Karyopherin-Β1 Regulates Radioresistance and Radiation-Increased Programmed Death-Ligand 1 Expression in Human Head and Neck Squamous Cell Carcinoma Cell Lines

cancers

Article Karyopherin-β1 Regulates Radioresistance and Radiation-Increased Programmed Death-Ligand 1 Expression in Human Head and Neck Squamous Cell Carcinoma Cell Lines

1, 2, , 3 3 Masaharu Hazawa † , Hironori Yoshino * † , Yuta Nakagawa , Reina Shimizume , Keisuke Nitta 3, Yoshiaki Sato 2 , Mariko Sato 4 , Richard W. Wong 1 and Ikuo Kashiwakura 2 1 Cell-Bionomics Research Unit, Institute for Frontier Science Initiative, Kanazawa University, Kanazawa, Ishikawa 920-1192, Japan; [email protected] (M.H.); rwong@staﬀ.kanazawa-u.ac.jp (R.W.W.) 2 Department of Radiation Science, Hirosaki University Graduate School of Health Sciences, Hirosaki, Aomori 036-8564, Japan; [email protected] (Y.S.); [email protected] (I.K.) 3 Department of Radiological Technology, Hirosaki University School of Health Sciences, Hirosaki, Aomori 036-8564, Japan 4 Department of Radiation Oncology, Hirosaki University Graduate School of Medicine, Hirosaki, Aomori 036-8563, Japan; [email protected] * Correspondence: [email protected]; Tel.: +81-172-39-5528 These authors contributed equally to this paper. † Received: 3 March 2020; Accepted: 4 April 2020; Published: 8 April 2020

Abstract: Nuclear transport receptors, such as karyopherin-β1 (KPNB1), play important roles in the nuclear-cytoplasmic transport of macromolecules. Recent evidence indicates the involvement of nuclear transport receptors in the progression of cancer, making these receptors promising targets for the treatment of cancer. Here, we investigated the anticancer effects of KPNB1 blockage or in combination with ionizing radiation on human head and neck squamous cell carcinoma (HNSCC). HNSCC cell line SAS and Ca9-22 cells were used in this study. Importazole, an inhibitor of KPNB1, or knockdown of KPNB1 by siRNA transfection were applied for the blockage of KPNB1 functions. The roles of KPNB1 on apoptosis induction and cell surface expression levels of programmed death-ligand 1 (PD-L1) in irradiated HNSCC cells were investigated. The major findings of this study are that (i) blockage of KPNB1 specifically enhanced the radiation-induced apoptosis and radiosensitivity of HNSCC cells; (ii) importazole elevated p53-upregulated modulator of apoptosis (PUMA) expression via blocking the nuclear import of SCC-specific oncogene ∆Np63 in HNSCC cells; and (iii) blockage of KPNB1 attenuated the upregulation of cell surface PD-L1 expression on irradiated HNSCC cells. Taken together, these results suggest that co-treatment with KPNB1 blockage and ionizing radiation is a promising strategy for the treatment of HNSCC.

Keywords: head and neck squamous cell carcinoma; karyopherin-β1; radiosensitization; apoptosis; puma; ∆Np63; programmed death-ligand 1

1. Introduction Head and neck squamous cell carcinoma (HNSCC) is a lethal malignancy arising from the regions of the head and neck, such as the pharynx and oral cavity. The cumulative incidence of HNSCC was approximately 890,000 new cases in 2018, and it now ranks as the seventh most common cancer types worldwide [1,2]. In spite of combined treatment involving surgery, radiation therapy, and chemotherapy, the ﬁve-year survival rate of HNSCC patients is low, and the prognosis is still poor [3]. Part of the reason is that resistance to chemo- and radiotherapy often occurs [4]. Furthermore, recent

Cancers 2020, 12, 908; doi:10.3390/cancers12040908 www.mdpi.com/journal/cancers Cancers 2020, 12, 908 2 of 16 evidence indicates that ionizing radiation increases cell surface programmed death-ligand 1 (PD-L1) expression, which is an immune checkpoint molecule and negatively regulates anti-tumor immune responses [5–7]. In order to overcome these responses, the development of an effective strategy is desired for the treatment of HNSCC. Upon genotoxic stresses, including radiation, apoptosis and PD-L1 expression are initiated from the nuclear events, such as DNA damage responses and transcription-mediated pro- and anti-apoptotic effects [8–11]. The Bcl-2 family of proteins play central roles in regulating apoptosis, where most of them maximize its activity through post-translational modification. Among the Bcl-2 family members, p53-upregulated modulator of apoptosis (PUMA) is the most potent killer, and its activity is exclusively controlled by transcriptional regulation [12]. Since all proteins regulating those nuclear events must enter the nucleus with assistance from nuclear transport receptors, a disturbance in the nuclear import process is considered as a therapeutic strategy to prevent tumor radiation responses. Nuclear transport receptors, such as the karyopherin-α (KPNA) and karyopherin-β1 (KPNB1) family, selectively aid the shuttle of karyophilic proteins harboring nuclear localization signals (NLSs) through a nuclear pore complex [13–15]. Moreover, the KPNA family recognizes and binds to NLS-containing cargo. KPNB1 mediates the docking of KPNA/NLS-containing cargo complex to the nuclear pore complex, thereby facilitating nuclear entry of the target cargo. There are seven subtypes in the human KPNA family, and each individual KPNA is cargo-specific [15]. Recently, we reported KPNA4 as a HNSCC specifically amplified KPNA, which establishes mitogen-activated protein kinase activation through Ras-responsive element-binding protein 1-nuclear import [16]. Further, the high expression level of KPNA2 is involved in the progression of human breast tumor or human hepatocellular carcinoma [17,18]. Thus, while importance of cancer-specific alteration of KPNA subtype in cancer biology is recognized, therapeutic benefits from blocking KPNB1, the master nuclear transport receptor mediating all KPNA subtypes, remains to be investigated further. A unifying feature of SCC is the high-level expression of TP63 in 30% of the cases, and the major isoform of p63 expressed in SCC is ∆Np63α [19–22]. ∆Np63α functions as a positive and negative transcriptional regulator of different gene subsets [23–25]. As a nuclear protein, ∆Np63α requires the aid of KPNB1 during nuclear traffic [26]. Moergel et al. previously reported that the high expression of p63 is related to the poor radiation response and prognosis of patients with HNSCC [27]; however, how p63 is involved in DNA damage response has not been extensively explained. In this study, the authors investigated the effects of the KPNB1 inhibitor importazole (IPZ) or KPNB1 knockdown on the radiation response of HNSCC cells. Furthermore, it was shown that IPZ treatment enhanced the radiation-induced apoptosis and radiosensitivity of HNSCC cells, where relieving ∆Np63-mediated transcriptional silencing of PUMA expression is the central axis. The researchers also found that IPZ treatment or KPNB1 knockdown suppressed the radiation-induced upregulation of cell surface PD-L1 expression. In addition, the cytotoxic effect of IPZ was less in human umbilical vein endothelial cells (HUVEC) compared with HNSCC cells, and IPZ hardly enhanced the radiation-induced apoptosis in HUVEC. These findings highlight KPNB1 as a promising target to improve radiation therapy for HNSCC.

2. Results

2.1. High Expression Levels of KPNB1 Determines the Proliferation and Apoptosis of HNSCC Cells We first profiled the clinical status of KPNB1 in HNSCC by re-analyzing data from The Cancer Genome Atlas (TCGA) cohorts via Cancer RNA-Seq Nexus or cBioportal for Cancer Genomics (see Section 4.13 for URLs). As shown in Figure1A, TCGA RNA-seq data of the HNSCC cohort revealed that the expression level of KPNB1 in tumor tissue was significantly higher than that of normal tissue. In addition, the Kaplan–Meier analysis on the TCGA cohorts showed that HNSCC patients with high expressions of KPNB1 resulted in a poor outcome (Figure1B). These findings imply that KPNB1 is related to the malignancy of HNSCC; therefore, we next examined whether KPNB1 is functionally Cancers 2020, 12, 908 3 of 16 Cancers 2020, 12, x 3 of 15 involvedinvolved inin thethe proliferationproliferation asas wellwell as the viability of HNSCC cell cell lines lines ( (SASSAS and and Ca9 Ca9-22)-22) using using the the knockdownknockdown ofof KPNB1 by by siRNA siRNA transfecti transfectionon or or the the KPNB1 KPNB1 inhibitor inhibitor IPZ. IPZ. The The silencing silencing of KPNB1 of KPNB1 by bysiRNA siRNA decreased decreased the the clonogenic clonogenic potential potential to to about about 3% 3% for for SAS SAS cells cells and and 36 36%% for for Ca9 Ca9-22-22 cells cells,, respectivelyrespectively (Figure(Figure1 1C,D),C,D), andand enhancedenhanced thethe apoptosisapoptosis of both SAS and Ca9 Ca9-22-22 cells cells ( (FigureFigure 11E)E).. Furthermore,Furthermore, thethe dose-dependentdose-dependent treatment with IPZ IPZ decreased decreased the the viable viable cell cell number number of of SAS SAS and and Ca9-22Ca9-22 cells cells (Figure (Figure S1). S1). TheThe 50%50% inhibitoryinhibitory concentrationsconcentrations (IC(IC5050)) of of IPZ IPZ were were 2 2.9.9 μµMM for for SAS SAS cells cells and and 0.90.9µ MμM for for Ca9-22 Ca9-22 cells cells (Figure (Figure S1). S IPZ1). decreasedIPZ decreased the clonogenic the clonogenic potential potential and enhanced and enhanced the apoptosis the ofapoptosis HNSCC ofcells HNSCC (Figure cells1F,G). (Fig Takenure 1F together,,G). Taken these together results, indicate these results that KPNB1 indicate is involved that KPNB1 in the is proliferationinvolved in the ofHNSCC proliferation cells. of HNSCC cells.

