In vivo loss-of-function screens identify KPNB1 as a PNAS PLUS new druggable oncogene in epithelial ovarian cancer

Michiko Kodamaa,b,1, Takahiro Kodamaa,c,1,2, Justin Y. Newberga,d, Hiroyuki Katayamae, Makoto Kobayashie, Samir M. Hanashe, Kosuke Yoshiharaf, Zhubo Weia, Jean C. Tiena,g, Roberto Rangela,h, Kae Hashimotob, Seiji Mabuchib, Kenjiro Sawadab, Tadashi Kimurab, Neal G. Copelanda,i, and Nancy A. Jenkinsa,i,2

aCancer Research Program, Houston Methodist Research Institute, Houston, TX 77030; bDepartment of Obstetrics and Gynecology, Osaka University Graduate School of Medicine, Osaka 5650871, Japan; cDepartment of Gastroenterology and Hepatology, Osaka University Graduate School of Medicine, Osaka 5650871, Japan; dDepartment of Molecular Oncology, Moffitt Cancer Center, Tampa, FL 33612; eDepartment of Clinical Cancer Prevention, University of Texas MD Anderson Cancer Center, Houston, TX 77030; fDepartment of Obstetrics and Gynecology, Niigata University Graduate School of Medical and Dental Sciences, Niigata 9518510, Japan; gDepartment of Pathology, Michigan Center for Translational Pathology, University of Michigan, Ann Arbor, MI 48109; hDepartment of Immunology, University of Texas MD Anderson Cancer Center, Houston, TX 77030; and iDepartment of Genetics, University of Texas MD Anderson Cancer Center, Houston, TX 77030

Contributed by Nancy A. Jenkins, July 23, 2017 (sent for review April 3, 2017; reviewed by Roland Rad and Kosuke Yusa) Epithelial ovarian cancer (EOC) is a deadly cancer, and its prognosis has To overcome this problem, several alternative methods have re- not been changed significantly during several decades. To seek new cently been used for cancer gene discovery, including insertional therapeutic targets for EOC, we performed an in vivo dropout screen mutagenesis and RNAi/shRNA/CRISPR/Cas9-based screens. In in human tumor xenografts using a pooled shRNA library targeting our laboratory, we have performed transposon-based mutagenesis thousands of druggable genes. Then, in follow-up studies, we per- screens for a variety of cancer types and successfully identified many formed a second screen using a genome-wide CRISPR/Cas9 library. candidate cancer genes in a high-throughput manner (7, 8). How- These screens identified 10 high-confidence drug targets that included ever, the lack of EOC mouse models that recapitulate human EOC well-known oncogenes such as ERBB2 and RAF1, and novel oncogenes, has hampered our use of this technology for cancer gene discovery notably KPNB1, which we investigated further. Genetic and pharma- in EOC. Although several groups have used pooled RNAi library cological inhibition showed that KPNB1 exerts its antitumor effects screens for identifying new drug targets for EOC, most of these GENETICS through multiphase cell cycle arrest and apoptosis induction. Mecha- screens were performed in vitro (9, 10), which may not represent nistically, proteomic studies revealed that KPNB1 acts as a master the clinical setting. To overcome these limitations, we performed an regulator of cell cycle-related proteins, including p21, p27, and APC/ in vivo loss-of-function screen in human tumor xenografts using a C. Clinically, EOC patients with higher expression levels of KPNB1 pooled shRNA library targeting thousands of druggable genes. Then, showed earlier recurrence and worse prognosis than those with in follow-up studies, we performed a second screen using a genome- lower expression levels of KPNB1. Interestingly, ivermectin, a Food wide CRISPR/Cas9 library. These screens identified 10 high-confidence and Drug Administration-approved antiparasitic drug, showed KPNB1- candidate drug targets for EOC. In addition, we functionally vali- dependent antitumor effects on EOC, serving as an alternative dated a potent EOC oncogene, KPNB1, and showed its clinical therapeutic toward EOC patients through drug repositioning. Last, relevance to human EOC. We also showed that a well-established we found that the combination of ivermectin and paclitaxel produces a stronger antitumor effect on EOC both in vitro and in vivo than Significance either drug alone. Our studies have thus identified a combinatorial therapy for EOC, in addition to a plethora of potential drug targets. The poor prognosis of epithelial ovarian cancer (EOC) has not ovarian cancer | KPNB1 | loss-of-function screen | CRISPR/Cas | RNAi improved for several decades because of drug resistance to cur- rent anticancer drugs. Furthermore, few molecularly targeted agents are effective for EOC, likely because EOC has high tumor pithelial ovarian cancer (EOC) is the fifth leading cause of heterogeneity. Discovering new drug targets and mechanisms Ecancer-related deaths among women in the United States and involved in the progression of EOC is therefore sorely needed. Our the most lethal gynecological cancer (1). Because of its rapid growth multiple CRISPR and RNAi-based in vivo loss-of-function screens and lack of effective early detection strategies, 70% of EOC pa- have identified multiple new EOC candidate drug targets, in- tients are diagnosed at an advanced stage, accompanied by peri- cluding the druggable oncogene KPNB1, whose inhibition caused toneal carcinomatosis (PC) (2). Most EOC patients also eventually multiphased cell cycle arrest and induced apoptosis. Ivermectin, a become refractory to platinum, the major drug for treating EOC Food and Drug Administration-approved antiparasitic drug, exerts (3). Importantly, there are few molecularly targeted agents available KPNB1-dependent antitumor effects and synergistically inhibits for treating EOC, likely because EOC has high intertumor and tumor growth in combination with paclitaxel, and therefore rep- intratumor heterogeneity at the molecular and epigenetic levels (4). resents a new potential combinatorial therapy for EOC through Therefore, the mortality rate of EOC has not been significantly drug repositioning. changed for several decades (5). To improve the poor prognosis of

EOC, the discovery of new drug targets is sorely needed. Author contributions: M. Kodama, T. Kodama, N.G.C., and N.A.J. designed research; To elucidate the molecular pathogenesis of EOC, the Cancer M. Kodama, T. Kodama, H.K., M. Kobayashi, Z.W., J.C.T., R.R., K.H., S.M., and K.S. per- Genome Atlas project has performed whole-genome sequencing formed research; M. Kodama, T. Kodama, J.Y.N., H.K., M. Kobayashi, S.M.H., K.Y., T. Kimura, and DNA copy number analysis of 489 patients with high-grade N.G.C., and N.A.J. analyzed data; and M. Kodama, T. Kodama, S.M.H., and N.A.J. wrote the paper. serous ovarian cancer, the most common type of cancer found in Reviewers: R.R., Technische Universität München; and K.Y., Wellcome Trust EOC patients. Sequencing revealed that almost all tumors (96%) Sanger Institute. had mutations in TP53, which serves as a major driver of this cancer The authors declare no conflict of interest. (6). Low-prevalence but statistically significant mutations in nine 1M. Kodama and T. Kodama contributed equally to this work. other genes including NF1, BRCA1, BRCA2, RB1, and CDK12 2To whom correspondence may be addressed. Email: [email protected] or were also identified, but the majority of genes were mutated at [email protected]. low frequency, making it difficult to distinguish between driver and This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. passenger mutations. 1073/pnas.1705441114/-/DCSupplemental.

