C-terminus of ExoU contains a MLD (residues 550-687) that targets
the protein to the plasma membrane of the host cell. The C-terminus contains no
other recognizable homologues; however, this region is required for the
phospholipase activity [83, 87].
27
ExoU producing P. aeruginosa strains exhibit greater virulence in murine
models of pneumonia than non-ExoU producing strains [40, 88, 89]. In humans,
P. aeruginosa clinical isolates secreting ExoU are more pathogenic compared to strains lacking ExoU [27, 88, 90]. Moreover, for patients with hospital acquired pneumonia, disease severity and worst clinical outcomes is correlated positively with ExoU-secreting isolates [23].
ExoY.ExoY is a secreted adenylyl cyclase that binds to F-actin for full enzymatic activity [91, 92]. Injection of ExoY into host cells leads to actin cytoskeleton disruption, increased endothelial permeability, and decreased bacterial uptake [91, 93, 94]. However, the significance of ExoY in infection was found to be negligible in murine lung and cornea infection models, indicating that
ExoY is not required for virulence [28, 30, 35].
Table 1.1: Characteristics of P. aeruginosa T3SS effector proteins. GAP, GTPase-activating protein; ADPRT, ADP-ribosyl transferase; Crk, CT10 regulator of kinase. Table adopted from [59]
28
Chaperones
The chaperones of the T3SS facilitate the storage of effector proteins in
the bacterial cytosol and chaperone their delivery to the secretion apparatus.
Chaperone proteins are required for maximal secretion of effector proteins [95]
[96]. Chaperon SpcS associates with effector proteins ExoS and Exot, and SpcU
interacts with ExoU Table 1.1).
P. aeruginosa genome
The genome of P. aeruginosa harbors genetic material that allows it to
survive in most environments and to infect a broad range of hosts, including
insects, nematodes, plants, and mammals [97-99]. The genome contains a high proportion of predicted regulatory genes [100].
Sequencing of strain PAO1 and several clinical isolates have allowed
comparisons of the genomes of different P. aeruginosa strains. The P.
aeruginosa genome includes conserved genomic sequences and has accessory
genetic material throughout. The core genome is defined as genes that are found
in nearly all environmental, clinical, and laboratory P. aeruginosa strains. The
core genome is conserved among strains and comprises ~90% of the total
genome [101]. For example, a comparison of 18 P. aeruginosa strains found that
of the 267 known PAO1 virulence genes. 97% were found in all strains [101]. The
core genome includes genes that encode for proteins involved with adhesion,
motility, the T3SS, antibiotic efflux, transport systems, metabolism, and nutrient
uptake.
29
In contrast, the accessory genome is identified as genes that are not found in all P. aeruginosa strains. These accessory genes are found throughout the core genome but are clustered at specific sites, called regions of genomic plasticity (RGP) [102, 103]. The genetic sequences found at many RGPs are referred to as genomic islands and comprise >10kb. Virulence of P. aeruginosa documented clinically and in animal models varies from strain to strain even though genes of most characterized virulence factors are situated on the core genome [90, 104, 105]. Strain variation in pathogenicity among P. aeruginosa may be attributed to genomic islands within the accessory genome [105].
Genomic Islands
Genomic islands are diverse in structure and function, yet many of them share similar characteristics. Genomic islands are defined as segments of chromosomal DNA that were acquired through horizontal gene transfer [106]. A genomic island can be identified by its G+C content as it often differs from the core genome. For example, P. aeruginosa core genome has a high G+C content
(~66.6%), whereas islands acquired through horizontal gene transfer often have a lower G+C content [107, 108]. Another defining feature is mobile genetic components required for chromosomal integration and excision [108, 109]. These include transposases, integrases, insertion sequences, and direct repeat (DR) sequences. tRNA genes located in specific loci of the core genome are targeted for the insertion of the genomic island, therefore, insertion of a genomic island is often adjacent to core genome tRNA gene.
30
Among P. aeruginosa strains, the genomic islands of the pKLC102/PAGI-
2 family are highly prevalent. Strain variation in pathogenicity among P.
aeruginosa may be attributed to genomic islands within the accessory genome
[105]. Genomic islands that encode virulence factors are classified as
pathogenicity islands. The P. aeruginosa pathogenicity island 1 (PAPI-1), P.
aeruginosa pathogenicity island 2 (PAPI-2), and P. aeruginosa genomic island 5
(PAGI-5) encode virulence factors that confer pathogenicity [103]. For example,
P. aeruginosa PA14 exhibits greater pathogenicity than strain PAO1 in several
infection models, including acute pneumonia and burn wounds [110, 111]. PA14,
but not PAO1, carries the 108-kb PAPI-1 and, the 11-kb PAPI-2 islands [111].
Deletion of PAPI-1 or PAPI-2 resulted in diminished virulence of strain PA14 in
an acute pneumonia model [110], although the mechanisms by which PAPI-1
and PAPI-2 enhance virulence are unknown. In strain PSE9, PAGI-5 is A 99-kb
island that carries two open reading frames (ORFs)(NR-I and NR-II) that are
absent in PAPI-1 [105]. Deletion of either NR-I or NR-II decreased virulence in an acute pneumonia model [105]. Examination of 35 clinical isolates from patients with ventilator-associated pneumonia revealed that strains with PAPI-1 or PAGI-5 had markedly enhanced virulence in a mouse model of acute pneumonia [105].
The P. aeruginosa strain 19660, used in our experiments, contains an
exoU genomic island that is not found in PAO1. The 19660 exoU genomic island
is a 29.85-kbp segment that contains 41 predicted ORFs and has a G+C content
of 56.8% [108]. It is located on the RGP locus 7 and is flanked by the unique
31
20bp TAGI repeat [22]. The role of the exoU genomic island in19660 pathogenicity is addressed in Chapter 3.
Neutrophils
In humans, polymorphonuclear leukocytes (neutrophils, PMN) comprise around 70% of total circulating leukocytes and play a critical role in host defense against invading fungi, protozoa, and bacteria. During an acute infection, neutrophils are the first cells recruited to the site of an infection and are responsible for eliminating pathogens by. The critical role for neutrophils in host defense is highlighted by neutropenic patients who are extremely susceptible to bacterial infections [112].
Neutrophils are multi-lobed granulocytes that develop in the bone marrow, with 1-2x1011 cells generated in a 24 h period [113]. After granulopoiesis, mature neutrophils expressing receptor CXCR4 are retained in the bone marrow via its interaction with the chemokine CXCL12 produced by bone marrow stromal cells
[114]. Patients with mutations in CXCR4 cause neutrophil accumulation in the bone marrow and peripheral neutropenia [115, 116]. The mobilization of mature neutrophils from the bone marrow to the periphery is mediated by CXCR2 ligands. Indeed, the number of circulating neutrophils significantly increases during infection [117, 118]. Neutrophils are short-lived, terminal cells that only circulate for ~6-12 h in the human body [119]. Once in circulation, neutrophils constantly probe the vessel wall searching for activated endothelial cells near the inflammatory site. Upon encountering activated endothelial cells, neutrophils become activated and begin the process to transmigrate to the site of infection.
32
Neutrophil Recruitment
At the site of infection, pathogen-derived and host cell-derived
inflammatory signals stimulate vascular endothelial cells to express adhesion
molecules on their luminal side:, including E-selectin, P-selectin, and ICAM-1
[120]. Circulating, non-activated neutrophils continuously patrol the vessel wall to
encounter stimulated endothelial cells. Due to the confined space of the vessel
and thin vessel wall, postcapillary venules are often where neutrophils find
stimulated endothelial cells and cross [121]. Neutrophils constitutively express
adhesion molecules, including P-selectin glycoprotein ligand-1 (PSGL-1) and L- selectin [122, 123]. The binding of PSGL-1 to P-selectin and E-selectins results in selectin-mediated tethering of neutrophils to the vessel wall. Subsequently, Src family kinases, PI3K, p38 mitogen-activated protein kinase, and Syk are activated as neutrophils roll along the endothelium. Activation of these kinases results in integrin activation and cytoskeletal rearrangements within the neutrophil leading to a firm adhesion state [124, 125].
Mediating firm adhesion of neutrophils to the endothelium are β2 integrins
Mac-1 (CD11b) and LFA-1 on the neutrophil and ICAM-1 and ICAM-2 on the
endothelial cell. As the neutrophil rolls along the endothelium, contact with
endothelial derived selectins, chemoattractants and cytokines result in activation
of β2 integrins [126]. Activated and clustered β2 integrins bind to ICAM-1 on the
endothelial cell thereby stopping rolling and promoting firm adhesion. Once
adhered, continuous stimulation with chemo-attractants and cytokines further activate the neutrophil to produce a leading-edge lamelipodium where chemokine
33 and phagocytic receptors are concentrated. The leading edge is organized by F- actin and controlled by G-protein coupled receptors via signals from phosphoinositol 3 phosphate and Rac [127, 128]. Constant F-actin generation directs the neutrophil to move along chemotactic gradients.
Once firmly adhered, the neutrophil begins to extravasate and migrate towards the site of infection via a chemo-attractant gradient. Transendothelial migration is dependent upon β2 integrins and ICAMs [129]. At endothelial junctions, neutrophils extravasate by squeezing between endothelial cells. Once across the endothelial lining, the neutrophil traverses the basement membrane and continues to follow chemotactic gradients (CXCL1, IL-8, and CXCL2) towards the invading pathogen [130].
Figure 1.4: Neutrophil Extravasation [131] Reprint permission obtained from publisher.
34
Neutrophil Antimicrobial Mechanisms
Once at the site of infection, neutrophils mediate microbe clearance.
Neutrophils possess a wide-array of antimicrobial mechanisms to clear ingested bacteria, fungi, and parasites (Figure 1.5) [132].
Activated neutrophils are highly effective phagocytes that can ingest an opsonized particle within 20s [133]. After receptor mediated phagocytosis, the internalized microbe is confined to an immature phagosome that is benign to the microorganism. To create an environment hostile to the pathogen, the phagosome fuses with granules to undergo phagosome maturation. Following granule fusion, there is delivery of antimicrobial proteins and proteases into the phagosomal lumen. In addition, nicotinamide adenine dinucleotide phosphatase- oxidase (NADPH) components required for reactive oxygen species (ROS) production are incorporated into the phagosome membrane (Figure 1.6).
Chapter 2 examines the effect of the T3SS on NADPH oxidase, which is discussed in detail below. However, additional neutrophil anti-microbial mechanisms are also important, including: neutrophils granules and anti- microbial peptides (AMPs).
35
Figure 1.5: Microbicidal functions of neutrophils [132]. Reprint permission obtained from Macmillan Publishers Ltd.
Neutrophil Granules
The different subsets of granules contained within the neutrophil constitute
an important pool of proteases, antimicrobial proteins, and NADPH oxidase
components. In addition, theses granules carry a wide range of membrane- bound receptors, soluble mediators of inflammation, and extracellular matrix proteins (Figure 1.5) . When neutrophils are activated, exocytosis of granules
occurs. Fusion of the granule membrane with the pathogen-containing
phagosome membrane and release of total granule content into the phagosome
lumen is a process called phagosome maturation (Figure 1.6) Granule fusion with pathogen-containing phagosome is critical for microbial killing.
There are four types of granules in neutrophils: azurophilic, specific, gelatinase, and secretory vesicles [134]. Following neutrophil activation, the granules are mobilized and fuse with either the phagosome or the plasma
36
membrane where they release their contents. In both cases, the granule
membrane becomes a permanent part of the phagosome or plasma membrane,
thereby altering the molecular composition [135]. During activation, the four
classes of granules have different degranulation propensities: secretory vesicles
exocytose first, followed by gelatinase granules, specific granules, and finally, azurophilic granules [136-139].
Figure 1.6: Granule fusion with the pathogen-containing phagosome. 1) Recognition of the microbe triggers phagocytosis. 2) After phagocytosis, the microbe is enclosed in an immature phagosome and granules begin to traffic to the phagosome. 3) Phagosome maturation occurs in which granules fuse with the pathogen-containing phagosome membrane and releases total granule content into the phagosome lumen.
37
Primary (Azurophilic) Granules
Primary granules are the largest (~0.3 µM diameter) and the first to form during neutrophil maturation[140]. These granules are defined by the presence of myeloperoxidase (MPO), an enzyme critical for ROS production [141] Based upon morphological data, a single human neutrophil contains ~1300 azurophilic granules [142]. Primary granules also contain the serine proteases elastase, cathepsin G, and proteinase 3 (Figure 1.7), which play a significant role in killing intracellular and extracellular microbes [143, 144], and in degrading the tissues, thereby limiting dissemination of microbes. These granules also contain alpha defensins, which are 3K-4K Da peptides that exhibit antibacterial activity [145].
Secondary (Specific) Granules
Secondary granules are smaller than primary granules (0.1µM diameter) and contain lactoferrin, which binds and chelates iron and copper (Figure 1.7).
Sequestration of these metals results in antimicrobial activity against Gram- positive and Gram-negative bacteria by starving them of essential metals [146,
147], a process termed nutritional immunity [148]. Secondary granules also contain the antimicrobial compounds neutrophil gelatinase-associated lipocalin
(NGAL), which also chelates iron and lysozyme, which degrades bacterial cell walls and is especially effective for Gram positive bacteria [149]. Moreover, a number of membrane proteins are present in the secondary granule membrane, notably gp91phox/p22phox and CD11b [120, 150]. The membrane protein gp91phox/p22phox is a major component of the NADPH oxidase complex and is
38
further discussed below. The integrin CD11b is critical for mediating neutrophil
extravasation and migration.
Tertiary (Gelatinase) granules
Tertiary granules are the last subset of granules formed during neutrophil
maturation [120]. These granules are smaller than secondary granules, contain
less antimicrobial peptides, and lack MPO. Tertiary granules are defined by their
reservoir of matrix degrading gelatinases and number of other metalloproteases such MMP-9 and MMP-25 (Figure 1.7). Like specific granules, gelatinase
granules house membrane proteins gp91phox/p22phox and CD11b. The importance
of gelatinase and specific granules is highlighted by patients who suffer from
Specific Granule Deficiency (SGD). SGD patients often suffer from severe and
recurrent bacterial infections [151, 152] . Neutrophils from these patients lack expression of both specific granules and gelatinase. As a result, SGD neutrophils are unable to migrate into tissues, limited chemotaxis, impaired receptor upregulation, and thereby have diminished bactericidal activity [153].
39
Figure 1.7: Neutrophil granule contents and characteristics. Reprint permission obtained from
NADPH Oxidase System and ROS
The generation of ROS by neutrophils results from the activation of a
multi-protein enzyme complex known as the NADPH oxidase [154-159], (Figure
1.8). The NADPH oxidase complex is responsible for generating superoxide, but
subsequent biochemical events can convert superoxide into hydrogen peroxide,
hypochlorous acid, hydroxyl radical, singlet oxygen, and nitric oxide [141, 160-
164]. Conversion of superoxide to hydrogen peroxide is through superoxide
dismutase (SOD), and myeloperoxidase from primary granules converts
hydrogen peroxide to hypochlorous acid.
The NADPH oxidase complex comprises five oxidase-specific proteins
(gp91phox, p22phox, p67phox, p47phox, and p40phox) and the GTPase Rac. The cytosolic proteins are p67phox, p47phox, p40phox, and Rac, whereas the membrane
bound components are gp91phox and p22phox [165, 166]. NADPH oxidase
40
assembly is a highly regulated process involving phosphorylation, conformational
changes, and translocation (Figure 1.8). The NADPH oxidase complex is
assembled when cytosolic oxidase proteins translocate to the phagosome or
plasma membrane, and bind to the membrane-bound complex gp91phox/p22phox
[167, 168].
Figure 1.8 Assembly of the NADPH oxidase system.
The membrane components of NADPH oxidase are gp91phox and p22phox,
and exist as a single structure called flavoctyochrome b in a 1:1 stoichiometry.
The gp91phox subunit is the electron transfer chain of the active NADPH oxidase
due to its binding sites for NADPH, FAD and two hemes [169, 170]. The p22phox
subunit contributes to the maturation and stabilization of gp91phox, and its C- terminal cytoplasmic portion has a proline-rich region that is the known target of
41
the SH3 domain of p47phox [171, 172]. In resting cells, 60-70% of flavocytochrome
b is located in the membranes of specific granules, 20-25% is found in the
membranes of gelatinase granules, and the remainder is in the membrane of
secretory vesicles and the plasma membrane [173, 174]. Granule fusion results
in the expression of flavocytochrome b in pathogen-containing phagosomes. The
mechanisms of exocytosis of granule subsets are unclear, although the actin cytoskeleton, ERM proteins, and small-Ras GTPases have been implicated
[175]. Incorporation of gp91phox/p22phox with the phagosome membrane, and the
activation and translocation of p47phox, p67phox, p40phox, and Rac are essential for
optimal NADPH oxidase activation in a neutrophil.
The p47phox protein contains four known domains: N-terminus phox homology (PX) domain, a tandem internal SH3 domain, an auto-inhibitory region
(AIR), and a C-terminus proline rich domain (PRR) (Figure 1.9 and 1.10) [176-
178].
Figure 1.9: Structures of cytosolic NADPH oxidase components. PX, phox homology domain; AIR, auto-inhibitory region; PRR, proline rich domain (PRR); TPR, tertricopeptide repeat; PB1, Phox and Bem domain
42
Two SH3 domains are also found in p67phox in addition to four tertricopeptide
repeat (TPR) domains, an activation domain (AD), a proline-rich domain, and a
Phox and Bem 1 (PB1) domain (Figure 1.8) [179]. The third phox protein found in the cytosol, p40phox, contains one SH3 domain, one PB1 domain, and a single
PX domain (Figure 1.8) [180-183]. The specified domains of the cytosolic components regulate their interaction with each other, and with phospholipids,
membrane NADPH oxidase components, moesin and F-actin [184]. In a resting neutrophil, the three phox proteins exist in the cytoplasm as a trimeric complex with a stoichiometry of 1:1:1 [183]. Translocation of the trimeric complex to the membrane/phagosome is facilitated by p47phox, and in neutrophils from CGD
patients lacking p47phox, p67phox, p40phox, and the GTPase Rac all fail to
translocate to the membrane phagosome when stimulated [185, 186].
Figure 1.10: p47phox structure and activation. In the resting state, the two SH3 domains associate with the C-terminal auto-inhibitory region (AIR) to keep p47phox in an auto-inhibited state. Upon activation, serines in the auto-inhibitory region are phosphorylated inducing a conformational change to p47phox for activation. Permission was obtained from the publisher [184].
When neutrophils are activated, there is extensive phosphorylation of
p47phox on several serines, located in the auto-inhibitory region and in the SH3
43
domain, which results in the unmasking of the tandem SH3 domains on the auto-
inhibitory region [187]. Phosphorylation of p47phox is mediated by protein kinase
C (PKC) and Akt; however, other kinases can phosphorylate p47phox including
IRAK-4 and p21- activated kinase [188-193]. In addition, p40phox and p67phox are
phosphorylated. Phosphorylation of p40phox on threonine 154 is required for full
oxidase activation [194], (Figure 1.9). Once p47phox is phosphorylated and
activated, translocation of the trimeric complex occurs. The actin cytoskeleton
mediates translocation by interacting with p47phox and p40phox [195-198].
Specifically, the PX domains of p40phox and p47phox bind to moesin, which is one
of the ERM family of actin-binding proteins [199]. The p47 PX domain-moesin interaction may be responsible for membrane translocation of the p47phox-p67pox-
p40phox complex as it could mediate association of p47phox to the actin
cytoskeleton [200]. Another study demonstrated that phosphorylated p47phox can bind to F-actin directly and that this interaction may be responsible for translocation [201]. Once the cytosolic complex reaches the membrane/phagosome, the PX domain of p47phox and p40phox can bind to
phosphoinositides tethering the complex to the membrane [202]. In addition, the
SH3 domains of p47phox bind to the proline-rich region of p22phox, and the
activation domain of p67phox binds to gp91phox/p22phox [186]. The GTPase Rac translocates to the membrane/phagosome independently and interacts with p67phox through its TPR domain [203]. Once all components are together, eletron
transfer can begin for generating ROS.
44
NADPH oxidase and susceptibility to P. aeruginosa infections
NADPH mediated ROS is critical for neutrophil antimicrobial activity as
demonstrated in chronic granulomatous disease patients (CGD). CGD patients
have genetic defects in their membrane or cytosolic NADPH oxidase component
resulting in an inactive NADPH oxidase complex. Neutrophils and macrophages
from CGD patients kill microbes poorly as a result of a defective NADPH oxidase,
and patients therefore experience severe, recurrent fungal and bacterial
infections [204]. Indeed, this is applicable to P aeruginosa, as CGD patients are
more susceptible to P. aeruginosa infections. During a 25 year study of pediatric
patients in Spain, it was found that P. aeruginosa was the causal microorganism
in 9% of all infectious episodes [205]. Another group followed 39 patients for 22
years of which they were able to isolate an infectious agent in 151 infectious
episodes. Among Gram-negative microorganisms, Pseudomonas was found to
be the most prevalent, accounting for 9% of all infections (n=151). Furthermore, for pneumonia episodes, clinicians noted that P. aeruginosa was among the most frequently isolated organisms accounting for 20% of pneumonia episodes [206].
Lastly, in another cohort of CGD patients with a bacteremia, Pseudomonas
accounted for 9% of isolated organisms [207].
PI3K-mediated Activation of ROS Production
In neutrophils, class I phosphatidylinositol-3-OH kinases (PI3K) play a
critical role in chemotaxis, secretion, and phagocytosis [208]. Neutrophils
express both class IA PI3K (a p85 family regulatory subunit and either a p110α,
p110β, or p110δ) and class IB PI3K (a p101 or p84 regulatory subunit and a
45
p110γ) [209]. When activated, Class I PI3Ks phosphorylate the membrane lipid
phosphatidylinositol 4,5-biphosphate [PtdIns(4,5)P2] to form phosphatidylinositol
4,5-biphosphate [PtdIns(3,4,5)P3] on the inner leaflet of the plasma / phagocytic
membrane. As a result, effector proteins are recruited that bind to PtdIns(3,4,5)P3
initiating downstream signaling. Effector proteins bind to PtdIns(3,4,5)P3 via a
pleckstrin homology domain (PH) to concentrate at the cytosolic interface of the
membrane. The activity of PI3K is regulated by the phosphatase and tensin
homologue (PTEN) [210].
In neutrophils, PI3Kγ regulates ROS production [211, 212]. Neutrophils
from PI3Kγ-/- mice are unable to generate ROS in response to fMLP or C5a. In addition, lipid kinase activity and PtdIns(3,4,5)P3 production is severly decreased.
PI3Kγ is comprised of a p110γ catalytic subunit [213] and either a p101 [214] or a
p84 adaptor unit. Gβγs activate p101/p110γ in a p101 dependent manner [215],
and conversely PI3Kγ can be activated by GTP-Ras in a p101 independent manner [216].
The p110γ unit of PI3Kγ contains a classical Ras-binding domain (RBD) that binds selectively to the switch I region of GTP-Ras. Crystal structures of p110γ reveal the RBD spans aa206-309 in which five residues are critical for binding to GTP-Ras: T232, K251, K254, K255, and K256 [216]. Neutrophils from mice with a knock-in Ras-insensitive allele of p110γ (all five critical residues
mutated) had significantly less PtdIns(3,4,5)P3, activation of AKT, and ROS
production when stimulated with fMLP or C5a. The p101 regulatory unit that
binds to G-coupled receptor does not mediate oxidative burst, as neutrophils
46 from p101-/- mice have normal production in response to fMLP and C5a [211] In summary, GTP-Ras activation of PI3Kγ is required for NADPH oxidase dependent ROS generation.
Ras in neutrophils
Ras proteins are monomeric GTPases that regulate multiple cellular processes. The mammalian genome contains three Ras genes: H-Ras, K-Ras, and N-Ras [217]. The three Ras proteins are >90% identical, but differ in the hypervariable region (HVR) located in the 20 C-terminal amino acids. The HVR has two signal sequences that allow Ras to associate with the inner leaflet of the plasma membrane. In each Ras protein, the first signal is a CAAX box that is farnesylated, abridged, and carboxymethylated [218, 219]. In K-Ras, the second signal sequence is a polybasic stretch of six lysines, whereas in N-Ras and H-
Ras are modified by palymitoylation.[220]
Ras proteins are 21 kDa guanine nucleotide binding proteins that exist in either GDP-bound, basal state or a GTP-bound, signaling-competent state.
Binding of GTP to the guanine-nucleotide-binding-pocket changes the conformation of the switch I and switch II regions of Ras. This allows Ras to transduce signals by activating effectors with a Ras binding domain. The Ras binding domain interacts with the swith I and II regions of Ras. There are seven effector proteins Ras interacts with: Raf1, PI3K, and a family of Ral-specific guanine nucleotide exchange factors (GEFs).
Guanine nucleotide exchange factors (GEFs) are responsible for loading
GTP onto Ras. There are eight GEFs encoded in the mammalian genome [221].
47
These include two isoforms of Son of sevenless (SOS), four isoforms of Ras- specific guanine-nucleotide releasing protein (RasGRP), and two isoforms of
Ras-specific guanyl-nucleotide-releasing factor (RasGRF). Each GEF contains a
CDC25 homology region that catalyzes removal of GDP [222]. The genetic loss
of RasGRP4 in mouse neutrophils results in loss of GTP-bound Ras when
stimulated with G protein-coupled receptor agonists fMLP, C5a, or LTB4 [223].
Moreover, RasGRP4-/- neutrophils exhibit similar defects as neutrophils from
-/- PI3Kγ mice and Ras-insensitive PI3Kγ mice, including reduced PIP3, Akt
activation, and ROS production. Hence, RasGRP4 and Ras regulate ROS
formation via the RBD of PI3Kγ in neutrophils.
Bacterial Keratitis
Bacterial keratitis is a painful infection of the cornea that occurs in immune
competent individuals and leads to visual impairment or blindness. The pattern of
microbial keratitis differs with geographic region and local climate [224]. On a
global level, predisposing risk factors, incidence of disease, and bacteriological
profile differs between developed and developing countries. Prior to contact lens
usage, a majority of bacterial infection cases were associated with ocular trauma.
Today, in western countries, contact lens wear is the main predisposing factor
leading to bacterial keratitis, whereas trauma to the ocular surface is the major
risk factor in developing countries [224-226]. The difference in risk factors is also
associated with the agricultural-related jobs that are common in developing countries [224]. Incidence of bacterial keratitis in the United States is roughly 11
48 per 100,000 persons; in contrast, a developing country such as Nepal has an incidence of 799 per 100,000 persons [227, 228].
With over 125 million contact lens wearers worldwide, bacterial keratitis has a significant clinical and economic impact. In the US, the annual incidence of ulcerative keratitis in daily-wear soft contact lenses is estimated to be ~4 per
10,000 persons, but ~21 per 10,000 persons using extended-wear soft contact lens [229]. Risk for microbial keratitis is also related to overnight soft contact lens wear. Corneal scrapings from microbial keratitis patients indicate that P. aeruginosa is the predominant bacterial cause in both developed and developing countries [226], and is associated with rapid onset and worse visual prognosis than other bacterial pathogens.
Clinical Features of P. aeruginosa Keratitis
The often-associated clinical features of P. aeruginosa keratitis include a rapid evolution, a corneal epithelial defect, and stromal infiltrate with irregular borders of infiltration beneath the epithelium [230]. This infiltrate often assumes ring formation that may result in corneal perforation. There is typically a “ground glass” appearance to the noninvolved area of the cornea, as well as infiltrates in the anterior chamber (hypopyon) [231]. Corneal scrapings reveal that stromal infiltrates are composed of ~92% neutrophils and ~5% mononuclear cells
(Figure 1.11) [231].
Current treatment strategies involve topical fluoroquinolones
(moxifloxacin) or aminoglycosides (tobramycin). The microbiological response is
49
usually rapid with stromal infiltrate size and stromal necrosis being further
arrested within 24 to 48 hours. Topical corticosteroids are given to limit the tissue
damage and scarring caused by the cellular infiltrate.
