An Investigation Into Australian Freshwater Zooplankton with Particular Reference to Ceriodaphnia Species (Cladocera: Daphniidae)

An investigation into Australian freshwater zooplankton with particular reference to Ceriodaphnia species (Cladocera: Daphniidae)

Pranay Sharma

School of Earth and Environmental Sciences

July 2014

Supervisors

Dr Frederick Recknagel

Dr John Jennings

Dr Russell Shiel

Dr Scott Mills

Table of Contents

Abstract ...... 3 Declaration ...... 5 Acknowledgements ...... 6 Chapter 1: General Introduction ...... 10 Molecular Taxonomy ...... 12 Cytochrome C Oxidase subunit I ...... 16 Traditional taxonomy and cataloguing biodiversity ...... 20 Integrated taxonomy ...... 21 Taxonomic status of zooplankton in Australia ...... 22 Thesis Aims/objectives ...... 24 References ...... 28 Chapter 2: Molecular approach to identify sibling species of the Ceriodaphnia cornuta species group (Cladocera: Daphniidae) from Australia with notes on the continental endemism of this group. Zootaxa 3702: 079–089...... 35 Chapter 3: Morphological description for three Ceriodaphnia sp. (Cladocera: Daphniidae) from Australia ...... 48 Introduction ...... 49 Taxonomic records of Ceriodaphnia...... 49 Materials and Methods ...... 51 Anatomy of Ceriodaphnia ...... 61 Results ...... 81 Discussion ...... 125 References ...... 129 Chapter 4: Morphological and molecular identification of three Ceriodaphnia sp. (Cladocera: Daphniidae) in Australia ...... 131 Abstract ...... 132 Introduction ...... 133 Materials and Methods ...... 134 Results ...... 139 Discussion ...... 149 Acknowledgments ...... 152 References ...... 153

Chapter 5: The identification of common Cladocerans and Calanoids in two South Australian reservoirs using DNA barcoding and morphological analysis: an integrative approach Crustaceana 87 (7): 834-55...... 170 Chapter 6 : Are “Universal” DNA primers really universal?. DOI: 10.1007/s13353-014-0218-9 ...... 204 Chapter 7 – General Conclusions ...... 218 Future Directions ...... 223 References ...... 224 Appendix 1 ...... 249 Appendix 2 ...... 254 Appendix 3 ...... 257 Appendix 4 ...... 353 Appendix 5 ...... 362

Abstract

The taxonomy of Ceriodaphnia Dana, 1853 has long been uncertain, and their species richness often underestimated due to a lack of good morphological taxonomy. Modern molecular techniques such as genetic barcoding allow the detection of cryptic species. In this study DNA sequences from two mitochondrial

DNA (COI and 16s) and one nuclear DNA (28s) gene fragments, were used to investigate Ceriodaphnia diversity in Australia, and is the first molecular analysis of this genus from Australia.

A preliminary study using morphology and DNA barcoding of zooplankton diversity, particularly Ceriodaphnia from two South Australian reservoirs: Myponga and South

Para and supplemented by specimens from water bodies across Australia, revealed cryptic speciation for Ceriodaphnia. Derived sequences support the recognition of three beaked species in Ceriodaphnia cornuta Sars (1885) complex, C. sp. nov. 1 and

C. sp. nov. 2, and three non-beaked species C. dubia Richard, 1894, C. spinata

Henry, 1919 and C. sp. nov. 3.

We also examined the Folmer primer (LCO 1490 and HCO 2198) region, sourced from 725 complete mitochondrial genomes across 17 animal phyla is universal. The correlation between the frequency of base pair differences in the primer region at different taxonomic levels were analysed using 1-way ANOVA and Fishers Post Hoc analysis. A significant difference in the means of base pair differences from Order to

Species and Class to Kingdom levels (ANOVA, F= 8.193, p = 0.00) for LCO 1490 and at the level of Genus (ANOVA, F= 2.538, p = 0.027) for HCO 2198 was detected.