(A) (B)

Normal tissue HNSCC Tumor tissue 1.0 KPNB1: High (N=165) 200  KPNB1: Low (N=351) 0.8 Logrank Test: P<0.05 150 0.6

100 0.4

50 0.2 Overall survival Overall 0.0 0 0 50 100 150 200 250 KPNB1 mRNA (TPM) mRNA KPNB1 HNSCC Month (C) (D) (E) siRNA Control KPNB1 siRNA Control KPNB1 2.2% 7.7% SAS Ca9-22 1.5 Control siRNA KPNB1 siRNA SAS SAS siRNA 1.0 0.9% 9.1%  KPNB1 0.5 1.5% 8.7% Ca9-22  Ca9-22 Actin fraction Surviving 0.0 0.8% 13%

SAS Ca9-22 PI Annexin V FITC (F) (G) Control IPZ 5 mM IPZ 10 mM IPZ 1.3% 5.3% 5.0% Control 5 mM 10 mM Control 1.0 IPZ 5 mM SAS IPZ 10 mM 16.0% SAS 1.3% 1.9% 0.5 0.8% 23.1% 12.3% Ca9-22 Ca9-22     Surviving fraction Surviving 0.0 1.1% 29.3% 86.0% SAS Ca9-22 PI Annexin V FITC

FigureFigure 1. 1.High High expression expression levels levels of of karyopherin- karyopherinβ-β11 (KPNB1) (KPNB1 determines) determines the the proliferation, proliferation as, as well well as as the apoptosisthe apoptosis resistance, resistance of head, of and head neck and squamous neck squamous cell carcinoma cell carcinoma (HNSCC) cells.(HNSCC (A) The) cells. expression (A) The of KPNB1expression in non-tumor of KPNB1 tissue in non and-tumor HNSCC tissue samples and HNSCC from Cancer samples RNA-Seq from Cancer Nexus areRNA shown.-Seq Nexus * indicates are pshown.< 0.01.( * Bindicates) The relationship p < 0.01. (B between) The relationship the overall between survival andthe ove KPNB1rall survival expression and of KPNB1 HNSCC expression patients in theof HNSCC The Cancer patients Genome in the Atlas The (TCGA) Cancer cohorts Genome is shown.Atlas (TCGA The patients) cohorts whose is shown. KPNB1 The mRNA patients expression whose z-ScoresKPNB1 (RNAmRNA Seq expression V2 RSEM) z- isScores greater (RNA than Seq 0.5 SDV2 aboveRSEM) mean is greater were deﬁnedthan 0.5as SD KPNB1 above highmean patients. were (Cdefined) HNSCC as KPNB1 cells (SAS high and patients. Ca9-22 ( cells)C) HN transfectedSCC cells ( withSAS controland Ca9 or-22 KPNB1 cells) transfected siRNA were with harvested, control andor KPNB1KPNB1 protein siRNA expressionswere harvested, were and analyzed KPNB1 by protein Western expression blot. Thes representative were analyzed image by W ofestern immunoblot blot. The is shown.representative Actin was image used of asimmunoblot loading control. is shown. (D) Actin The clonogenicwas used as potential loading control. of HNSCC (D) cellsThe clonogenic transfected withpotential control of or HNSCC KPNB1 cells siRNA transfected was estimated with control by colony or KPNB1 formation siRNA assay. was (Left) estimated The representative by colony picturesformation of assay. the colonies (Left) The are r shown.epresentative (Right) pictures The number of the colon of coloniesies are fromshown. the (Right) cells transfected The number with of control siRNA is considered 1.0. Data are presented as the mean SD of at least three independent colonies from the cells transfected with control siRNA is considered± 1.0. Data are presented as the experiments.mean ± SD of *atp

Cancers 2020, 12, 908 4 of 16

are shown. (Right) The number of colonies from the cells treated with DMSO control is considered 1.0.Cancers Data 2020 are, 12, presented x as the mean SD of at least three independent experiments. * p < 0.05 versus4 of 15 ± DMSO. (G) HNSCC cells cultured in the presence of IPZ for 4 days were harvested for apoptosis assay usingthree annexin independent V/PI staining. experiments. The * representative p < 0.05 versus DMSO cytograms. (G) HNSCC are shown. cells cultured Inset numbers in the presence indicate of the IPZ for 4 days were +harvested for apoptosis assay+ +using annexin V/PI staining. The representative proportion of annexin V /PI− cells or annexin V /PI cells. cytograms are shown. Inset numbers indicate the proportion of annexin V/PI− cells or annexin V/PI cells. 2.2. KPNB1 Regulates Radioresistance of HNSCC Cells 2.2. KPNB1 Regulates Radioresistance of HNSCC Cells The apoptotic induction rate determines the efficacy of radiation therapy. Apoptosis is evoked by two independentThe apoptotic pathways, induction rate namely determines the extrinsic the efficacy and of intrinsic radiation pathways. therapy. Apoptosis The extrinsic is evoked pathway causesby caspase two independent 8 activation pathways, while the namely latter the depends extrinsic on and caspase intrinsic 9 activation. pathways. AsThe found extrinsic in thepathway study, the causes caspase 8 activation while the latter depends on caspase 9 activation. As found in the study, blockage of KPNB1 significantly augmented apoptosis, and the researchers investigated the pathway the blockage of KPNB1 significantly augmented apoptosis, and the researchers investigated the that waspathway activated that was by eitheractivated radiation by either alone, radiation IPZ alone,alone, IPZ ora alone combination, or a combination of both. of Western both. Western blot results showedblot thatresults the showed presence that of the IPZ presence activated of IPZ the activated caspase-9-mediated the caspase-9-mediated apoptosis apoptosis pathway, pathway, which was not observedwhich was in not radiation observed alone in radiation (Figure 2 aloneA). As (Figure a result 2A). of As caspase a result 9 activation, of caspase 9the activation, combination the of IPZ andcombination radiation of markedly IPZ and increased radiation markedly apoptotic increased cells as compared apoptotic with cells eitheras compar radiationed with or either IPZ alone (Figureradiation2B,C). Similarly,or IPZ alone KPNB1 (Figure depletion 2B,C). Similarly, by siRNA KPNB1 also depletion enhanced by siRNA radiation-induced also enhanced apoptotic radiation- cells (Figureinduced2D). Importantly, apoptotic cells analysis (Figure of2D). survival Importantly, fraction analysis demonstrated of survival that fraction IPZ demonstrated has synergistic that e IPZffects on the clonogenichas synergistic survival effects of on SAS the andclonogenic Ca9-22 survival cells with of SAS radiation and Ca9 treatment-22 cells with (Figure radiation2E, Appendixtreatment A). Collectively,(Figure 2E, these Appendix results indicateA). Collectively, that caspase-9 these results activation indicate by that preventing caspase- KPNB19 activation functions by preventing is important KPNB1 functions is important for causing radiosensitizing effects on HNSCC cells. for causing radiosensitizing effects on HNSCC cells. (A) SAS Ca9-22 IPZ - -   - -   IR -  -  -  -  Pro-caspase-8 Cleaved caspase-8 Pro-caspase-9 Cleaved caspase-9 Actin (B) (C) SAS Ca9-22

0 Gy 6 Gy 0 Gy 6 Gy

+ V 1.1% 7.7% 0.7% 9.3% 50 Control 

Control (%) 40 IPZ Annexin

0.9% 9.1% 0.6% 9.5% Gy 30 

6 in 20 1.5% 8.7% 4.4% 16% by

IPZ 10 cells

increase 0 SAS Ca9-22

PI 0.8% 13% 33% 7.3% Net

Annexin V FITC

(D) (E) +

V SAS Ca9-22 80 Control siRNA 1 Control 1 Control  KPNB1 siRNA IPZ IPZ

(%) 60 * * Annexin

Gy 0.1  0.1 * 6 *

in 40 by 20

* 0.01 * Surviving fraction Surviving

Surviving fraction Surviving 0.01 cells

increase 0 0 2 4 6 0 2 4 6

SAS Ca9-22 Dose (Gy) Dose (Gy) Net

FigureFigure 2. IPZ 2. IPZ enhances enhances the the radiation-induced radiation-induced apoptosisapoptosis and and radiosensitivity radiosensitivity of HNSCC of HNSCC cells cells.. (A) IPZ (A) IPZ (10 µ(M)10 m wasM) was added added to to thethe culture culture medium medium 1 h 1before h before X-ray X-rayirradiation. irradiation. After 20 h- Afterincubation, 20 h-incubation, the cell- the cell-culture-conditioned medium was replaced with fresh media and the cells were further cultured