www.pnas.org/cgi/doi/10.1073/pnas.1705441114 PNAS Early Edition | 1of10 Downloaded by guest on September 24, 2021 antiparasitic drug, ivermectin, has antitumor effects on EOC through criteria). To confirm the validity of these results, we repeated the its inhibition of KPNB1, and describe a combinational therapy for screen and confirmed that most of the shRNAs targeting the top treating EOC. 10 genes were consistently depleted in tumors (Fig. 1C), excluding the possibility that this depletion was due to random chance. Results We conducted another screen using a genome-scale CRISPR/ An in Vivo Loss-of-Function Screen Identifies Potent Drug Targets for Cas9 knockout library (GeCKOv2) (12). Interestingly, most of the EOC. To identify new drug targets for EOC, we conducted an in single-guide RNAs (sgRNAs) targeting the top 10 genes identified in vivo dropout screen using a pooled shRNA library targeting our initial shRNA library screen were also depleted in the CRISPR 7,490 druggable genes (Fig. 1A). We performed this screen using screen (Fig. S1 and Dataset S1), further confirming that these genes an established EOC PC model (11), since PC is the biggest con- are essential for PC tumors to survive. Among the top 10 genes, tributing factor to the lethality of EOC. In this screen, the human ERBB2 and RAF1 are well-known oncogenes in many solid tumors serous ovarian cancer cell line, SKOV3, was lentivirally transduced (13, 14) and several HER2 inhibitors have already been used in the with the shRNA library and then i.p. injected into female nude clinic for multiple cancer types (15), confirming that our screen is mice. Genomic DNA from the PC tumors was PCR-amplified and capable of identifying promising drug targets. sequenced to identify shRNAs depleted in tumors compared with To verify the potential of these genes as drug targets, we assessed transduced cells (Fig. 1A and Dataset S1). By focusing on depleted the effect of their depletion on cell proliferation/survival, which is shRNAs, we hoped to identify drug targets whose inhibition would highlyrelatedtotumorgrowth(16).Inagreementwiththeresults efficiently suppress PC formation. Thousands of shRNAs were of our in vivo screen, individual knockdown of all but one gene depleted in tumors through in vivo selective pressure (Fig. 1B). The decreased cell proliferation/survival (Fig. S2). Taken together, these top 10 genes, which had multiple shRNAs showing substantial de- results suggest that our screen provides a good resource to identify pletion in PC tumors, are shown in Fig. 1C (see Methods for detailed potential drug targets for EOC.

Fig. 1. An in vivo loss-of-function screen identifies potent drug targets for EOC. (A) Diagram of the in vivo pooled library screen. A large-scale pooled shRNA library targeting 7,490 druggable genes with 42,450 shRNAs was transduced into SKOV3 cells at an MOI of 0.2. Five million transduced cells then were injected into 12 female nude mice i.p., and peritoneal tumors were harvested 7 wk after injection. Genomic DNA extracted from referential transduced cells, and the 12 biggest tumors, were amplified and sequenced. (B) The average numbers of detected shRNAs from the first and second screen are shown. (C) The top 10 genes, which had multiple shRNAs showing substantial depletion in PC tumors, are ranked according to the average FC of shRNAs read counts in tumors relative to cells.

2of10 | www.pnas.org/cgi/doi/10.1073/pnas.1705441114 Kodama et al. Downloaded by guest on September 24, 2021 PNAS PLUS GENETICS

Fig. 2. KPNB1 is a drug target candidate for EOC. (A) SKOV3 cells were lentivirally transduced with NC shRNAs or KPNB1 shRNAs, and the transduced cells were i.p. injected into female nude mice. Total tumor weights (Left) and tumor numbers (Right) in the peritoneum of each mouse were then measured 6 wk after injection (n = 5each,*P < 0.05 vs. all). (B and C)SKOV3(Left), CAOV3 (Middle), and OVCAR3 (Right) cells were transfected with NC siRNA or KPNB1 siRNA. (B)Cell proliferation/survival was then assessed by colorimetric measurement via WST-1 3 d after transfection (n = 4each,*P < 0.05 vs. all). (C) Cell numbers were counted 3 d after transfection with NC siRNA or KPNB1 siRNA (n = 3each,*P < 0.05 vs. all). (D) Five hundred SKOV3 cells were transduced with NC shRNA or three KPNB1 shRNAs and seeded into a six-well plate. Cells were stained with crystal violet 14 d after transfection. (E)SKOV3(Left), CAOV3 (Middle), and OVCAR3 (Right) cells were treated with different doses of importazole (IMZ) for 3 d. Cell proliferation/survival was assessed by WST-1 (n = 4each,*P < 0.05 vs. all).

KPNB1 Is a Drug Target Candidate for EOC. Since Food and Drug B–D) significantly decreased cell proliferation/survival in all three Administration (FDA)-approved drugs are already in clinical use lines (Fig. 2 B–D). We then examined the antitumor effect of for our top-ranked gene ERBB2, we decided to test the potential pharmacological inhibition of KPNB1 using importazole, a small of our second-ranked gene, KPNB1 (karyopherin beta-1 or, alter- molecule that specifically inhibits the importin β family (17). Con- natively, importin beta-1), as a new drug target for EOC. First, to sistent with our siRNA results, blockade of KPNB1 by importazole validate our initial screening results, we individually transduced also significantly reduced cell proliferation/survival in a dose- KPNB1 shRNAs or negative control (NC) shRNA into SKOV3 dependent manner (Fig. 2E). Collectively, these results identify cells and then i.p. injected them into nude mice. KPNB1 knock- KPNB1 as a promising therapeutic target for EOC. down by any of the three shRNAs (Fig. S3A) significantly reduced tumor size and numbers in their peritoneal cavity (Fig. 2A). We also KPNB1 Inhibition Induces Apoptosis. To investigate the mechanism assessed the effect of KPNB1 knockdown on cell proliferation/ of the antitumor effect resulting from KPNB1 inhibition, we survival in three human EOC cell lines, SKOV3, CAOV3, and first focused on apoptotic cell death, which is one of the major OVCAR3. The siRNA-mediated knockdown of KPNB1 (Fig. S3 determinants of cell proliferation/survival. KPNB1 inhibition via any