Figure 1.11: Clinical characteristics of P. aeruginosa keratitis. A) Representative corneal ulcers of patients with P. aeruginosa. B) Gram staining of corneal ulcer material showing Gram-negative bacilli. C) Wright Giemsa stain of corneal ulcer material from P. aeruginosa patients. D) Percent neutrophils and mononuclear cells in the corneal ulcer. Reprint permission obtained from the publisher.
50
P. aeruginosa Keratitis and Neutrophils
In murine models of P. aeruginosa keratitis, neutrophils comprise the
majority of the cellular infiltrate in the cornea, especially early in infection [35, 39,
232]. The recruitment of neutrophils into the corneal stroma is required for
clearance of P. aeruginosa. Impairment of neutrophil infiltration into the cornea
results in uncontrolled P. aeruginosa growth [35]. Furthermore, in acute lung
models, neutrophils are rapidly recruited upon P. aeruginosa infection and are
essential for preventing P. aeruginosa growth and dissemination [233-235].
Neutrophil recruitment is dependent upon chemokines that are rapidly produced from corneal epithelial cells and stromal macrophages [236, 237]. Initial steps in recognizing P. aeruginosa in the corneal stroma are recognition of bacterial LPS and flagellin by the toll-like receptor 4 (TLR-4) and TLR5 on resident stromal macrophages is required for chemokine production, neutrophil recruitment, and P. aeruginosa clearance as mice that do not express these pathogen recognition molecules exhibit impaired bacterial clearance [237]. In this model, TLR recruits the adaptor molecule MyD88 to the cytoplasmic regions
TLR4 and TLR5, which is essential for NF-kB translocation, and production of chemokines and cytokines. Macrophage production of chemokine CXCL1/KC recruits neutrophils from limbal capillaries to the corneal stoma, and IL-1α and IL-
1β activate the IL-1R1/MyD88 pathway in resident corneal epithelial cells,
macrophages and keratocytes. Activation of these cells promote further
production of chemokines that contribute to neutrophil recruitment. Similarly,
MyD88 and TLR4 are required for chemokine production, neutrophil recruitment,
51 and lower bacterial burden in a mouse model of P. aeruginosa lung infection
[238].
52
Chapter 2: Pseudomonas aeruginosa ExoS inhibits NADPH oxidase assembly and ROS production in human neutrophils through ADP ribosylation of Ras
*Reprint Permission obtained from publisher
53
ABSTRACT
Neutrophils are the first line of defense against bacterial infections, and
the generation of reactive oxygen species is a key part of their arsenal.
Pathogens use detoxification systems to avoid the bactericidal effects of reactive
oxygen species. Here we demonstrate that the Gram-negative pathogen
Pseudomonas aeruginosa is susceptible to reactive oxygen species but actively blocks the reactive oxygen species burst using two type III secreted effector proteins, ExoS and ExoT. ExoS ADP-ribosylates Ras and prevents it from interacting with and activating phosphoinositol-3-kinase (PI3K), which is required to stimulate the phagocytic NADPH-oxidase that generates reactive oxygen species. ExoT also affects PI3K signaling via its ADP-ribosyltransferase activity but does not act directly on Ras. A non-ribosylatable version of Ras restores reactive oxygen species production and results in increased bacterial killing.
These findings demonstrate that subversion of the host innate immune response requires ExoS-mediated ADP-ribosylation of Ras in neutrophils.
54
INTRODUCTION
Neutrophils are essential immune cells that are rapidly recruited to sites of
bacterial infection and are critical for host defense [239]. Bacteria avoid killing by neutrophils, by inhibiting phagocytosis [240, 241], escaping the phagosome, detoxifying reactive oxygen species [242], resisting antimicrobial peptides [243],
degrading NETs [244], or killing neutrophils recruited to the site of infection [35].
Pseudomonas aeruginosa is a major cause of acute, hospital-acquired infections and microbial keratitis, as well as chronic lung infections in cystic fibrosis patients [4, 5, 245]. P. aeruginosa has a type III secretion system (T3SS),
which is a molecular syringe that allows the bacterium to directly inject effector
proteins into the cytoplasm of host cells. Type III secretion is linked to increased
patient morbidity and mortality in ventilator associated pneumonia and blood
stream infections [21, 23]. The T3SS is likewise a crucial virulence factor in
animal models of pulmonary and corneal infections, and primarily targets
neutrophils [27, 28, 35, 40].
P. aeruginosa has four effector proteins at its disposal. Almost all P. aeruginosa strains produce ExoT, whereas ExoS and ExoU are for the most part distributed in a mutually exclusive manner, with the majority of strains producing
ExoS [60, 246]. A fourth effector, ExoY, appears to play only a minimal role in
infection [28, 35]. ExoS and ExoT are closely related (76% amino acid identity), hetero-bifunctional enzymes, with amino-terminal Rho-GAP and C-terminal ADP-
ribosyltransferase activities [247]. In animal models of infection, the survival
benefit of having a type III secretion system can be attributed almost entirely to
55 the ADP-ribosyltransferase activities of these two effector proteins [35, 89].
However, the molecular mechanism by which ExoS and ExoT prevent clearance by neutrophils remains an open question.
Here we demonstrate that ExoS and ExoT disrupt the signaling pathway responsible for activation and assembly of the phagocytic NADPH oxidase
(PHOX). Blocking ROS production is linked to survival in neutrophils in vitro, and in a mouse model of corneal infection. Moreover, we present evidence that ExoS interferes with ROS production by ADP-ribosylating Ras. This modification prevents binding of Ras to, and activation of phosphoinositol-3-kinase (PI3K), which is required ROS production.
56
MATERIAL and METHODS
Bacterial strains and Culture Conditions
All strains and plasmids used in this study have been described previously and are listed in the Key Resources Table. P. aeruginosa was cultured in high salt LB to mid-log (10 g of tryptone, 5 g of yeast extract, and 11.7 g of NaCl per L, supplemented with 10 mM MgCl2 and 0.5 mM CaCl2) with 5mM EGTA to induce production of the T3SS [54].
In vivo model of corneal infection
Five week old female C57BL/6 and Cybbtm1Din (gp91-/-) mice were purchased from Jackson Laboratory. Mice were anesthetized by i.p. injection of
0.4 ml 2,2,2-tribromoethanol (1.2%). Three parallel 1-mm–long abrasions in the central cornea were applied using a 26-gauge needle, and a 2.5-μl aliquot containing 105 bacteria was placed on the corneal surface as described [237].
Images of corneal opacity were taken at 24hr post infection. At 24hrs post infection whole eyes were homogenized using a Mixer Mill MM300 (Retsch) at 33
Hz for 4 min. Serial log dilutions were plated onto brain heart infusion agar plates
(BD Biosciences), and CFU were determined after overnight incubation at 37°C.
Eyes from control mice were homogenized at 2 hours post infection to determine the starting inoculum. Quantification of corneal opacity, histology- and immunohistochemistry methods are outlined below.
57
Corneal opacity quantification
Corneal opacity was quantified as previously described [35, 248]. Mouse
corneas were illuminated using a gooseneck fiber optic light source and constant
light levels were maintained during image acquisition. Twenty-four-bit color images were captured with a SPOT RTKE camera (Diagnostic Instruments) connected to a Leica MZF III stereo microscope. Image analysis was performed using Metamorph Imaging software (Molecular Devices). All images were captured using the same exposure time. Naïve mice were used to acquire images of the iris and these images were used to generate a color threshold for the iris. This iris color threshold was then applied to the experimental images and set to an intensity of zero thus effectively eliminating the iris from the subsequent analysis process. To eliminate areas of reflective glare on experimental images saturated pixels were identified and then set to zero thus eliminating these pixels from the subsequent analysis. A circular region of constant area was applied to the modified experimental image and centered on the cornea. Integrated intensity values were then obtained from within the circular region and recorded as the opacity value for each mouse cornea. More opaque corneas display a greater value of integrated intensity when compared to less opaque corneas.
Histology and immunohistochemistry
Whole eyes were fixed in 10% phosphate buffered formalin, paraffin embedded, and sectioned. For immunohistochemistry, sections were treated with proteinase K (DakoCytomation) and blocked in 1.5% serum. Corneal sections
58
were stained with anti-mouse neutrophil antibody NIMP-R14 (20 μg/ml), followed by staining with Alexa Fluor 488 goat anti-rat IgG (1:1000, Life Technologies), and DAPI (Life Technologies). Hematoxylin and eosin (H&E) staining was performed by the Case Western Reserve University Visual Science Research
Center histology core.
ROS measurement
Human neutrophils were incubated with 500µM luminol (Sigma), 50U of superoxide dismutase (SOD) (Sigma), and 2,000U catalase (Milipore) for 15 minutes. Cell were then dispensed into black-wall 96 well plates with an optically clear bottom (CoStar 3720) and infected with Pseudomonas aeruginosa at MOI
30. Chemiluminescence was measured every 2 minutes for 90 minutes (Synergy
HT; Biotek).
Isolation of peripheral blood neutrophils.
Human neutrophils were isolated from normal, healthy donors by Ficoll-
Paque Plus (GE Healthcare) density centrifugation. Peripheral blood (20 ml) was obtained and layered onto 3% dextran in PBS (Sigma-Aldrich). Red blood cells
(RBCs) were separated from whole blood via incubation at 1xg for 20 minutes.
The top clear layer containing leukocytes was overlaid onto 10ml of Ficoll-Paque
Plus in a fresh 50-ml conical tube. The cell suspension was centrifuged at 500xg
for 20 minutes at 4°C to separate mononuclear cells from neutrophils and the
remaining RBCs. The overlying plasma and monocyte layers were aspirated, and
the neutrophil/RBC pellet was re-suspended in RBC Lysis Buffer (eBioscience)
59
(8.3 g NH4Cl, 1 g KHCO3, 0.09 g EDTA/1 l ddH2O), incubated at 37°C for 10
minutes to lyse remaining RBCs, and spun at 300xg for 5 minutes at 4°C. The
lysis procedure was repeated as needed to obtain sufficient rbc lysis in cell
preparations. Subsequently, cells were washed twice in PBS and re-suspended
in RPMI1640 plus l-glutamine without phenol red (Hyclone). The neutrophil cell
suspension was counted using a hemocytometer, and samples were collected by
Cytospin and stained by Wright-Giemsa (Fisher). Using this approach, neutrophils were routinely found to be greater than 97% of the final cell preparation. Donor population is composed of 60% female and 40% male with ages ranging from 22-60 years old.
Western Blot analysis
Cells were lysed in ice-cold lysis buffer (Cell Signaling Technology), 1mM phenylmethylsulfonyl fluoride (PMSF), and protease inhibitor cocktail (Cell
Signaling Technology). Cell lysate were cleared by rapid centrifugation for 5 min at 4° C. Equal amounts of proteins were separated by SDS-PAGE on a 10% or
12% polyacrylamide gel (Bio-Rad), transferred to polyvinylidene difluoride
(PVDF) membrane, blocked with 5% BSA (Fisher, Pittsburgh PA) in TBS-T (25 mM Tris, 0.15M NaCl, 0.05% Tween-20, pH 7.5). Primary antibodies were detected using horseradish peroxidase (HRP)-conjugated secondary antibodies and a chemiluminescent detection reagent (Western Bright Quantum
[Advansta]). Antibodies to pAkt, Akt, p-p40phox, Ras and GRB2 were purchased from Cell Signaling Technology and p40phox from Santa Cruz Biotechnology.
Blots were imaged using a GE ImageQuant LAS 4000 digital imaging system.
60
Scanned images were processed for brightness and contrast using only the
levels function of Adobe Photoshop applied to the entire image before cropping.
Ras activity assay of neutrophils
GTP-loaded Ras was quantified by GST-Raf-RBD pull-down assay (Cell
Signaling Technology). Human neutrophils (1x107 cells) were incubated with P.
aeruginosa (MOI 30) for 25 min in serum-free RPMI 1640 at 37 ºC. Cells were then centrifuged and lysed in ice-cold lysis buffer (Cell Signaling Technology),
1mM phenylmethylsulfonyl fluoride (PMSF), and protease inhibitor cocktail (Cell
Signaling Technology). The cell lysate was obtained following rapid centrifugation for 5 min at 4° C. Equal amounts of cell lysate were incubated with GST-Raf-
RBD and glutathione agarose beads for 1.5 h at 4ºC with light shaking. Bound
proteins were washed 3x with ice-cold lysis buffer, eluted with SDS sample
buffer, boiled at 95 C for 5 min, and detected by Western blot.
Tat fusion protein production
BL21 pET28b-Tat-Ras (strain RE9356) and BL21 pET28b-Tat-Ras (R41K)
(strain RE9357) were grown overnight in 5ml LB (10 g of tryptone, 5 g of yeast
extract, 10g NaCl per liter) with kanamycin (50µg/ml) and chloramphenicol
(30µg/ml). The overnight cultures were diluted 1:250 into 1L of 2xYT (16g
tryptone, 10g yeast extract, 5g NaCl, and 1ml 1M NaOH per liter) and grown at
37°C with shaking to mid-logarithmic phase. Expression was then induced with
100µM IPTG and cultures were incubated overnight at room temperature with
shaking. Bacteria were pelleted (10 minutes at 7000 RPM) and re-suspended in
100ml sonication buffer (20mM Tris pH 7.4, 5mM MgCl2, 200mM NaCl, 0.5mM
61
DTT, and 1mM PMSF). 50ml aliquots were centrifuged again, the supernatant
discarded, and each cell pellet was re-suspended in 20ml chilled sonication
buffer. An aliquot was divided into four 15ml conical tubes and sonicated on ice
for 8 minutes (30 sec on, 30sec off).
Pooled lysates were centrifuged for 10 minutes at 7000RPM and
supernatants were moved to 20ml BioRad Econo-Pac chromatography column
(BioRad). After washing 3x with sonication buffer, 500µl of Ni-NTA beads
(Qiagen) were added to the supernatant, and place on a rocker at 4°C for 2hrs.
The flow through fraction was collected and beads were washed 3x with wash
buffer (20mM Tris pH 7.4, 5mM MgCl2, 200mM NaCl, 0.5mM DTT, and 10%
glycerol). Bound protein was eluted with 3x1ml elution buffer (wash buffer
supplemented with 200mM Imidazole + 1mM GDP), and then 1ml elution buffer
containing 500mM Imidazole.
Purified Tat-fusion proteins were dialyzed in G-Bioscience Tube-O-Lyzers
(Medi, 8K MWCO) against RPMI1640 plus L-glutamine without phenol red
(Hyclone) at 4°C with stirring. For each 4ml of eluted protein, the first dialysis step was against 500mL RPMI1640 for one hour after which the tubes were moved to a second, overnight dialysis step against fresh 500ml RPMI1640. The protein solution was removed from the Tube-O-Lyzer, syringe filtered, and 1mM
GDP was added. The protein sample was then moved to an Amicon Ultra-4
Centrifugal Filter unit (Regenerated cellulose, 3,000 NMWL, Milipore) and centrifuged at 4500RPM at 4C until the sample was concentrated to 200µl. The protein concentration was determined by Bradford protein assay (BioRad) and
62
samples stored at 4°C. All Tat-fusion proteins contain a human influenza hemagglutinin (HA) tag.
GTP-Loading of Ras
Purified HA-Tat-Ras and HA-Tat-R41K Ras were diluted in 100ul GTP buffer (10mM Tris pH 7.5, 20mM NaCl) to a final concentration of 10µM. 2mM of non-hydrolysable GTP was added and incubated for 45 minutes at room temperature. GTP loaded Ras was stored at 4°C.
In vitro ADP-ribosylation of Ras
HA-agarose beads (Sigma Aldrich) were blocked in 5% BSA Kinase buffer
(50mM HEPES pH 7.4, 150mM NaCl, 5mM EDTA, 5mM dithiothreitol, 10mM
MgCl2, 0.01% Triton X-100) for one hour at 4°C. 1.6µM purified GTP-HA-Tat-Ras
or GTP-HA-Tat-R41K Ras were added and incubated for two hours at 4°C with
rocking. HA-agarose beads were centrifuged at 1000 RPM for one minute,
washed with 1ml kinase buffer, centrifuged again, and the supernatant was
removed using a 30-gauge needle. Beads were then re-suspended in 80µl 5%
BSA kinase buffer and divided into two separate tubes. 0.8µM purified ExoS,
200µM NAD (Sigma-Aldrich), and 3.2µM human recombinant 14-3-3 zeta
(Sigma-Aldrich) were added to ADP-ribosylate Ras where indicated. Samples of
un-modified Ras and ADP-ribosylated Ras were brought up to a final volume of
100ul with kinase buffer. The tubes were then placed in the dark with end over
63 end mixing and incubated with for 6.5 hours at room temperature. After incubation, tubes were stored in 4°C.
Cell-free PI3Kγ affinity assay
Unmodified and ADP-ribosylated Ras and R41K Ras were mixed with
0.08µM purified PI3Kγ (SignalChem) in a total volume of 500µl. Tubes were then placed on a rocker to incubate for 30 minutes at room temperature, then at in 4°C for an additional 30 minutes. Mixtures were washed 5x at 1000RPM for one minute with 1ml ice cold kinase buffer. After washing, residual kinase buffer was removed with a 30-gauge needle, beads were re-suspended in 1x sample buffer, and boiled at 95°C for five minutes.
Proteinase K protection assay
Human neutrophils (1x106) were incubated in 1ml serum-free RPMI 1640 with 0.01, 0.03, 0.1, 0.3, 1, or 3µM Tat-Ras(R41K) for 30 min. Cells were then pelleted at 300g for five minutes and supernatants were aspirated. Samples were re-suspended in 100ul of 1xPBS and incubated for 15 minutes at room temperature in the presence of 250µg/ml proteinase K and, where indicated,
0.1% triton X-100 (final). Proteinase K was inactivated through the addition of phenylmethane sulfonyl fluoride (PMSF, 1mM for 5 min at room temperature), samples were mixed with SDS sample buffer and boiled.
In vitro neutrophil survival assay
Human neutrophils (1x107) were incubated in 2ml serum-free RPMI 1640 at 37ºC with 3x108 bacteria for 15 min, media was replaced with RPMI1640
64
containing 400µg/ml gentamicin and incubated for an additional 30 minutes to kill
extracellular bacteria. Cells were subsequently washed twice with 1xPBS and
immediately lysed using 0.1% Triton X-100 (Sigma-Aldrich). Surviving CFU were quantified by serial log dilutions, plated on LB plates.
Bacterial Uptake by Human Neutrophils
GFP+ P. aeruginosa were cultured in high salt LB (10 g of tryptone, 5 g of
yeast extract, and 11.7 g of NaCl per L, supplemented with 10 mM MgCl2 and 0.5
mM CaCl2) with 5mM EGTA to induce production of the T3SS. Bacteria were
then pelleted and re-suspended in 1ml PBS containing 0.5mg/ml
sulfosuccinimidyl-6-(biotinamido) hexanoate (Sulfo-NHS-LC-Biotin, Fisher) to a
final concentration of 2x109 cells/ml. P aeruginosa were incubated at room temperature with end over end mixing for one hour, after which, the bacteria were pelleted at 14,000 RPM for 5 minutes, washed twice with 1xPBS, and re- suspended in 1xPBS. Human neutrophils (1x106) were incubated with 3x107
bacteria for 15 min in 2ml serum-free RPMI at 37ºC and then washed 3x with
PBS. Neutrophils were fixed with 4% paraformaldehyde, stained with a 1:20 dilution of streptavidin-APC (eBioscience) for one hour, washed 3x with PBS, and re-suspended in incubation buffer (0.5% BSA in 1xPBS). Cells were analyzed on an Accuri C6 flow cytometer (BD Bioscience). Gating was based upon uninfected human neutrophils subjected to the same staining protocol.
Quantification and Statistical Analysis
Experimental data analyzed for significance were from at least three independent experiments using GraphPad Prism. The statistical test used is
65
indicated in the figure legends. Statistical significance was defined as p<0.05. N
represents animals, human donor, or experimental replicates, and is specified in
the figure legends. We assumed a Gaussian distribution for our data.
Accordingly, statistical significance was determined by using 1-way ANOVA with
Bonferroni correction for multiple comparisons, and data are reported as mean
with standard deviation. The one exception to this are the animal experiments,
which can include outliers and therefore not follow a Gaussian distribution. These
experiments were analyzed using a non-parametric, Kruskal-Wallis test, with
Dunn’s multiple comparison correction. In these experiments, we reported median and interquartile range, since these are less vulnerable to skewing by outliers.
Experimental Model and Subject Details
Mice were housed and maintained according to institutional guidelines and the
Association for Research in Vision and Ophthalmology Statement for the Use of
Animals in Ophthalmic and Vision Research. The corneal infection protocol was
approved by the CWRU Institutional Animal Care and Use Committee [protocols
#2012-0105 (E.P.) and #2013-0055 (A.R.)], as well as at the University of
California, Irvine, [protocol #2016-3200-0 (E.P.)]. The protocol for the use of
human peripheral blood from normal healthy volunteers was approved by the
Institutional Review Board of University Hospitals of Cleveland (protocol 01-15-
43). Informed consent was obtained from each volunteer.
66
Bacterial Strains PAO1F (wild-type PAO1) [249] RP1831 PAO1F ΔpscD [35] RP1903 PAO1F ΔexoS [35] RP1883 PAO1F ΔexoT [35] RP1945 PAO1F ΔexoST [35] RP1947 PAO1F ΔexoS ΔexoT ΔexoY (Δ3TOX) [51] RP1949 PAO1F ΔpopBD [35] RP2750 PAO1F exoS(ADPR-) [35] RP5481 PAO1F exoT(ADPR-) [35] RP6202 PAO1F exoS(GAP-) exoT(GAP-) [35] RP6203 PAO1F exoS(ADPR-) exoT(ADPR-) [35] RP6205 pP25-GFPo constitutive GFP producing plasmid, [250] N/A CarbR BL21/pET28b-TAT-Ras This study RE9356 BL21/ pET28b-TAT-Ras(R41K) This study RE9357 Table 2.1 Strains and plasmids
67
RESULTS
NADPH oxidase is required for P. aeruginosa clearance
Neutrophils are the predominant immune cells in P. aeruginosa infections
[38]. A key feature of their antimicrobial arsenal is the generation of reactive
oxygen species (ROS). We assessed the role of ROS in clearing P. aeruginosa
infections using mice that are unable to generate ROS due to a mutation in the
NADPH oxidase gp91phox subunit, a mouse model of chronic granulomatous
disease [251]. Corneas of C57BL/6 and gp91phox-/- mice were infected with wild-
type P. aeruginosa (PAO1) that produce ExoS, ExoT, and ExoY, or with a mutant
strain that lacks the essential T3SS inner membrane component PscD (∆pscD),
and therefore cannot assemble a functional T3SS. Corneal opacification resulting
from infiltration of neutrophils into the cornea [35], and bacterial load (colony
forming units, CFU) were quantified after 24h.
Figure 2.1A shows pronounced corneal opacification in representative
C57BL/6 mice infected with the parental P. aeruginosa strain PAO1, but not in
mice infected with the ∆pscD T3SS null mutant bacteria. In contrast, corneas of gp91phox-/- mice infected with the ∆pscD mutant strain exhibited severe corneal
opacification (Figure 2.1A and B). Consistent with the corneal opacification data,
we recovered significantly more PAO1 than the ∆pscD mutant bacteria from
infected C57BL/6 mouse corneas (Figure 2.1C), indicating that the ∆pscD
mutant bacteria were being cleared. However, in infected gp91phox-/- corneas,
CFU of both the PAO1 and ∆pscD strains were equivalent (no statistical
difference). Similar results were obtained with an exoST(A-) strain in which the
68
ADPRT activities of both ExoS and ExoT are inactivated (Figure S2.1). Figures
2.1D and E show the presence of neutrophils in the corneal stroma of infected gp91phox-/- mice, indicating that there is no defect in neutrophil recruitment in these mice. ROS production is therefore required for bacterial clearance, and the data suggest that the T3SS promotes bacterial survival by inhibiting ROS production by neutrophils.
69
Figure 2.1: NADPH oxidase mediates ROS production by neutrophils and facilitates clearance of P. aeruginosa during bacterial keratitis. (A) Representative images of corneal opacification 24 h post-infection of C57BL/6 and gp91phox -/- (CGD) mice infected with 1x105 CFU PAO1 (WT) or with the ΔpscD (T3SS null) mutant strain. (B) Quantification of corneal opacity by determining average pixel intensity of corneas from five infected mice as described previously [35]. (C) Colony forming units (CFU) recovered from infected corneas 24 h post-infection. (D) Corneal sections were stained with hematoxylin and eosin, or (E) 4’,6-Diamidino-2-Phenylindole dye (DAPI, Blue) and an antibody to Ly6G (NIMP-R14, FITC, green) (Epi: epithelium, Str: stroma, End: corneal endothelium, AC: anterior chamber). B, C: Data points represent individual corneas. Median and interquartile range are indicated. Significance was calculated using the Kruskal-Wallis test, with Dunn’s multiple comparison correction. * p<0.05, **p<0.01, ***p<0.001, or n.s., not significant. See also Figure S2.1.
70
Neutrophil ROS inhibition is mediated by the ADPRT activities of ExoS and ExoT
To assess if the P. aeruginosa T3SS inhibits neutrophil ROS production,
peripheral blood neutrophils from healthy volunteers were infected with PAO1 or
with the T3SS null mutant strain (∆pscD), and ROS production was measured.
Neutrophils infected with the ∆pscD mutant strain exhibited robust production of
reactive oxygen species compared with wild type PAO1 (Figure 2.2A), indicating that P. aeruginosa is able to directly inhibit ROS production in neutrophils in a
T3SS-dependent manner. The decrease in ROS production was not due to a defect in phagocytic uptake of PAO1, since uptake of wild-type and T3SS-null
mutant P. aeruginosa was equivalent under the conditions of this assay (Figure
S2.2A). In addition, the T3SS did not induce neutrophil lysis over the course of
the experiment (Figure S2.2B).
We also examined neutrophils infected with a strain that has the intact
needle structure, but lacks the effector molecules ExoS, ExoT, and ExoY
(∆3TOX). While initial ROS production by neutrophils infected with the ∆3TOX or
ΔexoST strain was similar to that seen in neutrophils infected by the ∆pscD
mutant, ROS production decreased more rapidly (Figure 2.2A), suggesting that
formation of pores in the phagosome membrane by the translocation apparatus
interferes with ROS production. Similarly, the pore-forming toxin streptolysin O
was shown to blunt ROS production in Streptococcus pyogenes infected
neutrophils [252]. In support of this, a strain lacking the pore-forming translocator
proteins PopB and PopD (∆popBD) replicated the ∆pscD mutant phenotype. We
had previously observed that ExoS and ExoT, but not ExoY, are required for
71
PAO1 virulence in a murine model of P. aeruginosa keratitis, and for survival of
P. aeruginosa in neutrophils in vitro [35]. Consistent with those data, a strain
lacking only ExoS and ExoT induced ROS production to similar levels as the
∆3TOX mutant strain (Figure 2.2A). Deletion of exoS or exoT individually did not
prevent the block in ROS production (Figure 2.2B). Taken together, these data
indicate that ExoS and ExoT independently block ROS production by infected
neutrophils, and that there is no role for ExoY.
ExoS and ExoT are highly homologous effectors with a similar domain
structure. They each have an N-terminal rho-GAP and C-terminal ADPRT
domain. The Rho GAP domains of these two proteins target Rho, Rac, and
CDC42, while the ADPRT domains of ExoS and ExoT have different target
specificities. ExoS ADP-ribosylates multiple proteins, including low molecular
weight GTPases, ERM (Ezrin-Radixin-Moesin) proteins, and vimentin, whereas
the only known targets of ExoT are CrkI, CrkII, and phosphoglycerate kinase
[247]. To assess the individual contributions of these activities to blocking ROS
production, we infected neutrophils with P. aeruginosa strains in which either the
rho-GAP activity (G-) or the ADPRT activity (A-) were inactivated by point mutations. Whereas Rho-GAP mutations had no effect on the ability of P. aeruginosa to block ROS production by human neutrophils, inactivating the
ADPRT activities of both ExoS and ExoT [exoST(A-)] resulted in elevated ROS production by infected neutrophils (Figure 2.2C). As with the whole-gene deletions, inactivating the ADPRT-activities of ExoS or ExoT individually had no
72 effect. ExoS and ExoT therefore act independently to block ROS production in an
ADPRT-dependent fashion.