Cancers 2020, 12, 908 5 of 16

for 24 h. The cultured SAS and Ca9-22 cells were harvested for Western blot analyses of caspase-8 and -9. The representative immunoblots are shown. Actin was used as loading control. (B,C) IPZ (10 µM) was added to the culture medium 1 h before X-ray irradiation. After 20 h-incubation, the cell-culture-conditioned medium was replaced with fresh media and the cells were further cultured for 3 days. After culturing, the SAS and Ca9-22 cells were harvested for apoptosis assay using annexin V/PI staining. (B) The representative cytograms are shown. Inset numbers indicate the proportion + + + of annexin V /PI− cells or annexin V /PI cells. (C) The results are presented as the net increase in + + + + the population of annexin V cells (the sum of annexin V /PI− cells or annexin V /PI cells) by 6 Gy irradiation. Data are presented as the mean SD of three independent experiments. * p < 0.05 versus ± DMSO control. (D) SAS and Ca9-22 cells transfected with control or KPNB1 siRNA were irradiated with 6 Gy X-ray and cultured for 4 days. After culturing, the cells were harvested for apoptosis assay using annexin V/PI staining. The results are presented as the net increase in the population of + + + + annexin V cells (the sum of annexin V /PI− cells or annexin V /PI cells) by 6 Gy irradiation. Data are presented as the mean SD of three independent experiments. * p < 0.05 versus control siRNA. ± (E) IPZ (10 µM) was added to the culture medium 1 h before X-ray irradiation. After 20 h-incubation, the cell-culture-conditioned medium was replaced with fresh media and the cells were further cultured until the colony was observed. The surviving fraction of SAS and Ca9-22 cells is shown. Data are presented as the mean SD of three independent experiments performed in triplicate. * p < 0.01 ± versus DMSO.

2.3. IPZ Abolishes the Transcriptional Silencing of PUMA by Blocking p63 Nuclear Import in HNSCC Cells Since PUMA is a major factor in activating caspase-9–mediated apoptosis [12], the researchers next determined whether or not PUMA is involved in apoptosis enhancement by IPZ. Previously, the authors, as well as other resources, reported that the lineage-specific oncogene ∆Np63, the major isoform expressed in SCCs, transcriptionally suppresses BBC3 (PUMA) [26,28]. First, the authors profiled the occupancy of p63, as well as H3K27me (silencing mark for transcripts) around BBC3 gene, by reanalyzing ChIP-Seq data. The promoter regions were occupied by p63 together with H3K27me, indicating BBC3 is transcriptionally suppressed by p63 (Figure3A). Next, the localization analysis of ∆Np63 was addressed by confocal imaging. It was observed that IPZ treatment caused diffusion or less nuclear localization of ∆Np63 in the HNSCC cell (Figure3B and Figure S2A). Lastly, IPZ treatment significantly increased PUMA expression at both mRNA and protein levels (Figure3C,D), suggesting that IPZ enhances PUMA expression by preventing ∆Np63 nuclear import. Since KPNB1 blockage was reported to block c-JUN nuclear import [29], the localization of c-JUN was also investigated (Figure S3). Consistent with previous reports [29], the nuclear levels of c-JUN were inhibited by IPZ (Figure S3). Of utmost importance is the examination of TCGA RNA-seq datasets that further showed that the expression levels of PUMA are inversely related to the levels of p63 and not of the activator protein 1 (AP-1) family, including c-JUN (Figure3E,F and Figure S2B,C). Collectively, these results suggest that IPZ can trigger the elevation of PUMA expression via blocking ∆Np63 nuclear import in HNSCCs. Cancers 2020, 12, 908 6 of 16 Cancers 2020, 12, x 6 of 15

(A) (B) ControlControl IPZIPZ Control IPZ Np63 Np63 DAPI DAPI BBC3

2kb Z1

47,218 47,218 kb 47,234 47,234 kb

Np63 Np63

JHU029 TP63 H3K27Me Merge Merge Z4

HNSCC keratinocyte HNSCC SCC25 Z5

** ** s

s * *

l * * l 1 0 SAS Ca9-22

e 1 0

)

v )

e *

e * l

A IPZ

A - -   - -  

M A M IR

N 5 -  -  -  -  U

N 5

(

3 5

5 PUMA

PUMA (BBC3) PUMA

l e

e Actin

Relative levels Relative mRNA

R R

0 0 0 0 -  -  -  -  IRIRIR --  --  IRIR --  --  IPZIPZIPZ -- --   IPZIPZ ------   (E) (F) HNSCC HNSCC (TCGA, n=488) HNSCC Spearman r = -0.28 Spearman r = -0.28 Mutual exclusivity p=5.94e-10 BBC3 p=5.94e-10 **:p<0.01 16 TP63 14 12 JUN 10

8 TP63 JUNB TP63 6 4 JUND 2 5 6 7 8 9 10 11 -3 3 BBC3 BBC3

Figure 3. IPZIPZ silences silences pro pro-apoptotic-apoptotic p53 p53-upregulated-upregulated modulator modulator of apoptosis apoptosis ( (PUMA)PUMA) by by suppressing suppressing the ∆Np63aNp63a nuclear nuclear import import in HNSCC cells. ( (AA)) The The occupancy occupancy profiles profiles of of H3K27me H3K27me and and TP63 TP63 at the BBC3 (PUMA) promoter in keratinoc keratinocytesytes and HNSCCs. ( B)) Confocal Confocal imaging imaging of of ∆Np63αNp63α inin SAS SAS cells. cells. ThreeThree-dimensional-dimensional construction construction with with maximum maximum intensity intensity (Left), (Left), and sequential and sequential z-stack z imaging-stack imaging (Right), (Right),respectively. respectively. (C,D) IPZ (C, (10D) IPZµM) (10 was mM added) was toadded the cultureto the culture medium medium 1 h before 1 h before X-ray X irradiation.-ray irradiation. After After20 h-incubation, 20 h-incubation, the cells the were cells harvested were harvested for qRT-PCR for qRT and-PCR Western and Western blot analyses. blot analyses (C) qRT-PCR. (C) qRT analysis-PCR analysisof PUMA of expression PUMA expression levels. Data levels. are presented Data are aspresented the mean as theSD meanof three ± independentSD of three independent experiments ± eperformedxperiments in performed triplicate. in * ptriplicate.< 0.05, ** * pp << 0.010.05, versus** p < 0.01 DMSO versus control. DMSO (D )control. Western (D blot) Western analysis blot of analysisPUMA expression. of PUMA The expression. representative The representative images are shown. images (E) The are heatshown. map (E showing) The heat mutual map exclusivity showing mutualbetween exclusivity BBC3 (PUMA) between expression BBC3 (PUMA) and TP63, expression as well asand activator TP63, as protein well as 1 activator (AP-1) family protein genes. 1 (AP The-1) familysamples genes. were The divided samples according were divided to mRNA according expression to levelsmRNA (mRNA expression expression levels z-Scores(mRNA expression (RNA-Seq V2z‐ ScoresRSEM) (RNA> mean‐Seq+ 1.0V2 SD)RSEM) from > the mean TCGA + 1.0 cohorts. SD) from The the P values TCGA are cohorts. based on The Fisher’s P values exact are test. based (F) Theon Fisher’scorrelation exact between test. ( eachF) The BBC3 correlation (PUMA) between mRNA and each TP63 BBC3 mRNA (PUMA) in HNSCC mRNA from and TCGA. TP63 mRNA in HNSCC from TCGA. 2.4. Radiosensitization Effects through Abolishing ∆Np63α-Mediated PUMA Silencing Is Unique to HNSCC Cells 2.4. Radiosensitization Effects through Abolishing Np63α-Mediated PUMA Silencing Is Unique to HNSCCAmong Cells several cancers (lung cancer, prostate cancer, and breast cancer) applied for radiation therapy, a poor prognosis in lung adenocarcinoma was observed in patients with high levels of KPNB1 Among several cancers (lung cancer, prostate cancer, and breast cancer) applied for radiation (Figure S4). Since ∆Np63α is an SCC-specific oncogene, the researchers next investigated whether therapy, a poor prognosis in lung adenocarcinoma was observed in patients with high levels of IPZ treatment confer radiosensitization effects on lung adenocarcinoma cells. Unsurprisingly, ∆Np63 KPNB1 (Figure S4). Since ΔNp63α is an SCC-specific oncogene, the researchers next investigated whether IPZ treatment confer radiosensitization effects on lung adenocarcinoma cells. Unsurprisingly, Np63 expression was observed in only HNSCC cells, while the expression level of