This study has demonstrated the potential of DNA barcoding in identifying species in a taxonomically uncertain group like Ceriodaphnia. However, the success of DNA barcoding relies on sequence databases that have been verified taxonomically. This research highlights the importance of an integrative approach required to clarify the taxonomic status of Ceriodaphnia from Australia. It also shows that automated primer sites can be generated for species which have an insufficient numbers of sequences in online genetic databases for which the Universal primers (LCO 1490 and HCO 2198) have been unsuccessful in amplifying the COI gene.

Declaration

This work contains no material which has been accepted for the award of any other degree or diploma in any university or other tertiary institution to Pranay Sharma and, to the best of my knowledge and belief, contains no material previously published or written by another person, except where due reference has been made in the text.

I give consent to this copy of my thesis, when deposited in the University Library, being made available for loan and photocopying, subject to the provisions of the Copyright Act 1968.The author acknowledges that copyright of published works contained within this thesis ( as listed below) resides with the copyright holder(s) of those works.

I also give permission for the digital version of my thesis to be made available on the web, via the University’s digital research repository, the Library catalogue, the Australasian Digital Theses Program (ADTP) and also through web search engines, unless permission has been granted by the University to restrict access for a period of time.

Published Articles:

Sharma P & Kotov A 2013. Molecular approach to identify sibling species of the Ceriodaphnia cornuta complex (Cladocera: Daphniidae) from Australia with notes on the continental endemism of this group. Zootaxa 3702: 079–089.

Sharma, P and Kobayashi, T 2014. Are "Universal" DNA primers really universal? Journal of Applied Genetics, DOI: 10.1007/s13353-014-0218-9.

Sharma, P; Elias-Gutierrez, M and Kobayashi, T 2014. The identification of common Cladocerans and Calanoids in two South Australian reservoirs using DNA Barcoding and morphological analysis: An Integrative Approach. Crustaceana 87 (7): 834–855.

Pranay Sharma

Acknowledgements

Although this will be the most widely read part of my thesis, and is longer than the abstract itself, it is important to appreciate the support and encouragement of many people from the field of academia and non-academia without whose help, this thesis may have never reached completion. First, I would like to thank my Grandparents, Mr and Mrs Dubey, Parents, and my lovely sister, for providing me the support needed in order to continuously push myself to success and without their unconditional love and support, I would not be here today.

I would like to express my sincere thanks and appreciation to Dr Scott Mills, for his excellent guidance, trust and patience throughout my doctoral studies. I have learned a great deal from him and I will never forget the valuable lessons he taught me. One simply could not wish for a better or friendlier supervisor. The time I spent working with him was satisfying and interesting, he was the only person who stood beside me from the day one of my PhD. He was always there to provide a helping hand whether it was setting up a laboratory or applying for major grants. At certain times, I may have disappointed him due to limitations of professional or domestic problems, but all along, he encouraged me to be independent. I am grateful to him for his indulgence in often going out of his way to help me out in facing problems on various fronts of life.

I am very grateful to Dr Russell Shiel for being my Co-supervisor and it is his encouragement, advice and support that motivated me to learn the taxonomic identification of the microcrustaceans. He not only allowed me to go through his valuable reprints but gave access to the laboratory and specimens as well. I deeply thank Dr John Jennings for his invaluable support and encouragement during the study. I should also thank A/Prof. Friedrich Recknagel for giving me the opportunity to work with him; I learned many valuable lessons from him. I would also like to thank the team from SA Water (Microbiology Department) especially to Dr Chris Saint, Dr Paul Monis, Dr Brett Robinson and Dr Daniel Hoefel for giving me access to their laboratory for carrying out the genetic experiments, it was such a pleasure to work with them.

I would like to express my deepest gratitude to Dr Alexey Kotov and Dr Tsuyoshi Kobayashi for their ideas, support and advice that inspired me to strive to do my very best in conveying the taxonomic information clearly.