. Figure 2.2: ExoS and ExoT ADPRT activities inhibit ROS production in human neutrophils. ROS production was measured using a chemiluminescent substrate (relative light units, RLU). Neutrophils were infected with: wild type (PAO1), a T3SS null mutant (ΔpscD), as well as: (A) a strain lacking the translocation apparatus (∆popBD), a strain lacking all 3 effectors (∆3TOX), and a strain lacking exoS and exoT effector genes (∆exoST). (B) a strain lacking exoS (∆exoS), a strain lacking exoT(∆exoT), or (C) strains with chromosomal point mutations inactivating the Rho-GAP (G-) or ADP-ribosyltransferase activities (A-) of ExoS and/or ExoT. A time course representative of at least three independent experiments is shown. See also Figure S2.2
73
ExoS and ExoT block NADPH Oxidase activity by inhibiting PI3K signaling.
Activation and assembly of NADPH oxidase in neutrophils involves the
phosphoinositide 3-kinase (PI3K) signaling pathway [208]. Activation of PI3Kγ
leads to phosphorylation and activation of Akt and protein kinase C (PKC), which
are needed to phosphorylate the p47phox and p40phox cytosolic components of
NADPH oxidase. Once activated, p-p47phox, p-p40phox, and p67phox translocate to
the membrane and, in conjunction with activated Rac, interact with
p22phox/gp91phox to form the active NADPH oxidase complex [165]. Activation of
NADPH oxidase in P. aeruginosa infected neutrophils similarly depends on the
PI3K signaling pathway, as ROS production was blocked in the presence of PI3K inhibitors (Figure S2.3).
To determine whether P. aeruginosa T3SS-effectors interfere with the
PI3K signaling pathway, human neutrophils were infected with PAO1 or ΔpscD
mutant bacteria, and phosphorylation of Akt and p40phox was examined. Infection
of neutrophils with the ∆pscD mutant strain induced Akt and p40phox
phosphorylation within 15 minutes, which was sustained over 60 minutes (Figure
2.3A). In marked contrast, PAO1 only induced phosphorylation of Akt and p40phox
at the 15-minute time point, and to a lesser extent than the ∆pscD mutant
bacteria. Together, these findings demonstrate that P. aeruginosa-induced ROS
production by human neutrophils requires PI3K, and that the T3SS inhibits
phosphorylation of Akt and the p40phox subunit of NADPH oxidase, both of which are signaling events downstream of PI3K.
74
The ADPRT activities of ExoS and ExoT disrupt PI3K signaling and NADPH
Oxidase activation
To examine the role of ExoS and ExoT ADPRT activities on PI3K
signaling, human neutrophils were infected with the exoT(A-), exoS(A-) or
exoST(A-) mutants and after 30 min, cell lysates were assayed for
phosphorylation of Akt and p40phox. Infection of neutrophils with the exoST(A-) double mutant strain resulted in phosphorylation of Akt and p40phox, akin to the
T3SS-null mutant strain. Consistent with the redundant role of ExoS and ExoT in
blocking ROS production, strains in which the ADPRT activity of only one of
these two effectors had been inactivated, exoS(A-) or exoT(A-), blocked phosphorylation of Akt and p40phox (Figure 2.3B). As with ROS production, the
GAP activities of ExoS and ExoT do not affect the PI3K pathway or the NADPH
oxidase complex.
Ras is critical for activation of PI3Kγ mediated ROS production in
neutrophils [211, 216], and is a known target of ExoS in epithelial cells. The
addition of ADP-ribose to Ras by ExoS, both in vitro and in vivo, results in a gel
mobility shift [78, 253]. We found that Ras in lysates from neutrophils infected
with wild-type P. aeruginosa exhibited a shift in its mobility, indicating that Ras is
ADP-ribosylated (Figure 2.3A, B). This mobility shift was uniquely dependent on
the ADPRT activity of ExoS, since ADP-ribosylation of Ras was evident in
neutrophils infected with the exoT(A-) mutant strain, but not neutrophils infected
with the exoS(A-) strain (Figure 2.3B). Using purified proteins, we confirmed that
the mobility shift depends both on the presence of ExoS, and residue Arg41 in
75
Ras (Figure 2.3D). These data are also in agreement with previous studies in epithelial cells, which indicated that Ras is not a target of ExoT [81].
ADP-ribosylation of Ras at Arg41, in vitro, results in a 3-fold slower rate of
GDP/GTP exchange compared to unmodified Ras, which led to the proposal that
ExoS interferes with Ras signaling by reducing guanine nucleotide exchange
[78]. To determine if ExoS reduces the amount of active Ras in infected human neutrophils, the same lysates probed in Figure 2.3B were also used to purify
GTP-bound Ras using the immobilized Ras-binding domain of Raf1. ADP- ribosylation of Ras does not interfere with binding to Raf1 [78]. Total- and GTP- bound Ras were detected by western blot. ADP-ribosylation of Ras did not significantly affect the relative amount of GTP-bound Ras in infected neutrophils
(averages of five independent experiments are reported in Figure S2.3). Our finding that all GTP-bound Ras in neutrophils infected with ExoS+ bacteria is
ADP-ribosylated was highly reproducible in five experiments. We speculate that this reflects the activation state of Ras near the site of bacterial phagocytosis
(and injection of ExoS).
In summary, injected ExoS and ExoT, through their ADPRT-activities, disrupt the PI3K signaling pathway in human neutrophils. ADP-ribosylation of
Ras is a likely candidate for the block elicited by ExoS, but not by affecting the level of GTP-bound Ras in infected neutrophils.
76
ADP-ribosylation of Ras interferes with binding to PI3Kγ
We hypothesized that instead of interfering with GDP/GTP exchange,
ADP-ribosylation could be blocking the Ras-PI3K interaction that is required for
activation of PI3K. In fact, arginine 41 of Ras is close to the Ras-binding domain
of PI3K, and is oriented towards PI3K in the published crystal structure of the
Ras-PI3K complex (Figure 2.3C)[216].
To test this hypothesis, we used recombinant, HA-tagged versions of human, full-length Ras, or Ras(R41K), where Arg41 is replaced by lysine, to monitor binding of PI3K by affinity chromatography using purified proteins. PI3Kγ co-purified with Ras (Figure2. 3D, lane 2). ADP-ribosylation of Ras by ExoS significantly reduced binding of wild type Ras to PI3Kγ (Figure 2.3D, lane 3).
The R41K mutation did not interfere with Ras binding to PI3Kγ. However, in the presence of ExoS, there was no ADP-ribosylation of Ras, and PI3Kγ binding was significantly restored (Figure 2.3D, lane 5). These results provide evidence that
ExoS mediated ADP-ribosylation of Ras at arginine 41 impedes Ras binding to
PI3Kγ.
77
Figure 2.3: ExoS and ExoT ADP-ribosyltransferase activities interfere with PI3K signaling in neutrophils. (A) Cell lysates from uninfected human neutrophils, or from neutrophils infected with wild type PAO1, or a ∆pscD mutant strain were probed by Western blot for Akt, P-Akt (Thr308), p40phox, P-p40phox (Thr154), and Ras. The experiments were repeated 3 times with similar results.(B) Cell lysates from uninfected human neutrophils, or neutrophils infected for 30 minutes with PAO1, ∆pscD, or with strains in which the ADP- ribosyltransferase activity was inactivated in ExoS only (exoS(A-)), ExoT only (exoT(A-)), or both (exoST(A- )). P-Akt (Thr308), Akt, P-p40phox (Thr154), p40phox, total Ras, GTP-bound Ras, and Grb2 (loading control) were detected by western blot. The experiments were repeated 5 times with similar results.(C) Model of Ras (gray) bound to the Ras-binding domain (light blue) of PI3K (dark blue) based on the structure PDB:1he8 [216]. Residue Arg 41 of Ras is highlighted red. (D) Purified ExoS was used to ADP-ribosylate HA-tagged versions of Ras, or Ras(R41K), in vitro and subsequently mixed with purified PI3Kγ. The interaction between Ras and PI3Kγ was probed by immunoprecipitating Ras using an anti-HA-tag antibody. PI3Kγ, as well as unmodified and ADP-ribosylated Ras were detected by western blot. The experiments were repeated 3 times with similar results. Input and output levels of PI3Kγ were determined by densitometry. The input/output ratio for the untreated control sample was set to 100% and compared to the corresponding ExoS-treatment condition (mean and standard deviation are noted below each lane). Results were compared by 1-way ANOVA with Bonferroni correction (**** p<0.0001). See also Figures S2.3 and S2.4.
78
Intracellular delivery of R41K Ras protein into neutrophils rescues ROS production in the presence of ExoS
If ADP-ribosylation of Ras by ExoS interferes with activation of the PI3K signaling pathway, we should be able to reverse the ExoS-dependent block in
ROS production by introducing Ras(R41K) into neutrophils. We used Tat peptide-mediated cellular delivery to introduce Ras(R41K) into primary human neutrophils. The HIV Tat-derived peptide is a cell penetrating peptide (CPP) that can deliver proteins into cells [254].
We purified the recombinant Tat-Ras(R41K) fusion protein containing an
HA tag from E. coli, and introduced it into human neutrophils. To examine if Tat-
Ras(R41K) was delivered into the cells, we used a proteinase K protection assay, which degrades extracellular, but not intracellular proteins unless the cells are permeabilized. The Tat-Ras(R41K) fusion protein was taken up in a dose- dependent manner, and Ras was not detected in Triton-X100 treated neutrophils
(Figure 2.4A), indicating that the Tat-Ras(R41K) fusion protein was protected from proteolysis, and therefore intracellular.
Delivery of Tat-Ras(R41K) into human neutrophils prior to infection with the exoT(A-) strain resulted in a dose-dependent increase in ROS production, indicating that Tat-Ras(R41K) was able to reverse the ExoS-dependent block in
ROS production (Figure 2.4B, S2.4A). ROS production did not reach the level induced by the exoST(A-) double mutant. This could be due to the presence of endogenous wild-type Ras, or indicate that a second target of ExoS also contributes to the block in ROS production. Delivery of either Tat-Ras(R41K) on
79
its own, or the unrelated Tat-fusion protein, Tat-GFP, did not induce ROS
production (Figure S2.4B). Tat-GFP, unlike Tat-Ras(R41K), did not reverse the
ExoS-dependent block in ROS production (Figure S2.4C). While delivery of wild-
type Tat-Ras also resulted in increased ROS production (Figure S2.4D), this was
only significant at the highest concentration tested, arguing that preventing ADP- ribosylation of Ras on Arg41 specifically interfered with the ExoS-dependent block in ROS production.
To determine if the increased ROS production by Tat-Ras(R41K)-treated neutrophils results in increased bacterial killing, we assessed survival using a gentamicin protection assay. As shown in Figure 2.4C, we recovered about a log fewer CFU from neutrophils infected with the ∆pscD or exoST(A-) mutant strains, compared to the PAO1 or exoT(A-) strains. However, CFU recovered from TAT-
Ras(R41K)-, but not Tat-Ras treated neutrophils infected with the exoT(A-) strain were significantly reduced compared to untreated neutrophils, which is consistent with increased ROS production in the presence of Ras(R41K). Recovered CFU for the exoST(A-) strain was not affected by Tat-Ras or Tat-Ras(R41K), indicating that the effect of the Tat-Ras(R41K) fusion protein on survival of phagocytosed P. aeruginosa is specific to the ADPRT activity of ExoS. Taken together our data demonstrate that ADP-ribosylation of Ras at Arg41 blocks ROS production and allows P. aeruginosa to survive intracellularly in human neutrophils.
80
Figure 2.4: Tat-Ras(R41K) rescues ROS production in human neutrophils, resulting in increased killing of P. aeruginosa. (A) Human neutrophils were treated with increasing concentrations of Tat-Ras(R41K) for 30 minutes, and extracellular protein was degraded by proteinase K. Western blots of cell lysates were probed with antibodies to Ras (which detect endogenous and Tat-Ras(R41K)) or the HA tag (which detects only Tat-Ras(R41K)). (B) ROS production by human neutrophils infected with PAO1, exoT(A-), or exoST(A-) P. aeruginosa was measured by chemiluminescence. Neutrophils were incubated with increasing amounts of Tat-Ras (R41K) thirty minutes prior to infection with an exoT(A-) strain. The experiment was repeated 4 times with similar results. (C) Human neutrophils were incubated with Tat-Ras(R41K) (red) or Tat-Ras (blue) (3 µM final concentration) for 30 minutes prior to infection with PAO1, ∆pscD, exoS(A-), or exoST(A) 15 min (MOI30). Extracellular bacteria were killed with gentamicin for 30 minutes. Each point represents an individual human donor. Statistical significance was measured by 1-way ANOVA with Bonferroni correction. **p<0.01, ***p<0.001, n.s. not significant. See also Figure S2.5.
81
DISCUSSION ROS production by neutrophils plays a major role in pathogen clearance,
which is highlighted by chronic granulomatous disease patients (CGD), who have
genetic defects that inactivate the phagocytic NADPH oxidase [204]. While P.
aeruginosa is not among the most common pathogens afflicting CGD patients,
epidemiological data suggests that this patient group is also more susceptible to
P. aeruginosa infections [205-207]. Using CGD mice that do not express gp91, we found that ROS production is needed to control P. aeruginosa replication in
the cornea. Moreover, we demonstrate here that the T3SS is not required for
survival in the cornea in CGD mice, despite massive influx of neutrophils to the
site of infection. This finding indicates that an important function of the T3SS is to
prevent ROS production by infiltrating neutrophils. Indeed, we found that P.
aeruginosa ExoS and ExoT can each, independently block ROS production in
neutrophils. Inhibition or ROS production depends on the ADP-ribosyltransferase
activities of ExoS and ExoT, which block the NADPH oxidase signaling cascade.
This efficient inhibition of neutrophil ROS production is unusual. Most pathogens survive the effect of ROS by producing superoxide dismutases, catalases, and peroxidases to detoxify ROS [242, 255, 256]. Inhibition or reduction of ROS production have been described [257, 258], but the molecular mechanism is unknown. Salmonella enterica sv. Typhimurium uses the SPI2 secretion system to not actually block ROS production, but instead prevent localization of ROS production to the phagosome [259, 260], thereby reducing the exposure of intracellular bacteria to ROS. This reduction in exposure to ROS may work hand-in-hand with periplasmic superoxide dismutase [261], and a set
82 of cytoplasmic catalases, peroxidases, and thiol-reducing systems that protect
Salmonella from ROS-mediated oxidative damage and are needed for survival in animal models of infection [242, 262]. S. pyogenes streptolysin O inhibits ROS production [252], but the reduction is comparatively minor. It is possible that pore-formation in the phagosome membrane is sufficient to partially interfere with
ROS production, which could also explain the translocation-pore dependent reduction in ROS production that we observed. However, P. aeruginosa strains lacking all effectors are as defective in mouse models of infection as strains lacking the translocon or the T3SS entirely [28, 35, 89], arguing that the effector- mediated block in ROS production is the key factor that leads to virulence.
In the current study, we examined the molecular mechanism by which P. aeruginosa type III secreted effectors inhibit ROS production. Specifically, we demonstrate that ExoS interferes with the signaling cascade that mediates
NADPH oxidase assembly by ADP-ribosylating Ras on arginine 41. Delivery of the ribosylation resistant Ras(R41K) into primary human neutrophils restored
ROS production and resulted in increased killing of P. aeruginosa. This result highlights the intimate relationship between the effector-mediated block in ROS production and the ability of P. aeruginosa to survive in neutrophils. We also demonstrate that ADP-ribosylation of Ras interferes with its ability to bind to
PI3K, a step that is critical for activation of PI3K.
Ras(R41K) reversed the ExoS-dependent block in ROS production incompletely. This may be a consequence of endogenous Ras, which is still susceptible to ADP-ribosylation by ExoS, or the presence of a second target of
83
ExoS. Possible candidates are Ezrin-Radixin-Moesin (ERM) proteins as they are
high affinity targets for ExoS and regulate phagosome maturation in both
macrophages and dendritic cells [77, 263]. Rab5, another known target of ExoS,
directs the intracellular fusion of granules with pathogen-containing phagosomes
in neutrophils [264]. ExoS could also target an as yet uncharacterized,
neutrophil-specific protein. The target of ADP-ribosylation by ExoT in neutrophils is similarly unclear. While Crk proteins are targets of ExoT, and activate Rac via the Elmo1-/DOCK180 complex, this would not explain the defect in PI3K signaling we observed, suggesting that more targets of ExoT-ADP-ribosylation remain to be discovered.
The block in ROS production is clearly important for mediating the survival of P. aeruginosa in neutrophils. However, ExoS and ExoT likely contribute to P. aeruginosa pathogenesis in addition to blocking ROS production. For example, the ADP-ribosyltransferase activities of ExoS and ExoT induce apoptosis in infiltrating neutrophils [35]. Also, both effectors are anti-phagocytic [265], which was recently observed in vivo, in a mouse model of lung infection [266]. While we saw no effect on uptake in our in vitro experiments, our infection period was very short. A plausible explanation is that the first bacteria that encounter the infiltrating neutrophils are in fact phagocytosed. T3SS-mediated injection of ExoS and ExoT might then block phagocytosis of subsequently attaching bacteria. The combined activities of inhibiting phagocytosis and inducing apoptosis could contribute to the overall survival of the infecting population of bacteria. Clearly however, neither mechanism contributes much to the ability of P. aeruginosa to
84 survive if the host is incapable of mounting an effective reactive oxygen species burst. Our data therefore argue that blocking ROS production is a critical function of ExoS and ExoT in subverting the anti-microbial activity of neutrophils.
85
Figure S2.1: NADPH oxidase mediates ROS production by neutrophils facilitate clearance of exoST(A-) strain during bacterial keratitis. Related to Figure 2.1.
phox (A) Representative images of corneal opacification 24 h post-infection of C57BL/6 and gp91 -/- (CGD) 5 mice infected with 1x10 CFU PAO1 (WT) or with the exoST(A-) (APDRT of ExoS and ExoT are inactivated) mutant strain. (B) Colony forming units (CFU) recovered from infected corneas 24 h post-infection. Data points represent individual corneas (n = 6-13 mice). Median and interquartile range are indicated. Statistical significance was calculated by Kruskal-Wallis test with Dunn’s multiple comparison correction, **p<0.01, ***p<0.001, n.s. not significant.
86
Figure S2.2: The type-III secretion system does not affect initial neutrophil phagocytosis or cell death. Related to Figures 2.2 and 2.4.
(A) Human neutrophils were infected with biotin labelled GFP+-P. aeruginosa for 15 minutes. After washing and fixing with 4% paraformaldehyde, extracellular P. aeruginosa were labelled with streptavidin-APC. Gates were set to exclude mock infected neutrophils that had been subjected to the same fixing/staining protocol. The percentage of GFP+/APC- cells (top left quadrant), representing intracellular bacteria, is indicated. The experiments were repeated 2 times with similar results. (B) Human neutrophils were infected with P. aeruginosa, and lactate dehydrogenase (LDH) release was measured after 2 hours. The strains used in these experiments were wild type (PAO1) and a T3SS null mutant (ΔpscD). Total LDH represents LDH release after freezing and thawing neutrophils. The experiments were repeated 2 times with similar results.
87
Figure S2.3: ROS production in neutrophils infected by the ∆pscD mutant strain requires PI3-kinase, but ExoS ADP-ribosylation does not affect the GTP-Ras/Ras ratio in infected neutrophils. Related to Figures 2.3.
(A) ROS production was assayed in human neutrophils infected with a T3SS null mutant strain (∆pscD) incubated with PI3K inhibitors GDC-0941 or AS-605240 (both 1µM), or vehicle (DMSO, column 1). Activity was determined by integrating the area under the curve of the luminescence plots, and is expressed as a percentage of ROS production by infected neutrophils in the absence of inhibitors. The data represent an average of 2 independent experiments (n = 2 donors).(B) The ratio of GTP-bound Ras to total Ras was determined in 5 independent experiments and is plotted as fold change relative to the GTP-Ras/Ras ratio in PAO1-infected neutrophils. GTP-bound Ras was isolated by Raf1-mediated affinity chromatography, and was detected by Western blot. Total Ras was detected in the corresponding cellular lysate. Densitometry values were normalized relative to the Ras-band of PAO1-infected neutrophils of each blot to allow comparison between experiments. The ratio of GTP-bound/total Ras was plotted for each experiment and infection condition. None of the GTP-Ras/Ras ratios changed significantly compared to PAO1-infected neutrophils (n.s. = not significant by one-way ANOVA, with Bonferroni multiple comparison test).
88
Figure S2.4: Tat-Ras(R41K) and Tat-GFP do not induce ROS production in human neutrophils, nor does Tat-GFP restore ROS production in infected neutrophils. Related to Figure 2.4.
(A) ROS production by human neutrophils infected with PAO1, exoT(A-), or exoST(A-) P. aeruginosa was measured by chemiluminescence. Where indicated, cells were pre-incubated with Tat-Ras(R41K) thirty minutes prior to infection. The plot is representative of three independent experiments. (B) ROS production by human neutrophils infected with exoST(A-) P. aeruginosa, or incubated only with Tat- GFP or Tat-Ras(R41K), no infection. The plot is representative of three independent experiments. (C) ROS production by human neutrophils infected with PAO1, exoT(A-), or exoST(A-) P. aeruginosa . Where indicated, cells were pre-incubated with Tat-GFP thirty minutes prior to infection. The plot is representative of two independent experiments. (D) Area under the curve values for ROS production (relative light units) by neutrophils from five volunteers infected with PAO1 exoT(A-). Neutrophils were either left untreated, or pretreated with 0.3µM (left panel) or 3µM (right panel) Tat-Ras or Tat-Ras (R41K), as indicated. Mean values, and standard deviation are indicated. Samples were compared by 1-way ANOVA with Bonferroni correction. ** p<0.01,* p<0.05, n.s. not significant
89
Chapter 3: The ExoU genomic island of strain 19660 modulates type III secretion-dependent virulence
90
ABSTRACT
P. aeruginosa is a common opportunistic pathogen. One of its main
virulence factors is a type III secretion system that allows the bacterium to
directly inject effector proteins into targeted host cells. Of all the effector proteins
described to date, the phospholipase ExoU contributes the most to disease
severity, both in the clinic and in animal models of infection. ExoU is encoded on
a pathogenicity island, raising the question if other genes on this genomic island
also contribute to the virulence of ExoU-producing strains. Here we demonstrate
that ExoU production lowers the minimal infectious dose in a mouse model of keratitis, even when expressed out of context in a strain that normally does not produce ExoU. Moreover, we demonstrate that other genes on the exoU- genomic island of strain 19660 contribute to the severity of the infection. This increase in pathogenicity depends on the presence of a functional type III secretion system, arguing that the exoU-genomic island modulates the severity of type III secretion dependent virulence.
91
INTRODUCION
Pseudomonas aeruginosa is a frequent cause of hospital-acquired
infections, microbial keratitis, and chronic lung infections in cystic fibrosis patients
[11, 245, 267, 268].
A key virulence factor is the type III secretion system, a molecular syringe
that allows P. aeruginosa to directly inject proteins (effectors) into targeted host
cells [59]. Notably, while strains of P. aeruginosa lacking a functional type III
secretion system are attenuated in mouse models of infection [28, 34, 35, 89,
269], the bacteria do not require a T3SS if recruitment of neutrophils to the site of
infection is prevented, arguing that one of the primary functions of the T3SS is to
avoid clearance by infiltrating neutrophils [35].
To date, four effector proteins have been described in P. aeruginosa:
ExoS, ExoT, ExoU, and ExoY. While most strains of P. aeruginosa produce
ExoT, distribution of ExoS and ExoU tends to be mutually exclusive [60, 246,
270, 271]. The adenylate cyclase ExoY, which is also broadly distributed among
P. aeruginosa isolates, is, at best, a minor contributor to P. aeruginosa virulence
in animal models of infection [30, 35, 272]. ExoS and ExoT are highly
homologous effector proteins with N-terminal Rho-GAP domain (directed against
RhoA, Rac, and Cdc42), and a C-terminal ADP-ribosyltransferase domain.
Survival in animal models of infections is tied to the ADP-ribosyltransferase activities of ExoS and ExoT, which target divergent substrates. ExoS ADP- ribosylates a large number of proteins, including small Ras-like GTPases, ezrin- radixin-moesin (ERM) proteins, and vimentin. ExoT targets CrkI and CrkII, as
92
well as phosphoglycerate kinase [247]. ExoU is a phospholipase A2 that initially disrupts focal adhesions, and effects collapse of the cytoskeleton, followed by membrane blebbing and lysis [273, 274]. Notably, production of ExoU is associated with more severe disease in the clinic [275], as well as increased alveolar destruction and sepsis in animal models of infection [27], and increased tissue destruction in a mouse model of keratitis [276].
Clinical P. aeruginosa isolates exhibit significant variation in their pathogenicity [4, 275, 277]. While some of this variation can be attributed to the distribution of known virulence factors (e.g. presence of ExoU, mentioned above), it has become ever clearer in recent years that much variation in virulence can be attributed to genes encoded on genomic islands that vary between strains [111, 277]. In fact, ExoU is encoded on a pathogenicity island
that varies among strains [108]. In the commonly studied strain PA14, exoU is encoded on P. aeruginosa pathogenicity island 2, PAPI-2. Analysis of virulence in a wax moth model of infection suggested that PAPI-2 contributes to the virulence of strain PA14, beyond encoding exoU [110]. A subsequent analysis of genomic islands encoding exoU identified three additional genomic island configurations: An A-type genomic island, encoding 77 open reading frames, a B- type genomic island harboring 41 genes, as well as a C-type island, that essentially only encodes the genes for ExoU and its cognate chaperone SpcU
[108].
Here, we undertook an analysis of the relative contribution of exoU and genes on the B-type ExoU island of strain 19660, in a mouse model of infectious
93
keratitis. We found that ExoU-production results in a decrease in the minimal infectious dose required to cause a production infection. Moreover, by comparing the virulence of strain 19660 lacking exoU to a mutant derivative lacking the adjacent genomic island open reading frames EXB31-41, we provide evidence that genes on the B-type ExoU island also increase the virulence of strain 19660.
Notably, this increase in pathogenicity is only observed in a type III secretion positive, ExoT-producing strain, arguing that the genes encoded on the island specifically increase type III secretion-dependent disease.
94
METHODS and MATERIALS
Bacterial strains and Culture Conditions
All strains and plasmids used in this study are listed in Table 1. P. aeruginosa was cultured in high salt LB (10 g of tryptone, 5 g of yeast extract, and 11.7 g of
NaCl per L, supplemented with 10 mM MgCl2 and 0.5 mM CaCl2) with 5mM
EGTA to induce production of the T3SS [54].
Strain and plasmid construction
Mutant strains were constructed as described [278] and are derived from the same parental PAO1 strain or 19660 strain, as indicated in Table 3.1. Briefly, chromosomal mutations of P. aeruginosa were achieved by allelic exchange. All primers used for plasmid construction are listed in Table II. Flanks specifying the appropriate mutation were amplified using chromosomal DNA as template
(unless specified otherwise), joined by splicing by overlap extension PCR, and cloned into the appropriate plasmid using the indicated restriction enzymes.
In vivo model of corneal infection
Mice were housed and maintained according to institutional guidelines and the
Association for Research in Vision and Ophthalmology Statement for the Use of
Animals in Ophthalmic and Vision Research. The corneal infection protocol was
approved by the CWRU Institutional Animal Care and Use Committee [protocols
#2012-0105 (E.P.) and #2013-0055 (A.R.)]. Mice were anesthetized by i.p.
injection of 0.4 ml 2,2,2-tribromoethanol (1.2%). Three parallel 1-mm–long
abrasions in the central cornea were applied using a 26-gauge needle, and a 2.5-
μl aliquot containing 103 or 105 bacteria was placed on the corneal surface as
95
described [237]. Images of corneal opacity were taken at 24hr and 48hr post
infection. At 48hrs post infection whole eyes were homogenized using a Mixer
Mill MM300 (Retsch) at 33 Hz for 4 min. Serial log dilutions were plated onto
brain heart infusion agar plates (BD Biosciences), and CFU were determined
after overnight incubation at 37°C. Eyes from control mice were homogenized at
2 hours post infection to determine the starting inoculum.