Kodama et al. PNAS Early Edition | 3of10 Downloaded by guest on September 24, 2021 Fig. 3. KPNB1 inhibition induces apoptosis. (A) SKOV3 cells were transfected with NC siRNA or KPNB1 siRNA. Apoptosis was then assessed by caspase-3/7 activity in cell supernatants 3 d after transfection (n = 3 each, *P < 0.05 vs. all). (B and C) SKOV3 cells were transfected with NC siRNA or KPNB1 siRNA. Three days after transfection, cells were stained for annexin V and propidium iodide (PI), and the proportion of apoptotic cells was then measured by flow cytometry. (B) Representative dot plots of flow cytometry and (C) the percentage of apoptotic cells are shown. (D) SKOV3 cells were treated with different doses of IMZ for 3 d. Apoptosis was assessed by caspase-3/7 activity of cell supernatants (n = 3 each, *P < 0.05 vs. all). (E and F) SKOV3 cells were treated with vehicle or 16 μM IMZ for 3 d. Cells were then stained with annexin V and PI, and the population of apoptotic cells was measured by flow cytometry. (E) Representative dot plots of flow cytometry and (F) percentage of apoptotic cells are shown. (G) SKOV3 cells were transfected with NC siRNA or KPNB1 siRNA. Three days after transfection, expression levels of apoptosis-related proteins were assessed by Western blots. (H) SKOV3 cells were lentivirally transduced with NC shRNAs or KPNB1 shRNAs, and the transduced cells were i.p. injected into female nude mice. Six weeks after injection, i.p. tumors were collected, and apoptosis was assessed by the number of tumor cells with immunopositivity for cleaved PARP (n = 5 each, *P < 0.05 vs. NC shRNA).

of three KPNB1 siRNAs or importazole treatment induced apo- the G2/M transition. We also confirmed that pharmacological ptosis in human EOC cell lines (Fig. 3 A–F and Fig. S4), and was inhibition of KPNB1 by importazole produced a similar effect accompanied by an increase in the expression levels of the proa- (Fig. 4 C and D). We then checked the expression levels of a poptotic proteins BAX and cleaved caspase-3 (Fig. 3G). Further- number of cell cycle regulators and found that KPNB1 inhibition more, immunohistochemical staining showed an increase in the increased p21 and p27 protein levels (Fig. 4E and Fig. S5). We number of cleaved PARP-positive tumor cells in tissue sections (18) also assessed the cell cycle in xenografted tumors derived from from xenografted tumors containing KPNB1 shRNAs (Fig. 3H), SKOV3 cells transduced with KPNB1 shRNAs. Immunohisto- further confirming that KPNB1 inhibition induces apoptosis both in chemical staining showed that the number of Ki67 positive cells vitro and in vivo, and providing a mechanism for its antitumor effect was significantly lower in tumors transduced with KPNB1 shRNA in EOC. (Fig. 4F), suggesting that KPNB1 inhibition also delayed cell cycle progression in vivo. Taken together, these results suggest that KPNB1 Inhibition Induces Multiphase Cell Cycle Arrest. We next ex- KPNB1 inhibition exerts its antitumor effect, in part, by inducing amined the effect of KPNB1 inhibition on the cell cycle, another apoptosis and cell cycle arrest in human EOC. strong determinant of cell proliferation/survival. Knockdown of KPNB1 elevated the population of cells at the G2/M phase as KPNB1 Functions as an Oncogene in EOC. These results prompted us measured by flow cytometric analysis (Fig. 4 A and B). To assess to examine whether KPNB1 acts as an oncogene in EOC. Stable each stage of the cell cycle individually, we treated cells with overexpression of KPNB1 in SKOV3 and OVCAR3 (Fig. S6) nocodazole, an inhibitor of microtubule polymerization (19), to significantly accelerated cell proliferation/survival (Fig. 5 A–C), induce mitotic arrest. Twenty-four hours later, while the majority confirming that KPNB1 functions as an oncogene in EOC. In of the cells treated with NC siRNA were accumulated at the G2/ contrast to the apoptosis induced by KPNB1 inhibition (Fig. 3), M phase, a large fraction of cells treated with KPNB1 siRNAs KPNB1 overexpression significantly decreased caspase-3/7 activity still remained at the G1/S phase (Fig. 4 A and B), suggesting that (Fig. 5D), in addition to the expression levels of cleaved caspase- KPNB1 inhibition delays the G1/S transition. In addition, 24 h 3andBAXproteins(Fig.5E). KPNB1 overexpression also de- after the withdrawal of nocodazole, the G2/M population in creased p21 and p27 protein levels (Fig. 5E), as opposed to their KPNB1 knockdown cells further increased, in sharp contrast to increase by KPNB1 inhibition (Fig. 4E). Collectively, these results the rapid decrease of the G2/M population in control cells (Fig. 4 indicate that KPNB1 functions as an antiapoptotic and proproli- A and B), further suggesting that KPNB1 inhibition also delays ferative oncogene in EOC.

4of10 | www.pnas.org/cgi/doi/10.1073/pnas.1705441114 Kodama et al. Downloaded by guest on September 24, 2021 PNAS PLUS GENETICS

Fig. 4. KPNB1 inhibition induces multiphase cell cycle arrest. (A and B) SKOV3 cells were transfected with NC siRNA or KPNB1 siRNA. (A) Two days later, cell cycles were assessed by flow cytometry (Left); then, to induce G2/M arrest, cells were treated with 500 ng/mL of nocodazole (NOC) for 24 h, and cell cycles were again assessed by flow cytometry (Middle); cells were then further incubated for 24 h after withdrawal of NOC and analyzed by flow cytometry (Right). (B) Cell populations at each stage of cell cycle are shown. (C and D) SKOV3 cells were treated with vehicle or 16 μMIMZ.(C) Two days later, cell cycles were assessed by flow cytometry (Left); then, to induce G2/M arrest, cells were treated with 500 ng/mL of NOC for 24 h, and cell cycles were again assessed by flow cytometry (Middle); cells were further incubated for 24 h after withdrawal of NOC and analyzed by flow cytometry (Right). (D) Cell populations at each stage of the cell cycle are shown. (E) SKOV3 cells were transfected with NC siRNA or KPNB1 siRNA. Three days after transfection, the expression levels of cell cycle- related proteins were assessed by Western blots. (F) SKOV3 cell were lentivirally transduced with NC shRNAs or KPNB1 shRNAs, and the transduced cells were i.p. injected into female nude mice. Six weeks after injection, i.p. tumors were collected and stained with Ki-67 (×40, scale bar, 100 μm) (Left). The proportions of Ki-67 positive cells are shown (n = 5 each, *P < 0.05 vs. NC shRNA) (Right).