Cancers 2020, 12, 908 7 of 16

Cancers 2020, 12, x 7 of 15 expression was observed in only HNSCC cells, while the expression level of KPNB1 was noted in both HNSCC and lung adenocarcinoma cells (Figure4A). However, IPZ showed no e ffects on both KPNB1 was noted in both HNSCC and lung adenocarcinoma cells (Figure 4A). However, IPZ showed the mRNA and protein levels of PUMA (Figure4B,C). Furthermore, although the IC value of IPZ no effects on both the mRNA and protein levels of PUMA (Figure 4B,C). Furthermore50, although the for A549 cells (3.2 µM) was similar to that for SAS cells (Figure S5), there was no significant effect IC50 value of IPZ for A549 cells (3.2 mM) was similar to that for SAS cells (Figure S5), there was no of IPZ on radiation-induced apoptosis, as well as radiosenstivity, in A549 cells (Figure4D,E). More significant effect of IPZ on radiation-induced apoptosis, as well as radiosenstivity, in A549 cells importantly, the negative correlation between TP63 and BBC3 was only observed in SCCs samples, (Figure 4D,E). More importantly, the negative correlation between TP63 and BBC3 was only observed including HNSCC, whereas it was not observed in non-SCC samples, such as lung adenocarcinoma in SCCs samples, including HNSCC, whereas it was not observed in non-SCC samples, such as lung and hepatocellular carcinoma (Figure4F). Similar to the results of A549 cells, IPZ failed to enhance the adenocarcinoma and hepatocellular carcinoma (Figure 4F). Similar to the results of A549 cells, IPZ radiosensitivity of hepatocellular carcinoma cell line HepG2 lacking ∆Np63 expression (Figure S6). failed to enhance the radiosensitivity of hepatocellular carcinoma cell line HepG2 lacking Np63 These results strongly emphasize the blockage of ∆Np63–mediated PUMA suppression as the key expression (Figure S6). These results strongly emphasize the blockage of ΔNp63–mediated PUMA pathway involved in radiosensitization in irradiated HNSCC cells. suppression as the key pathway involved in radiosensitization in irradiated HNSCC cells.

(A) (B) (C) A549A 5 4 9 A549 1 0

s IPZ - -  

e v

e IR

l -  - 

A Pro-caspase-9

ΔNp63α N M R 5

U Cleaved

ΔNp63β e v

i caspase-9

PUMA (BBC3) PUMA

l e

Relative levels Relative mRNA PUMA KPNB1 R

0 Actin IRIR - -  --  Actin IPZIPZ - - -  

(D) (E) (F) A549 0 Gy 6 Gy T P 6 3 - P U M A S t o m a c h A d e n o c a r c i n o m a

A549 0 . 5 0 1.0% 2.2% 1 Control H e p a t o c e l l u l a r C a r c i n o m a IPZ 0 . 2 5 L u n g A d e n o c a r c i n o m a

Control r

n a 1.0% 12% C e r v i c a l S C C

0.1 m 0 . 0 0

r a

e H e a d a n d N e c k S C C 1.0% 1.0% p S - 0 . 2 5 IPZ fraction Surviving L u n g S C C 0 2 4 6

Dose (Gy) - 0 . 5 0 PI 1.3% 9.2% 0 2 5 0 5 1 1 Annexin V FITC - L o g 1 0 ( p - v a l u e ) Figure 4. RadiRadiosensitizationosensitization effects eﬀects through through abolishing Δ∆Np63α--mediatedmediated PUMA silencing is unique toto HNSCC HNSCC cells cells.. ( (AA)) Western Western blot blot analysis analysis of of Δ∆Np63Np63 and and KPNB1 KPNB1 expression. expression. The The r representativeepresentative image image isis shown. ( (BB,,CC)) IPZ IPZ ( (1010 mµMM)) was added to the culture medium 1 h before X-rayX-ray irradiation. After 20 hh-incubation,-incubation, the cells were were harvested harvested for for qRT qRT-PCR-PCR and Western blot analyses analyses.. ( (BB)) qRT qRT-PCR-PCR analysis of PUMA expression levels. Data are presented as the mean SD of three independent experiments of PUMA expression levels. Data are presented as the mean ± SD of three independent experiments performed in in triplicate. triplicate. (C (C) )Western Western blot blot analysis analysis of of PUMA PUMA expression. expression. The The representative representative image image is shown.is shown. (D) ( DIPZ) IPZ (10 (10 mMµ)M) was was added added to the to the culture culture medium medium 1 h 1 before h before X-ray X-ray irradiation. irradiation. After After 20 20h- incubation,h-incubation, the the cell cell-culture-conditioned-culture-conditioned medium medium was was replaced replaced with with a afresh fresh medium, medium, and and the the cells were further cultured for 3 days. After culturing, the the A549 cells were harvested for apoptosis assay using anne annexinxin V/PI V/PI staining. The The r representativeepresentative cytograms of annexin V/PI V/PI are shown. Inset Inset numbers numbers + + + µ indicateindicate the proportion ofof annexinannexin VV/PI− cellscells or annexin V//PI cells.cells. (E) (E) IPZ IPZ ( (1010 mMM)) was was added added to thethe culture medium 1 h beforebefore X-rayX-ray irradiation.irradiation. After 20 h-incubation,h-incubation, the cell-culture-conditionedcell-culture-conditioned medium was replaced with fresh medimediaa and the cells were further cultured until the colony was observed. The surviving fraction of A549 cells is shown. Data are presented as the mean SD of three observed. The surviving fraction of A549 cells is shown. Data are presented as the mean ± SD of three independent experiments performed in triplicate. (F) Correlation analysis was performed based on independent experiments performed in triplicate. (F) Correlation analysis was performed based on Spearman r and p values between TP63 and PUMA from the TCGA datasets. Spearman r and p values between TP63 and PUMA from the TCGA datasets.

2.5. KPNB1 Is Involved in Radiation-Increased Cell Surface PD-L1 Expression on HNSCC Cells PD-L1 (also known as CD274) is one of the ligands of the immunoinhibitory molecule PD-1 expressed on immune cells, including T cells [5], and the interaction of PD-L1 and PD-1 negatively regulates immune response. Therefore, cancer cells expressing PD-L1 on their cell surface may impede host immunity against cancer cells. Since ionizing radiation is known to increase PD-L1

Cancers 2020, 12, 908 8 of 16

Cancersregulates 2020 immune, 12, x response. Therefore, cancer cells expressing PD-L1 on their cell surface may impede8 of 15 host immunity against cancer cells. Since ionizing radiation is known to increase PD-L1 expression expressionof cancer cells of cancer[6,11], thecells authors [6,11], thenthe authorsinvestigated thenthe investigated involvement the of involvement KPNB1 in the of upregulation KPNB1 in the of upregulationcell surface PD-L1 of cell expression surface PD on-L1 irradiated expression HNSCC on irradiated cells. As HNSCC shown incells. Figure As 5shownA, the expressionin Figure 5 ofA, thePD-L1 expression on HNSCC of PD cells-L1 increased on HNSCC upon cells 6 Gyincreased X-ray irradiation. upon 6 Gy Intriguingly, X-ray irradiation. the blockage Intriguingly, of KPNB1 the blockagefunctions of significantly KPNB1 functions suppressed significantly the radiation-increased suppressed the PD-L1 radiation expression-increased in irradiated PD-L1 expression HNSCC cells in irradiated(Figure5A,B). HNSCC Similarly, cells KPNB1 (Figure knockdown 5A,B). Similarly, suppressed KPNB1 the radiation-increased knockdown suppressed PD-L1 theexpression radiation on- increasedHNSCC cells PD- (FigureL1 expression S7). While on IPZ HNSCC treatments cells ( blockedFigure S∆7Np63). While nuclear IPZ treatmentsimport and blockedinduced  PUMANp63 nuclearexpression, import IPZ and itself induced did not PUMA affect PD-L1 expression, expression IPZ itself in non-irradiated did not affect HNSCC PD-L1 cellsexpression (Figure 5inC). non To- irradiatedget an insight HNSCC on PD-L1 cells regulation,(Figure 5C). a correlationalTo get an insight analysis on PD between-L1 regulation, CD274 (PD-L1) a correlation mRNAal levels analysis and betweenTP63 (∆Np63), CD274 BBC3 (PD-L1) (PUMA), mRNA and levels interferon and TP63 regulatory (Np63), factor BBC3 1 (PUMA) (IRF1) reported, and interferon as PD-L1 regulatory inducible factortranscription 1 (IRF1) factor reported in irradiated as PD-L1 cellsinducible [11] was transcription performed. factor We foundin irradiated that the cells mRNA [11] was levels performed of CD274. Wesignificantly found that showed the mRNA a strong levels and of CD274 positive significantly correlation showed with IRF1 a strong expression and positive levels, correlation which was with not IRF1observed expression for either levels, TP63 which or BBC3 was (Figurenot observed5D,E). for Furthermore, either TP63 a or positive BBC3 (Figure correlation 5D,E). between Furthermore CD274, amRNA positive and correlation IRF1 mRNA between was observed CD274 mRNA in both non-SCCand IRF1 andmRNA SCC was samples observed (Figure in5 bothF), suggesting non-SCC thatand SCCthe regulation samples (Figure of PD-L1 5F), expression suggesting depends that the on regula IRF1.tion of PD-L1 expression depends on IRF1.