Histology
Whole eyes were fixed in 10% phosphate buffered formalin, paraffin embedded,
and sectioned. Hematoxylin and eosin (H&E) staining was performed by the
Case Western Reserve University Visual Science Research Center histology
core.
Western Blot analysis
1 ml log-phase bacterial culture was centrifuged, and culture supernatant was
precipitated with 10% TCA. Equal amounts of proteins were separated by SDS-
PAGE on a 10% or 12% polyacrylamide gel (Bio-Rad), transferred to polyvinylidene difluoride (PVDF) membrane, blocked with 5% BSA (Fisher,
Pittsburgh PA) in TBS-T (25 mM Tris, 0.15M NaCl, 0.05% Tween-20, pH 7.5).
Primary antibodies were detected using horseradish peroxidase (HRP)-
conjugated secondary antibodies and a chemiluminescent detection reagent
(Western Bright Quantum [Advansta]). Antibodies to VSV-G and RpoA were purchased from Santa Cruz Biotechnology and ExoT and ExoT were generated in-house. Blots were imaged using a GE ImageQuant LAS 4000 digital imaging system. Scanned images were processed for brightness and contrast using only
96
the levels function of Adobe Photoshop applied to the entire image before
cropping.
Statistical Analysis
Experimental data analyzed for significance were from at least three
independent experiments using GraphPad Prism. The statistical test used is
indicated in the figure legends. Statistical significance was defined as p<0.05.
Table 3.1 Strains and plasmids Strains genotype source RP1831 PAO1F, wild type Pseudomonas aeruginosa {Bleves, PAO1 2005 #7} RP1883 PAO1F ∆exoS {Sun, 2012 #2} RP1924 PAO1F ∆exoS ∆exoY this study RP1871 PAO1F ∆pscD {Sun, 2012 #2} RP3269 19660, wild type Pseudomonas aeruginosa American Type Culture Collection RP6663 19660 ∆exoU this study RP8478 19660 ∆exoT this study RP8389 19660 ∆exoU ∆exoT this study RP8298 19660 ∆pscD this study RP9232 19660 ∆exoU-EXB41 this study RP9291 19660 ∆exoU-EXB32 this study RP9293 19660 ∆exoU ∆norR this study RP9295 19660 ∆exoU ∆norB this study RP9297 19660 ∆exoU ∆EXB35-41 this study RP10154 19660 ∆exoU ∆EXB35.1 this study RP10156 19660 ∆exoU ∆EXB36 this study RP9566 19660 ∆exoU ∆EXB37 this study RP9667 19660 ∆exoU ∆EXB39 this study RP9568 19660 ∆exoU ∆EXB41 this study RP10340 19660 EXB41-VG this study RP10342 19660 ∆pscD EXB41-VG this study RP10354 19660 ∆exoU EXB41-VG this study RP10344 19660 ∆exoU ∆EXB39 EXB41-VG this study
Plasmids characteristics source pEXG2 allelic exchange plasmid, gentamicin {Rietsch, resistance, sacB, oriT 2005 #46} pPSV39 shuttle vector, gentamicin resistance, lacIq, this study
97
lacUV5 promoter, oriT pEXG2-∆exoU delete codons 3 to 681 of exoU this study pEX-∆exoT delete codons 14 to 426 of exoT {Vance, 2005 #24} pEX-∆exoY delete codons 10 to 368 of exoY {Vance, 2005 #24} pEXG2-∆pscD delete codons 39 to 410 of pscD {Sun, 2012 #2} pEXG2-∆exoU- delete codons 3 of exoU to 367 of EXB41 this study EXB41 pEXG2-∆exoU- delete codons 3 of exoU to 473 of EXB32 this study EXB32 pEXG2-∆norR delete codons 3 to 543 of norR this study pEXG2-∆norB delete codons 3 to 757 of norB this study pEXG2-∆EXB35- delete codons 44 of EXB35 to 367 of EXB41 this study 41 pEXG2- delete codons 3 to 180 of EXB35 this study ∆EXB35.1 pEXG2- delete codons 3 to 165 of EXB36 this study ∆EXB36.1 pEXG2-∆EXB37 delete codons 3 to 174 of EXB37 this study pEXG2-∆EXB39 delete codons 3 to 140 of EXB39 this study pEXG2-∆EXB41 delete codons 1 to 367 of EXB41 this study pEXG2-EXB41- add 2 copies of VSV-G tag to EXB41 this study VG2 pP39-EXB35 complementation plasmid, EXB35 this study pP39-EXB39 complementation plasmid, EXB39 this study pP39-EXB41 complementation plasmid, EXB41 this study
98
Table 3.2 Primers used Primer name Sequence (5’ -> 3’) use exoU-5-1 AAAAAgagctcCGCTGGACGAGATGGCGC 5’ flank, SacI GGTTTC exoU-5-2 AACTCGAGCCGCAAGCATGCTGAAATG internal primer, pair CATGTTCGCTCCTTGAAATAC with 5-1 exoU-3-1 TTCAGCATGCTTGCGGCTCGAGTTCGG internal primer, pair AATAAGGAGTTCACATGATTG with 3-2 exoU-3-2 AAAAAaagcttCTTAGGGTGGCCCATCTAT 3’ flank, HindIII TAGAG UV5noAlpha1 GTGCTTTACACTTTATGCTTCCGGCTCG replace lacUV5 + TATAATGTGTGGAATTGTGAGCGGATAA lacZ alpha fragment CAATTTCAG of pPSV37 UV5noAlpha2 AATTCTGAAATTGTTATCCGCTCACAATT CCACACATTATACGAGCCGGAAGCATAA AGTGTAAAGCACGTA EXB32-3-1 TTCAGCATGCTTGCGGCTCGAGTTATCT 3’ flank internal GAGTCAGAGCAGGTTCAGCC primer, pair with 3-2 EXB32-3-2 AAAAAaagcttCGCGGCAACCAACCGCAC 3’ flank, HindIII CCTCATC EXB35.1-5-1 AAAAAgaattcGGCGTTCATGCAGCAACCT 5’ flank, EcoRI CTG EXB35.1-5-2 AACTCGAGCCGCAAGCATGCTGAACTC internal primer, pair CATCCGATATCGCCATAGC with 5-1 EXB35.1-3-1 TTCAGCATGCTTGCGGCTCGAGTTAGAC internal primer, pair TACGCTTGTCGACCAG with 3-2 EXB35.1-3-2 AAAAAaagcttTGCGTGTTTTGTTCTTTCG 3’ flank, HindIII GCTCGG EXB36-5-2 AAAAAaagcttGTTTGGCCTACCCCGGAGT 5’ flank, HindIII TGGGTG primer EXB36-5-1 TTCAGCATGCTTGCGGCTCGAGTTCTTC internal primer, pair ATTGCATGCTCGCTTTTG with 5-2 EXB36-3-22 AACTCGAGCCGCAAGCATGCTGAAGCG internal primer, pair CTAGCTGCGGTTGGCATTTAC with 3-1 EXB36-3-1 AAAAAgaattcCCAGTTATTCAGGAGCAGG 3’ flank, EcoRI TGCTG EXB37-5-1 AAAAAgaattcCGGATACAGGTAAATGCCA 5’ flank, EcoRI ACC EXB37-5-2 AACTCGAGCCGCAAGCATGCTGAAAGT internal primer, pair CAAGCCTCTAACCTACAAAAGC with 5-1 EXB37-3-1 TTCAGCATGCTTGCGGCTCGAGTTCCCT internal primer, pair AGGGATGGTCTGACGTAG with 3-2 EXB37-3-2 AAAAAaagcttCTGGGTTCTGGGAAGAGTA 3’ flank, HindIII CGCTC EXB39-3-12 AAAAAgaattcCCCCTAGGGATGGTCTGAC 3’ flank, EcoRI GTAGC EXB39-3-2 AACTCGAGCCGCAAGCATGCTGAACTG internal primer, pair TAGCCGCCGACGGTAGCTG with 3-1 EXB39-5-1 TTCAGCATGCTTGCGGCTCGAGTTTATC internal primer, pair
99
AAACTTGTGCCTTCTTGC with 5-2 EXB39-5-22 AAAAAaagcttGATTAATCCGGCGCTGGCA 5’ flank, HindIII CGTTG EXB41-5-1 AAAAAgaattcCTACCAATCATGCGTTTAA 5’ flank, EcoRI GCTC EXB41-5-2 AACTCGAGCCGCAAGCATGCTGAAGCA internal primer, pair CAAGGTGTCTCATGAACATGC with 5-1 EXB41-3-1 TTCAGCATGCTTGCGGCTCGAGTTATTT internal primer, pair AGAGGATATTAAAATAGAGAG with 3-2 EXB41-3-2 AAAAAaagcttCAAACAGTACCGTTCTTTTT 3’ flank, HindIII ATGAAAACC EXB41-2VG- TTCATCTCGATGTCCGTGTACACTTTTC Internal primer, pair 3-1 CTAATCTATTCATTTCAATATCTGTATAA with EXB41-3-2 ATACTTTCAGCCATAGACGGG EXB41-2VG- GGAAAAGTGTACACGGACATCGAGATG Internal primer, pair 5-2 AACAGGTTGGGCAAATGAAGGATATTAA with EXB41-5R AATAGAGAGTG EXB35.1-5R AAAAAgaattcTGGCTTGTTGATCTGAGGA ORF primer, EcoRI ATCACGATGTCCACCGCGTGGCGCTGC AC EXB35.1-3H AAAAAaagcttCTAGCTGCGGTTGGCATTT ORF primer, HindIII ACCTG EXB39-5R CCCCgaattcAAACATCAGGAGAAGGCAA ORF primer, EcoRI CCATCTTGATACTGGAGAACAACAGAGT G EXB39-3H CCCCAaagcttCTACAGCTCTTGTTCCGGA ORF primer, HindIII TTTATTTC EXB41-5R CCCCgaattcAAACATCAGGAGAAGGCAA ORF primer, EcoRI CCATCATGACTGAAAAACATCCGTTGAA AC EXB41-3H CCCCAaagcttCTAAATACTTTCAGCCATA ORF primer, HindIII GACGG norR-5-1 TTCAGCATGCTTGCGGCTCGAGTTTGCC internal primer, pair ATCTGAAGAATAAGACTTAC with 5-2 norR-5-2 AAAAAaagcttCCGAACAGCGCGACGTAG 5’ flank, HindIII TAGGTG norR-3-1 AAAAAgaattcACCGAGGCCGGCTACGTG 3’ flank, EcoRI TACATC norR-3-2 AACTCGAGCCGCAAGCATGCTGAACTC internal primer, pair TGACTCAGATGGTGCGCGAG with 3-1 norB-5-1 AAAAAgaattcAGCCGTCATACGGGTCGG 5’ flank, EcoRI GCAGTTC norB-5-2 AACTCGAGCCGCAAGCATGCTGAAACC internal primer, pair CATGGCACACCCCCGCACGGATG with 5-1 norB-3-1 TTCAGCATGCTTGCGGCTCGAGTTGATT internal primer, pair AAATCAATAAGATGAGTGTG with 3-2 norB-3-2 AAAAAaagcttTGCGACCTGACCCAGTTGT 3’ flank, HindIII AGCG
100
RESULTS
ExoU production lowers the minimal infectious dose in a mouse model of
keratitis
We had reported that P. aeruginosa strain PAO1 is less pathogenic than strain 19660, requiring a 2 log greater inoculum to induce the same level of disease [237]. A key difference between these strains is that strain 19660 produces the type III secreted effector proteins ExoT and ExoU, whereas PAO1 produces ExoS, ExoT and ExoY [27]. To determine if ExoU is responsible for the
increased virulence of strain 19660, we constructed a PAO1 strain that
expresses ExoT and ExoU by deleting exoS and inserting the genes encoding
ExoU and its cognate chaperone, SpcU, into the genome at the neural att-Tn7
site (PAO1 ΔexoS exoU+)[279]. To confirm that this strain produced, and was
capable of secreting ExoU, bacteria were grown in the presence or absence of
calcium (an in vitro trigger of effector secretion), and ExoU production and
secretion into the supernatant was monitored by Western blot. PAO1 ∆exoS
exoU+ was capable of producing and secreting ExoU, albeit at a reduced level
compared to strain 19660 (Figure 3.1A). This is due to reduced expression of
exoU inserted at the ectopic attTn7 site, since production of ExoU was also reduced in an exoU null mutant derivative of strain 19660, which had been
complemented with the same exoUspcU construct (19660 ∆exoU exoU+)(Figure
3.1A). Production and low-calcium-dependent secretion of ExoT was unaffected
in these strains (Figure 3.1A).
101
To examine the pathogenicity of PAO1 ΔexoS exoU+, corneas of C57BL/6
mice were abraded and 1x103 CFU bacteria were added topically. After 48 h, eyes were homogenized and bacterial load was quantified. As anticipated, the
bacterial load in corneas infected with the more virulent strain 19660 was about
20x higher than in corneas infected with strain PAO1, which essentially did not
increase over the 2-day infection period (Figure 3.1B). However, despite the lower production of ExoU, the bacterial load in corneas infected with PAO1
ΔexoS exoU+ was significantly higher than the PAO1 parent strain, and was not
significantly different from 19660. PAO1 ΔexoS exoU+ also caused more corneal
opacification than the parental PAO1 strain (Figure 3.1C). These findings demonstrate that production of ExoU lowers the minimal infectious dose and increases corneal virulence.
102
Figure 3.1: P. aeruginosa strain 19660 has greater virulence than PAO1. (A) Total cell lysate and culture supernatants were processed for Western blot analysis to detect ExoU, and ExoT. Cell wall-associated RpoA served as fractionation control. Cells were grown in calcium or calcium free conditions. (B) Representative images of corneal opacification 48 h post-infection of C57BL/6 mice infected with 1x103 CFU PAO1, 19660 or PAO1 Δexos exoU+. (C) Colony forming units (CFU) recovered from infected corneas 48 h post-infection. Data points represent individual corneas. Median and interquartile range are indicated. Significance was calculated using the Kruskal-Wallis test, with Dunn’s multiple comparison correction. * p<0.05, NS, not significant.
103
Corneal virulence of strain 19660 depends on both ExoU and ExoT
To dissect the role of the type III secretion in strain 19660, we generated mutants lacking ExoT, ExoU or both (19660 ΔexoTU), and a type III secretion null mutant (19660 ΔpscD). Corneas were infected as before, and CFU and corneal opacification were examined. We found no significant difference in CFU between the parent 19660 and the single gene mutants ΔexoT and ΔexoU,
whereas there was significantly less CFU in the double ΔexoTU and T3SS
ΔpscD mutants (Figure 3.2A). Consistent with this observation, the ΔexoTU and
ΔpscD mutants caused less corneal opacification than the parent strain, and the
single mutants (Figure 3.2B).
104
Figure 3.2: Corneal virulence of strain 19660 depends on both ExoU and ExoT (A) Colony forming units (CFU) recovered from infected corneas 48 h post-infection of C57BL/6 mice infected with 1x105 CFU 19660, 19660 ΔexoU, 19660 ΔexoT, 19660 ΔexoTU, or 19660 ΔpscD. (B) Representative images of corneal opacification 48 h post-infection. Median and interquartile range are indicated. Significance was calculated using the Kruskal-Wallis test, with Dunn’s multiple comparison correction. * p<0.05, ***p<0.001, or NS, not significant
105
P. aeruginosa 19660 is more virulent than PAO1 when expressing only
ExoT
Strain 19660 producing only ExoT replicates as well in the cornea as the wild-type parent, which differs markedly from strain PAO1, where deletion of exoS results in a decrease in virulence. To further examine the role of ExoT in virulence, we generated a PA01 mutant that produced only ExoT (PAO1 ΔexoS,
ΔexoY), and compared the virulence of this strain with 19660 ΔexoU, which also produces only ExoT. Corneas of C57BL/6 mice were infected with 1x105 of each strain, and CFU and corneal opacification were examined after 48h. We found that although both strains produce similar levels of ExoT (Figure 3.3A).
However, there was a significantly higher bacterial load and increased corneal opacification in mice infected with strain 19660 ΔexoU, compared with mice infected with PAO1 ΔexoS ΔexoY (Figure 3.3B, C). Notably, strain 19660 lacking a functional T3SS (∆pscD) and the equivalent PAO1 mutant are equally avirulent (Figure 3.3D, E), arguing that the increased virulence of strain 19660
∆exoU, compared to strain PAO1 ∆exoS ∆exoY, is T3SS-dependent. Strain
19660 must therefore harbor additional virulence factors that are not present in strain PAO1, that modulate type III secretion dependent virulence.
106
Figure 3.3: P. aeruginosa 19660 is more virulent than PAO1 when expressing only ExoT (A) Total culture, or cell-free supernatant samples of strain 19660 ∆exoU, or PAO1 ∆exoS ∆exoY (PAO1 ∆exoSY) grown in the absence of calcium to trigger effector secretion were analyzed by Western blot to examine production and secretion of ExoT. RpoA served as a fractionation control. (B) Colony forming units (CFU) recovered from infected corneas 48 h post-infection of C57BL/6 mice infected with 1x105 CFU 19660 ΔexoU, PAO1 ΔexoS ∆exoY. (C) Representative images of corneal opacification 48 h post-infection. (D) Colony forming units (CFU) recovered from infected corneas 48 h post-infection of C57BL/6 mice infected with 1x105 CFU 19660 ΔpscD, PAO1 ΔpscD. (E) Representative images of corneal opacification 48 h post-infection. Median and interquartile range are indicated. Significance was calculated using the Kruskal-Wallis test, with Dunn’s multiple comparison correction. **p<0.01, NS, not significant.
107
The ExoU genomic island, though not the putative nitric oxide reductase, confers corneal virulence
The genes encoding ExoU and its cognate chaperone are located on a virulence island that has been sequenced. The island harbors 41 open reading frames, which have been designated EXB1-41 [108]. Notably, several of the genes in the EXB1-25 range have homologs in the corresponding region of the
PAO1 genome, whereas EXB28-41 are not represented in the PAO1 genome
(exoU and spcU are EXB26 and EXB27 in this nomenclature). We therefore focused our efforts on determining if genes in the EXB28-41 region of the 19660
ExoU island (Figure 3.4A) are involved in the increased virulence of strain
19660. In particular, we were interested in examining the role of the putative nitric oxide reductase, NorB, encoded in this region, as well as the putative NO- responsive transcription factor, NoR. During P. aeruginosa corneal infection, neutrophils are the majority of immune cells within the cornea and are responsible for P. aeruginosa clearance. Neutrophil derived nitric oxide (NO) is critical for mouse survival and control of bacterial replication in animal models of pneumonia and keratitis [280, 281]. To test the role of NorB and NorR, we deleted the corresponding open reading frames in strain 19660 ∆exoU. In addition, we generated larger deletions that spanned the flanking open reading frames, EXB28-32, and EXB35-41, respectively. As shown in Figure 3.4B,
strains lacking norB, norR, or EXB28 – EXB32 showed no significant difference
in bacterial load compared with the ΔexoU parent strain. In contrast, deletion of
the EXB35-41 regions resulted in a significant decrease in the bacterial load.
108
These results are paralleled in the severity of corneal disease (Figure 3.4C). The region comprised of genes EXB35-41 in the ExoU genomic island therefore contributes to the virulence of strain 19660, the putative nitric oxide reductase, however, is not involved.
109
Figure 3.4: The ExoU genomic island, though not the putative nitric oxide reductase, confers corneal virulence (A) The portion of the genomic island encoding exoU in strain 19660, including genes EXB28-41, which are not present in strain PAO1, is shown, as is the corresponding region of the PAO1 genome. Red indicates the EXB number of genes in the island. Hypothetical open reading frames are colored grey. Deletions analyzed in this study are indicated below the diagram as blue lines. (B) Colony forming units (CFU) recovered from infected corneas 48 h post-infection of C57BL/6 mice infected with 1x105 CFU 19660 ΔexoU, 19660 ΔexoU ΔnorR, 19660 ΔexoU ΔnorB, 19660 ΔexoU-EXB32, or 19660 ΔexoU ΔEXB35-41. Median and interquartile range are indicated. Significance was calculated using the Kruskal-Wallis test, with Dunn’s multiple comparison correction. * p<0.05. All other comparisons were not significant. (C) Representative images of corneal opacification 48 h post-infection.
110
Genomic island gene EXB41 is required for virulence of strain 19660 ∆exoU
To identify more specifically the genes in region EXB35-41 of the 19660 genomic island associated with virulence, we generated individual deletions of
EXB35, EXB36, EXB37, EXB39, and EXB41 in strain 19660 ∆exoU. We compared the virulence of these individual mutants to the parental strain, as well as a strain lacking the entire exoU-EXB41 region in the corneal infection model.
Deletion of EXB35, an open reading frame of unknown function reduced the bacterial load in infected corneas (Figure 3.5A). Similarly, deletion of the gene encoding a putative transcription regulator, EXB39, and an adjacent putative
NADH-flavin oxidoreductase family protein, EXB41, resulted in reduced corneal opacification and reduced bacterial load (Figure 3.5A, B). As expected, deletion of the entire exoU-EXB41 region also resulted in a significant decrease in bacterial load compared to the parental ∆exoU mutant strain (Figure 3.5A). We attempted to complement the individual deletion mutants with plasmids expressing the corresponding open reading frame, but while the median bacterial load increased in all cases, complementation was only significant for the EXB41 deletion (Figure 3.5B, S3.1).
111
Figure 3.5: The role of NADH-flavin oxidoreductase in P. aeruginosa keratitis (A) Colony forming units (CFU) recovered from infected corneas 48 h post-infection of C57BL/6 mice infected with 1x105 CFU 19660 ΔexoU, 19660 ΔexoU-EXB41, 19660 ΔexoU ΔEXB35, 19660 ΔexoU ΔEXB36, 19660 ΔexoU ΔEXB37, 19660 ΔexoU ΔEXB39, and 19660 ΔexoU ΔEXB41. Median and interquartile range are indicated. Significance was calculated using the Kruskal-Wallis test, with Dunn’s multiple comparison correction. * p<0.05, ** p<0.01. All other comparisons were not significant. (B) Colony forming units (CFU) recovered from infected corneas 48 h post-infection of C57BL/6 mice infected with 1x105 CFU 19660 ΔexoU, 19660 ΔexoU-EXB41, 19660 ΔexoU ΔEXB41, and 19660 ΔexoU ΔEXB41 with a plasmid expressing the EXB41 gene (19660 ΔexoU ΔEXB41/EXB41). Significance was calculated using the Kruskal-Wallis test, with Dunn’s multiple comparison correction. * p<0.05, NS, not significant. (D) Representative images of corneal opacification 48 h post-infection.
112
The putative NADH-Flavin oxidoreductase EXB41 is not secreted
The open reading frames of the ExoU island seem to modulate virulence
in the context of a functional type III secretion system, since the virulence of
strain 19660 ∆exoTU, or strain 19660 ∆pscD, resembles that of PAO1 ∆pscD,
which lacks the ExoU-Island. One possible explanation is that the ExoU island
encodes a novel type III secreted effector. Since effector secretion can be
triggered artificially in vitro, by removing calcium from the medium, we first
analyzed concentrated low-calcium supernatants of strain 19660, 19660 ∆exoU,
19660 ∆exoU-EXB41, and 19660 ∆pscD by SDS-PAGE. We were unable to
detect any secreted proteins in the supernatant of strain 19660 ∆exoU, which
were absent in strain 19660 ∆exoU-EXB41, using this method (Figure 3.6A).
Since the abundance of these proteins may be low, we epitope tagged EXB41,
which plays a prominent role in bacterial survival in the cornea and development
of corneal disease, to determine whether it is secreted via the T3SS. However,
while ExoT was secreted into the culture supernatant upon removal of calcium
from the medium, EXB41 remained cell-associated at all times, indicating that it
is not secreted via the T3SS (Figure 3.6B). We also examined whether the
putative transcriptional regulator, EXB39, regulates EXB41 expression. However,
EXB39 had no effect on production of EXB41 under the conditions of the assay
(Figure 3.6B).
113
Figure 3.6: EXB41 is not a secreted effector. (A) Supernatant samples of cultures grown in the absence of calcium to induce effector secretion, were concentrated and separated by SDS-PAGE. Total protein was stained using Coomassie brilliant blue. N=2 (B) Total cell lysate and culture supernatants were processed for Western blot analysis to detect VSV-g tagged NADH-flavin oxidoreductase (EXB41), ExoT, and RpoA. Unless indicated, all strains have VSV-G tagged NADH-flavin oxidoreductase. Bacteria were grown either in the presence or absence of calcium as indicated. A representative of three independent experiments is shown.
114
DISCUSSION
Even before the genetic reason for the dichotomy was known, P.
aeruginosa isolates had been subdivided into “invasive” and “cytotoxic” isolates,
based on their ability to cause rapid necrosis of infected epithelial cells [276,
282]. It was later discovered, that this categorization depends on the type III
secreted effectors produced by a given strain. Invasive isolates tend to produce
ExoS, whereas cytotoxic isolates produce ExoU [27, 283]. Beyond this basic
difference in toxic activity directed against tissue culture cells, it was also noted
that ExoU-producing strains tend to cause more epithelial damage in animal
models of infection [27, 276], and ExoU-production itself is correlated with more severe disease in the clinic [267, 275].
Here we examined the role of ExoU in an animal model of microbial keratitis, isolating the effect of removing ExoU, by replacing ExoS with ExoU in the common laboratory strain PAO1. We found that replacing ExoS with ExoU, allowed strain PAO1 to replicate in vivo even at low infectious doses, which normally are not sufficient for establishing an infection, akin to the elevated virulence of the naturally ExoU-producing strain 19660, which has been used frequently to model corneal infections. These findings are consistent with data from a lung model of infection, where mutants of strain PA99, a rare isolate of P. aeruginosa which produces ExoS, ExoT, and ExoU, were used to isolate the effect of individual effectors on virulence. Here, production of ExoU was correlated with a lower LD50 [89].
115
Virulence of strain 19660 depends on an active type III secretion system,
and is an effector-driven process. A mutant of strain 19660 lacking exoT and
exoU is as defective for replication in the cornea as a complete type III secretion null mutant. These data recapitulate earlier observations with strain PA103, also an ExoU and ExoT-producing isolate, in which virulence, both in a lung model of infection, and in a keratitis model, depended on the production of these two effector proteins [34, 269].
In the course of studying individual effector null mutants, we noticed that a
mutant of strain 19660 lacking exoU (but still producing ExoT), still caused a significant corneal infiltrate of neutrophils, more than we had seen in the corresponding PAO1 mutant, engineered to also only produce ExoT. We reasoned that this increase in virulence must be a reflection of other virulence factors encoded on the 19660 genome. Indeed, a strain lacking a portion of the
ExoU genomic island that is not conserved in PAO1, EXB28-41, was less virulent than the parental strain 19660 ∆exoU, and more closely resembled the equivalent PAO1 strain (PAO1 ∆exoS ∆exoY), suggesting that the island encodes additional virulence factors. Notably, there is no apparent difference in virulence (or lack thereof) when comparing strains 19660 ∆pscD and PAO1
∆pscD, arguing that the difference in virulence seen between strain 19660 ∆exoU
and PAO1 ∆exoS ∆exoY, is only seen in the context of an intact T3SS, capable
of delivering ExoT. This T3SS-dependence indicates that the genes encoded on the ExoU island, modulate T3SS-dependent virulence. We narrowed the effect to three open reading frames in the island, EXB35, EXB39, and EXB41. Of
116
these, only two have been ascribed a potential functional role through homology.
EXB39 resembles a transcription factor in HxlR family, which activates
expression of the hxlAB operon in Bacillus subtilis [284], while EXB41 encodes a
putative NADH:flavin oxidoreductase family protein [108]. How these might
contribute to virulence is unclear. Deletion of EXB39 did not affect expression of
EXB41 under laboratory conditions, but this does not preclude that EXB39 might
be needed to, for example, up-regulate EXB41 expression in vivo. One possible
explanation for the increased type III secretion-dependent virulence, is that the
genomic island encodes a new type III secreted effector. In recent years, novel
effectors have been proposed [285, 286], but since their secretion depends on
removal of existent effectors, and the proteins often have no discernable effect
on the host cell, it is unclear if they represent bona fide effector proteins, or
simply proteins that are recognized aberrantly by the T3SS when the canonical
effectors are removed from the system. We examined the possibility that EXB41, the ORF with the most striking effect on virulence, is secreted by the T3SS, however, EXB41 remained cell-associated, arguing that it is not a new type III secreted effector. Most likely the virulence genes in the ExoU-island provide a function that synergizes with effectors to promote virulence, e.g. by increasing resistance to antimicrobial functions of neutrophils. This will have to be explored in future work.