To assess the clinical relevance of its oncogenic function, we beling with amino acids in cell culture (SILAC) and mass spec- analyzed the relationship between KPNB1 expression and EOC trometric (MS) analysis to identify proteins shuttled by KPNB1 into patient prognosis using a publicly available microarray dataset the nucleus in a high-throughput manner. SKOV3 and OVCAR3 (GSE 9891) (20). Patients with higher expression levels of KPNB1 cells were transfected with NC siRNA or KPNB1 siRNA, labeled showed earlier recurrence and worse prognosis than those with with light or heavy amino acids, respectively, and analyzed by lower expression levels of KPNB1 (Fig. S7 A and B), further quantitative MS (Fig. 6A). Comprehensive analysis revealed confirming that KPNB1 acts as an oncogene in human EOC and that protein levels of multiple anaphase-promoting complex/cyclo- represents a promising therapeutic target. some (APC/C) family members decreased in the nucleus of cells treated with KPNB1 siRNA (Fig. 6B). APC/C is a positive regulator KPNB1 Positively Regulates Members of the Anaphase-Promoting of mitosis and functions as an E3 ubiquitin ligase to mark cell cycle- Complex/Cyclosome. KPNB1 functions as a nucleocytoplasmic trans- related proteins for proteasomal degradation (22). Loss of APC/C porter to import proteins containing nuclear localization signals into results in cell cycle arrest at metaphase and severe aberrations of the nucleus (21). We thus decided to perform stable isotope la- the mitotic spindle (23). To further investigate the relationship

Kodama et al. PNAS Early Edition | 5of10 Downloaded by guest on September 24, 2021 Fig. 5. KPNB1 functions as an oncogene in EOC. (A and B)SKOV3(Left) and OVCAR3 (Right) cells were lentivirally transduced with a KPNB1 expression vector or control vector. (A) Cell proliferation was then assessed by WST-1 (n = 4each,*P < 0.05 vs. all). (B) Cell numbers were counted 3 d after seeding equal numbers of cells in six-well plates and are shown as ratio relative to control cells (n = 3each,*P < 0.05 vs. all). (C) Five hundred SKOV3 cells were seeded into a six-well plate after lentiviral transduction of a KPNB1 expression vector or control vector. Cells were stained with crystal violet 14 d after transfection. (D)SKOV3(Left)and OVCAR3 (Right) cell lines were lentivirally transduced with a KPNB1 expression vector or control vector. Apoptosis was assessed by caspase-3/7 activity in cell supernatants (n = 3each,*P < 0.05 vs. all). (E) SKOV3 cells were lentivirally transduced with a KPNB1 expression vector or control vector. Expression levels of apoptosis- and cell cycle-related proteins were assessed by Western blots.

between KPNB1 and APC/C protein levels, we analyzed liquid Ivermectin Synergistically Suppresses EOC Tumor Growth in Combination chromatography (LC)-MS data for various other human cancer cell with Paclitaxel. Paclitaxel is a drug currently in use for EOC. It is lines (24). We observed a positive correlation in protein levels be- used as a first-line chemotherapy in combination with platinum, or tweenKPNB1andmultipleAPC/Cfamily members in several dif- as a second-line therapy for platinum/paclitaxel-refractory cancers ferent cancer types (Fig. 6C), suggesting that regulation of APC/C (26). We thus explored the potential of ivermectin combined with proteins by KPNB1 may not be unique to EOC. In addition, we found paclitaxel for the treatment of EOC. Interestingly, we found that that KPNB1 inhibition significantly decreased cell proliferation/ ivermectin synergistically reduced cell proliferation/viability in H viability in many other human cancer cell lines including breast, combination with paclitaxel in human EOC cells (Fig. 7 ), via the pancreas, and liver (Fig. 6D), suggesting that KPNB1 could also induction of apoptosis and cell cycle arrest at the G2/M phase (Fig. I J be a potential therapeutic target for these cancers in addition 7 and and Fig. S9). Lastly, we tested this combination therapy in to EOC. vivo. Single treatment of ivermectin or paclitaxel reduced tumor growth in nude mice, but, notably, combination treatment of iver- Ivermectin Exerts a Strong Antitumor Effect On EOC in a KPNB1- mectin and paclitaxel almost completely suppressed tumor growth K Dependent Manner. Next, we searched clinically available drugs (Fig. 7 ). These results identify ivermectin and paclitaxel as a that can potentially target KPNB1 and found a recent report that promising combinatorial therapy for human EOC. ivermectin, an FDA-approved antiparasitic drug, inhibits importin Discussion α/β-mediated nuclear import (25). In our initial studies, we found We identified, in this study, several candidate drug targets for EOC that ivermectin treatment suppressed cell proliferation/viability in a using a combination of shRNA and CRISPR/Cas9 library screen- dose-dependent manner (Fig. 7A), indicating that it exerts an anti- ing. Among these drug targets, we showed that inhibition of one, tumor effect on EOC. Similar to KPNB1 inhibition or importazole B C KPNB1, by ivermectin has promising antitumor effects and syn- treatment, ivermectin also induced apoptosis (Fig. 7 and ). We ergizes with paclitaxel in the treatment in EOC. While RNAi/ also found that ivermectin increased the expression levels of BAX, shRNA/CRISPR/Cas9 library screening was originally developed D and cleaved PARP, as well as p21 and p27 (Fig. 7 ). Cell cycle for use in vitro, more recently, these technologies have been used analysis with nocodazole also showed a cell cycle arrest upon iver- in vivo to mimic a more clinically relevant physiological environ- mectin treatment, similar to what we observed with KPNB1 in- ment (27). Several in vivo loss of function screens using RNAi or E F hibition (Fig. 7 and ). These findings suggest that ivermectin exerts CRISPR-Cas9 have been reported that identified shRNAs or its antitumor effect through the same mechanisms as KPNB1 inhi- sgRNAs, which were enriched in tumors, but the targets of these bition. To provide additional validation, we treated SKOV3 and screens are mostly undruggable tumor suppressor genes (27, 28). In OVCAR3 cells with ivermectin in the absence of KPNB1. In sharp contrast, our screen focused on shRNAs or sgRNAs (CRISPR/ contrast to the strong antitumor effect we observed for ivermectin in Cas9) that are depleted in tumors and thus potentially represent NC siRNA-treated cells, we observed a severely diminished effect for druggable oncogenes. We also performed multiple screens using ivermectin in KPNB1 siRNA-treated cells (Fig. 7G and Fig. S8), in- the same experimental conditions, to help eliminate background dicating that KPNB1 inhibition is responsible for the antitumor effect noise. Interestingly, we observed depletion of many more genes in of ivermectin. tumors using CRISPR/Cas9 compared with shRNA. We first excluded

6of10 | www.pnas.org/cgi/doi/10.1073/pnas.1705441114 Kodama et al. Downloaded by guest on September 24, 2021 PNAS PLUS GENETICS