(A) (B) IR -   IPZ - -  SAS 10 Ca9-22 7.1 5.1     3.5 5 8 SAS 4 6

3 L1 expression L1 - 4 2 2.1 4.9 2.7 2 1

Ca9-22 0 0

Relative Relative PD IR -   -  

Cell Cell number IPZ - -  - -  PD-L1-PE (C) (D) HNSCC (TCGA, n=488) Co-occurrence 5 Control CD274 4 IPZ ***:P<0.00l

expression 3 IRF1 L1

- 2 TP63 PD 1 BBC3 0

SAS Ca9-22 -3 3 Relative

(E) (F) I R F 1 v s C D 2 7 4 HNSCC S t o m a c h A d e n o c a r c i n o m a

1 . 0 0 Spearman r = 0.552 Spearman r = 0.01 Spearman r = -0.103 H e p a t o c e l l u l a r C a r c i n o m a p=2.55e-40 p=0.903 p=0.023

0 . 7 5 L u n g A d e n o c a r c i n o m a r 12

12 12 n a 10 10 C e r v i c a l S C C 10 m 0 . 5 0 8 a 8 8 r 6 e H e a d a n d N e c k S C C

6 6 p CD274 4 S 0 . 2 5 4 4 L u n g S C C 2 2 2 0 0 0 0 . 0 0 6 8 10 12 14 0 2 4 6 8 10 12 14 16 5 6 7 8 9 10 11 0 2 0 4 0 6 0 IRF1 TP63 BBC3 - L o g 1 0 ( p - v a l u e ) Figure 5. TheThe e effectsﬀects of of KPNB1 inhibition on radiation radiation-increased-increased cell cell surface PDPD-L1-L1 expression i inn HNSCC cells cells.. ( (AA,,BB)) IPZ IPZ ( (1010 mµMM)) was was added added to to the culture medium 1 h before X-rayX-ray irradiation. The SAS cells were cultured for 4 days in the presence of IPZ after irradiation. In In terms terms of of Ca9 Ca9-22-22 cells cells,, the the cellcell culture culture-conditioned-conditioned medium was replaced with fresh medi mediaa at 20 h after irradiation and the cells were further cultured for 3 days. (A) The representative histograms of PD-L1 expression on SAS and Ca9-22 cells are shown. The dotted line and filled black histograms indicate the isotype control and the PD-L1 expression, respectively. Inset numbers indicate the relative values of the mean fluorescence intensity of PD-L1 compared with isotype control. (B) Data are presented as the mean ± SD of three independent experiments. * indicates p < 0.01. (C) The quantification of PD-L1 expression levels in HNSCC cells upon IPZ treatment is shown. Data are presented as the mean ± SD of three independent experiments. (D) The heat map showing co-occurrence between PD-L1 (CD274)

Cancers 2020, 12, 908 9 of 16

The effects of KPNB1 inhibition on radiation-increased cell surface PD-L1 expression in HNSCC cells. (A,B) IPZ (10 µM) was added to the culture medium 1 h before X-ray irradiation. The SAS cells were cultured for 4 days in the presence of IPZ after irradiation. In terms of Ca9-22 cells, the cell culture-conditioned medium was replaced with fresh media at 20 h after irradiation and the cells were further cultured for 3 days. (A) The representative histograms of PD-L1 expression on SAS and Ca9-22 cells are shown. The dotted line and filled black histograms indicate the isotype control and the PD-L1 expression, respectively. Inset numbers indicate the relative values of the mean fluorescence intensity of PD-L1 compared with isotype control. (B) Data are presented as the mean SD of three independent ± experiments. * indicates p < 0.01. (C) The quantification of PD-L1 expression levels in HNSCC cells upon IPZ treatment is shown. Data are presented as the mean SD of three independent experiments. ± (D) The heat map showing co-occurrence between PD-L1 (CD274) expression and IRF1. The samples were divided according to mRNA expression levels (mRNA expression z-Scores (RNA-Seq V2 RSEM) > mean + 1.0 SD) from the TCGA cohorts. P values are based on Fisher’s exact test. (E) Correlation between CD274 mRNA and each of IRF1, TP63, and BBC3 (PUMA) mRNA in HNSCC from TCGA. (F) Correlation analysis was performed based on Spearman r and p values from TCGA cohorts.

3. Discussion Many reports, including the present study, have demonstrated an involvement of nuclear transport receptors in the progression of cancer, making them promising targets for the treatment of cancer [16,30]. Since radiation-chemotherapy is the standard approach for HNSCC treatment, it is extremely important to know whether the blockage of nuclear transport receptors has a therapeutic benefit in that axis. In this study, it was demonstrated that the combination of KPNB1 blockage and radiation stimuli synergistically enhanced apoptosis by upregulating pro-apoptotic PUMA in HNSCC cells. Furthermore, the radiosensitizing effects was unique to HNSCC, since PUMA regulation is under the control of the SCC-specific oncogene ∆Np63α. Note that the researchers further observed that IPZ treatment or KPNB1 knockdown attenuated the upregulation of cell surface PD-L1 expression on irradiated HNSCC cells, suggesting that a combination of KPNB1 blockage and radiation is highly expected as a novel therapeutic approach for HNSCC. Radiation treatment is expected to cause apoptotic cell death by damaging the genomic DNA in cancer cells. Apoptosis is a physiological process activated by caspase-dependent protease cascades [31]. Caspase activation depends on two pathways, namely the extrinsic and intrinsic pathways. The authors found that either IPZ or its combination with radiation enhanced the intrinsic pathway, as characterized by caspase-9 activation. There was a further highlight on PUMA as the key pro-apoptotic factor contributing to the radiosensitization effects of IPZ in irradiated HNSCC cells, which is consistent with the results of previous studies that demonstrated PUMA expression evokes a profound chemo- and radiosensitization in several cancer cells [32–34]. While the DNA repair process requires the karyopherin-dependent import of DNA repair proteins, such as BRAC1, NBS1, and p53 binding protein 1 in cancer cells [8,35,36], it would be interesting to determine whether KPNB1 inhibition disturbs the importation such repair proteins in HNSCC cells. Moreover, ∆Np63α was identified as the candidate target of KPNB1 in determining the radiosensitivity of HNSCC cells. Functionally, KPNB1-mediated ∆Np63α nuclear transport is crucial in suppressing pro-apoptotic PUMA expression and consequentially lowering the survival rate in irradiated HNSCC cells. TP63 gene, a p53 homolog, is a master transcriptional regulator of epithelial development and maintenance [37]. Furthermore, ∆Np63α is known as an oncogenic transcription factor in SCC [38]. Because ∆Np63α acts as the lineage-specific oncogene, the synergistic effects of IPZ and radiation were demonstrated in HNSCC cells but were not reported in human lung adenocarcinoma A549 cells, hepatocellular carcinoma HepG2 cells, or in normal human umbilical vein endothelial cells (HUVEC) (Figure S8). The cytotoxic effect of IPZ was less in HUVEC, and it hardly enhanced the radiation-induced toxicity on HUVEC (Figure S8). Therefore, the application of IPZ in Cancers 2020, 12, 908 10 of 16 chemo-radiotherapy has positive benefits in HNSCC. It would be noteworthy to investigate whether the blockage of KPNB1 regulates the cellular radiosensitivity of other SCCs in future studies. Recent evidence shows that ionizing radiation increases PD-L1 expression in various cancer cells [39–41]. In this study, however, the researchers showed that blocking KPNB1 functions suppressed the induction of PD-L1 expression in irradiated HNSCC cells, suggesting that KPNB1’s nuclear transport-regulating action is involved in the radiation-increased PD-L1 expression. Consistent with the previous study [11], the transcript amounts of PD-L1 had a significant positive correlation to IRF1 levels but not with either TP63 or PUMA expression levels. IRF1 contains NLS [42] and is transported by KPNA2 upon interferon-γ stimuli [43]. Therefore, blocking the KPNA2-IRF1 nuclear import may serve as a promising mechanism to prevent abominable PD-L1 upregulation during radiation therapy.

4. Materials and Methods

4.1. Bioinformatics and Data Analysis KPNB1 expression in tumor and non-tumor tissue samples was downloaded from Cancer RNA-Seq Nexus (see Section 4.13 for URLs) and reanalyzed. The relationship between high KPNB1 expressions (mRNA expression z-Scores (RNA Seq V2 RSEM) > mean + 0.5 SD) and overall survival of diﬀerent types of cancer patients in TCGA cohorts was analyzed through cBioportal for Cancer Genomics (see Section 4.13 for URLs). ChIP-seq proﬁles were reanalyzed based on Cistrome Data Browser (see Section 4.13 for URLs).