Clearly, the contribution of the ExoU-island of strain 19660 to virulence extends beyond directing the production of ExoU. Here we demonstrate that a series of proteins encoded on the associate genomic island increase the
117 virulence of strain 19660 in a context-dependent manner, requiring the type III secretion dependent delivery of ExoT. The P. aeruginosa accessory genome therefore encodes modulators type III secretion dependent disease.
Figure S3.1: EXB35 and EXB39 complementation Colony forming units (CFU) recovered from infected corneas 48 h post-infection of C57BL/6 mice infected with 1x105 CFU 19660 ΔexoU ΔEXB39, 19660 ΔexoU ΔEXB39 with a plasmid expressing the exb39 gene (19660 ΔexoU ΔEXB39/EXB39), 19660 ΔexoU ΔEXB35, 19660 ΔexoU ΔEXB35 with a plasmid expressing the EXB35 gene (19660 ΔexoU ΔEXB35/EXB35). Significance was calculated using the Kruskal-Wallis test, with Dunn’s multiple comparison correction. * p<0.05, NS, not significant.
118
Chapter 4: Data Summary and Future Directions
119
Data Summary
P. aeruginosa directly inhibits ROS production for survival. Previous
work by our lab and others has demonstrated that injection of two effectors, ExoS
and ExoT, promotes survival of P. aeruginosa during infection. The increased
survival of P. aeruginosa in murine models of pneumonia and keratitis, as well as survival in neutrophils in vitro, can be attributed entirely to ADPRT activities of these two proteins. In Chapter 2, we demonstrate that ROS production by neutrophils is critical for P. aeruginosa clearance as despite the infiltration of neutrophils to infected corneas of CGD mice, they were unable to clear a T3SS-
null mutant. We found that P. aeruginosa ExoS and ExoT inhibit ROS production
in neutrophils. Inhibition is based on the ADP-ribosyl transferase activities of
ExoS and ExoT impairing NADPH oxidase activity. We also show that ExoS
specifically blocks the RAS-PI3Kγ interactions required for NADPH oxidase
assembly by ADP-ribosylating Ras on arginine 41. In a cell-free system and in
neutrophils in vivo, we demonstrate that ADP-ribosylation of Ras interferes with
its ability to bind to PI3Kγ. It remains unclear which protein is targeted for ADP-
ribosylation by ExoT in neutrophils and this will be examined in future studies.
Based upon these findings, we have identified a key mechanism by which P.
aeruginosa ExoS and ExoT subvert the anti-microbial activity of neutrophils
(Figure 4.1).
120
Figure 4.1: The role of ExoS and ExoT in inhibiting ROS production
The role of ExoU and the ExoU island in strain virulence. In the second study, expression of ExoU in strain 19660 and PAO1 was found to lower the infectious dose of P. aeruginosa. We found that not only does virulence of strain
19660 require ExoT and ExoU, but we also demonstrate that open reading frames EXB35, EXB39, and EXB41 in the exoU genomic island contribute to the strains pathogenicity. How the putative transcription factor (EXB39) and the putative NADH:flavin oxidoreductase (EXB41) contribute to virulence is unknown and will be explored in future studies discussed below.
121
Future Directions
Future Studies based on Chapter 2
In Chapter 2, I identified a mechanism by which the T3SS allows P.
aeruginosa to subvert neutrophil killing. The ADPRT activity of both ExoS and
ExoT was found to directly inhibit ROS production in neutrophils. ExoS targets
Ras for ADP-ribosylation resulting in impaired binding to PI3Kγ and an impaired
oxidative burst. TAT peptide-mediated cellular delivery of Ras(R41K) to exoT(A-)
infected neutrophils only partially rescued ROS production indicating that
additional substrates are ADP-ribosylated by ExoS. Given that there is no
substrate overlap between ExoS and ExoT targets, it remains unclear which
protein is ADP-ribosylated by ExoT. Future directions involve a) Identifying
additional ExoS targeted proteins and ExoT substrates, and b) defining the
mechanisms by which ADP-ribosylation affects their function.
Assembly of the NADPH oxidase system is a highly regulated process
involving phosphorylation, conformational changes, and translocation to the
plasma or phagosome membranes. For pathogen-containing phagosomes, the
generation of ROS is dependent on the translocation of membrane and cytosolic
NADPH oxidase components. Granule fusion facilitates the delivery and
incorporation of gp91phox/p22phox proteins into the phagosome membrane.
Preliminary data show greater granule fusion in ΔpscD-infected neutrophils than
PAO1-infected neutrophils (Figure 4.7), indicating that granule fusion is impaired by the T3SS; however, the effector protein underlying this is unknown. Blockade of granule fusion is one possible mechanism by which the ADPRT activity of
122
ExoS or ExoT can impair ROS production in neutrophils. Equally important as
granule fusion is the translocation of cytosolic Rac, p47phox, p67phox, and p40phox
to the phagosome membrane for NADPH oxidase assembly. A future direction is
therefore to examine the effect of ExoS and ExoT in trafficking of these proteins.
Discussed below are potential ExoS and ExoT substrates in neutrophils, their
relation to granule fusion or protein translocation, and possible mechanisms by
which ADP-ribosylation may affect their function. Specifically, proposed
experiments will examine ERM proteins, Rac, and Ras-GTPase family of
proteins, including Ras, Rap1, Ral, and Rab5.
ExoS and ExoT both require the eukaryotic 14-3-3 protein for full activity. It
is uncertain as to which 14-3-3 isoform in human neutrophils binds and activates the effector proteins. Moreover, the mechanisms by which 14-3-3 activate
ExoS/T is unknown. It is also unclear as to which receptor(s) on the neutrophil is responsible recognizing P. aeruginosa and initiating the RAS-PI3Kγ pathway for
ROS production. Proposed experiments will also examine the function of 14-3-3 proteins during infection and potential neutrophil PRRs that recognize P. aeruginosa.
Future Experiments: Possible additional substrates of ExoS
Ezrin, radixin, and moesin
Ezrin, radixin, and moesin (ERMs) are members of the ERM protein family
that play a critical role in organizing membrane domains through their ability to
interact with transmembrane proteins and the cytoskeleton. ERMs have a similar
123
domain structure, which is characterized by a FERM domain in the N-terminus
that mediates direct and indirect association with the plasma membrane and
microtubule binding, and the carboxyl-terminal (C-ERMAD) domain with F-actin binding sites (Figure 4.2) [287]. ERM activity is regulated by an intramolecular association between the FERM domain and the C-ERMAD domain. ERMs exist in a dormant, closed conformation state in which the two domains bind to each other concealing several binding sites [288]. The release of the C-ERMAD from the FERM domain is required for full activation and unmasks both the F-actin binding sites in the C-ERMAD domain and the binding sites in the FERM domain.
Phosphorylation of Thr576 on ezrin and Thr560 on radixin reduces the affinity of the FERM domain for the C-ERMAD domain [287]. In summary, activation of
ERM proteins is characterized as a two-step process. First, in its closed state,
ERMs bind to membrane regions rich in PI(4,5)P2 rendering the conserved Thr
residue more accessible for phosphorylation by Rho kinase and PKC. Second,
phosphorylation releases the binding between FERM and C-ERMAD allowing F-
actin binding and binding to membrane proteins such as CD44 and ICAM-2 [289-
291]. Future plans will detemine if inhibition of Thr phosphorylation affects
neutrophil ROS production.
Figure 4.2: ERM domain structure
124
Phagosome maturation is a dynamic process that is dependent on the
actin cytoskeleton and the microtubule network. Actin, actin-binding protein, and
ERM proteins are present in mature phagosomes of macrophages [196, 292],
and PI(4,5)P2, ezrin, moesin, and profilin participate in F-actin assembly in phagosomes [196, 292, 293]. Specifically, ezrin, through its FERM domain,
promotes F-actin assembly by recruiting and activating the N-WASP-Arp2/3 actin
nucleation machinery (Figure 4.3). Inhibition of ezrin activity in macrophages
blocked F-actin accumulation on phagosomes and thereby fusion between
phagosomes and lysosomes [292]. Interestingly, P. aeruginosa ExoS targets
ERM proteins for ADP-ribosylation in HeLa cells [77, 294] as injection of ExoS
inhibited moesin phosphorylation by adding ADP-ribose at three C-terminal
arginines (Arg553, Arg560 and Arg563) [77]. The proximity of the targeted
arginines to Thr558 suggests that steric hindrance of the ADP-ribose residues
prevents phosphorylation by PKC or Rho kinase [77]. Since ROS production in
neutrophils is dependent upon phagosomes fusing with granules to obtain the
NAPDH oxidase component gp91phox/p22phox, it is plausible that the inactivation
of ERM proteins by ADP-ribosylation prevents granule fusion and subsequently
ROS production (Figure 4.3).
To test this hypothesis, human neutrophils will be infected with a RFP
labeled P. aeruginosa mutant strain expressing only ExoS with either the GAP
activity inactivated [ΔexoTY exoS(G-)] or with both GAP and ADPRT activities
inactivated [ΔexoTY exoS(GA-)]. Granule fusion will be assessed by confocal microscopy. To detect the azurophilic, specific, and gelatinase granules, I will
125
stain for myeloperoxidase (MPO), lactoferrin, and gelatinase, respectively [131].
Co-localization of granule markers p22phox and gp91phox with RFP-bacteria will
identify granule fusion with phagosomes, and determine if granule fusion is
affected by ExoS ADPRT activity.
If granule fusion is impaired, future studies will investigate ADP- ribosylation of ERM proteins in neutrophils. Infected neutrophils will be permeabilized with tetanolysin and introduced to biotinylated NAD that will be the source of ADP-ribose for ExoS [81, 295]. ERM proteins will be
immunoprecipitated and ADP ribosylation of these proteins will be detected by
streptavidin-HRP.
Localization of ERM proteins on phagosomes in activated neutrophils will
also be assessed in addition to F-actin assembly via the N-Wasp-ARP2/3 complex. To assess this, confocal microscopy will be used and infected neutrophils will be stained for actin (phalloidin), ERM proteins, and phagosome membrane protein gp91phox. Co-localization of RFP-labeled bacteria with gp91phox
will be quantified and noted if ERM proteins or F-actin are associated. Finally, to
determine if ADP-ribosylated ERM proteins inhibit the oxidative burst by inhibiting
granule fusion, human neutrophils will be pre-incubated with recombinant TAT-
ERM(R553K, R560K, R563K) fusion protein and infected with RFP labeled
ΔexoTY exoS(-G) or ΔexoTY exoS(GA-). Confocal microscopy will determine if
granule fusion is restored by quantifying P. aeruginosa-containing phagosomes
that contain gp91phox or granule markers such as lactoferrin and gelatinase. ROS generation will be measured by luminol (as described in Chapter 2).
126
As shown in Figure 1.7, activation of the NADPH oxidase requires
association of it cytosolic subunits with the membrane-bound gp91phox/p22phox
proteins. [183]. Translocation of the p47phox-p67phox-p40phox complex to the
membrane/phagosome is controlled and facilitated by p47phox. Support for this comes from CGD patients lacking p47phox, in these patients the subunits p67phox,
p40phox, and the GTPase Rac all fail to translocate to the membrane/ phagosome
when stimulated with a ROS antagonist [185, 186]. The actin cytoskeleton is
thought to be a critical component of p47phox translocation to the plasma
membrane [195-198]. One study found that translocation of p47phox to the
membrane is mediated by its association with the actin cytoskeleton by direct
interaction between the PX domain of p47phox and the N-terminal FERM domain of moesin [199, 200]. ADP-ribosylation could mask the binding sites of the FERM domain thereby inhibiting p47phox translocation to the inner leaflet of the
membrane, resulting in impaired NADPH oxidase assembly and oxidative burst
(Figure 4.3).
The role of moesin in oxidase assembly will also be investigated in
addition to examining the effect of ADP-ribosylation of moesin. Neutrophils will be
infected with RFP-labeled PAO1, or exoS(A-), exoT(A-), exoST(A-) or ∆pscD
mutant strains and stained for p-p47phox, p-moesin, and gp91phox. Confocal
microcopy will be used to identify mature pathogen-containing phagosomes and co-localization of p47phox with the membrane oxidase components
(gp91phox/p22phox) will be quantified to determine if trafficking is affected[296].
Location of moesin on mature phagosomes will also be noted.
127
Figure 4.3: Proposed model of ERM regulating granule fusion and protein trafficking. 1) ERM proteins are phosphorylated on the conserved Thr residue. Activated ERMs recruit and activate N-Wasp-Arp2/3 complex. 2) N-Wasp-Arp2/3 mediate F-actin assembly on the phagosome. Cytoplasmic NAPDH units and granules traffic to the P. aeruginosa-containing phagosome. 3) Granules fusion occurs and antimicrobial activities begin. ADP-ribosylation inhibits the activation of ERM proteins.
Potential ADPRT substrate: Ral
Ral is a membrane-associated small GTPase that regulates vesicle trafficking in neurons, platelets, and neutrophils. [297-299]. Like all GTPases, Ral propagates signaling in cells by switching between an active-GTP bound or inactive-GDP bound state via Guanine nucleotide exchange factors (GEFs) and
GTPase-activating proteins (GAPs).
In human neutrophils, Ral is critical for the mobilization and release of secondary granules when stimulated with fMLP [300]. In unstimulated human neutrophils Ral in an active form but quickly becomes inactive after fLMP
128
stimulation. The release of secondary granule content is dependent upon inactivation of Ral indicating that GTP-bound Ral acts as a negative regulator of secondary granule degranulation (Figure 4.4). Conversely, in unstimulated platelets, Ral is inactive and becomes GTP-bound after stimulation [269]. The mechanism by which Ral regulates secondary granule release in neutrophils is unclear. In HT-29 and HeLa cells, Ral is ADP-ribosylated by ExoS, although the target arginine residue is unknown [75]. Moreover, the effect of ADP-ribosylated
Ral on cellular function has not been investigated. In neutrophils, Ral control of secondary granule release has only been demonstrated following stimulation with fMLP, therefore, the role of Ral in neutrophil bacterial infection has yet to be determined.
To test the role of Ral on secondary granule degranulation, constitutively active Tat-Ral(G23V) or a dominant negative Tat-Ral(S28N) will be delivered into human neutrophils and infected with an RFP labeled T3SS-null mutant (ΔpscD).
Secondary granule degranulation will be measured by ELISA to detect lactoferrin release. Also, confocal microscopy will be used to quantify P. aeruginosa- containing phagosomes that co-localizes with secondary granule markers lactoferrin or CD66b to determine the status of granule fusion. Tertiary granule and secretory vesicle release will be monitored by gelatinase and CD35/CR1 respectively. Like tertiary granules and secretory vesicles, secondary granules contain membrane bound gp91phox/p22phox proteins that are required for ROS production; however, it is unclear if one granule subset or a combination of
granules is responsible for delivery gp91phox/p22phox during P. aeruginosa
129
infection. Therefore, if Ral does control secondary granule fusion to P.
aeruginosa-containing phagosomes, I would also measure ROS to determine the
importance of secondary granules for neutrophil oxidative burst (Figure 4.4).
If secondary granules are critical for ROS production, ADP-ribosylation of
Ral will also be examined. Human neutrophils will be infected with strain exoT(A-
), cell lysates collected, and ADP-ribosylated Ral will be detected as a gel– mobility shift [301]. The effect of ADP-ribosylation might inhibit GAP binding, leaving Ral in a GTP-bound form that will inhibit secondary granule fusion. The
effects of ADP-ribosylation on Ral will be determined by measuring GTP-bound
Ral during infection.
130
Figure 4.4: Proposed model of Ral regulating secondary granule mobilization 1) GTP-bound Ral inhibits secondary granule exocytosis. 2) Ral is inactivated by GAPs allowing the secondary granule to fuse with the P. aeruginosa-containing phagosome. 3) Granule fusion occurs and antimicrobial activities begin. ADP-ribosylation of Ral inhibits GAPs from inactivating the protein thereby impairing secondary granule fusion.
Rab5 as a target for ADP-ribosylation
Rab5 is a small GTP-binding protein that is part of the small Ras-like
GTPase family. Rab proteins are molecular switches in which the nucleotide-
bound state of the protein influences its localization and activity. The GDP-bound
Rab is located in the cytosol and when activated (GTP-bound) is situated in the
membrane. As with other Ras-family proteins, the activity of Rab proteins is
controlled by switch I and II regions in the N-terminus, and which bind GTP and
GDP [302]. Rab proteins regulate intracellular membrane trafficking of several
131
microbes, including Listeria, Salmonella, and Mycobacterium [303-305]. Rab5 is
critical for phagosome-endosome fusion in macrophages and regulates
trafficking of endocytosed cargo from the plasma membrane [306]. In neutrophils,
Rab5 co-purifies with granules in density centrifugation, and directs the fusion of
secondary granules to S. aureus- and mycobacteria- containing phagosomes
(Figure 4.5) [264, 307].
The mechanism by which Rab5 regulate neutrophil granule fusion is
unknown. Rab GTPases bound to yeast secretory vesicles and melanosome
granules attach to myosin V-type motors to promote movement along actin
cables for cargo delivery [308]. Therefore, it is possible that F-actin helps drive the transport of all neutrophil granules to the pathogen-containing phagosome,
and also facilitates granule fusion by spatial regulation. Specificity of these
interactions may be achieved through Rab5 as it associates with the granule and
binds to a myosin v-type motor. Myosin can then propel granules along actin
filaments to the phagosome (Figure 4.5). ExoS ADP-ribosylates Rab5 on six
arginine sites: 81, 91, 110, 120, 195, and 197 [309]. Further, ADP-ribosylation of
Arg81, 91, 110, and 120 on Rab5 inhibits macrophage endocytosis [309],
suggesting that, perhaps in neutrophils, ADP-ribosylation of Rab5 will affect
granule fusion with P. aeruginosa-containing phagosomes (Figure 4.5).
Initial studies will determine if there is a role for Rab5 in ROS production.
Bone marrow neutrophils will be isolated from WT and Rab5-/- mice, infected with
a T3SS-null mutant (ΔpscD), and ROS production will be measured using the
luminol assay (as described in Chapter 2). If Rab5-/- neutrophils exhibit impaired
132
oxidative burst, the next step is to determine if Rab5 is ADP-ribosylated in
neutrophils. Human neutrophils infected with exoT(A-) mutant strain will be permeabilized with tetanolysin and treated with biotinylated NAD. Rab5 will be
immunoprecipitated and ADP ribosylation will be detected by western blot using
streptavidin-HRP. To determine the effects of ADP-ribosylation, I will measure
GTP-bound Rab5 using commercially available kits, and examine if secondary or tertiary granule fusion occurs by confocal microscopy (as described above).
Figure 4.5: Proposed model of Rab5 regulating granule trafficking. 1) Rab5 associate with secondary granules and bind to myosin motors which propel the granule along F-actin filaments until it reaches the P. aeruginosa-containing phagosome. 2) Granule fusion occurs and antimicrobial activities begin. ExoS ADP-ribosylates Rab5, thereby, inhibiting its association with myosin and affecting granule fusion.
133
Rap1a as a target for ADP-ribosylation
Rap1 is a small GTPase that induces cell signaling by switching between an active-GTP bound or inactive-GDP bound state via GEFs and GAPs. Two isoforms of Rap1 exists: Rap1a and Rap1b. Of the two isoforms, Rap1a is highly expressed in neutrophils and co-purifies with gp91phox/p22phox [310]. Although the
physiological relevance of this association is unknown, deletion of Rap1a from
neutrophils results in reduced fMLP-induced superoxide production [311]. It is
also unclear if Rap1 needs to be GTP-bound to bind to the membrane NADPH
oxidase components. Rap1 and Ras share >50% homology, and have 100%
identity in the switch I and switch II regions [312]. Similar to Ras, ExoS ADP-
ribosylates Rap1a at Arg41, thereby, inhibiting the interaction between Rap1a and the guanine nucleotide exchange factor C3G [313]. To determine if Rap1a is
ADP-riboylated in human neutrophils, cells will be infected with exoT(A-), cell
lysates collected, and ADP-ribosylated Rap1a will be detected as a gel–mobility
shift via western blot. Future studies should further investigate the mechanism by
which Rap1a regulates ROS production and how ADP-ribosylation affects this
process.
Rac as a substrate of ExoS
Rac is a member of the Rho family of GTPases that regulate actin
cytoskeleton, chemotaxis, and ROS production in neutrophils [314-319]. Rac1
and Rac2 share 92% amino acid identity with the only differences being in the C
terminus. Rac2 makes up >96% of the Rac in human neutrophils, whereas
mouse neutrophils express comparable amounts of Rac1 and Rac2 [320]. The
134
high degree of homology in the switch I and switch II regions of Rac1 and Rac2
indicate that these proteins can function interchangeably. In bone marrow Rac1-/-
and Rac2-/- neutrophils, recruitment, chemotaxis, and chemoattractant-mediated actin polymerization are downregulated [319, 321]. Interestingly, Rac1-/-
- neutrophils generate normal levels of superoxide, whereas O2 production is
diminished in neutrophils lacking Rac2 [316, 319]. Rac1 and Rac2 are both
critical for actin-mediated neutrophil functions such as recruitment and
chemotaxis; however, Rac2 is specifically required for NADPH oxidase activation
and ROS production. Binding of activated Rac2 to gp9phox/p22phox and p67phox
completes the NADPH oxidase system for ROS production (Figure 4.6).
The importance of Rac2 in human disease is illustrated by a Rac2 mutation in a 5-week-old male infant, who had severe bacterial infections and poor wound healing, which is similar to patients with CGD or neutropenia.
Analysis of the patient’s neutrophils revealed a point mutation of the Rac2 gene in residue Asp57, which was substituted by an asparagine (Rac2D57N) [322, 323].
Rac2D57N can bind to GDP but not GTP and prevents NADPH oxidase activation and ROS production [322].
ExoS can ADP-ribosylate Rac1 but this activity is dependent on the cell line used. ADP-riboslyated Rac1 is detected in human epithelial and fibroblastic cells but not in lymphocytic or macrophage cell lines [324]. Whether Rac2 is
ADP-ribosylated by ExoS has not been reported. In Rac1, the arginine residues at position 66 and 68 are targeted for ADP-ribosylation by ExoS [324]. Given that both arginines are in a GTP-binding domain of the switch I region, it is possible
135
that the addition of ADP-ribose inhibits Rac1 activation. If Rac2 is found to be
ADP-ribsoylated, and given the shared homology with Rac1, ADP-ribosylation of
Rac2 may result in impaired ROS production since the protein cannot be activated (Figure 4.6).
To examine if Rac1 or Rac2 is ADP-ribosylated in human neutrophils, cells will be infected with exoT(A-) mutant strain, cell lysates collected, and ADP- ribosylated Rac1 or Rac2 will be detected by gel–mobility shift. If Rac2 is indeed
ADP-ribosylated, the targeted residues will need to be identified. Since Rac1 and
Rac2 share 92% homology, I predict that the targeted arginines will be similar to
Rac1, which are located in the GTP-binding domain (switch I region). To assess the impact of ADP-ribosylation on Rac2 activation, levels of GTP-bound Rac2 will be examined in infected neutrophils. In addition, the location of ADP-ribosylated
Rac2 will be investigated by confocal microscopy using antibodies for gp91phox
and Rac2, and infecting with a RFP labeled exoT(A-).
136
Figure 4.6: Rac activation of NADPH oxidase complex. GTP-bound Rac traffics to the membrane to bind to gp91phox and p67phox. ROS production begins when all cytosolic NADPH oxidase components associate with gp91phox/p22phox. ExoS adds ADP-ribose to the switch I region inhibiting activation of Rac2.
Unknown Substrates
To date, targets of ExoS ADP-ribosylation have mostly been characterized
in epithelial, fibroblastic, and macrophage cell lines of human and mouse origin
[59]. This raises the possibility that an uncharacterized, neutrophil-specific
protein could be targeted. To detect other ADP-ribosylated neutrophil-specific
targets, human neutrophils will be infected with mutant strain exoT(A-),
permeabilized with tetanolysin, treated with biotinylated NAD and
immunoprecipitated. Detected bands will be compared to lysates from non-
infected neutrophils to detect ADP-ribosylated bands specific to ExoS targeting.
Bands that meet this criterion will be excised and identified by mass
spectrometry.
137
Targeted substrates of ExoT
ExoT mediated ADP-ribosylation results in impaired phosphorylation of
Akt and p40phox. Yet, in contrast to ExoS, Ras is not ADP-ribosylated ExoT, implying that ExoT blocks PI3K mediated signaling by targeting another substrate. Known substrates for ExoT include Ct10 regulator of kinase 1 (CrkI),
CrkII, and phosphoglycerate kinase.
CrkI/II as a substrate in neutrophils
Possible ExoT substrates of interest within neutrophils are CrkI and CrkII.
Crk proteins are SH2-SH3 domain containing cytoskeletal adaptors involved in the activation of Rac. Specifically, Crk proteins activate and recruit the Elmo1/
DOCK180 complex which are the guanine nucleotide exchange factors responsible for activating Rac [325, 326]. As described above, Rac is a small
GTPase critical for activation of the NADPH oxidase complex (Figure 4.7). In
addition, activated Rac regulates actin cytoskeleton remodeling by activating
Wave1/2 which then activates Arp2/3 to promote actin nucleation [327].
In macrophages, CrkII and Dock180 are found to accumulate at the
phagocytic cup. CrkII deletion prevented recruitment of Dock180 and activation
of Rac in the phagocytic cup resulting in inhibition of Fcy receptor-mediated
phagocytosis[328]. ADP-ribosylation of CrkI/II in HeLa cells prevents the
activation of Rac indirectly by preventing Crk-dependent recruitment of the Rac
guanine-nucleotide exchange factor Dock180 [82]. As translocation of p47phox in
endothelial cells is induced by Wave1, it is possible that Wave1-induced actin nucleation plays a role in translocation of the cytoplasmic oxidase complex to the
138
membrane in infected neutrophils [329]. Thus, the disruption of Crk signaling by
ADP-ribosylation could disrupt phagocytosis, F-actin mediated granule fusion, or
translocation of NAPDH oxidase components (Figure 4.6). Currently, it is unclear
if human neutrophils express Crk proteins.
Crk expression will be examined by western blot of membrane versus
cytosol. If Crk is expressed by neutrophils, Crk-/- mice will be used to test if
deletion of Crk affects neutrophil functions. To determine if Crk signaling
regulates oxidative burst, Crk-/- bone marrow neutrophils will be infected with a
T3SS-null mutant (ΔpscD) and ROS production will be measured using the
luminol assay (as described in Chapter 2). For phagocytosis, intracellular uptake
of RFP labeled zymosan beads and RFP labeled ΔpscD will be assayed in Crk-/-
bone marrow neutrophils as described in Chapter 2. If these cellular functions
depend on Crk, I would assess if Crk proteins are ADP-ribosylated. In HeLa cells,
CrkI/II is ADP-ribosylated at Arg20 and as a result is unable to bind to DOCK180 for nucleotide exchange. To examine if CrkI/II is ADP-ribosylated, human neutrophils will be infected with mutant strain exoS(A-), permeabilized with tetanolysin and treated with biotinylated NAD. Crk will be pulled down and ADP ribosylation will be detected by western blot using streptavidin-HRP. To
determine the mechanism by which ADP-ribsoylated effects ROS production, infected human neutrophils will be intracellularly stained with granule markers lactoferrin, gelatinase, and gp91phox/p22phox to detect co-localization with RFP
labeled exoS(A-). Trafficking of examined by confocal microscopy as described
139
above. Lastly, activated GTP-bound Rac will be quantified by using commercially available kits.