Fig. 6. KPNB1 positively regulates multiple APC/C family members. (A) Diagram of LC-MS analysis after SILAC. (B) Expression levels of KPNB1 and APC/C-related proteins in the nucleus of SKOV3 and OVCAR3 cells following transfection with KPNB1 siRNA or NC siRNA as assessed by LC-MS. Relative expression ratios in cells treated with KPNB1 siRNAs compared with those treated with NC siRNA are shown. (C) Expression levels of KPNB1 and APC/C-related proteins in 136 human cancer cell lines as assessed by LC-MS and plotted to analyze the correlation between expression levels of KPNB1 and APC/C-related proteins. Pearson’s correlation coefficients for APC8, APC5, APC2, and APC4 and Spearman’s correlation coefficients for APC7 and APC1 are shown. (D) MDA-MB-231 (breast adenocarcinoma), MCF-7 (breast adenocarcinoma), MIA PaCa-2 (pancreas ductal adenocarcinoma), and Huh-7 cells (well-differentiated hepatocellular carcinoma) were transfected with NC siRNA or KPNB1 siRNA. Cell proliferation/survival was then assessed by WST-1 3 d after transfection (n = 4each,*P < 0.05 vs. all).

the possibility that cancer cells containing the CRISPR library were (33), non-small-cell lung (34), and gastric cancer (35), and is a poor engrafted unsuccessfully, because the tumor size and growth were prognostic factor in certain cancer types (36, 37). Several HER2 similar in both screens. We also confirmed that essential genes, inhibitors, either tyrosine kinase inhibitors or monoclonal anti- identified by previously reported CRISPR screens (29, 30), were sig- bodies, are already in clinical use and are invaluable drugs in the nificantly more depleted than nonessential genes in peritoneal tumors treatment of breast cancer. Regarding their clinical implications for in our CRISPR screen [depletion rate; essential genes vs. nonessential EOC, several clinical trials using HER2 inhibitors have already genes defined by Blomen et al. (29) and Wang et al. (30), 72.4% vs. been conducted with unsatisfying results (38, 39), However, the − − 60.4%, P < 8.67 × 10 18,and70.7%vs.60.4%,P < 5.24 × 10 23, latest phase III clinical trials (pertuzumab in platinum-resistant low respectively], suggesting that genes were not depleted randomly but by human epidermal growth factor receptor 3 messenger ribonucleic in vivo selective pressure. The shRNA generally induces partial gene acid epithelial ovarian cancer; PENELOPE) for EOC have shown knockdown, and the residual activity of the wild-type protein may thus favorable results for pertuzumabcombinedwithgemcitabineand prevent a knockdown phenotype from being observed. This is in paclitaxel for platinum-resistant EOC with low HER3 mRNA levels contrast to CRISPR/Cas9, where complete gene knockouts are usually (40). In accordance with these results, SKOV3 has the highest ex- produced. This functional difference between RNAi and CRISPR/Cas pression levels of HER2, and the fifth-lowest expression levels of may be, at least in part, responsible for the different screening output. HER3, among 52 EOC cell lines registered in the cancer cell line By analyzing both types’ loss-of-function screens, we hoped to provide encyclopedia (41), which might have resulted in the identification of a more highly reliable list of drug targets for EOC. ERBB2 as the most potent drug target in our screen. Our top-ranked gene, ERBB2, is amplified and overexpressed in KPNB1 was the second-highest-ranked gene identified in our many cancers, including breast (31), ovary (31), colon (32), bladder screen. Increased KPNB1 protein levels have been reported in

Kodama et al. PNAS Early Edition | 7of10 Downloaded by guest on September 24, 2021 Fig. 7. Ivermectin (IV) exerts KPNB1-dependent antitumor effects on EOC. (A and B) SKOV3 (Left), CAOV3 (Middle), and OVCAR3 (Right) cells were treated with different doses of IV for 3 d. (A) Cell proliferation/survival was then assessed by WST-1 proliferation (n = 4each,*P < 0.05 vs. all). (B) Apoptosis was assessed by caspase-3/7 activity in cell supernatants (n = 4 each, *P < 0.05 vs. all). (C and D) SKOV3 cells were treated with vehicle or 16 μMIVfor3d.(C) Cells were then stained with annexin V and PI, and the population of apoptotic cells was assessed by flow cytometry. (D) Expression levels of cell cycle- and apoptosis-related proteins were assessed by Western blots. (E and F) SKOV3 cells were treated with 8 μMIV.(E) Two days later, cell cycles were assessed by flow cytometry (Left); then, to induce G2/M arrest, cells were treated with 500 ng/mL of NOC for 24 h, and the cell cycles were assayed by flow cytometry (Middle); cells were further incubated for 24 h after withdrawal of NOC and analyzed by flow cytometry (Right). (F) Cell populations at each stage of the cell cycle are shown. (G) SKOV3 cells were transfected with NC siRNA or KPNB1 siRNA. Two days later, they were treated with vehicle or 12 μM IV for 2 d. Cell proliferation/survival was then assessed by WST-1 proliferation (n = 4 each, *P < 0.05). (H–J) SKOV3 cells were treated with vehicle, 2 μMIV,5nMPTX,or2μM IV + 5 nM PTX for 2 d. (H) Cell proliferation/survival was then assessed by WST-1 proliferation (n = 4 each, *P < 0.05 vs. all) and (I) apoptosis was assessed by caspase-3/7 activity in cell supernatants (n = 3 each, *P < 0.05 vs. all). (J) Cells were stained with annexin V and propidium iodide, and the number of apoptotic cells was assessed by flow cytometry. (K) SKOV3 cells were s.c. injected into immunodeficient NSG mice. One week later, mice were randomly assigned into four groups (control, IV, PTX, and IV+PTX). Mice were then treated with i.p. injection of PBS, or 1 mg/kg of IV and/or 15 mg/kg of PTX 5 d a week for 40 d. Xenograft tumor volumes were then measured at different times after the initiation of treatment (n = 4 each, *P < 0.05 vs. all).