Interest and encouragement was also shown by many not directly involved with me or with this project. I am grateful for the help that they have provided me especially with type descriptions and specimens needed to carry out this work Thierry Laperousaz (Collection Manager, SA Museum, Australia), Jens Petter Nilssen (Natural History Museum Universitetet i Oslo), Christine LeBeau (Scientific Assistant, Division of Invertebrate Zoology,American Museum of Natural History), Karen Vandorp (Collection manager Arachnida, NCB naturalis, Netherland), Mathew Lowe (Collection manager Arachnida, University of Zoology, Cambridge), Patricia Esclante (Instituto de Biologia, Mexico), Hannah Robson (Species Research Officer, Wildfowl & Wetlands Trust). Additional Ceriodaphnia species samples were provided from the personal collection of Dr Russell Shiel (South Australia), Jess Delaney and Andrew Storey (Wetland Research and Management, Western Australia); Dr Tsuyoshi Kobayashi, Steve Jacobs and Moreno Julli from New South Wales Office of Environment and Heritage and Dr Sarah J Adamowicz (Biodiversity Institute of Ontario).

There are those who are not officially supervisors, but their contribution for this work deserves a special note of praise. The various departments in the University of Adelaide have been helpful but following departments and members have been remarkable in their support. I will start with the Adelaide Graduate Centre, Professor Richard A Russell for his guidance and thoughtful consideration which helped me significantly when I was stuck with problems, Research Librarians Mr Robin Secomb, Ms Louise Gillis, Mr Mick Draper, Ms Lucy Zuzolo and Ms Ursula Gilchrist Henderson, for there unconditional and valuable assistance and I owe them my heartful appreciation. I would also like to extend my sincerest thanks to the technicians of the Jordan laboratories, Ms Julianne Francis and Ms Helen Falconer, for offering me the resources required during the research period. I am also grateful to the Research Grant Department including the financial department for their assistance while submitting many grant applications during the course of this research Ms Paula Rosenbauer (Asst Research Grant Officer), Ms Dalia Lasso Serna (School Finance Officer), Ms Jenny Reiners (Academic Program Officer) and Ms 7

Chelsea Mudge (Research Accountant), thank you for your support. I also wish to thank Ms Kathleen M Saint and Dr Steve Cooper (Facility manager, SA Museum) for her invaluable support and guidance during primer development work. My warm thanks are due to Ms Sarah Streeter and Mr Peter J Ward for the English support and revising the manuscript as well.

I am grateful to Sir Mark Mitchell Research Foundation (Project Number 75105075), ANZ Holsworth Grant (Project Number 75104813), and ABRS Travel Bursary (Project Number 55106981) for financial support.

My deepest gratitude goes toward my friends Ms Samantha –Ann Schneider, Ms Deborah Furst, Mrs Grace W Chain, Mrs Rebecca Duffield, Mrs Sonia Croft, Dr Jaqueline Sudiman, Mr Peter J Ward, and Mr Roberisco for being always willing to listen and motivating me to keep going when I was hopeless and frustrated. A special thanks goes to Ms Vicky Prior, Ms Pat Meyer and Mr Christos Ionenau from Adelaide Convention Centre, for their love and efforts that made me feel more at home.

Preamble

As most of this thesis has either been prepared for publication or published each chapter has been written as a journal article or compilation of journal articles.

Consequently there is some repetition between the general introduction and conclusion with the introduction and conclusion of each chapter. To keep this to a minimum, the General Introduction (Chapter 1) and General Conclusion (Chapter 7) have been kept brief, focussing on broader issues. There is also some repetition with regards to methodology used among the chapters. The title page of each chapter details publication information, along with authorship contributions. All references for each chapter have been compiled separately, following the particular journal’s style.

Chapter 1: General Introduction

The investigation and understanding of organisms that inhabit earth is an important task. In order to make sense of this complex world, scientists compartmentalize its many facets into manageable components that can be studied individually and once understood, combined to reveal complex interactions. Understanding these complex interactions is one of the driving motivations behind taxonomy.

Taxonomists use morphological taxonomy as a primary tool to reveal some of the mysteries of biodiversity. The codes of taxonomic nomenclature lay out the hierarchical rules for the organization of taxonomic information, allowing scientists to communicate their findings about species or related groups of organisms. The importance of good taxonomic descriptions with consistent nomenclature cannot be understated, as it provides the foundation for an understanding of ecology and community-level effects.