Figure 4.7: Proposed model of Crk signaling and ExoT mediated inhibition. Phosphorylated Crk recruits Dock180 to activate Rac. A) GTP-bound Rac mediates phagocytosis of P. aeruginosa. B) GTP-bound Rac activates Wave to induce actin assembly for p47phox and granule trafficking to the P. aeruginosa- containing phagosome. Crk is ADP-ribosylated thereby inhibiting Rac activation, and affecting phagocytosis and trafficking. Gelsolin as a potential substrate for ExoT
Gelsolin is an actin binding protein that regulates severing and capping
actin filaments. Gelsolin’s actin rearrangement activity is dependent upon
calcium and the protein constitutes about 1% of the total neutrophil protein [330].
Preliminary data indicates that neutrophil derived gelsolin, in the presence of
140
calcium, is ADP-ribosylated by ExoT (data not shown). In neutrophils, deletion of gelsolin had no effect on primary or secondary granule fusion with the phagosome [331]. Moreover, loss of gelsolin in neutrophils inhibits IgG-mediated phagocytosis [331]. Stimulated fibroblasts from gelsolin KO mice have decreased
GTP-Rac indicating that Rac activation is dependent upon gelsolin [332].
Activation of Rac is required for phosphorylation of Akt at Thr308 which in turn is required for NADPH oxidase activation. Therefore, it is possible that ADP- ribosylation of gelsolin inhibits Rac and Akt activation subsequently impairing
NADPH oxidase activation and ROS production. To test this, human neutrophils will be infected with exoS(A-) or ΔpscD, cell lysates collected, and GTP-bound
Rac will be detected by WB. Phosphorylated Akt is diminished in human neutrophils infected with exoS(A-) (Figure 2.3) Future studies will need to assess which residue(s) is ADP-riboyslated by ExoT.
Unknown Substrates
To date, targets of ExoT ADP-ribosylation have only been characterized in
HeLa cells [81]. Much like ExoS, this raises the possibility that an uncharacterized, neutrophil-specific protein could be targeted. To detect other
ADP-ribosylated neutrophil-specific targets, human neutrophils will be infected with mutant strain exoT(A-), permeabilized with tetanolysin, treated with biotinylated NAD and immunoprecipitated. Detected bands will be compared to lysates from non-infected neutrophils to detect ADP-ribosylated bands specific to
ExoS targeting. Bands that meet this criterion will be excised and identified by mass spectrometry.
141
Characterization of 14-3-3 proteins in neutrophils
14-3-3 proteins play a role in multiple signaling cascades. 14-3-3 serves
different functions that can be divided into five classes: (i) binding of 14-3-3 can
alter the target protein ability to interact with other proteins [333]. (ii) 14-3-3 can
serve as a scaffold by bridging two proteins together [334]. (iii) 14-3-3 binding can protect a protein from post-translational modifications [335]. (iv) 14-3-3 binding can alter localization [336]. (v) 14-3-3 binding can inhibit or augment the function of a target protein by altering its catalytic activity [337]. It has been noted that 14-3-3 can exert more than one function in the regulation of a target protein.
Most interactions between 14-3-3 and other proteins occur in a phospho- specific manner. However, there are instances in which phosphorylation- independent interactions occur between 14-3-3 and target proteins. Proteins involved with phosphorylation-independent 14-3-3 interaction include p75NTR- associated cell death executor (NADE), 5-phosphatase, ExoS, and ExoT [338-
341]. There are seven identified 14-3-3 isoforms in mammals and it has been
shown in vitro that all seven isoforms can bind to ExoS and ExoT [71]. 14-3-3
proteins are needed to activate ExoS/T; however, which isoforms bind and
activate ExoS/T in specific cell types is unknown. The requirement of a
eukaryotic 14-3-3 protein to activate ExoS/T is a mechanism by which effector
proteins will not target P. aeruginosa proteins prior to secretion. ExoS/T
specificity is confined to host cell proteins since 14-3-3 is derived from the host
cell and ExoS/T doesn’t return to P. aeruginosa once secreted by the T3SS. With
regards to ExoS/T, the mechanism of 14-3-3 regulation is unknown. It is unlikely
142 that 14-3-3 functions as (iii) because studies have shown that the MLD domain of
ExoS determines localization even when bound to 14-3-3.
To assess which 14-3-3 isoforms are present in human neutrophils, cell lysates will be collected and examined by western blot for all seven isoforms. To determine which 14-3-3 cofactor is bound to ExoS or ExoT neutrophils will be infected with wildtype-PAO1 strain, mutant strains in which ExoS and/or ExoT are deleted, or T3SS null mutant (ΔpscD). After infection, cells lysates will be immunoprecipitated with anti-ExoS/T antibody. Proteins in the immunoprecipitate will be separated by SDS-PAGE and immunoblotted against ExoS/T and specific
14-3-3 isoform. To determine if 14-3-3 acts as a scaffold, neutrophils will be given TAT-FLAG ExoS or TAT-FLAG ExoS without the 14-3-3 binding motif. The
TAT-FLAG ExoS will be isolated, run on SDS-PAGE, and immunoblotted for
ExoS/T, 14-3-3, and potential target proteins: Ras, ERM protein, or Rab5.
Neutrophil PRR responsible for recognizing P. aeruginosa
Currently, it is unclear which receptor(s) triggered by P. aeruginosa and initiate downstream signals required for ROS production. In addition, it is unknown which P. aeruginosa pathogen associated molecular pattern (PAMP) ligands are recognized by neutrophils. Toll-like receptor 4 (TLR4) is ubiquitously expressed on the neutrophil cell surface and detects LPS. Therefore, it is possible that TLR4 recognizes the LPS on the outer membrane of P. aeruginosa and induces ROS production. The importance of TLR4 in host defense against P. aeruginosa has been demonstrated in murine models of pulmonary infection and cornea infection [238, 342]. Mice deficient in TLR4 exhibit less neutrophil
143
recruitment to the site of infection and higher bacterial loads when in infected with a ΔfliC mutant strain (flagellin is not expressed). It seems that increased
bacterial load in TLR4-/- is due to decreased neutrophil infiltration; however, ROS
production by TLR4-/- neutrophils stimulated with P. aeruginosa has not been
examined. The role of TLR4 in ROS production can be assessed by
chemiluminesence. Using luminol to detect ROS, neutrophils from TLR4-/- mice
will be infected with a P. aeruginosa strain that is T3SS-null mutant and lacks flagellin (PAO1 ΔpscD ΔfliC). P. aeruginosa strains PAO1 and 19660 contain a flagellin for motility. Neutrophils also express TLR5 which recognizes flagellin;
therefore, TLR5/flagellin should also be assessed for activating the oxidative
burst in neutrophils as mentioned above. Given that both TLR4 and TLR5 signal
through the IRAK4 pathway it is important to consider the redundancy between
the two receptors. Interestingly, neutrophils from patients with IRAK4 deficiency
generate less ROS when stimulated with LPS+fMLP compared to normal neutrophils [343, 344].
Chapter 3 Future Studies
Our data demonstrate that strain 19660 is more virulent than strain PAO1 in the cornea. This increased virulence is due to the expression of ExoU.
Moreover, 19660 harbors a B-type exoU genomic island that is required for full
pathogenicity of the strain. The putative NADH:flavin oxidoreductase encoded in
the ExoU genomic island was identified as a potential virulent factor. Future
studies will examine the function of this putative NADH:flavin oxidoreductase. In
144
addition, the expression of the B-type exoU genomic island in clinical isolates and ExoU’s potential to inhibit ROS production will be investigated.
Putative NADH:flavin oxidoreductase and H2O-forming oxidases
NADH oxidases are flavoenzymes in which the flavin cofactor is the
electron mediator. Flavin-containing NADH oxidases have been purified and
characterized from several bacteria including Streptococcus faecalis,
Amphibacillus xylanus, Bacillus megaterium, and Leuconostoc mesenteroids
[345-348]. Flavin-containing NADH oxidases can be categorized into two groups:
H2O2- and H2O-forming NADH oxidases. H2O2-foming NADH oxidases catalyze
the reduction of O2 to hydrogen peroxide and H2O-forming oxidases catalyze the
reduction of hydrogen peroxide to water. The Amphibacillus xylanus NADH
oxidase reduce oxygen to hydrogen peroxide with β-NADH and reduce hydrogen
peroxide to water in the presence of free flavin adenine dinuceotide (FAD) [346].
In Aspergillus fumigatus, anti-oxidative pathways are essential for optimal fungal
growth in the presence of human neutrophils and are required for fungal survival
in vivo [349]. It is therefore possible that the putative NADH:flavin
oxidoreductase, found in the ExoU island, is an enzyme responsible for
converting ROS into less toxic products thereby impairing neutrophil killing.
Whether NADH:flavin oxidoreductase is required for optimal bacterial
survival under ROS toxic conditions will be examined. Survival will be compared
in vitro between 19660 ΔexoU ΔEXB41 and 19660 ΔexoU in the presence of
hydrogen peroxide and without. In addition, the importance of the NADH:flavin
oxidoreductase for intracellular survival will be assessed by using the survival
145 assay (described in Chapter 2) comparing 19660 ΔexoU ΔEXB41, 19660 ΔexoU, and 19660 ΔexoU-ΔEXB41. The impact of this anti-oxidative enzyme will be assessed in other strains of P. aeruginosa that lack the putative NADH:flavin oxidoreductase. To evaluate this, the putative NADH:flavin oxidoreductase will be introduced to a PAO1 mutant strain lacking all three effectors (PAO1 Δ3TOX
EXB41+) and tested for survival in presence of hydrogen peroxide and within neutrophils.
In future studies, the putative NADH:flavin oxidoreductase will be isolated from strain 19660 by fractionation and affinity chromatography. Once purified, I will determine if the protein is a H2O2- or a H2O-forming NADH oxidase by assessing if oxygen is consumed to produce hydrogen peroxide or hydrogen peroxide is consumed to produce with or without FAD. Further analysis of the
NADH:flavin oxidoreductase will include determining the optimum pH and temperature for the enzyme’s activity.
Our data indicate that the NADH:flavin oxidoreductase is not secreted and expression is not dependent on the T3SS secretion. To further understand the characteristics of the putative NADH:flavin oxidoreductase I will determine if it complexes with other proteins. This will be tested by immunoprecipitating VSV-G tagged putative NADH:flavin oxidoreductase and mass spec to see if other proteins are pulled down. Investigation into whether expression of the
NADH:flavin oxidoreductase protein changes in response to a stressed environment will need to be investigated. To test this, strains 19660 ΔexoU and
19660 ΔexoU ΔEXB41 bacteria will be exposed to hydrogen peroxide,
146 hypochlorous acid, or antimicrobial peptides, bacterial pellets collected, and levels of VSV-G tagged NADH:flavin oxidoreductase will be measured by western blot.
Pathogenicity Island Screening
P. aeruginosa strain to strain variation in virulence can be attributed to accessory genomes and the genomic islands found within them. A genomic island that encodes virulence factors that endow pathogenic characteristics upon the strain that harbors them is identified as a pathogenicity island. Our data in
Chapter 3 indicates that the B-type ExoU genomic island in 19660 is indeed a pathogenicity island as it is required for full virulence. Future studies will express the B-type ExoU island in strains that lack this island and evaluate changes in pathogenicity. To assess this, corneas will be infected with a PAO1 strain that only expresses ExoT and has the ExoU island inserted (PAO1 ΔexoSY EXB35-
EXB41+). Corneal disease and CFU will be compared to strains PAO1 ΔexoSY and PAO1 ΔexoSY exoU+. In patients, correlation of disease severity and outcome, and ExoU island expression among clinical isolates will be assessed.
In addition, clinical isolates from different anatomical sites will be examined for expression of the ExoU island.
ExoU and Impairment of the Oxidative Burst
ExoU possesses a potent phospholipase A2 activity and once inside the host cell can induce cell death within 2-5 hours of injection depending on the cell type [27, 84, 85]. In HeLa cells and at the early stage of infection, ExoU targets
147 and hydrolyzes the plasma membrane lipid phosphatidylinositol 4,5-bisphosphate
[PI(4,5)P2 ] [85, 350]. Reduction in PI(4,5)P2 disrupts the anchoring and association of focal adhesion proteins and cytoskeletal structure with the plasma membrane. Then, actin depolymerization and collapse of the cytoskeleton occurs due to loss of PI(4,5)P2-mediated actin regulation. Up to this point, the outer leaflet of the plasma membrane is still intact and the cell is alive. At the late stage of infection, the outer leaflet of the membrane finally ruptures resulting in cell death.
Our data indicates that P. aeruginosa induces ROS production in neutrophils within 10 minutes of infection (Figure 2.3). Given that cell death occurs in 2-5 hours it is unclear, during early infection, if intracellular P. aeruginosa are being cleared by ROS prior to the neutrophil’s death. Specifically, the impact of PI(4,5)P2 hydrolysis on granule fusion, protein trafficking, and ROS production is unclear. The cytosolic NADPH oxidase component p47phox contains
phox a PX domain that allows it to bind to PI(3,4,5)P2. Since p47 is complexed with
phox phox p67 and p40 , the PX domain binding to PI(3,4,5)P2 is critical for translocation of the trimeric complex to the membrane and activation of the entire
NADPH oxidase system [351]. I predict that depletion of PI(4,5)P2 by ExoU will inhibit binding of cytosolic NADPH oxidase components with the membrane components resulting in impaired ROS generation and increased intracellular survival for P. aeruginosa. Activated PI3K targets PI(4,5)P2 for phosphorylation to form PI(3,4,5)P2 allowing for further propagation of PI3K signaling. Effector
148
proteins with PH domains can bind to PI(3,4,5)P2 for activation or translocation
from the cytosol to the inner leaflet of the plasma membrane.
Akt activation is PI3K-dependent as the protein’s PH domain binds to
PI(3,4,5)P2, thereby promoting its phosphorylation on Thr308 by the upstream
kinase phosphoinositide-dependent kinase 1 (PDK1) [352, 353]. Activated Akt is
responsible for phosphorylating p47phox and is critical for ROS production.
Hydrolysis of PI(4,5)P2 may lead to low levels of PI(3,4,5)P2 interfering with Akt phosphorylation and subsequent activation of p47phox. I predict that blockade of p47phox phosphorylation will lead to defective ROS production.
To investigate if ExoU inhibits ROS production, human neutrophils will be
infected with a mutant strain that only expresses ExoU (19660 ΔexoT) and ROS
will be measured by luminol (as described in Chapter 2). If oxidative burst is
inhibited, I will examine p47phox translocation and actin depolymerization by
confocal microscopy using phalloidin and antibodies for p47phox and gp91phox. In
addition, cell lysates from infected neutrophils will be probed by western blot for
levels of phosphorylated Akt and phosphorylated p47phox. Lastly, I will measure
the effects of ExoU’s phospholipase A2 activity on P. aeruginosa survival within neutrophils. To do so, the survival assay highlighted in Chapter 2 will be performed. These experiments will provide insight into if ExoU disrupts ROS- related signaling pathways leading to increased survival in the neutrophil and ultimately in the cornea and other tissues.
149
Preliminary Data
Figure 4.7 T3SS-dependent inhibition of granule fusion by strain PAO1. A) Human neutrophils were infected with red fluorescent (mCherry) PAO1 or PAO1 ∆pscD for 45 minutes. Granule fusion with the phagosome was monitored by confocal microscopy. White arrowheads indicate bacteria in phagosomes that have fused. Co-localization of marker proteins (p22phox: secondary and tertiary granules, MPO: primary granules) with phagosomes was quantitated B) Percent intracellular bacteria co- localized with p22phox (n= number of bacteria evaluated).
150
References
1. Sorvillo, F., et al., Incidence and determinants of Pseudomonas aeruginosa infection among persons with HIV: association with hospital exposure. Am J Infect Control, 2001. 29(2): p. 79-84. 2. Williams, B.J., J. Dehnbostel, and T.S. Blackwell, Pseudomonas aeruginosa: host defence in lung diseases. Respirology, 2010. 15(7): p. 1037-56. 3. Bodey, G.P., Pseudomonas aeruginosa infections in cancer patients: have they gone away? Curr Opin Infect Dis, 2001. 14(4): p. 403-7. 4. Roy-Burman, A., et al., Type III protein secretion is associated with death in lower respiratory and systemic Pseudomonas aeruginosa infections. J Infect Dis, 2001. 183(12): p. 1767-74. 5. Stapleton, F. and N. Carnt, Contact lens-related microbial keratitis: how have epidemiology and genetics helped us with pathogenesis and prophylaxis. Eye (Lond), 2012. 26(2): p. 185-93. 6. Van Delden, C. and B.H. Iglewski, Cell-to-cell signaling and Pseudomonas aeruginosa infections. Emerg Infect Dis, 1998. 4(4): p. 551-60. 7. Crouch Brewer, S., et al., Ventilator-associated pneumonia due to Pseudomonas aeruginosa. Chest, 1996. 109(4): p. 1019-29. 8. Rello, J., et al., Survival in patients with nosocomial pneumonia: impact of the severity of illness and the etiologic agent. Crit Care Med, 1997. 25(11): p. 1862-7. 9. Maschmeyer, G. and I. Braveny, Review of the incidence and prognosis of Pseudomonas aeruginosa infections in cancer patients in the 1990s. Eur J Clin Microbiol Infect Dis, 2000. 19(12): p. 915-25. 10. Ratjen, F., Diagnosing and managing infection in CF. Paediatr Respir Rev, 2006. 7 Suppl 1: p. S151-3. 11. Chastre, J. and J.Y. Fagon, Ventilator-associated pneumonia. Am J Respir Crit Care Med, 2002. 165(7): p. 867-903. 12. Krcmery, V., et al., Pseudomonas aeruginosa bacteraemia in cancer patients. J Infect, 2006. 52(6): p. 461-3. 13. Mendelson, M.H., et al., Pseudomonas aeruginosa bacteremia in patients with AIDS. Clin Infect Dis, 1994. 18(6): p. 886-95. 14. Lee, H.G., et al., Blood stream infections in patients in the burn intensive care unit. Infect Chemother, 2013. 45(2): p. 194-201. 15. Wagenlehner, F.M. and K.G. Naber, Hospital-acquired urinary tract infections. J Hosp Infect, 2000. 46(3): p. 171-81. 16. Hamasuna, R., et al., Bacteria of preoperative urinary tract infections contaminate the surgical fields and develop surgical site infections in urological operations. Int J Urol, 2004. 11(11): p. 941-7. 17. Wang, M.C., et al., Ear problems in swimmers. J Chin Med Assoc, 2005. 68(8): p. 347-52. 18. Sy, A., et al., Pseudomonas aeruginosa keratitis: outcomes and response to corticosteroid treatment. Invest Ophthalmol Vis Sci, 2012. 53(1): p. 267-72. 19. Cornelis, G.R., The type III secretion injectisome. Nat Rev Microbiol, 2006. 4(11): p. 811- 25. 20. Berthelot, P., et al., Genotypic and phenotypic analysis of type III secretion system in a cohort of Pseudomonas aeruginosa bacteremia isolates: evidence for a possible association between O serotypes and exo genes. J Infect Dis, 2003. 188(4): p. 512-8.
151
21. El-Solh, A.A., et al., Clinical outcomes of type III Pseudomonas aeruginosa bacteremia. Crit Care Med, 2012. 40(4): p. 1157-63. 22. Pena, C., et al., Influence of virulence genotype and resistance profile in the mortality of Pseudomonas aeruginosa bloodstream infections. Clin Infect Dis, 2015. 60(4): p. 539-48. 23. Hauser, A.R., et al., Type III protein secretion is associated with poor clinical outcomes in patients with ventilator-associated pneumonia caused by Pseudomonas aeruginosa. Crit Care Med, 2002. 30(3): p. 521-8. 24. El Solh, A.A., et al., Persistent infection with Pseudomonas aeruginosa in ventilator- associated pneumonia. Am J Respir Crit Care Med, 2008. 178(5): p. 513-9. 25. Ader, F., et al., Alveolar response to Pseudomonas aeruginosa: role of the type III secretion system. Infect Immun, 2005. 73(7): p. 4263-71. 26. Dacheux, D., et al., Cell death of human polymorphonuclear neutrophils induced by a Pseudomonas aeruginosa cystic fibrosis isolate requires a functional type III secretion system. Infect Immun, 1999. 67(11): p. 6164-7. 27. Finck-Barbancon, V., et al., ExoU expression by Pseudomonas aeruginosa correlates with acute cytotoxicity and epithelial injury. Mol Microbiol, 1997. 25(3): p. 547-57. 28. Lee, V.T., et al., Activities of Pseudomonas aeruginosa effectors secreted by the Type III secretion system in vitro and during infection. Infect Immun, 2005. 73(3): p. 1695-705. 29. Sawa, T., et al., In vitro cellular toxicity predicts Pseudomonas aeruginosa virulence in lung infections. Infect Immun, 1998. 66(7): p. 3242-9. 30. Vance, R.E., A. Rietsch, and J.J. Mekalanos, Role of the type III secreted exoenzymes S, T, and Y in systemic spread of Pseudomonas aeruginosa PAO1 in vivo. Infect Immun, 2005. 73(3): p. 1706-13. 31. Nicas, T.I. and B.H. Iglewski, Isolation and characterization of transposon-induced mutants of Pseudomonas aeruginosa deficient in production of exoenzyme S. Infect Immun, 1984. 45(2): p. 470-4. 32. Starkey, M., et al., Identification of anti-virulence compounds that disrupt quorum- sensing regulated acute and persistent pathogenicity. PLoS Pathog, 2014. 10(8): p. e1004321. 33. Balachandran, P., et al., The ubiquitin ligase Cbl-b limits Pseudomonas aeruginosa exotoxin T-mediated virulence. J Clin Invest, 2007. 117(2): p. 419-27. 34. Lee, E.J., et al., Contribution of ExsA-regulated factors to corneal infection by cytotoxic and invasive Pseudomonas aeruginosa in a murine scarification model. Invest Ophthalmol Vis Sci, 2003. 44(9): p. 3892-8. 35. Sun, Y., et al., ExoS and ExoT ADP ribosyltransferase activities mediate Pseudomonas aeruginosa keratitis by promoting neutrophil apoptosis and bacterial survival. J Immunol, 2012. 188(4): p. 1884-95. 36. Hauser, A.R. and J.N. Engel, Pseudomonas aeruginosa induces type-III-secretion- mediated apoptosis of macrophages and epithelial cells. Infect Immun, 1999. 67(10): p. 5530-7. 37. Saliba, A.M., et al., Type III secretion-mediated killing of endothelial cells by Pseudomonas aeruginosa. Microb Pathog, 2002. 33(4): p. 153-66. 38. Diaz, M.H., et al., Pseudomonas aeruginosa induces localized immunosuppression during pneumonia. Infect Immun, 2008. 76(10): p. 4414-21. 39. Karmakar, M., et al., Cutting edge: IL-1beta processing during Pseudomonas aeruginosa infection is mediated by neutrophil serine proteases and is independent of NLRC4 and caspase-1. J Immunol, 2012. 189(9): p. 4231-5.
152
40. Diaz, M.H. and A.R. Hauser, Pseudomonas aeruginosa cytotoxin ExoU is injected into phagocytic cells during acute pneumonia. Infect Immun, 2010. 78(4): p. 1447-56. 41. Czechowska, K., et al., Cheating by type 3 secretion system-negative Pseudomonas aeruginosa during pulmonary infection. Proc Natl Acad Sci U S A, 2014. 111(21): p. 7801- 6. 42. Deng, W., et al., Assembly, structure, function and regulation of type III secretion systems. Nat Rev Microbiol, 2017. 43. Pastor, A., et al., PscF is a major component of the Pseudomonas aeruginosa type III secretion needle. FEMS Microbiol Lett, 2005. 253(1): p. 95-101. 44. Blaylock, B., et al., Characterization of the Yersinia enterocolitica type III secretion ATPase YscN and its regulator, YscL. J Bacteriol, 2006. 188(10): p. 3525-34. 45. Koster, M., et al., The outer membrane component, YscC, of the Yop secretion machinery of Yersinia enterocolitica forms a ring-shaped multimeric complex. Mol Microbiol, 1997. 26(4): p. 789-97. 46. Journet, L., et al., The needle length of bacterial injectisomes is determined by a molecular ruler. Science, 2003. 302(5651): p. 1757-60. 47. Hauser, A.R., The type III secretion system of Pseudomonas aeruginosa: infection by injection. Nature Reviews Microbiology, 2009. 7(9): p. 654-665. 48. Schoehn, G., et al., Oligomerization of type III secretion proteins PopB and PopD precedes pore formation in Pseudomonas. EMBO J, 2003. 22(19): p. 4957-67. 49. Lee, P.C., et al., Control of effector export by the Pseudomonas aeruginosa type III secretion proteins PcrG and PcrV. Mol Microbiol, 2010. 75(4): p. 924-41. 50. Goure, J., et al., The V antigen of Pseudomonas aeruginosa is required for assembly of the functional PopB/PopD translocation pore in host cell membranes. Infect Immun, 2004. 72(8): p. 4741-50. 51. Cisz, M., P.C. Lee, and A. Rietsch, ExoS controls the cell contact-mediated switch to effector secretion in Pseudomonas aeruginosa. J Bacteriol, 2008. 190(8): p. 2726-38. 52. Vallis, A.J., et al., Regulation of ExoS production and secretion by Pseudomonas aeruginosa in response to tissue culture conditions. Infection and Immunity, 1999. 67(2): p. 914-20. 53. Iglewski, B.H., et al., Pseudomonas aeruginosa exoenzyme S: an adenosine diphosphate ribosyltransferase distinct from toxin A. Proc Natl Acad Sci U S A, 1978. 75(7): p. 3211-5. 54. Rietsch, A. and J.J. Mekalanos, Metabolic regulation of type III secretion gene expression in Pseudomonas aeruginosa. Mol Microbiol, 2006. 59(3): p. 807-820. 55. Goure, J., et al., Protective anti-V antibodies inhibit Pseudomonas and Yersinia translocon assembly within host membranes. J Infect Dis, 2005. 192(2): p. 218-25. 56. Sawa, T., et al., Active and passive immunization with the Pseudomonas V antigen protects against type III intoxication and lung injury. Nat Med, 1999. 5(4): p. 392-8. 57. Armentrout, E.I. and A. Rietsch, The Type III Secretion Translocation Pore Senses Host Cell Contact. PLoS Pathog, 2016. 12(3): p. e1005530. 58. Dacheux, D., et al., Pore-forming activity of type III system-secreted proteins leads to oncosis of Pseudomonas aeruginosa-infected macrophages. Mol Microbiol, 2001. 40(1): p. 76-85. 59. Hauser, A.R., The type III secretion system of Pseudomonas aeruginosa: infection by injection. Nat Rev Microbiol, 2009. 7(9): p. 654-65. 60. Feltman, H., et al., Prevalence of type III secretion genes in clinical and environmental isolates of Pseudomonas aeruginosa. Microbiology, 2001. 147(Pt 10): p. 2659-69.