4.2. Reagents IPZ, propidium iodide (PI), and dimethyl sulfoxide (DMSO) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Anti-caspase-8 antibody (#9746), caspase-9 antibody (#9502), PUMA antibody (#12450), β-actin antibody (#4967), anti-rabbit IgG horseradish peroxidase (HRP)-linked antibody (#7074), and anti-mouse IgG HRP-linked antibody (#7076) were purchased from Cell Signaling Technology Japan, K.K. (Tokyo, Japan). The anti-importin beta mouse monoclonal antibody [3E9] (ab2811) was purchased from abcam (Cambridge, UK). The phycoerythrin (PE)-labeled anti-human PD-L1 monoclonal antibody (#329706), PE-conjugated anti-mouse IgG2b antibody (#400314), and anti-p63(∆N) antibody (#619001) were purchased from BioLegend (San Diego, CA, USA). Ambion Silencer® Select Pre-designed siRNA against the gene-encoding KPNB1 (cat. no. s7919) and Silencer® Select Negative #1 Control siRNA (cat. no. AM4611) were purchased from Thermo Fisher Scientiﬁc, Inc. (Waltham, MA, USA).

4.3. Cell Culture and Treatment SAS, Ca9-22, and A549 cells were obtained from RIKEN Bio-Resource Center (Tsukuba, Japan). HepG2 and RERF-LC-MS cells were from the Japanese Collection of Research Bioresources Cell Bank (Osaka, Japan). SAS and Ca9-22 cells were maintained in high glucose Dulbecco’s modified eagle medium (DMEM; Wako Pure Chemical Industries, Ltd., Osaka, Japan) supplemented with 10% heat-inactivated fetal bovine serum (FBS, Japan Bioserum Co., Ltd., Fukuyuma, Japan) and 1% penicillin/streptomycin (P/S, Wako Pure Chemical Industries). A549 and HepG2 cells were maintained in low glucose DMEM (Sigma-Aldrich) supplemented with 1% P/S and 10% heat-inactivated FBS. RERF-LC-MS were maintained in Minimum Essential Medium Eagle (Sigma-Aldrich) supplemented with 1% P/S and 1% MEM non-essential amino acids (Thermo Fisher Scientific, Inc.), and 10% heat-inactivated FBS. H1299 cells from the American Type Culture Collection (ATCC, Manassas, VA, USA) were maintained in RPMI1640 medium (Gibco®; Invitrogen/Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 1% P/S and 10% heat-inactivated FBS. HUVEC were purchased from Cell Applications, Inc. (San Diego, CA, USA) and maintained in an endothelial cell growth medium kit (D12023, Takara Bio Inc., Shiga, Japan) in type I collagen-coated dishes (IWAKI Glass Co. Ltd., Chiba, Japan). All cell lines were cultured at 37◦C in a humidified atmosphere containing 5% CO2. Cancers 2020, 12, 908 11 of 16

The cells were seeded in 12-well plates (5 104 cells; BD Falcon; BD Biosciences, Franklin Lakes, × NJ, USA), 35-mm culture dishes (10 104 cells; IWAKI Glass Co. Ltd.), or 60-mm culture dishes × (20 104 cells; IWAKI Glass Co. Ltd.) and incubated for 6 h to allow adherence. After incubation, IPZ × was added to the culture medium. DMSO-treated cells were prepared as vehicle controls. After 4 days of culturing at 37 ◦C, the cultured cells were harvested using 0.25% trypsin-ethylenediaminetetraacetic acid (Wako Pure Chemical Industries, Ltd.), and the number of viable cells was counted using trypan blue dye exclusion assay before subsequent analysis. In some experiments, X-ray irradiation was performed at 1 h after IPZ administration and the cells were incubated for 4 days or about 20 h in the presence of IPZ. After the 20 h-incubation, the cells were washed twice with fresh media, and then the culture medium was replaced. After the medium replacement, the cells were further cultured for 1–3 days at 37 ◦C and harvested for subsequent analyses.

4.4. siRNA Transfection The SAS or Ca9-22 cells were transfected with siRNA, targeting either KPNB1 or Control siRNA, using Lipofectamine® RNAiMAX (Invitrogen; Thermo Fisher Scientiﬁc, Inc.), following the manufacturer’s instructions. The ﬁnal siRNA concentration was 5 nM. After transfection for 48 h, the cells were harvested and used for subsequent analyses.

4.5. In Vitro X-ray Irradiation X-ray irradiation (150 kVp, 20 mA, 0.5 mm Al, and 0.3-mm Cu ﬁlters) was performed using an X-ray generator (MBR-1520R-3; Hitachi Medical Corporation, Tokyo, Japan) at a distance of 45 cm from the focus, with a dose rate of 0.99–1.04 Gy/min, which was monitored by placing a thimble ionization chamber next to the sample during irradiation.

4.6. Clonogenic Survival Assay The cells were seeded in 6-well plates (BD Falcon) or 60-mm culture dishes (IWAKI Glass Co. Ltd.) and were incubated for 6 h to promote adherence to the dish. After incubation, 0.1% DMSO or IPZ was added to the culture medium and the cells were cultured for 8–12 days. To further investigate the radiosensitizing eﬀect of IPZ, 0.1% DMSO or IPZ was added to the culture medium 1 h before irradiation and then exposed to X-rays. After X-ray irradiation, the cells were incubated for about 20 h in the presence of IPZ. Next, the cells were washed twice with fresh media and their culture medium was replaced with a fresh set. After the replacement, the cells were cultured for 8–12 days. Subsequently, the cells were ﬁxed with methanol and were stained with Giemsa solution (Wako Pure Chemical Industries, Ltd.). The colonies that contained >50 cells were counted. The surviving fraction at each radiation dose was calculated based on previously reported procedures in this study [44].

4.7. Detection of Apoptosis Apoptosis was analyzed by annexin V-FITC (BioLegend) and PI staining as previously reported [45]. Moreover, the cells treated with each compound were harvested, washed, and suspended in annexin V Binding Buﬀer (BioLegend). The annexin V-FITC (2.5 µg/mL) and PI solution (50 µg/mL) were added to the cell suspension and incubated for 15 min in the dark at room temperature. Then, the apoptotic cells were analyzed via ﬂow cytometry (Cytomics FC500; Beckman–Coulter, Fullerton, CA, USA).

4.8. SDS-PAGE and Western Blotting SDS-PAGE analysis and Western blotting were performed based on previously reported procedures in this study [46]. The primary antibodies that were used are anti-caspase-8 antibody (1:3000), caspase-9 antibody (1:3000), puma antibody (1:3000), p63 (∆N) antibody (1:3000), importin beta antibody (1:3000), and β-actin antibody (1:4000). The following secondary antibodies that were used were HRP-linked anti-rabbit IgG antibody (1:10,000) or HRP-linked anti-mouse IgG antibody (1:10,000). The antigens Cancers 2020, 12, 908 12 of 16 were visualized using the ClarityTM Western ECL Substrate (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Blot stripping was performed using Stripping Solution (Wako Pure Chemical Industries, Ltd.).

4.9. Immunofluorescence Analysis The cells on coverslips were incubated under the indicated conditions and fixed for 10 min in 4% paraformaldehyde in Ca2+- and Mg2+-free phosphate-buffered saline [PBS( )] and then permeabilized − with 0.3% Triton X-100 in PBS( ) for 3 min at room temperature. The coverslips were incubated − with the indicated primary antibodies for 2 h. They were washed three times and incubated with Alexa Fluor-conjugated secondary antibodies (Life Technologies; Thermo Fisher Scientific, Waltham, MA, USA) for 1 h. After three washes, the samples were mounted onto coverslips using Pro-Long Gold Antifade reagent (Life Technologies) and examined by confocal microscopy (objective 60/1.2, × FluoView® FV10i, Olympus, Tokyo, Japan).

4.10. Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR) The total RNA extraction and the synthesis of complementary DNA templates were performed as previously indicated [47]. The synthesis of complementary DNA templates was performed using PrimeScript™ RT Master Mix (Takara Bio Inc.), used according to the manufacturer’s instructions, and quantitative RT–PCR was performed by SYBR® Premix Ex Taq™ II (Takara Bio Inc.) in a Thermal Cycler Dice® Real Time System (Takara Bio Inc.). The relative mRNA expression level of the target genes was calculated using GAPDH as a loading control. The primers that were used for this are listed in Table1.

Table 1. Primer sequences used for qRT-PCR.

Sequence (5 3 ) 0→ 0 PUMA F GACGACCTCAACGCACAGTA PUMA R CACCTAATTGGGCTCCATCT GAPDH F GTCAGTGGTGGACCTGACCT GAPDH R AGGGGTCTACATGGCAACTG

4.11. Analysis of Cell Surface PD-L1 Expression The analysis of the cell surface PD-L1 expression was performed. In brief, harvested cells were washed twice with PBS( ) and then stained with PE-conjugated anti-human PD-L1 antibody or − PE-conjugated anti-mouse IgG2b isotype control for 30 min at 4 ◦C in the dark. After staining, the cells were washed and analyzed using ﬂow cytometry.