Zooplankton from the orders Anomopoda, Ctenopoda, Halopoda and Onychopoda, the class Maxillopoda and phylum Rotifera have been the subject of intense taxonomic scrutiny for the past 200 years, due to intraspecific variation that complicates taxonomic decisions and yet, our knowledge of them is far from complete. For example, to date, only 620 species of cladocerans of the estimated

2,420 fresh water species and 6,107 species of freshwater copepods have been described from the estimated 25,725 morphospecies, including marine species believed to exist (Walter and Boxshall 2008). Referencing original descriptions is critical for any thorough taxonomic revision. Another potentially complicating factor is the sourcing of type specimens, which can be in poor condition, may be missing, or have limited access. Often museums do not have dedicated collection managers 10

and researchers must travel long distances to examine type specimens. Recent advancements in imaging technology such as micro-CT, which use a similar technique as X-ray tomography but with much finer resolution, in combination with

3D printers, create computerised virtual artefacts and models of specimens (Abel et al. 2011; Laforsch et al. 2012). Many museums are gradually making resources available through the World Wide Web, thus reducing the need to physically examine slides and specimens (Winston 1999; Speers 2005).

The focus of this thesis is genus Ceriodaphnia Dana 1853, which was first described from a specimen collected from “Sandalwood Bay, Vanua Lebu, Feejee Islands”

(Dana 1853) Fiji (16°35′S ; 179°11′E) during the United States Exploring Expedition

(1838 to 1842) of the Pacific Ocean and surrounding islands. Today, the genus has

14 valid species and 21 species inquirendae. These 14 species have recently been recognised as valid (http://goo.gl/CZZXa 2010 ) (see Chapter 4 and Appendix 3 for further details). There is limited morphological and genetic evidence to support this proliferation of the large number of proposed names. There are eight Ceriodaphnia species recorded from Australia which includes one beaked species (‘beak’ = a rostral projection) i.e. C. cornuta Sars, 1885, and seven non-beaked species C. dubia

Richard, 1894, C. laticaudata Müller, 1867, C. quadrangula (Müller, 1785), C. rotunda Sars, 1862 (Smirnov and Timms, 1983), C. pulchella Sars, 1862, and C. planifrons Smith, 1909 and C. spinata Henry, 1919 which were re-instated by Berner

(2003).

Molecular Taxonomy

With the advent of molecular phylogenetics the status of zooplankton taxa once thought to be well documented, has been questioned. Techniques such as allozymes,

Restriction Fragment Length Polymorphisms (RFLPs), Random Amplified

Polymorphic DNA (RAPDs), DNA sequence polymorphism, and DNA barcoding have unlocked a surprising complexity of phylogenetic structure and cryptic speciation in a number of zooplankton species (Godfray 2002; Penev et al. 2010).

One of the most studied cladocerans is Daphnia. Hebert (1977) examined the

Daphnia carinata complex using allozymes and discovered nine separate species.

Benzie (1986) used 11 markers indicating 3 additional taxa and a study by Hebert and Wilson (1994) used 10 markers which indicated at least 7 species. The uncertainty around the number of species belonging to D. carinata complex is due to taxonomic confusion compounded by occurrences of parthenogenesis, hybridization and phenotypic plasticity. These studies also showed that endemism and allopatric speciation occurs in the species. Similarly, for other species of Daphnia, such as D. pulex where traditional taxonomy often resulted in grouping phenotypically similar species, genetic techniques have revealed a number of new species (Benzie 1986;

Taylor and Hebert 1993; Weider and Hobaek 1994; Hebert and Finston 1996;

Schwenk 1996 and Schwenk et al. 1998).

Mitochondrial genomes (mtDNA) have been identified as powerful tools for the reconstruction of animal phylogenies because of their near maternal inheritance.