8of10 | www.pnas.org/cgi/doi/10.1073/pnas.1705441114 Kodama et al. Downloaded by guest on September 24, 2021 several cancers, including cervical cancer (42), hepatocellular Chemicals and Reagents for Biological Assays. Ivermectin (Selleckchem), impor- PNAS PLUS carcinoma (43), and glioma (44), suggesting KPNB1’s oncogenic tazole (Selleckchem), paclitaxel (Sigma Aldrich), and nocodazole (Sigma potential in these tumor types. In this study, we validated an on- Aldrich) were dissolved in DMSO to prepare stock solutions, and were diluted in cogenic function of KPNB1 in EOC through apoptosis inhibition cell growth medium for assays. and cell cycle progression. MS analysis also revealed the positive In Vivo Pooled shRNA Library Screen. Decode pooled shRNA druggable library regulation of several APC/C family members by KPNB1, suggesting (#RHS6082) was purchased from GE Dharmacon. Female athymic nude mice that KPNB1 might shuttle these nuclear proteins related to cancer [Crl:Nu(NCr)-Foxn1nu] were purchased from Charles River Laboratories. progression. To determine whether these proteins directly interact, SKOV3 cells were lentivirally transduced with the shRNA library containing we further performed MS of proteins immunoprecipitated (IP-MS) 42,450 shRNAs targeting 7,490 genes at a multiplicity of infection (MOI) of 0.2, with a KPNB1 antibody. Although IP-MS could identify known and transduced cells were selected by 1.5 mg/mL puromycin treatment for 7 d. partner molecules of KPNB1, such as RAN and RAN-GTP, none of Pellets of transduced cells were stored at −80 °C as a reference for sequencing. the APC/C members were identified in this assay (Dataset S1). This Five million transduced cells were i.p. injected into female nude mice. Mice may be because interaction between APC/C and KPNB1 is not were monitored for tumor formation using the general animal health guide- static, or KPNB1 might indirectly affect APC/C protein levels in the lines, and tumors bigger than 10 mm in diameter were collected 7 wk after injection and snap-frozen. The Institutional Animal Care and Use Committee of nucleus. Nonetheless, positive regulation of APC/C by KPNB1 could Houston Methodist Research Institute approved all mouse procedures. still be important for cell cycle control, since APC/C is known to regulate the cell cycle from late G2/M to G1. Specifically, APC/ Genomic DNA Sequence. Genomic DNA was extracted from cells and xenograft cdc20 C is required for anaphase onset and mitotic exit, while APC/ tumors transduced with the pooled shRNA or CRISPR/Cas library, using the DNeasy cdh1 C is essential for mitotic exit to G1 (45). Taken together, our Blood and Tissue kit (Qiagen), according to the manufacturer’s instructions. For findings suggest that KPNB1 might serve as a master regulator of shRNA library, shRNA sequences of extracted gDNA were then amplified using cell cycle by regulating several cell cycle-related proteins, including Illumina-adapted Decode Forward and Reverse indexed PCR primers, according p21, p27, and APC/C family members. to the protocol supplied with the Decode Pooled Lentiviral shRNA screening li- Ivermectin has a long history of safe treatments for several par- braries. To keep the fold representation at 100 for each of the shRNAs, 27.8 μgof asitic infections in humans and mammals (46). Recently, Wagstaff gDNA per each sample was used for the PCR. Indexed PCR products were pu- rified using a PCR purification kit (Qiagen). Purified PCR amplicons were multi- et al. (25) has also identified ivermectin as a specific inhibitor of α β plexed and sequenced using Decode sequencing primers on an Illumina Hiseq. importin / -mediated nuclear import via high-throughput screen- For CIRSPR/Cas library, sgRNA sequences were first amplified with forward

ing. Indeed, in this study, we discovered a KPNB1-dependent anti- primer AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG and reverse GENETICS tumor effect of ivermectin on multiple EOC cell lines. We found primer TCTACTATTCTTTCCCCTGCACTGTTGTGGGCGATGTGCGCTCTG. Then, they that ivermectin induces apoptosis and multiphase cell cycle arrest in were secondarily amplified with forward primer AATGATACGGCGACCACCGA- EOC cells, accompanied by alterations in several molecules, all of GATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT(1-8 bp stagger)(8 bp which are consistent with the alterations we observed upon barcode)TCTTGTGGAAAGGACGAAACACCG and reverse primer CAAGCAGAAG- KPNB1 inhibition. The regimen used for the mice in our study was ACGGCATACGAGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATT- not the same as the one used for parasite treatment in humans. CTTTCCCCTGCACTGT. To keep the fold representation at 100 for each of the sgRNAs, 45 μg of gDNA per sample was used for the PCR. Purified PCR amplicons However, Guzzo et al. (47) reported that higher and/or more- were multiplexed and sequenced using Illumina sequencing primers on an Illumina frequent doses of ivermectin than currently approved for humans Hiseq. We obtained reads per tumor. The read counts for each unique shRNA/ are well tolerated in humans. In addition, none of the mice in this gRNA for a given sample were normalized as previously described (12). Then, these study treated with the effective dosage of ivermectin for in vivo normalized read counts were converted into the fold change (FC) relative to those anticancer therapy showed severe adverse event. Therefore, although of referential cells. For dropout hit identification, we first selected genes targeted we need to optimize the regimen in the clinical settings, considering by more than or equal to four shRNAs showing an FC of less than 0.1. Genes were its strong antitumor effect and accumulated safety profile as an then ranked based on average FC of all designed shRNAs targeting each gene. The antiparasitic drug, our results identify ivermectin as an attractive top 10 genes, which showed average FC of less than 0.2, are listed in Fig. 1C. alternative therapeutic toward EOC patients through drug reposi- tioning. In addition, we found that the combination of ivermectin Flow Cytometry. SKOV3 cells were transfected with NC siRNA or KPNB1 siRNA, or treated with anticancer drugs or vehicle. Cell cycle analysis was then performed 2 d and paclitaxel produces a stronger antitumor effect on EOC cell later. Cells were first labeled with propidium iodinide (Sigma Aldrich), and their lines than either drug alone. Recently, molecular therapies target- cell cycle was analyzed using a BD LSRFortessa cell analyzer (BD Biosciences). In ing cell cycle, including CDK4/6 inhibitors, have been approved by some experiments, the cells were first synchronized by the addition of nocodazole the FDA (48). In addition, cell cycle targeted therapy has been for 24 h, and the cell cycle was then analyzed. Synchronized cells were also an- studied in a number of clinical trials, in combination with chemo- alyzed 24 h after the withdrawal of nocodazole. For apoptosis analysis, 2 d later, therapeutic agents, to pursue synergistic antitumor effects. Indeed, the cells were trypsinized and washed with PBS. Cell pellets were then diluted with the latest phase III clinical trials have shown efficacy for combi- annexin V binding buffer 10× concentrate (BD Biosciences) and incubated with nation therapy of CDK4/6 inhibitors and hormone therapy for BD phospholipid-binding protein APC Annexin V (BD Biosciences) and propidium breast cancer (49), via overcoming the resistance to prior hormonal iodinide (Sigma Aldrich). The cells were then analyzed using a BD LSRFortessa cell analyzer. Data were analyzed using BD FACSDiva 8.0.1. therapy. Although the precise molecular mechanism of the syner- gistic antitumor effect of ivermectin and paclitaxel needs further In Vivo Xenografts. Female NOD scid gamma (NSG) mice (NOD.Cg-PrkdcscidIl2rgtm1wjl/SzJ) investigation, both drugs have been in clinical use for several de- were purchased from The Jackson Laboratory. Five million SKOV3 cells were cades, which should facilitate clinical trials assessing the combina- injected s.c. into both flanks of 16 NSG mice. One week later, mice were torial effects of these two drugs in EOC patients. randomly assigned into four groups [control, ivermectin (IV), paclitaxel (PTX), and IV+PTX]. Mice were then treated with i.p. injection of PBS, or 1 mg/kg of Methods IV and/or 15 mg/kg of PTX, 5 d a week for 40 d. Xenograft tumor volumes Cell Culture. SKOV3, OVCAR3, and CAOV3 human liver cancer cell lines, MIA were then measured at different times after the initiation of treatment. Tumor 2 PaCa-2 human pancreatic cancer cell line, MDA-MB231 and MCF-7 human volumes were calculated via the formula of 1/2 (length × width ). breast cancer cell lines, and HEK-293 cell line were purchased from the American Type Culture Collection. The Huh-7 human liver cancer cell line was Proteomic Analysis. SKOV3 and OVCAR3 cells were labeled with heavy iso- 13 purchased from the Japanese Collection of Research Bioresources Cell Bank. tope, C6 L-Lysine-2HCl, or light isotope, L-Lysine-2HCl, via Pierce SILAC Protein These cell lines were cultured in DMEM or RPMI-1640 medium supplemented quantitation kit-RPMI 1640 containing 10% dialyzed FBS (ThermoFisher Scien- with 10% FBS and penicillin−streptomycin, except for OVCAR3, which was tific). Cells were passaged and expanded for at least 10 doublings, before supplemented with 0.01 mg/mL of bovine insulin, 20% FBS, and penicillin transfection of KPNB1 siRNA or NC siRNA. For whole-cell extracts, cells were