4.12. Statistical Analysis Data are presented as mean SD. The comparisons between the control and experimental groups ± were performed using the two-sided Student’s t-test or Mann–Whitney U-test depending on data distribution. Multiple batches of data were analyzed using one-way analysis of variance, followed by the Tukey–Kramer test. The diﬀerences were considered signiﬁcant when the resulting p < 0.05. The Excel 2016 software (Microsoft, Washington, DC, USA), with the add-in software Statcel 4 (The Publisher OMS Ltd., Tokyo, Japan), was used to perform these statistical analyses. A sample t-test was performed using GraphPad QuickCalcs (see URLs), and the control group was considered as 100%.

4.13. URLs Cancer RNA-Seq Nexus, http://syslab4.nchu.edu.tw/; cBioportal for Cancer Genomics, http: //www.cbioportal.org/; Cistrome Data Browser, http://cistrome.org/db/#/; GraphPad QuickCalcs, http://graphpad.com/quickcalcs/OneSampleT1.cfm Cancers 2020, 12, 908 13 of 16

5. Conclusions In conclusion, the results in the study showed the beneﬁcial eﬀects of KPNB1 blockage on radiation response in HNSCC cells in terms of radiosensitization and inhibition of upregulation of cell surface PD-L1 expression. Therefore, co-treatment with KPNB1 blockage and ionizing radiation is a promising strategy for HNSCC therapy.

Supplementary Materials: The following are available online at http://www.mdpi.com/2072-6694/12/4/908/s1, Figure S1: The effects of IPZ on the viability of HNSCC cells, Figure S2: The analysis of relationship between BBC3 and TP63 or JUN mRNA, Figure S3: The effects of IPZ on nuclear localization of c-JUN in SAS cells, Figure S4: The relationship between KPNB1 expression and prognosis of different types of cancer patients, Figure S5: The effects of IPZ on cell viability of lung adenocarcinoma A549 cells, Figure S6: The effects of IPZ on proliferation and radiosensitivity of human hepatocellular carcinoma HepG2 cells, Figure S7: The effects of KPNB1 knockdown on radiation-increased cell surface PD-L1 expression on HNSCC cells, Figure S8: The effects of IPZ on proliferation and radiation-induced apoptosis of human umbilical vein endothelial cells (HUVEC). Supplementary information about western blot for Figure1C, Figure2A, Figure3D, Figure4A,C and Figure S6A. Author Contributions: M.H. and H.Y. initiated the research. M.H., H.Y., Y.N., R.S., K.N., Y.S., and M.S. performed the experiments and collected and analyzed data. M.H., H.Y., R.W.W., and I.K. wrote, reviewed, and revised the manuscript. All authors have read and agreed to the published version of the manuscript. Funding: This research was supported by the Hirosaki University Grant for Exploratory Research by Young Scientists. This work was also partially supported by the Takeda Science Foundation (H.Y.) and JSPS KAKENHI, with grant number JP18K07623. Conflicts of Interest: The authors declare no conflict of interest.

Appendix A The clonogenic potential of HNSCC cells significantly decreased after KPNB1 knockdown or the long-term treatment with IPZ (Figure1D,F). It is extremely hard to estimate the radiosensitization effects on KPNB1-depleted cells because the analysis of survival rate upon radiation stimuli requires moderate colony numbers of non-irradiated cells as a control. Although the effects of IPZ on KPNB1 blockage were controlled by IPZ treatment times to get moderate colony numbers for radiosensitization analysis, it was impossible to adjust the terms of KPNB1 silencing by siRNA-mediated knockdown to get enough colony numbers for further analysis. Therefore, the researchers did not use the clonogenic assay to estimate the radiosensitizing effect upon KPNB1 knockdown.

References

1. Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [CrossRef] 2. Balázs, K.; Kis, E.; Badie, C.; Bogdándi, E.N.; Candéias, S.; Cruz Garcia, L.; Dominczyk, I.; Frey, B.; Gaipl, U.; Jurányi, Z.; et al. Radiotherapy-Induced changes in the systemic immune and inﬂammation parameters of head and neck cancer patients. Cancers 2019, 11, 1324. [CrossRef] 3. Budach, V.; Tinhofer, I. Novel prognostic clinical factors and biomarkers for outcome prediction in head and neck cancer: A systematic review. Lancet Oncol. 2019, 20, e313–e326. [CrossRef] 4. Perri, F.; Pacelli, R.; Della Vittoria Scarpati, G.; Cella, L.; Giuliano, M.; Caponigro, F.; Pepe, S. Radioresistance in head and neck squamous cell carcinoma: Biological bases and therapeutic implications. Head Neck 2015, 37, 763–770. [CrossRef] 5. Xie, F.; Xu, M.; Lu, J.; Mao, L.; Wang, S. The role of exosomal PD-L1 in tumor progression and immunotherapy. Mol. Cancer 2019, 18, 146. [CrossRef][PubMed] 6. Wu, C.T.; Chen, W.C.; Chang, Y.H.; Lin, W.Y.; Chen, M.F. The role of PD-L1 in the radiation response and clinical outcome for bladder cancer. Sci. Rep. 2016, 6, 19740. [CrossRef][PubMed] 7. Chen, M.; Chen, P.; Chen, W.; Lu, M.; Lin, P.; Lee, K. The role of PD-L1 in the radiation response and prognosis for esophageal squamous cell carcinoma related to IL-6 and T-cell immunosuppression. Oncotarget 2016, 7, 7913–7924. [CrossRef][PubMed] Cancers 2020, 12, 908 14 of 16

8. Moudry, P.; Lukas, C.; Macurek, L.; Neumann, B.; Heriche, J.K.; Pepperkok, R.; Ellenberg, J.; Hodny, Z.; Lukas, J.; Bartek, J. Nucleoporin NUP153 guards genome integrity by promoting nuclear import of 53BP1. Cell Death Differ. 2012, 19, 798–807. [CrossRef] 9. Chao, C.; Saito, S.; Kang, J.; Anderson, C.W.; Appella, E.; Xu, Y. p53 transcriptional activity is essential for p53-Dependent apoptosis following DNA damage. EMBO J. 2000, 19, 4967–4975. [CrossRef] 10. Tamatani, T.; Takamaru, N.; Hara, K.; Kinouchi, M.; Kuribayashi, N.; Ohe, G.; Uchida, D.; Fujisawa, K.; Nagai, H.; Miyamoto, Y. Bortezomib-Enhanced radiosensitization through the suppression of radiation-induced nuclear factor-κB activity in human oral cancer cells. Int. J. Oncol. 2013, 42, 935–944. [CrossRef] 11. Sato, H.; Niimi, A.; Yasuhara, T.; Permata, T.B.M.; Hagiwara, Y.; Isono, M.; Nuryadi, E.; Sekine, R.; Oike, T.; Kakoti, S.; et al. DNA double-Strand break repair pathway regulates PD-L1 expression in cancer cells. Nat. Commun. 2017, 8, 1751. [CrossRef][PubMed] 12. Yu, J.; Zhang, L. PUMA, a potent killer with or without p53. Oncogene 2008, 27, S71–S83. [CrossRef][PubMed] 13. Yoneda, Y. Nuclear pore-Targeting complex and its role on nuclear protein transport. Arch Histol. Cytol. 1996, 59, 97–107. [CrossRef][PubMed] 14. Lange, A.; Mills, R.E.; Lange, C.J.; Stewart, M.; Devine, S.E.; Corbett, A.H. Classical nuclear localization signals: Definition, function, and interaction with importin alpha. J. Biol. Chem. 2007, 282, 5101–5105. [CrossRef] 15. Liang, S.H.; Clarke, M.F. The nuclear import of p53 is determined by the presence of a basic domain and its relative position to the nuclear localization signal. Oncogene 1999, 18, 2163–2166. [CrossRef] 16. Hazawa, M.; Sakai, K.; Kobayashi, A.; Yoshino, H.; Iga, Y.; Iwashima, Y.; Lim, K.S.; Chih-Cheng Voon, D.; Jiang, Y.Y.; Horike, S.I.; et al. Disease-Specific alteration of karyopherin-α subtype establishes feed-Forward oncogenic signaling in head and neck squamous cell carcinoma. Oncogene 2019.[CrossRef] 17. Yang, L.; Hu, B.; Zhang, Y.; Qiang, S.; Cai, J.; Huang, W.; Gong, C.; Zhang, T.; Zhang, S.; Xu, P.; et al. Suppression of the nuclear transporter-KPNβ1 expression inhibits tumor proliferation in hepatocellular carcinoma. Med. Oncol. 2015, 32, 128. [CrossRef] 18. Kuusisto, H.V.; Jans, D.A. Hyper-Dependence of breast cancer cell types on the nuclear transporter Importin β1. Biochim. Biophys. Acta 2015, 1853, 1870–1878. [CrossRef] 19. Cancer Genome Atlas Network. Comprehensive genomic characterization of head and neck squamous cell carcinomas. Nature 2015, 517, 576–582. [CrossRef] 20. Lin, D.C.; Hao, J.J.; Nagata, Y.; Xu, L.; Shang, L.; Meng, X.; Sato, Y.; Okuno, Y.; Varela, A.M.; Ding, L.W.; et al. Genomic and molecular characterization of esophageal squamous cell carcinoma. Nat. Genet. 2014, 46, 467–473. [CrossRef] 21. Lee, C.S.; Bhaduri, A.; Mah, A.; Johnson, W.L.; Ungewickell, A.; Aros, C.J.; Nguyen, C.B.; Rios, E.J.; Siprashvili, Z.; Straight, A.; et al. Recurrent point mutations in the kinetochore gene KNSTRN in cutaneous squamous cell carcinoma. Nat. Gene 2014, 46, 1060–1062. [CrossRef][PubMed] 22. Cancer Genome Atlas Research Network; Analysis Working Group: Asan University; BC Cancer Agency; Brigham and Women’s Hospital; Broad Institute, Brown University; Case Western Reserve University; Dana-Farber Cancer Institute; Duke University; Greater Poland Cancer Centre, Harvard Medical School; Institute for Systems Biology; et al. Integrated genomic characterization of oesophageal carcinoma. Nature 2017, 541, 169–175. [CrossRef][PubMed] 23. Leonard, M.K.; Kommagani, R.; Payal, V.; Mayo, L.D.; Shamma, H.N.; Kadakia, M.P. ∆Np63α regulates keratinocyte proliferation by controlling PTEN expression and localization. Cell Death Differ. 2011, 18, 1924–1933. [CrossRef][PubMed] 24. Carroll, D.K.; Carroll, J.S.; Leong, C.O.; Cheng, F.; Brown, M.; Mills, A.A.; Brugge, J.S.; Ellisen, L.W. p63 regulates an adhesion programme and cell survival in epithelial cells. Nat. Cell Biol. 2006, 8, 551–561. [CrossRef][PubMed] 25. Tordella, L.; Koch, S.; Salter, V.; Pagotto, A.; Doondeea, J.B.; Feller, S.M.; Ratnayaka, I.; Zhong, S.; Goldin, R.D.; Lozano, G.; et al. ASPP2 suppresses squamous cell carcinoma via RelA/p65-Mediated repression of p63. Proc. Natl. Acad. Sci. USA 2013, 110, 17969–17974. [CrossRef] Cancers 2020, 12, 908 15 of 16