153
61. Yahr, T.L., J. Goranson, and D.W. Frank, Exoenzyme S of Pseudomonas aeruginosa is secreted by a type III pathway. Mol Microbiol, 1996. 22(5): p. 991-1003. 62. Deng, Q. and J.T. Barbieri, Molecular mechanisms of the cytotoxicity of ADP-ribosylating toxins. Annu Rev Microbiol, 2008. 62: p. 271-88. 63. Zhang, Y., Q. Deng, and J.T. Barbieri, Intracellular localization of type III-delivered Pseudomonas ExoS with endosome vesicles. J Biol Chem, 2007. 282(17): p. 13022-32. 64. Riese, M.J. and J.T. Barbieri, Membrane localization contributes to the in vivo ADP- ribosylation of Ras by Pseudomonas aeruginosa ExoS. Infection and Immunity, 2002. 70(4): p. 2230-2. 65. Zhang, Y., et al., Plasma membrane localization affects the RhoGAP specificity of Pseudomonas ExoS. Cell Microbiol, 2007. 9(9): p. 2192-201. 66. Pederson, K.J., et al., The amino-terminal domain of Pseudomonas aeruginosa ExoS disrupts actin filaments via small-molecular-weight GTP-binding proteins. Mol Microbiol, 1999. 32(2): p. 393-401. 67. Goehring, U.M., et al., The N-terminal domain of Pseudomonas aeruginosa exoenzyme S is a GTPase-activating protein for Rho GTPases. J Biol Chem, 1999. 274(51): p. 36369-72. 68. Rocha, C.L., et al., Characterization of Pseudomonas aeruginosa exoenzyme S as a bifunctional enzyme in J774A.1 macrophages. Infect Immun, 2003. 71(9): p. 5296-305. 69. Knight, D.A., et al., Functional domains of Pseudomonas aeruginosa exoenzyme S. Infection and Immunity, 1995. 63(8): p. 3182-6. 70. Riese, M.J., et al., Auto-ADP-ribosylation of Pseudomonas aeruginosa ExoS. J Biol Chem, 2002. 277(14): p. 12082-8. 71. Henriksson, M.L., et al., A nonphosphorylated 14-3-3 binding motif on exoenzyme S that is functional in vivo. Eur J Biochem, 2002. 269(20): p. 4921-9. 72. Ottmann, C., et al., Phosphorylation-independent interaction between 14-3-3 and exoenzyme S: from structure to pathogenesis. EMBO J, 2007. 26(3): p. 902-13. 73. Morrison, D.K., The 14-3-3 proteins: integrators of diverse signaling cues that impact cell fate and cancer development. Trends Cell Biol, 2009. 19(1): p. 16-23. 74. Pederson, K.J. and J.T. Barbieri, Intracellular expression of the ADP-ribosyltransferase domain of Pseudomonas exoenzyme S is cytotoxic to eukaryotic cells. Mol Microbiol, 1998. 30(4): p. 751-9. 75. Fraylick, J.E., et al., Independent and coordinate effects of ADP-ribosyltransferase and GTPase-activating activities of exoenzyme S on HT-29 epithelial cell function. Infect Immun, 2001. 69(9): p. 5318-28. 76. Barbieri, A.M., et al., ADP-ribosylation of Rab5 by ExoS of Pseudomonas aeruginosa affects endocytosis. Infect Immun, 2001. 69(9): p. 5329-34. 77. Maresso, A.W., et al., Pseudomonas aeruginosa ExoS ADP-ribosyltransferase inhibits ERM phosphorylation. Cell Microbiol, 2007. 9(1): p. 97-105. 78. Ganesan, A.K., et al., Pseudomonas aeruginosa exoenzyme S disrupts Ras-mediated signal transduction by inhibiting guanine nucleotide exchange factor-catalyzed nucleotide exchange. J Biol Chem, 1999. 274(31): p. 21823-9. 79. Ganesan, A.K., et al., Pseudomonas aeruginosa exoenzyme S disrupts Ras-mediated signal transduction by inhibiting guanine nucleotide exchange factor-catalyzed nucleotide exchange. Journal of Biological Chemistry, 1999. 274(31): p. 21823-21829. 80. Pederson, K.J., et al., Intracellular localization modulates targeting of ExoS, a type III cytotoxin, to eukaryotic signalling proteins. Mol Microbiol, 2002. 46(5): p. 1381-90. 81. Sun, J. and J.T. Barbieri, Pseudomonas aeruginosa ExoT ADP-ribosylates CT10 regulator of kinase (Crk) proteins. J Biol Chem, 2003. 278(35): p. 32794-800.
154
82. Deng, Q., J. Sun, and J.T. Barbieri, Uncoupling Crk signal transduction by Pseudomonas exoenzyme T. J Biol Chem, 2005. 280(43): p. 35953-60. 83. Phillips, R.M., et al., In vivo phospholipase activity of the Pseudomonas aeruginosa cytotoxin ExoU and protection of mammalian cells with phospholipase A2 inhibitors. J Biol Chem, 2003. 278(42): p. 41326-32. 84. Sato, H., et al., The mechanism of action of the Pseudomonas aeruginosa-encoded type III cytotoxin, ExoU. EMBO J, 2003. 22(12): p. 2959-69. 85. Sato, H. and D.W. Frank, Intoxication of Host Cells by the T3SS Phospholipase ExoU: PI(4,5)P-2-Associated, Cytoskeletal Collapse and Late Phase Membrane Blebbing. Plos One, 2014. 9(7). 86. Sato, H., J.B. Feix, and D.W. Frank, Identification of superoxide dismutase as a cofactor for the pseudomonas type III toxin, ExoU. Biochemistry, 2006. 45(34): p. 10368-75. 87. Rabin, S.D. and A.R. Hauser, Functional regions of the Pseudomonas aeruginosa cytotoxin ExoU. Infect Immun, 2005. 73(1): p. 573-82. 88. Howell, H.A., L.K. Logan, and A.R. Hauser, Type III secretion of ExoU is critical during early Pseudomonas aeruginosa pneumonia. MBio, 2013. 4(2): p. e00032-13. 89. Shaver, C.M. and A.R. Hauser, Relative contributions of Pseudomonas aeruginosa ExoU, ExoS, and ExoT to virulence in the lung. Infect Immun, 2004. 72(12): p. 6969-77. 90. Schulert, G.S., et al., Secretion of the toxin ExoU is a marker for highly virulent Pseudomonas aeruginosa isolates obtained from patients with hospital-acquired pneumonia. J Infect Dis, 2003. 188(11): p. 1695-706. 91. Yahr, T.L., et al., ExoY, an adenylate cyclase secreted by the Pseudomonas aeruginosa type III system. Proc Natl Acad Sci U S A, 1998. 95(23): p. 13899-904. 92. Belyy, A., et al., Actin activates Pseudomonas aeruginosa ExoY nucleotidyl cyclase toxin and ExoY-like effector domains from MARTX toxins. Nat Commun, 2016. 7: p. 13582. 93. Cowell, B.A., D.J. Evans, and S.M. Fleiszig, Actin cytoskeleton disruption by ExoY and its effects on Pseudomonas aeruginosa invasion. FEMS Microbiol Lett, 2005. 250(1): p. 71- 6. 94. Vallis, A.J., et al., Biological effects of Pseudomonas aeruginosa type III-secreted proteins on CHO cells. Infect Immun, 1999. 67(4): p. 2040-4. 95. Yahr, T.L., et al., Transcriptional analysis of the Pseudomonas aeruginosa exoenzyme S structural gene. J Bacteriol, 1995. 177(5): p. 1169-78. 96. Shen, D.K., et al., Orf1/SpcS chaperones ExoS for type three secretion by Pseudomonas aeruginosa. Biomed Environ Sci, 2008. 21(2): p. 103-9. 97. Jander, G., L.G. Rahme, and F.M. Ausubel, Positive correlation between virulence of Pseudomonas aeruginosa mutants in mice and insects. J Bacteriol, 2000. 182(13): p. 3843-5. 98. Mahajan-Miklos, S., et al., Molecular mechanisms of bacterial virulence elucidated using a Pseudomonas aeruginosa-Caenorhabditis elegans pathogenesis model. Cell, 1999. 96(1): p. 47-56. 99. Silo-Suh, L., et al., A simple alfalfa seedling infection model for Pseudomonas aeruginosa strains associated with cystic fibrosis shows AlgT (sigma-22) and RhlR contribute to pathogenesis. Proc Natl Acad Sci U S A, 2002. 99(24): p. 15699-704. 100. Stover, C.K., et al., Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature, 2000. 406(6799): p. 959-64. 101. Wolfgang, M.C., et al., Conservation of genome content and virulence determinants among clinical and environmental isolates of Pseudomonas aeruginosa. Proc Natl Acad Sci U S A, 2003. 100(14): p. 8484-9.
155
102. Mathee, K., et al., Dynamics of Pseudomonas aeruginosa genome evolution. Proc Natl Acad Sci U S A, 2008. 105(8): p. 3100-5. 103. Kung, V.L., E.A. Ozer, and A.R. Hauser, The accessory genome of Pseudomonas aeruginosa. Microbiol Mol Biol Rev, 2010. 74(4): p. 621-41. 104. Lee, D.G., et al., Genomic analysis reveals that Pseudomonas aeruginosa virulence is combinatorial. Genome Biol, 2006. 7(10): p. R90. 105. Battle, S.E., et al., Hybrid pathogenicity island PAGI-5 contributes to the highly virulent phenotype of a Pseudomonas aeruginosa isolate in mammals. J Bacteriol, 2008. 190(21): p. 7130-40. 106. Dobrindt, U., et al., Genomic islands in pathogenic and environmental microorganisms. Nat Rev Microbiol, 2004. 2(5): p. 414-24. 107. Battle, S.E., J. Rello, and A.R. Hauser, Genomic islands of Pseudomonas aeruginosa. FEMS Microbiol Lett, 2009. 290(1): p. 70-8. 108. Kulasekara, B.R., et al., Acquisition and evolution of the exoU locus in Pseudomonas aeruginosa. J Bacteriol, 2006. 188(11): p. 4037-50. 109. Klockgether, J., et al., Sequence analysis of the mobile genome island pKLC102 of Pseudomonas aeruginosa C. J Bacteriol, 2004. 186(2): p. 518-34. 110. Harrison, E.M., et al., Pathogenicity islands PAPI-1 and PAPI-2 contribute individually and synergistically to the virulence of Pseudomonas aeruginosa strain PA14. Infect Immun, 2010. 78(4): p. 1437-46. 111. He, J., et al., The broad host range pathogen Pseudomonas aeruginosa strain PA14 carries two pathogenicity islands harboring plant and animal virulence genes. Proc Natl Acad Sci U S A, 2004. 101(8): p. 2530-5. 112. Donowitz, G.R., et al., Infections in the neutropenic patient--new views of an old problem. Hematology Am Soc Hematol Educ Program, 2001: p. 113-39. 113. Borregaard, N., Development of neutrophil granule diversity. Ann N Y Acad Sci, 1997. 832: p. 62-8. 114. von Vietinghoff, S. and K. Ley, Homeostatic regulation of blood neutrophil counts. J Immunol, 2008. 181(8): p. 5183-8. 115. Hernandez, P.A., et al., Mutations in the chemokine receptor gene CXCR4 are associated with WHIM syndrome, a combined immunodeficiency disease. Nat Genet, 2003. 34(1): p. 70-4. 116. Balabanian, K., et al., WHIM syndromes with different genetic anomalies are accounted for by impaired CXCR4 desensitization to CXCL12. Blood, 2005. 105(6): p. 2449-57. 117. Wengner, A.M., et al., The coordinated action of G-CSF and ELR + CXC chemokines in neutrophil mobilization during acute inflammation. Blood, 2008. 111(1): p. 42-9. 118. Pillay, J., et al., In vivo labeling with 2H2O reveals a human neutrophil lifespan of 5.4 days. Blood, 2010. 116(4): p. 625-7. 119. Kolaczkowska, E. and P. Kubes, Neutrophil recruitment and function in health and inflammation. Nat Rev Immunol, 2013. 13(3): p. 159-75. 120. Borregaard, N., Neutrophils, from marrow to microbes. Immunity, 2010. 33(5): p. 657- 70. 121. Lawrence, M.B., et al., Threshold levels of fluid shear promote leukocyte adhesion through selectins (CD62L,P,E). J Cell Biol, 1997. 136(3): p. 717-27. 122. Patel, K.D., et al., Neutrophils use both shared and distinct mechanisms to adhere to selectins under static and flow conditions. J Clin Invest, 1995. 96(4): p. 1887-96.
156
123. von Andrian, U.H., et al., L-selectin mediates neutrophil rolling in inflamed venules through sialyl LewisX-dependent and -independent recognition pathways. Blood, 1993. 82(1): p. 182-91. 124. Ley, K., et al., Getting to the site of inflammation: the leukocyte adhesion cascade updated. Nat Rev Immunol, 2007. 7(9): p. 678-89. 125. Mueller, H., et al., Tyrosine kinase Btk regulates E-selectin-mediated integrin activation and neutrophil recruitment by controlling phospholipase C (PLC) gamma2 and PI3Kgamma pathways. Blood, 2010. 115(15): p. 3118-27. 126. Zarbock, A., et al., Galphai2 is required for chemokine-induced neutrophil arrest. Blood, 2007. 110(10): p. 3773-9. 127. Xu, J., et al., Neutrophil microtubules suppress polarity and enhance directional migration. Proc Natl Acad Sci U S A, 2005. 102(19): p. 6884-9. 128. Van Keymeulen, A., et al., To stabilize neutrophil polarity, PIP3 and Cdc42 augment RhoA activity at the back as well as signals at the front. J Cell Biol, 2006. 174(3): p. 437-45. 129. Phillipson, M., et al., Intraluminal crawling of neutrophils to emigration sites: a molecularly distinct process from adhesion in the recruitment cascade. J Exp Med, 2006. 203(12): p. 2569-75. 130. Kobayashi, Y., The role of chemokines in neutrophil biology. Front Biosci, 2008. 13: p. 2400-7. 131. Amulic, B., et al., Neutrophil function: from mechanisms to disease. Annu Rev Immunol, 2012. 30: p. 459-89. 132. Nathan, C., Neutrophils and immunity: challenges and opportunities. Nat Rev Immunol, 2006. 6(3): p. 173-82. 133. Segal, A.W., J. Dorling, and S. Coade, Kinetics of fusion of the cytoplasmic granules with phagocytic vacuoles in human polymorphonuclear leukocytes. Biochemical and morphological studies. J Cell Biol, 1980. 85(1): p. 42-59. 134. Borregaard, N., O.E. Sorensen, and K. Theilgaard-Monch, Neutrophil granules: a library of innate immunity proteins. Trends Immunol, 2007. 28(8): p. 340-5. 135. Borregaard, N. and J.B. Cowland, Granules of the human neutrophilic polymorphonuclear leukocyte. Blood, 1997. 89(10): p. 3503-21. 136. Borregaard, N., et al., Changes in subcellular localization and surface expression of L- selectin, alkaline phosphatase, and Mac-1 in human neutrophils during stimulation with inflammatory mediators. J Leukoc Biol, 1994. 56(1): p. 80-7. 137. Sengelov, H., L. Kjeldsen, and N. Borregaard, Control of exocytosis in early neutrophil activation. Journal of Immunology, 1993. 150(4): p. 1535-43. 138. Kjeldsen, L., et al., Subcellular localization and release of human neutrophil gelatinase, confirming the existence of separate gelatinase-containing granules. Biochem J, 1992. 287 ( Pt 2): p. 603-10. 139. Kjeldsen, L., et al., Structural and functional heterogeneity among peroxidase-negative granules in human neutrophils: identification of a distinct gelatinase-containing granule subset by combined immunocytochemistry and subcellular fractionation. Blood, 1993. 82(10): p. 3183-91. 140. Lacy, P., The role of Rho GTPases and SNAREs in mediator release from granulocytes. Pharmacol Ther, 2005. 107(3): p. 358-76. 141. Klebanoff, S.J., Myeloperoxidase. Proc Assoc Am Physicians, 1999. 111(5): p. 383-9. 142. Nusse, O. and M. Lindau, The dynamics of exocytosis in human neutrophils. J Cell Biol, 1988. 107(6 Pt 1): p. 2117-23.
157
143. Hahn, I., et al., Cathepsin G and neutrophil elastase play critical and nonredundant roles in lung-protective immunity against Streptococcus pneumoniae in mice. Infect Immun, 2011. 79(12): p. 4893-901. 144. Liu, Z., et al., A critical role for neutrophil elastase in experimental bullous pemphigoid. J Clin Invest, 2000. 105(1): p. 113-23. 145. Ganz, T., Defensins: antimicrobial peptides of innate immunity. Nat Rev Immunol, 2003. 3(9): p. 710-20. 146. Bullen, J.J. and J.A. Armstrong, The role of lactoferrin in the bactericidal function of polymorphonuclear leucocytes. Immunology, 1979. 36(4): p. 781-91. 147. Ellison, R.T., 3rd, The effects of lactoferrin on gram-negative bacteria. Adv Exp Med Biol, 1994. 357: p. 71-90. 148. Hood, M.I. and E.P. Skaar, Nutritional immunity: transition metals at the pathogen-host interface. Nat Rev Microbiol, 2012. 10(8): p. 525-37. 149. Bundgaard, J.R., et al., Molecular cloning and expression of a cDNA encoding NGAL: a lipocalin expressed in human neutrophils. Biochem Biophys Res Commun, 1994. 202(3): p. 1468-75. 150. Jesaitis, A.J., et al., Ultrastructural localization of cytochrome b in the membranes of resting and phagocytosing human granulocytes. J Clin Invest, 1990. 85(3): p. 821-35. 151. Gallin, J.I., Neutrophil specific granule deficiency. Annu Rev Med, 1985. 36: p. 263-74. 152. McIlwaine, L., et al., Neutrophil-specific granule deficiency. Br J Haematol, 2013. 160(6): p. 735. 153. Gombart, A.F., et al., Neutrophil-specific granule deficiency: homozygous recessive inheritance of a frameshift mutation in the gene encoding transcription factor CCAAT/enhancer binding protein--epsilon. Blood, 2001. 97(9): p. 2561-7. 154. Umei, T., et al., Identification of the NADPH-binding subunit of the respiratory burst oxidase. J Biol Chem, 1991. 266(10): p. 6019-22. 155. Smith, R.M., et al., The cytosolic subunit p67phox contains an NADPH-binding site that participates in catalysis by the leukocyte NADPH oxidase. J Clin Invest, 1996. 98(4): p. 977-83. 156. Park, J.W. and B.M. Babior, Activation of the leukocyte NADPH oxidase subunit p47phox by protein kinase C. A phosphorylation-dependent change in the conformation of the C- terminal end of p47phox. Biochemistry, 1997. 36(24): p. 7474-80. 157. Babior, B.M., NADPH oxidase: an update. Blood, 1999. 93(5): p. 1464-76. 158. Diekmann, D., et al., Interaction of Rac with p67phox and regulation of phagocytic NADPH oxidase activity. Science, 1994. 265(5171): p. 531-3. 159. Stolk, J., et al., Characteristics of the inhibition of NADPH oxidase activation in neutrophils by apocynin, a methoxy-substituted catechol. Am J Respir Cell Mol Biol, 1994. 11(1): p. 95-102. 160. Babior, B.M., R.S. Kipnes, and J.T. Curnutte, Biological defense mechanisms. The production by leukocytes of superoxide, a potential bactericidal agent. J Clin Invest, 1973. 52(3): p. 741-4. 161. Fridovich, I., Oxygen toxicity: a radical explanation. J Exp Biol, 1998. 201(Pt 8): p. 1203-9. 162. Halliwell, B., Tell me about free radicals, doctor: a review. J R Soc Med, 1989. 82(12): p. 747-52. 163. Krinsky, N.I., Singlet excited oxygen as a mediator of the antibacterial action of leukocytes. Science, 1974. 186(4161): p. 363-5. 164. Beckman, J.S. and W.H. Koppenol, Nitric oxide, superoxide, and peroxynitrite: the good, the bad, and ugly. Am J Physiol, 1996. 271(5 Pt 1): p. C1424-37.
158
165. Groemping, Y. and K. Rittinger, Activation and assembly of the NADPH oxidase: a structural perspective. Biochem J, 2005. 386(Pt 3): p. 401-16. 166. Quinn, M.T. and K.A. Gauss, Structure and regulation of the neutrophil respiratory burst oxidase: comparison with nonphagocyte oxidases. J Leukoc Biol, 2004. 76(4): p. 760-81. 167. Rotrosen, D., et al., Cytochrome b558: the flavin-binding component of the phagocyte NADPH oxidase. Science, 1992. 256(5062): p. 1459-62. 168. Ponting, C.P., Novel domains in NADPH oxidase subunits, sorting nexins, and PtdIns 3- kinases: binding partners of SH3 domains? Protein Sci, 1996. 5(11): p. 2353-7. 169. Koshkin, V., O. Lotan, and E. Pick, Electron transfer in the superoxide-generating NADPH oxidase complex reconstituted in vitro. Biochim Biophys Acta, 1997. 1319(2-3): p. 139- 46. 170. Isogai, Y., T. Iizuka, and Y. Shiro, The mechanism of electron donation to molecular oxygen by phagocytic cytochrome b558. J Biol Chem, 1995. 270(14): p. 7853-7. 171. DeLeo, F.R., et al., Processing and maturation of flavocytochrome b558 include incorporation of heme as a prerequisite for heterodimer assembly. J Biol Chem, 2000. 275(18): p. 13986-93. 172. Huang, J., N.D. Hitt, and M.E. Kleinberg, Stoichiometry of p22-phox and gp91-phox in phagocyte cytochrome b558. Biochemistry, 1995. 34(51): p. 16753-7. 173. Borregaard, N., et al., Subcellular localization of the b-cytochrome component of the human neutrophil microbicidal oxidase: translocation during activation. J Cell Biol, 1983. 97(1): p. 52-61. 174. Kjeldsen, L., et al., Isolation and characterization of gelatinase granules from human neutrophils. Blood, 1994. 83(6): p. 1640-9. 175. Jog, N.R., et al., The actin cytoskeleton regulates exocytosis of all neutrophil granule subsets. Am J Physiol Cell Physiol, 2007. 292(5): p. C1690-700. 176. Finan, P., et al., An SH3 domain and proline-rich sequence mediate an interaction between two components of the phagocyte NADPH oxidase complex. J Biol Chem, 1994. 269(19): p. 13752-5. 177. Hiroaki, H., et al., Solution structure of the PX domain, a target of the SH3 domain. Nat Struct Biol, 2001. 8(6): p. 526-30. 178. Yuzawa, S., et al., Solution structure of the tandem Src homology 3 domains of p47phox in an autoinhibited form. J Biol Chem, 2004. 279(28): p. 29752-60. 179. Bedard, K. and K.H. Krause, The NOX family of ROS-generating NADPH oxidases: Physiology and pathophysiology. Physiological Reviews, 2007. 87(1): p. 245-313. 180. Wientjes, F.B., et al., p40phox, a third cytosolic component of the activation complex of the NADPH oxidase to contain src homology 3 domains. Biochem J, 1993. 296 ( Pt 3): p. 557-61. 181. Grizot, S., et al., Small angle neutron scattering and gel filtration analyses of neutrophil NADPH oxidase cytosolic factors highlight the role of the C-terminal end of p47phox in the association with p40phox. Biochemistry, 2001. 40(10): p. 3127-33. 182. Fuchs, A., M.C. Dagher, and P.V. Vignais, Mapping the domains of interaction of p40phox with both p47phox and p67phox of the neutrophil oxidase complex using the two-hybrid system. J Biol Chem, 1995. 270(11): p. 5695-7. 183. Lapouge, K., et al., Architecture of the p40-p47-p67phox complex in the resting state of the NADPH oxidase. A central role for p67phox. J Biol Chem, 2002. 277(12): p. 10121-8. 184. El-Benna, J., et al., p47phox, the phagocyte NADPH oxidase/NOX2 organizer: structure, phosphorylation and implication in diseases. Exp Mol Med, 2009. 41(4): p. 217-25.
159
185. Dusi, S., M. Donini, and F. Rossi, Mechanisms of NADPH oxidase activation: translocation of p40phox, Rac1 and Rac2 from the cytosol to the membranes in human neutrophils lacking p47phox or p67phox. Biochem J, 1996. 314 ( Pt 2): p. 409-12. 186. Heyworth, P.G., et al., Neutrophil nicotinamide adenine dinucleotide phosphate oxidase assembly. Translocation of p47-phox and p67-phox requires interaction between p47- phox and cytochrome b558. J Clin Invest, 1991. 87(1): p. 352-6. 187. Fontayne, A., et al., Phosphorylation of p47phox sites by PKC alpha, beta II, delta, and zeta: effect on binding to p22phox and on NADPH oxidase activation. Biochemistry, 2002. 41(24): p. 7743-50. 188. Chen, Q., et al., Akt phosphorylates p47phox and mediates respiratory burst activity in human neutrophils. Journal of Immunology, 2003. 170(10): p. 5302-8. 189. Dang, P.M., et al., Protein kinase C zeta phosphorylates a subset of selective sites of the NADPH oxidase component p47phox and participates in formyl peptide-mediated neutrophil respiratory burst. Journal of Immunology, 2001. 166(2): p. 1206-13. 190. Inanami, O., et al., Activation of the leukocyte NADPH oxidase by phorbol ester requires the phosphorylation of p47PHOX on serine 303 or 304. J Biol Chem, 1998. 273(16): p. 9539-43. 191. Johnson, J.L., et al., Activation of p47(PHOX), a cytosolic subunit of the leukocyte NADPH oxidase. Phosphorylation of ser-359 or ser-370 precedes phosphorylation at other sites and is required for activity. J Biol Chem, 1998. 273(52): p. 35147-52. 192. Pacquelet, S., et al., Cross-talk between IRAK-4 and the NADPH oxidase. Biochem J, 2007. 403(3): p. 451-61. 193. Martyn, K.D., et al., p21-activated kinase (Pak) regulates NADPH oxidase activation in human neutrophils. Blood, 2005. 106(12): p. 3962-9. 194. Chessa, T.A., et al., Phosphorylation of threonine 154 in p40phox is an important physiological signal for activation of the neutrophil NADPH oxidase. Blood, 2010. 116(26): p. 6027-36. 195. Grogan, A., et al., Cytosolic phox proteins interact with and regulate the assembly of coronin in neutrophils. J Cell Sci, 1997. 110 ( Pt 24): p. 3071-81. 196. Defacque, H., et al., Involvement of ezrin/moesin in de novo actin assembly on phagosomal membranes. EMBO J, 2000. 19(2): p. 199-212. 197. el Benna, J., J.M. Ruedi, and B.M. Babior, Cytosolic guanine nucleotide-binding protein Rac2 operates in vivo as a component of the neutrophil respiratory burst oxidase. Transfer of Rac2 and the cytosolic oxidase components p47phox and p67phox to the submembranous actin cytoskeleton during oxidase activation. J Biol Chem, 1994. 269(9): p. 6729-34. 198. Kobayashi, T., S. Tsunawaki, and H. Seguchi, Evaluation of the process for superoxide production by NADPH oxidase in human neutrophils: evidence for cytoplasmic origin of superoxide. Redox Rep, 2001. 6(1): p. 27-36. 199. Wientjes, F.B., et al., The NADPH oxidase components p47(phox) and p40(phox) bind to moesin through their PX domain. Biochem Biophys Res Commun, 2001. 289(2): p. 382-8. 200. Zhan, Y., et al., p47(phox) PX domain of NADPH oxidase targets cell membrane via moesin-mediated association with the actin cytoskeleton. J Cell Biochem, 2004. 92(4): p. 795-809. 201. Tamura, M., et al., Identification of an actin-binding site in p47phox an organizer protein of NADPH oxidase. FEBS Lett, 2006. 580(1): p. 261-7.