−streptomycin. All cell lines were maintained in a humid incubator (5% CO2, lysed in 1 mL of PBS containing detergent, protease inhibitor (Roche Diagnostics), 37 °C) that was confirmed to be free from pathogens and mycoplasma. and phosphatase inhibitor, 72 h after siRNA transfection, followed by sonication

Kodama et al. PNAS Early Edition | 9of10 Downloaded by guest on September 24, 2021 and centrifugation. For nuclear cell extracts, cells were lysedincelllysisbuffer Statistical Analysis. All data were analyzed with Graphpad Prism 6 (GraphPad with protease inhibitor and homogenized, followed by centrifugation. Nuclei Software) and provided as mean ± SEM unless otherwise indicated. Statistical resuspension buffer was then added to the pellets, followed by centrifugation. analyses were performed using an unpaired Student’s t test, Mann−Whitney U For the IP-MS experiment, nuclear cell extracts of SKOV3 were obtained as test, or a one-way ANOVA. For multiple comparisons, P value was adjusted by described above and immunoprecipitated by IgG or KPNB1 antibody (Abcam). Bonferroni correction of the differences or the differences in the mean values MS analysis were performed as previously described (24). among the groups were examined by Dunnett’s multiple comparison test. P < 0.05 was considered statistically significant. For all other information on materials Bioinformatic Analysis. To investigate an association between expression of and methods, please see Supporting Information. KPNB1 gene and prognosis in EOC patients, we downloaded GSE9891 dataset from Gene Expression Omnibus (https://www.ncbi.nlm.nih.gov/geo/)(20).We ACKNOWLEDGMENTS. We thank E. Freiter and H. Lee for monitoring the obtained Affymetrix Human Genome U133 Plus 2.0 array data from 285 ovarian mice and animal technical assistance, David L. Haviland for technical assistance tumor samples, and their patient survival data. We used the data from 194 ad- and discussion about flow cytometry experiments, and Ayako Okamura for the vanced stage high-grade serious ovarian cancer patients without chemotherapeutic experiments for revision. The Cancer Prevention Research Institute of Texas treatment before the sample collection. We performed Kaplan−Meier survival (CPRIT) supported this research [Grants R1112 (N.G.C.) and R1113 (N.A.J.)]. analysis in R 2.15.3 (R Development Core Team 2013) using package “survival.” N.G.C. and N.A.J. are both CPRIT Scholars in Cancer Research.