26. Hazawa, M.; Lin, D.C.; Kobayashi, A.; Jiang, Y.Y.; Xu, L.; Dewi, F.; Mohamed, M.S.; Nakada, M.; Meguro-Horike, M.; Horike, S.I.; et al. ROCK-Dependent phosphorylation of NUP62 regulates p63 nuclear transport and squamous cell carcinoma proliferation. EMBO Rep. 2018, 19, 73–88. [CrossRef] 27. Moergel, M.; Abt, E.; Stockinger, M.; Kunkel, M. Overexpression of p63 is associated with radiation resistance and prognosis in oral squamous cell carcinoma. Oral Oncol. 2010, 46, 667–671. [CrossRef] 28. Rocco, J.W.; Leong, C.O.; Kuperwasser, N.; DeYoung, M.P.; Ellisen, L.W. p63 mediates survival in squamous cell carcinoma by suppression of p73-Dependent apoptosis. Cancer Cell 2006, 9, 45–56. [CrossRef] 29. Stelma, T.; Leaner, V.D. KPNB1-Mediated nuclear import is required for motility and inflammatory transcription factor activity in cervical cancer cells. Oncotarget 2017, 8, 32833–32847. [CrossRef] 30. Stelma, T.; Chi, A.; van der Watt, P.J.; Verrico, A.; Lavia, P.; Leaner, V.D. Targeting nuclear transporters in cancer: Diagnostic, prognostic and therapeutic pohurtential. IUBMB Life 2016, 68, 268–280. [CrossRef] 31. Green, D.R.; Llambi, F. Cell death signaling. Cold Spring Harb. Perspect Biol. 2015, 7, a006080. [CrossRef] [PubMed] 32. Wang, R.; Wang, X.; Li, B.; Lin, F.; Dong, K.; Gao, P.; Zhang, H.Z. Tumor-Specific adenovirus-Mediated PUMA gene transfer using the survivin promoter enhances radiosensitivity of breast cancer cells in vitro and in vivo. Breast Cancer Res. Treat. 2009, 117, 45–54. [CrossRef][PubMed] 33. Yu, J.; Yue, W.; Wu, B.; Zhang, L. PUMA sensitizes lung cancer cells to chemotherapeutic agents and irradiation. Clin. Cancer Res. 2006, 12, 2928–2936. [CrossRef] 34. Zhang, K.; Zhang, B.; Lu, Y.; Sun, C.; Zhao, W.; Jiao, X.; Hu, J.; Mu, P.; Lu, H.; Zhou, C. Slug inhibition upregulates radiation-Induced PUMA activity leading to apoptosis in cholangiocarcinomas. Med. Oncol. 2011, 28, S301–S309. [CrossRef][PubMed] 35. Song, K.H.; Jung, S.Y.; Park, J.I.; Ahn, J.; Park, J.K.; Um, H.D.; Park, I.C.; Hwang, S.G.; Ha, H.; Song, J.Y. Inhibition of karyopherin-α2 augments radiation-Induced cell death by perturbing BRCA1-mediated DNA repair. Int. J. Mol. Sci. 2019, 20, 2843. [CrossRef] 36. Teng, S.C.; Wu, K.J.; Tseng, S.F.; Wong, C.W.; Kao, L. Importin KPNA2, NBS1, DNA repair and tumorigenesis. J. Mol. Histol. 2006, 37, 293–299. [CrossRef][PubMed] 37. Senoo, M.; Pinto, F.; Crum, C.P.; McKeon, F. p63 Is essential for the proliferative potential of stem cells in stratified epithelia. Cell 2007, 129, 523–536. [CrossRef] 38. Gatti, V.; Fierro, C.; Annicchiarico-Petruzzelli, M.; Melino, G.; Peschiaroli, A. ∆Np63 in squamous cell carcinoma: Defining the oncogenic routes affecting epigenetic landscape and tumour microenvironment. Mol. Oncol. 2019, 13, 981–1001. [CrossRef]

39. Azad, A.; Yin Lim, S.; D0Costa, Z.; Jones, K.; Diana, A.; Sansom, O.J.; Kruger, P.; Liu, S.; McKenna, W.G.; Dushek, O.; et al. PD-L1 blockade enhances response of pancreatic ductal adenocarcinoma to radiotherapy. EMBO Mol. Med. 2017, 9, 167–180. [CrossRef] 40. Gong, X.; Li, X.; Jiang, T.; Xie, H.; Zhu, Z.; Zhou, F.; Zhou, C. Combined radiotherapy and anti-PD-L1 antibody synergistically enhances antitumor effect in non-small cell lung cancer. J. Thorac. Oncol. 2017, 12, 1085–1097. [CrossRef] 41. Dovedi, S.J.; Adlard, A.L.; Lipowska-Bhalla, G.; McKenna, C.; Jones, S.; Cheadle, E.J.; Stratford, I.J.; Poon, E.; Morrow, M.; Stewart, R.; et al. Acquired resistance to fractionated radiotherapy can be overcome by concurrent PD-L1 blockade. Cancer Res. 2014, 74, 5458–5468. [CrossRef] 42. Heinrich, P.C.; Behrmann, I.; Müller-Newen, G.; Schaper, F.; Graeve, L. Interleukin-6-Type cytokine signalling through the gp130/Jak/STAT pathway. Biochem. J. 1998, 334 Pt 2, 297–314. [CrossRef] 43. Umegaki, N.; Tamai, K.; Nakano, H.; Moritsugu, R.; Yamazaki, T.; Hanada, K.; Katayama, I.; Kaneda, Y. Differential regulation of karyopherin alpha 2 expression by TGF-beta1 and IFN-Gamma in normal human epidermal keratinocytes: Evident contribution of KPNA2 for nuclear translocation of IRF-1. J. Invest. Dermatol. 2007, 127, 1456–1464. [CrossRef][PubMed] 44. Yoshino, H.; Iwabuchi, M.; Kazama, Y.; Furukawa, M.; Kashiwakura, I. Effects of retinoic acid-Inducible gene-I-Like receptors activations and ionizing radiation cotreatment on cytotoxicity against human non-Small cell lung cancer in vitro. Oncol. Lett. 2018, 15, 4697–4705. [CrossRef][PubMed] 45. Yoshino, H.; Konno, H.; Ogura, K.; Sato, Y.; Kashiwakura, I. Relationship between the regulation of caspase-8-Mediated apoptosis and radioresistance in human THP-1-Derived macrophages. Int. J. Mol. Sci. 2018, 19, 3154. [CrossRef] Cancers 2020, 12, 908 16 of 16

46. Yoshino, H.; Kumai, Y.; Kashiwakura, I. Eﬀects of endoplasmic reticulum stress on apoptosis induction in radioresistant macrophages. Mol. Med. Rep. 2017, 15, 2867–2872. [CrossRef][PubMed] 47. Yoshino, H.; Kashiwakura, I. Involvement of reactive oxygen species in ionizing radiation-Induced upregulation of cell surface Toll-Like receptor 2 and 4 expression in human monocytic cells. J. Radiat. Res. 2017, 58, 626–635. [CrossRef][PubMed]

© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).