160
202. Zhan, Y., et al., The p40phox and p47phox PX domains of NADPH oxidase target cell membranes via direct and indirect recruitment by phosphoinositides. J Biol Chem, 2002. 277(6): p. 4512-8. 203. Lapouge, K., et al., Structure of the TPR domain of p67phox in complex with Rac.GTP. Mol Cell, 2000. 6(4): p. 899-907. 204. Heyworth, P.G., A.R. Cross, and J.T. Curnutte, Chronic granulomatous disease. Curr Opin Immunol, 2003. 15(5): p. 578-84. 205. Soler-Palacin, P., et al., Chronic granulomatous disease in pediatric patients: 25 years of experience. Allergol Immunopathol (Madr), 2007. 35(3): p. 83-9. 206. Liese, J., et al., Long-term follow-up and outcome of 39 patients with chronic granulomatous disease. J Pediatr, 2000. 137(5): p. 687-93. 207. Winkelstein, J.A., et al., Chronic granulomatous disease. Report on a national registry of 368 patients. Medicine (Baltimore), 2000. 79(3): p. 155-69. 208. Hawkins, P.T., et al., PI3K signaling in neutrophils. Curr Top Microbiol Immunol, 2010. 346: p. 183-202. 209. Vanhaesebroeck, B., L. Stephens, and P. Hawkins, PI3K signalling: the path to discovery and understanding. Nat Rev Mol Cell Biol, 2012. 13(3): p. 195-203. 210. Song, M.S., L. Salmena, and P.P. Pandolfi, The functions and regulation of the PTEN tumour suppressor. Nat Rev Mol Cell Biol, 2012. 13(5): p. 283-96. 211. Suire, S., et al., Gbetagammas and the Ras binding domain of p110gamma are both important regulators of PI(3)Kgamma signalling in neutrophils. Nat Cell Biol, 2006. 8(11): p. 1303-9. 212. Lehmann, K., et al., PI3Kgamma controls oxidative bursts in neutrophils via interactions with PKCalpha and p47phox. Biochem J, 2009. 419(3): p. 603-10. 213. Stoyanov, B., et al., Cloning and characterization of a G protein-activated human phosphoinositide-3 kinase. Science, 1995. 269(5224): p. 690-3. 214. Stephens, L.R., et al., The G beta gamma sensitivity of a PI3K is dependent upon a tightly associated adaptor, p101. Cell, 1997. 89(1): p. 105-14. 215. Brock, C., et al., Roles of G beta gamma in membrane recruitment and activation of p110 gamma/p101 phosphoinositide 3-kinase gamma. J Cell Biol, 2003. 160(1): p. 89-99. 216. Pacold, M.E., et al., Crystal structure and functional analysis of Ras binding to its effector phosphoinositide 3-kinase gamma. Cell, 2000. 103(6): p. 931-43. 217. Barbacid, M., ras genes. Annu Rev Biochem, 1987. 56: p. 779-827. 218. Casey, P.J., et al., p21ras is modified by a farnesyl isoprenoid. Proc Natl Acad Sci U S A, 1989. 86(21): p. 8323-7. 219. Seabra, M.C., et al., Protein farnesyltransferase and geranylgeranyltransferase share a common alpha subunit. Cell, 1991. 65(3): p. 429-34. 220. Hancock, J.F., et al., All ras proteins are polyisoprenylated but only some are palmitoylated. Cell, 1989. 57(7): p. 1167-77. 221. Vigil, D., et al., Ras superfamily GEFs and GAPs: validated and tractable targets for cancer therapy? Nat Rev Cancer, 2010. 10(12): p. 842-57. 222. Ahearn, I.M., et al., Regulating the regulator: post-translational modification of RAS. Nat Rev Mol Cell Biol, 2011. 13(1): p. 39-51. 223. Suire, S., et al., GPCR activation of Ras and PI3Kc in neutrophils depends on PLCb2/b3 and the RasGEF RasGRP4. EMBO J, 2012. 31(14): p. 3118-29. 224. Bharathi, M.J., et al., Microbial keratitis in South India: influence of risk factors, climate, and geographical variation. Ophthalmic Epidemiol, 2007. 14(2): p. 61-9.
161
225. Vajpayee, R.B., et al., Study of the first contact management profile of cases of infectious keratitis: a hospital-based study. Cornea, 2000. 19(1): p. 52-6. 226. Green, M., A. Apel, and F. Stapleton, Risk factors and causative organisms in microbial keratitis. Cornea, 2008. 27(1): p. 22-7. 227. Erie, J.C., et al., Incidence of ulcerative keratitis in a defined population from 1950 through 1988. Arch Ophthalmol, 1993. 111(12): p. 1665-71. 228. Upadhyay, M.P., et al., The Bhaktapur eye study: ocular trauma and antibiotic prophylaxis for the prevention of corneal ulceration in Nepal. Br J Ophthalmol, 2001. 85(4): p. 388-92. 229. Poggio, E.C., et al., The Incidence of Ulcerative Keratitis among Users of Daily-Wear and Extended-Wear Soft Contact-Lenses. New England Journal of Medicine, 1989. 321(12): p. 779-783. 230. Hyndiuk, R.A., Experimental Pseudomonas keratitis. Trans Am Ophthalmol Soc, 1981. 79: p. 541-624. 231. Karthikeyan, R.S., et al., Host response and bacterial virulence factor expression in Pseudomonas aeruginosa and Streptococcus pneumoniae corneal ulcers. PLoS One, 2013. 8(6): p. e64867. 232. Kernacki, K.A., et al., Macrophage inflammatory protein-2 is a mediator of polymorphonuclear neutrophil influx in ocular bacterial infection. J Immunol, 2000. 164(2): p. 1037-45. 233. Rehm, S.R., G.N. Gross, and A.K. Pierce, Early bacterial clearance from murine lungs. Species-dependent phagocyte response. J Clin Invest, 1980. 66(2): p. 194-9. 234. Benarafa, C., G.P. Priebe, and E. Remold-O'Donnell, The neutrophil serine protease inhibitor serpinb1 preserves lung defense functions in Pseudomonas aeruginosa infection. J Exp Med, 2007. 204(8): p. 1901-9. 235. Koh, A.Y., et al., Inescapable need for neutrophils as mediators of cellular innate immunity to acute Pseudomonas aeruginosa pneumonia. Infect Immun, 2009. 77(12): p. 5300-10. 236. Brissette-Storkus, C.S., et al., Identification of a novel macrophage population in the normal mouse corneal stroma. Invest Ophthalmol Vis Sci, 2002. 43(7): p. 2264-71. 237. Sun, Y., et al., TLR4 and TLR5 on corneal macrophages regulate Pseudomonas aeruginosa keratitis by signaling through MyD88-dependent and -independent pathways. J Immunol, 2010. 185(7): p. 4272-83. 238. Power, M.R., et al., The development of early host response to Pseudomonas aeruginosa lung infection is critically dependent on myeloid differentiation factor 88 in mice. J Biol Chem, 2004. 279(47): p. 49315-22. 239. Dohrmann, S., J.N. Cole, and V. Nizet, Conquering Neutrophils. PLoS Pathog, 2016. 12(7): p. e1005682. 240. Andersson, K., et al., YopH of Yersinia pseudotuberculosis interrupts early phosphotyrosine signalling associated with phagocytosis. Mol Microbiol, 1996. 20(5): p. 1057-69. 241. Rooijakkers, S.H., et al., Immune evasion by a staphylococcal complement inhibitor that acts on C3 convertases. Nat Immunol, 2005. 6(9): p. 920-7. 242. Aussel, L., et al., Salmonella detoxifying enzymes are sufficient to cope with the host oxidative burst. Mol Microbiol, 2011. 80(3): p. 628-40. 243. Kraus, D. and A. Peschel, Molecular mechanisms of bacterial resistance to antimicrobial peptides. Curr Top Microbiol Immunol, 2006. 306: p. 231-50.
162
244. Buchanan, J.T., et al., DNase expression allows the pathogen group A Streptococcus to escape killing in neutrophil extracellular traps. Curr Biol, 2006. 16(4): p. 396-400. 245. Lyczak, J.B., C.L. Cannon, and G.B. Pier, Lung infections associated with cystic fibrosis. Clin Microbiol Rev, 2002. 15(2): p. 194-222. 246. Toska, J., et al., Diversity of virulence phenotypes among type III secretion negative Pseudomonas aeruginosa clinical isolates. PLoS One, 2014. 9(1): p. e86829. 247. Barbieri, J.T. and J. Sun, Pseudomonas aeruginosa ExoS and ExoT. Rev Physiol Biochem Pharmacol, 2004. 152: p. 79-92. 248. Leal, S.M., Jr., et al., Distinct roles for Dectin-1 and TLR4 in the pathogenesis of Aspergillus fumigatus keratitis. PLoS Pathog, 2010. 6: p. e1000976. 249. Bleves, S., et al., Quorum sensing negatively controls type III secretion regulon expression in Pseudomonas aeruginosa PAO1. J Bacteriol, 2005. 187(11): p. 3898-902. 250. Goodman, A.L., et al., A signaling network reciprocally regulates genes associated with acute infection and chronic persistence in Pseudomonas aeruginosa. Dev Cell, 2004. 7(5): p. 745-54. 251. Pollock, J.D., et al., Mouse model of X-linked chronic granulomatous disease, an inherited defect in phagocyte superoxide production. Nat Genet, 1995. 9(2): p. 202-9. 252. Uchiyama, S., et al., Streptolysin O Rapidly Impairs Neutrophil Oxidative Burst and Antibacterial Responses to Group A Streptococcus. Front Immunol, 2015. 6: p. 581. 253. Coburn, J. and D.M. Gill, ADP-ribosylation of p21ras and related proteins by Pseudomonas aeruginosa exoenzyme S. Infect Immun, 1991. 59(11): p. 4259-62. 254. Zhao, M. and R. Weissleder, Intracellular cargo delivery using tat peptide and derivatives. Med Res Rev, 2004. 24(1): p. 1-12. 255. Andisi, V.F., et al., Pneumococcal gene complex involved in resistance to extracellular oxidative stress. Infect Immun, 2012. 80(3): p. 1037-49. 256. Karavolos, M.H., et al., Role and regulation of the superoxide dismutases of Staphylococcus aureus. Microbiology, 2003. 149(Pt 10): p. 2749-58. 257. McCaffrey, R.L., et al., Multiple mechanisms of NADPH oxidase inhibition by type A and type B Francisella tularensis. J Leukoc Biol, 2010. 88(4): p. 791-805. 258. Smirnov, A., K.P. Daily, and A.K. Criss, Assembly of NADPH oxidase in human neutrophils is modulated by the opacity-associated protein expression State of Neisseria gonorrhoeae. Infect Immun, 2014. 82(3): p. 1036-44. 259. Vazquez-Torres, A., et al., Salmonella pathogenicity island 2-dependent evasion of the phagocyte NADPH oxidase. Science, 2000. 287(5458): p. 1655-8. 260. van der Heijden, J., et al., Direct measurement of oxidative and nitrosative stress dynamics in Salmonella inside macrophages. Proc Natl Acad Sci U S A, 2015. 112(2): p. 560-5. 261. De Groote, M.A., et al., Periplasmic superoxide dismutase protects Salmonella from products of phagocyte NADPH-oxidase and nitric oxide synthase. Proc Natl Acad Sci U S A, 1997. 94(25): p. 13997-4001. 262. Bjur, E., et al., Thioredoxin 1 promotes intracellular replication and virulence of Salmonella enterica serovar Typhimurium. Infect Immun, 2006. 74(9): p. 5140-51. 263. Erwig, L.P., et al., Differential regulation of phagosome maturation in macrophages and dendritic cells mediated by Rho GTPases and ezrin-radixin-moesin (ERM) proteins. Proc Natl Acad Sci U S A, 2006. 103(34): p. 12825-30. 264. Perskvist, N., et al., Rab5a GTPase regulates fusion between pathogen-containing phagosomes and cytoplasmic organelles in human neutrophils. J Cell Sci, 2002. 115(Pt 6): p. 1321-30.
163
265. Frithz-Lindsten, E., et al., Intracellular targeting of exoenzyme S of Pseudomonas aeruginosa via type III-dependent translocation induces phagocytosis resistance, cytotoxicity and disruption of actin microfilaments. Mol Microbiol, 1997. 25(6): p. 1125- 39. 266. Rangel, S.M., L.K. Logan, and A.R. Hauser, The ADP-ribosyltransferase domain of the effector protein ExoS inhibits phagocytosis of Pseudomonas aeruginosa during pneumonia. MBio, 2014. 5(3): p. e01080-14. 267. Borkar, D.S., et al., Association between cytotoxic and invasive Pseudomonas aeruginosa and clinical outcomes in bacterial keratitis. JAMA Ophthalmol, 2013. 131(2): p. 147-53. 268. Vincent, J.L., et al., The prevalence of nosocomial infection in intensive care units in Europe. Results of the European Prevalence of Infection in Intensive Care (EPIC) Study. EPIC International Advisory Committee. JAMA, 1995. 274(8): p. 639-44. 269. Garrity-Ryan, L., et al., The arginine finger domain of ExoT contributes to actin cytoskeleton disruption and inhibition of internalization of Pseudomonas aeruginosa by epithelial cells and macrophages. Infect Immun, 2000. 68(12): p. 7100-13. 270. Choy, M.H., et al., Comparison of virulence factors in Pseudomonas aeruginosa strains isolated from contact lens- and non-contact lens-related keratitis. Journal of medical microbiology, 2008. 57(Pt 12): p. 1539-46. 271. Winstanley, C., et al., Genotypic and phenotypic characteristics of Pseudomonas aeruginosa isolates associated with ulcerative keratitis. Journal of medical microbiology, 2005. 54(Pt 6): p. 519-26. 272. Hritonenko, V., et al., Adenylate cyclase activity of Pseudomonas aeruginosa ExoY can mediate bleb-niche formation in epithelial cells and contributes to virulence. Microbial pathogenesis, 2011. 51(5): p. 305-12. 273. Sato, H. and D.W. Frank, Intoxication of host cells by the T3SS phospholipase ExoU: PI(4,5)P2-associated, cytoskeletal collapse and late phase membrane blebbing. PLoS One, 2014. 9(7): p. e103127. 274. Sato, H., et al., The mechanism of action of the Pseudomonas aeruginosa-encoded type III cytotoxin, ExoU. Embo J, 2003. 22(12): p. 2959-2969. 275. Schulert, G.S., et al., Secretion of the toxin ExoU is a marker for highly virulent Pseudomonas aeruginosa isolates obtained from patients with hospital-acquired pneumonia. The Journal of infectious diseases, 2003. 188(11): p. 1695-706. 276. Fleiszig, S.M., et al., Relationship between cytotoxicity and corneal epithelial cell invasion by clinical isolates of Pseudomonas aeruginosa. Infect Immun, 1996. 64(6): p. 2288-94. 277. Battle, S.E., et al., Hybrid pathogenicity island PAGI-5 contributes to the highly virulent phenotype of a Pseudomonas aeruginosa isolate in mammals. Journal of bacteriology, 2008. 190(21): p. 7130-40. 278. Lee, P.C., et al., Control of type III secretion activity and substrate specificity by the cytoplasmic regulator PcrG. Proceedings of the National Academy of Sciences of the United States of America, 2014. 111(19): p. 6863-6863. 279. Choi, K.H., et al., A Tn7-based broad-range bacterial cloning and expression system. Nat Methods, 2005. 2(6): p. 443-8. 280. Zhang, Y., et al., Kinase suppressor of Ras-1 protects against pulmonary Pseudomonas aeruginosa infections. Nat Med, 2011. 17(3): p. 341-6. 281. Hazlett, L.D., et al., The role of nitric oxide in resistance to P. aeruginosa ocular infection. Ocul Immunol Inflamm, 2005. 13(4): p. 279-88.
164
282. Apodaca, G., et al., Characterization of Pseudomonas aeruginosa-induced MDCK cell injury: glycosylation-defective host cells are resistant to bacterial killing. Infect Immun, 1995. 63(4): p. 1541-51. 283. Hauser, A.R., P.J. Kang, and J.N. Engel, PepA, a secreted protein of Pseudomonas aeruginosa, is necessary for cytotoxicity and virulence. Mol Microbiol, 1998. 27(4): p. 807-18. 284. Yurimoto, H., et al., HxlR, a member of the DUF24 protein family, is a DNA-binding protein that acts as a positive regulator of the formaldehyde-inducible hxlAB operon in Bacillus subtilis. Mol Microbiol, 2005. 57(2): p. 511-9. 285. Burstein, D., et al., Novel type III effectors in Pseudomonas aeruginosa. MBio, 2015. 6(2): p. e00161. 286. Neeld, D., et al., Pseudomonas aeruginosa injects NDK into host cells through a type III secretion system. Microbiology, 2014. 160(Pt 7): p. 1417-26. 287. Solinet, S., et al., The actin-binding ERM protein Moesin binds to and stabilizes microtubules at the cell cortex. J Cell Biol, 2013. 202(2): p. 251-60. 288. Gary, R. and A. Bretscher, Ezrin self-association involves binding of an N-terminal domain to a normally masked C-terminal domain that includes the F-actin binding site. Mol Biol Cell, 1995. 6(8): p. 1061-75. 289. Yonemura, S., et al., Ezrin/radixin/moesin (ERM) proteins bind to a positively charged amino acid cluster in the juxta-membrane cytoplasmic domain of CD44, CD43, and ICAM-2. J Cell Biol, 1998. 140(4): p. 885-95. 290. Fievet, B.T., et al., Phosphoinositide binding and phosphorylation act sequentially in the activation mechanism of ezrin. J Cell Biol, 2004. 164(5): p. 653-9. 291. Coscoy, S., et al., Molecular analysis of microscopic ezrin dynamics by two-photon FRAP. Proc Natl Acad Sci U S A, 2002. 99(20): p. 12813-8. 292. Marion, S., et al., Ezrin promotes actin assembly at the phagosome membrane and regulates phago-lysosomal fusion. Traffic, 2011. 12(4): p. 421-37. 293. Kjeken, R., et al., Fusion between phagosomes, early and late endosomes: a role for actin in fusion between late, but not early endocytic organelles. Mol Biol Cell, 2004. 15(1): p. 345-58. 294. Maresso, A.W., M.R. Baldwin, and J.T. Barbieri, Ezrin/radixin/moesin proteins are high affinity targets for ADP-ribosylation by Pseudomonas aeruginosa ExoS. J Biol Chem, 2004. 279(37): p. 38402-8. 295. Zhang, J., Use of biotinylated NAD to label and purify ADP-ribosylated proteins. Methods Enzymol, 1997. 280: p. 255-65. 296. Allen, L.A., Immunofluorescence and confocal microscopy of neutrophils. Methods Mol Biol, 2007. 412: p. 273-87. 297. Ngsee, J.K., L.A. Elferink, and R.H. Scheller, A family of ras-like GTP-binding proteins expressed in electromotor neurons. J Biol Chem, 1991. 266(4): p. 2675-80. 298. Mark, B.L., O. Jilkina, and R.P. Bhullar, Association of Ral GTP-binding protein with human platelet dense granules. Biochem Biophys Res Commun, 1996. 225(1): p. 40-6. 299. Bielinski, D.F., et al., Ral and Rab3a are major GTP-binding proteins of axonal rapid transport and synaptic vesicles and do not redistribute following depolarization stimulated synaptosomal exocytosis. Biochim Biophys Acta, 1993. 1151(2): p. 246-56. 300. Chen, C.X., et al., Control of secondary granule release in neutrophils by Ral GTPase. J Biol Chem, 2011. 286(13): p. 11724-33.
165
301. Henriksson, M.L., et al., Exoenzyme S shows selective ADP-ribosylation and GTPase- activating protein (GAP) activities towards small GTPases in vivo. Biochem J, 2002. 367(Pt 3): p. 617-28. 302. Stalder, D., et al., Phosphorylation of the Rab exchange factor Sec2p directs a switch in regulatory binding partners. Proceedings of the National Academy of Sciences of the United States of America, 2013. 110(50): p. 19995-20002. 303. Alvarez-Dominguez, C., et al., Phagocytosed live Listeria monocytogenes influences Rab5-regulated in vitro phagosome-endosome fusion. J Biol Chem, 1996. 271(23): p. 13834-43. 304. Madan, R., G. Krishnamurthy, and A. Mukhopadhyay, SopE-mediated recruitment of host Rab5 on phagosomes inhibits Salmonella transport to lysosomes. Methods Mol Biol, 2008. 445: p. 417-37. 305. Clemens, D.L., B.Y. Lee, and M.A. Horwitz, Deviant expression of Rab5 on phagosomes containing the intracellular pathogens Mycobacterium tuberculosis and Legionella pneumophila is associated with altered phagosomal fate. Infect Immun, 2000. 68(5): p. 2671-84. 306. Stenmark, H., Rab GTPases as coordinators of vesicle traffic. Nat Rev Mol Cell Biol, 2009. 10(8): p. 513-25. 307. Chaudhuri, S., A. Kumar, and M. Berger, Association of ARF and Rabs with complement receptor type-1 storage vesicles in human neutrophils. J Leukoc Biol, 2001. 70(4): p. 669- 76. 308. Grosshans, B.L., D. Ortiz, and P. Novick, Rabs and their effectors: achieving specificity in membrane traffic. Proc Natl Acad Sci U S A, 2006. 103(32): p. 11821-7. 309. Simon, N.C. and J.T. Barbieri, Exoenzyme S ADP-ribosylates Rab5 effector sites to uncouple intracellular trafficking. Infect Immun, 2014. 82(1): p. 21-8. 310. Quinn, M.T., et al., Association of a Ras-related protein with cytochrome b of human neutrophils. Nature, 1989. 342(6246): p. 198-200. 311. Li, Y., et al., Rap1a null mice have altered myeloid cell functions suggesting distinct roles for the closely related Rap1a and 1b proteins. J Immunol, 2007. 179(12): p. 8322-31. 312. Bos, J.L., J. de Rooij, and K.A. Reedquist, Rap1 signalling: adhering to new models. Nat Rev Mol Cell Biol, 2001. 2(5): p. 369-77. 313. Riese, M.J., A. Wittinghofer, and J.T. Barbieri, ADP ribosylation of Arg41 of Rap by ExoS inhibits the ability of Rap to interact with its guanine nucleotide exchange factor, C3G. Biochemistry, 2001. 40(11): p. 3289-94. 314. Abo, A., et al., Activation of the NADPH oxidase involves the small GTP-binding protein p21rac1. Nature, 1991. 353(6345): p. 668-70. 315. Heyworth, P.G., et al., Regulation of NADPH oxidase activity by Rac GTPase activating protein(s). Mol Biol Cell, 1993. 4(11): p. 1217-23. 316. Roberts, A.W., et al., Deficiency of the hematopoietic cell-specific Rho family GTPase Rac2 is characterized by abnormalities in neutrophil function and host defense. Immunity, 1999. 10(2): p. 183-96. 317. Sun, C.X., M.A. Magalhaes, and M. Glogauer, Rac1 and Rac2 differentially regulate actin free barbed end formation downstream of the fMLP receptor. J Cell Biol, 2007. 179(2): p. 239-45. 318. Kunisaki, Y., et al., DOCK2 is a Rac activator that regulates motility and polarity during neutrophil chemotaxis. J Cell Biol, 2006. 174(5): p. 647-52. 319. Glogauer, M., et al., Rac1 deletion in mouse neutrophils has selective effects on neutrophil functions. J Immunol, 2003. 170(11): p. 5652-7.
166
320. Heyworth, P.G., et al., Rac translocates independently of the neutrophil NADPH oxidase components p47phox and p67phox. Evidence for its interaction with flavocytochrome b558. J Biol Chem, 1994. 269(49): p. 30749-52. 321. Li, S., et al., Chemoattractant-stimulated Rac activation in wild-type and Rac2-deficient murine neutrophils: preferential activation of Rac2 and Rac2 gene dosage effect on neutrophil functions. J Immunol, 2002. 169(9): p. 5043-51. 322. Ambruso, D.R., et al., Human neutrophil immunodeficiency syndrome is associated with an inhibitory Rac2 mutation. Proceedings of the National Academy of Sciences of the United States of America, 2000. 97(9): p. 4654-4659. 323. Williams, D.A., et al., Dominant negative mutation of the hematopoietic-specific Rho GTPase, Rac2, is associated with a human phagocyte immunodeficiency. Blood, 2000. 96(5): p. 1646-1654. 324. Rocha, C.L., et al., Examination of the coordinate effects of Pseudomonas aeruginosa ExoS on Rac1. Infection and Immunity, 2005. 73(9): p. 5458-5467. 325. Kiyokawa, E., et al., Activation of Rac1 by a Crk SH3-binding protein, DOCK180. Genes Dev, 1998. 12(21): p. 3331-6. 326. Li, H., et al., Association between Galphai2 and ELMO1/Dock180 connects chemokine signalling with Rac activation and metastasis. Nat Commun, 2013. 4: p. 1706. 327. Eden, S., et al., Mechanism of regulation of WAVE1-induced actin nucleation by Rac1 and Nck. Nature, 2002. 418(6899): p. 790-3. 328. Lee, W.L., et al., Role of CrkII in Fcgamma receptor-mediated phagocytosis. J Biol Chem, 2007. 282(15): p. 11135-43. 329. Wu, R.F., et al., Vascular endothelial growth factor causes translocation of p47phox to membrane ruffles through WAVE1. J Biol Chem, 2003. 278(38): p. 36830-40. 330. Wang, J.S., et al., Role of gelsolin in actin depolymerization of adherent human neutrophils. Mol Biol Cell, 1997. 8(1): p. 121-8. 331. Serrander, L., et al., Selective inhibition of IgG-mediated phagocytosis in gelsolin- deficient murine neutrophils. J Immunol, 2000. 165(5): p. 2451-7. 332. Arora, P.D., et al., Gelsolin mediates collagen phagocytosis through a rac-dependent step. Mol Biol Cell, 2004. 15(2): p. 588-99. 333. Datta, S.R., et al., 14-3-3 proteins and survival kinases cooperate to inactivate BAD by BH3 domain phosphorylation. Mol Cell, 2000. 6(1): p. 41-51. 334. Luo, Z., et al., Oligomerization activates c-Raf-1 through a Ras-dependent mechanism. Nature, 1996. 383(6596): p. 181-5. 335. Chiang, C.W., et al., Protein phosphatase 2A activates the proapoptotic function of BAD in interleukin- 3-dependent lymphoid cells by a mechanism requiring 14-3-3 dissociation. Blood, 2001. 97(5): p. 1289-97. 336. Yang, J., et al., Maintenance of G2 arrest in the Xenopus oocyte: a role for 14-3-3- mediated inhibition of Cdc25 nuclear import. EMBO J, 1999. 18(8): p. 2174-83. 337. Tzivion, G., Z. Luo, and J. Avruch, A dimeric 14-3-3 protein is an essential cofactor for Raf kinase activity. Nature, 1998. 394(6688): p. 88-92. 338. Kimura, M.T., et al., 14-3-3 is involved in p75 neurotrophin receptor-mediated signal transduction. J Biol Chem, 2001. 276(20): p. 17291-300. 339. Masters, S.C., et al., Interaction of 14-3-3 with a nonphosphorylated protein ligand, exoenzyme S of Pseudomonas aeruginosa. Biochemistry, 1999. 38(16): p. 5216-21. 340. Campbell, J.K., et al., Activation of the 43 kDa inositol polyphosphate 5-phosphatase by 14-3-3zeta. Biochemistry, 1997. 36(49): p. 15363-70.
167
341. Liu, S., et al., Biochemical relationships between the 53-kilodalton (Exo53) and 49- kilodalton (ExoS) forms of exoenzyme S of Pseudomonas aeruginosa. J Bacteriol, 1997. 179(5): p. 1609-13. 342. Skerrett, S.J., et al., Redundant Toll-like receptor signaling in the pulmonary host response to Pseudomonas aeruginosa. Am J Physiol Lung Cell Mol Physiol, 2007. 292(1): p. L312-22. 343. Singh, A., et al., Impaired priming and activation of the neutrophil NADPH oxidase in patients with IRAK4 or NEMO deficiency. J Immunol, 2009. 182(10): p. 6410-7. 344. van Bruggen, R., et al., Toll-like receptor responses in IRAK-4-deficient neutrophils. J Innate Immun, 2010. 2(3): p. 280-7. 345. Schmidt, H.L., et al., Isolation and properties of an H2O-forming NADH oxidase from Streptococcus faecalis. Eur J Biochem, 1986. 156(1): p. 149-55. 346. Niimura, Y., et al., A hydrogen peroxide-forming NADH oxidase that functions as an alkyl hydroperoxide reductase in Amphibacillus xylanus. J Bacteriol, 2000. 182(18): p. 5046- 51. 347. Saeki, Y., M. Nozaki, and K. Matsumoto, Purification and properties of NADH oxidase from Bacillus megaterium. J Biochem, 1985. 98(6): p. 1433-40. 348. Koike, K., et al., Purification and characterization of NADH oxidase from a strain of Leuconostoc mesenteroides. J Biochem, 1985. 97(5): p. 1279-88. 349. Leal, S.M., et al., Fungal antioxidant pathways promote survival against neutrophils during infection. Journal of Clinical Investigation, 2012. 122(7): p. 2482-2498. 350. Gendrin, C., et al., Structural Basis of Cytotoxicity Mediated by the Type III Secretion Toxin ExoU from Pseudomonas aeruginosa. Plos Pathogens, 2012. 8(4). 351. Karathanassis, D., et al., Binding of the PX domain of p47(phox) to phosphatidylinositol 3,4-bisphosphate and phosphatidic acid is masked by an intramolecular interaction. EMBO J, 2002. 21(19): p. 5057-68. 352. Stephens, L., et al., Protein kinase B kinases that mediate phosphatidylinositol 3,4,5- trisphosphate-dependent activation of protein kinase B. Science, 1998. 279(5351): p. 710-4. 353. Anderson, K.E., et al., Translocation of PDK-1 to the plasma membrane is important in allowing PDK-1 to activate protein kinase B. Curr Biol, 1998. 8(12): p. 684-91.
168