1. Group US Cancer Statistics Working Group (2016) United States cancer statistics: 1999– 26. Markman M, et al.; Gynecologic Oncology Group (2006) Phase II trial of weekly 2013 incidence and mortality web-based report. Available at www.cdc.gov/uscs. Ac- paclitaxel (80 mg/m2) in platinum and paclitaxel-resistant ovarian and primary peri- cessed October 31, 2016. toneal cancers: A Gynecologic Oncology Group study. Gynecol Oncol 101:436–440. 2. Rauh-Hain JA, Krivak TC, Del Carmen MG, Olawaiye AB (2011) Ovarian cancer 27. Zender L, et al. (2008) An oncogenomics-based in vivo RNAi screen identifies tumor screening and early detection in the general population. Rev Obstet Gynecol 4:15–21. suppressors in liver cancer. Cell 135:852–864. 3. Bast RC, Jr, Hennessy B, Mills GB (2009) The biology of ovarian cancer: New oppor- 28. Chen S, et al. (2015) Genome-wide CRISPR screen in a mouse model of tumor growth tunities for translation. Nat Rev Cancer 9:415–428. and metastasis. Cell 160:1246–1260. 4. Blagden SP (2015) Harnessing pandemonium: The clinical implications of tumor het- 29. Blomen VA, et al. (2015) Gene essentiality and synthetic lethality in haploid human erogeneity in ovarian cancer. Front Oncol 5:149. cells. Science 350:1092–1096. 5. Howlader N, et al. (2016) SEER Cancer Statistics Review, 1975–2013 (Natl Cancer Inst, 30. Wang T, et al. (2015) Identification and characterization of essential genes in the Bethesda). Available at https://seer.cancer.gov/csr/1975_2013/. Accessed October 31, human genome. Science 350:1096–1101. 2016. 31. Slamon DJ, et al. (1989) Studies of the HER-2/neu proto-oncogene in human breast 6. Cancer Genome Atlas Research Network (2011) Integrated genomic analyses of and ovarian cancer. Science 244:707–712. ovarian carcinoma. Nature 474:609–615. 32. Cancer Genome Atlas Network (2012) Comprehensive molecular characterization of – 7. Kodama T, et al. (2016) Transposon mutagenesis identifies genes and cellular pro- human colon and rectal cancer. Nature 487:330 337. cesses driving epithelial-mesenchymal transition in hepatocellular carcinoma. Proc 33. Cancer Genome Atlas Research Network (2014) Comprehensive molecular charac- – Natl Acad Sci USA 113:E3384–E3393. terization of urothelial bladder carcinoma. Nature 507:315 322. 8. Takeda H, et al. (2015) Transposon mutagenesis identifies genes and evolutionary 34. Mazières J, et al. (2013) Lung cancer that harbors an HER2 mutation: Epidemiologic – forces driving gastrointestinal tract tumor progression. Nat Genet 47:142–150. characteristics and therapeutic perspectives. J Clin Oncol 31:1997 2003. 9. Sethi G, et al. (2012) An RNA interference lethality screen of the human druggable genome 35. Jaehne J, et al. (1992) Expression of Her2/neu oncogene product p185 in correlation to identify molecular vulnerabilities in epithelial ovarian cancer. PLoS One 7:e47086. to clinicopathological and prognostic factors of gastric carcinoma. J Cancer Res Clin – 10. Arora S, et al. (2010) RNAi screening of the kinome identifies modulators of cisplatin Oncol 118:474 479. 36. Gravalos C, Jimeno A (2008) HER2 in gastric cancer: A new prognostic factor and a response in ovarian cancer cells. Gynecol Oncol 118:220–227. novel therapeutic target. Ann Oncol 19:1523–1529. 11. Shaw TJ, Senterman MK, Dawson K, Crane CA, Vanderhyden BC (2004) Character- 37. Brabender J, et al. (2001) Epidermal growth factor receptor and HER2-neu mRNA expres- ization of intraperitoneal, orthotopic, and metastatic xenograft models of human sion in non-small cell lung cancer is correlated with survival. Clin Cancer Res 7:1850–1855. ovarian cancer. Mol Ther 10:1032–1042. 38. Gordon AN, et al. (2005) Efficacy and safety of erlotinib HCl, an epidermal growth factor 12. Shalem O, et al. (2014) Genome-scale CRISPR-Cas9 knockout screening in human cells. receptor (HER1/EGFR) tyrosine kinase inhibitor, in patients with advanced ovarian car- Science 343:84–87. cinoma: Results from a phase II multicenter study. Int J Gynecol Cancer 15:785–792. 13. Maurer G, Tarkowski B, Baccarini M (2011) Raf kinases in cancer-roles and therapeutic 39. Vergote IB, et al. (2014) Randomized phase III study of erlotinib versus observation in opportunities. Oncogene 30:3477–3488. patients with no evidence of disease progression after first-line platin-based che- 14. Hynes NE, Lane HA (2005) ERBB receptors and cancer: The complexity of targeted motherapy for ovarian carcinoma: A European Organisation for Research and inhibitors. Nat Rev Cancer 5:341–354. Treatment of Cancer-Gynaecological Cancer Group, and Gynecologic Cancer In- 15. Schroeder RL, Stevens CL, Sridhar J (2014) Small molecule tyrosine kinase inhibitors of tergroup study. J Clin Oncol 32:320–326. ErbB2/HER2/Neu in the treatment of aggressive breast cancer. Molecules 19:15196–15212. 40. Kurzeder C, et al. (2016) Double-blind, placebo-controlled, randomized phase III trial 16. Tubiana M (1989) Tumor cell proliferation kinetics and tumor growth rate. Acta Oncol evaluating pertuzumab combined with chemotherapy for low tumor human epi- 28:113–121. dermal growth factor receptor 3 mRNA-expressing platinum-resistant ovarian cancer 17. Soderholm JF, et al. (2011) Importazole, a small molecule inhibitor of the transport (PENELOPE). J Clin Oncol 34:2516–2525. β – receptor importin- . ACS Chem Biol 6:700 708. 41. Barretina J, et al. (2012) The cancer cell line encyclopedia enables predictive model- 18. Bressenot A, et al. (2009) Assessment of apoptosis by immunohistochemistry to active ling of anticancer drug sensitivity. Nature 483:603–607. caspase-3, active caspase-7, or cleaved PARP in monolayer cells and spheroid and 42. van der Watt PJ, et al. (2009) The Karyopherin proteins, Crm1 and Karyopherin beta1, – subcutaneous xenografts of human carcinoma. J Histochem Cytochem 57:289 300. are overexpressed in cervical cancer and are critical for cancer cell survival and pro- 19. Zieve GW, Turnbull D, Mullins JM, McIntosh JR (1980) Production of large numbers of liferation. Int J Cancer 124:1829–1840. mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole: 43. Yang L, et al. (2015) Suppression of the nuclear transporter-KPNβ1 expression inhibits – Nocodazole accumulated mitotic cells. Exp Cell Res 126:397 405. tumor proliferation in hepatocellular carcinoma. Med Oncol 32:128. 20. Tothill RW, et al.; Australian Ovarian Cancer Study Group (2008) Novel molecular 44. Lu T, et al. (2016) Karyopherinβ1 regulates proliferation of human glioma cells via subtypes of serous and endometrioid ovarian cancer linked to clinical outcome. Clin Wnt/β-catenin pathway. Biochem Biophys Res Commun 478:1189–1197. Cancer Res 14:5198–5208. 45. García-Higuera I, et al. (2008) Genomic stability and tumour suppression by the APC/C 21. Stewart M (2007) Molecular mechanism of the nuclear protein import cycle. Nat Rev cofactor Cdh1. Nat Cell Biol 10:802–811. Mol Cell Biol 8:195–208. 46. Omura S, Crump A (2004) The life and times of ivermectin - A success story. Nat Rev 22. Sivakumar S, Gorbsky GJ (2015) Spatiotemporal regulation of the anaphase-promoting Microbiol 2:984–989. complex in mitosis. Nat Rev Mol Cell Biol 16:82–94. 47. Guzzo CA, et al. (2002) Safety, tolerability, and pharmacokinetics of escalating high 23. Song L, Rape M (2010) Regulated degradation of spindle assembly factors by the doses of ivermectin in healthy adult subjects. J Clin Pharmacol 42:1122–1133. anaphase-promoting complex. Mol Cell 38:369–382. 48. Shapiro GI (2006) Cyclin-dependent kinase pathways as targets for cancer treatment. 24. Schliekelman MJ, et al. (2015) Molecular portraits of epithelial, mesenchymal, and hybrid J Clin Oncol 24:1770–1783. states in lung adenocarcinoma and their relevance to survival. Cancer Res 75:1789–1800. 49. Turner NC, Huang Bartlett C, Cristofanilli M (2015) Palbociclib in hormone-receptor- 25. Wagstaff KM, Sivakumaran H, Heaton SM, Harrich D, Jans DA (2012) Ivermectin is a positive advanced breast cancer. N Engl J Med 373:1672–1673. specific inhibitor of importin α/β-mediated nuclear import able to inhibit replication 50. Sanjana NE, Shalem O, Zhang F (2014) Improved vectors and genome-wide libraries of HIV-1 and dengue virus. Biochem J 443:851–856. for CRISPR screening. Nat Methods 11:783–784.

10 of 10 | www.pnas.org/cgi/doi/10.1073/pnas.1705441114 Kodama et al. Downloaded by guest on September 24, 2021