Mitochondria are membrane bound organelles, making them structurally strong and therefore better at guarding DNA than nuclear DNA, which is bound only by a

nuclear envelope (Adams 2005). MtDNA is a small circular DNA molecule that resides in the cell cytoplasm and provides energy to drive biochemical reactions and cellular processes. It is comprised of 22 rRNA that are involved in protein syntheses and 13 protein coding genes that are required for biochemical reactions that make up respiration (Fig. 1.1). The numbers of mitochondria and mitochondrial genomes in a cell are regulated and vary significantly; for example a mammalian egg contains approximately 100,000 molecules of mtDNA, while sperm contains approximately

100 to 1,500 mtDNA (Wolstenholme 1992; Chen et al. 1995; Manfredi et al. 1997).

During fertilization the mitochondrion of a sperm cell, which is located in its mid- piece (tail section), is lost and thus sperm only contributes its nucleus. The sperm mitochondria which is marked with ubiquitin is decomposed during early embryonic development through the mechanism of ubiquitination and varies in a species- specific manner (Birky 1995). Those mtDNA remaining do not undergo meiosis, hence there is no crossing over of chromosomes. Instead, they go through DNA synthesis, which produces mutations. As a result only mtDNA inherited maternally is synthesised, hence the term ‘maternal inheritance’ (Sutovsky et al. 1996; 1999).

Furthermore, different genes of the mitochondrial genome evolve at different rates, allowing suitable gene regions to be chosen for the research being undertaken for population genetics and phylogeographic studies across the animal kingdom (Avise

2000; 2004). Although mtDNA inheritance is predominantly maternal, paternal transmission of mtDNA and recombination of mtDNA has been recorded in mussels

(Zouros et al. 1994; Venetis et al. 2006), fruit flies (Kondo et al. 1992) and honey bees (Meusel and Moritz 1993).

Control or

d-loop 12s rRNA region

Cytochrome b 16s rRNA

NADH Dehydrogenase 22 tRNA encoding genes subunits 13 protein encoding genes

ATP synthase subunits

Cytochrome Oxidase III Cytochrome Oxidase I

Cytochrome Oxidase II

Fig. 1.1. Map of the typical mtDNA genome showing regions of tRNA and protein encoding genes. Modified from Arnason and Janke (2002).

As a molecular marker, mtDNA presents advantages that make it suitable for investigating phylogenetic divergence among recently differentiated species or populations. Primarily this is due to the high number of mtDNA molecules ranging from 1,000 to 10,000 copies per cell, yielding substantial amounts of genomic DNA using a variety of extraction methods, compared to just two copies of nuclear gene

(Milligan 1998; Pakendorf and Stonekin 2005; Hubert et al. 2008; Chen et al. 2010;

Dentinger et al. 2010). Secondly, mtDNA evolves faster than nuclear DNA (Brown et al. 1979), due to an inefficient replication repair mechanism (Clayton 1984), and several other lineage-specific conditions such as metabolic rate, DNA repair efficiency, generation time, fluctuations in population size, and presence of

Wolbachia (Laird et al. 1969; Martin and Palumbi 1993; Shoemaker et al. 2004). 14

The use of DNA barcoding has already provided new insight by facilitating species identification in many groups of animals, including flagging specimens that may represent new species or cryptic species which are genetically quite distinct but morphologically similar. An additional advantage of using mtDNA is the abundance of sequences in various databases for reference purposes, providing a unique opportunity to investigate the dynamics of a mitochondrial evolution (Fig. 1.2).

7000

6000

5000

4000 COI 16s 3000 28s

Number Number sequences of 2000

1000

0 Copepoda Cladocera Rotifera

Fig. 1.2. Total number of sequences deposited in GenBank (15th Feb. 2014) for the taxa Copepoda, Cladocera and Rotifera for two mitochondrial (COI and 16s) and one nuclear genes (28s).

Cytochrome C Oxidase subunit I

COI gene is one of the most frequently used markers in the animal kingdom, because of its ability to provide phylogenetic resolution at species level by sorting and flagging genetically distinct lineages. COI is one of the protein coding genes found in mtDNA which codes for terminal enzymes of respiratory chains (Stryer 1995), and as such, has an Open Reading Frame (ORF). The ORF is the region of nucleotide sequences or reading frame that contains neither stop codons nor introns. As with all

DNA, the third position codons are not under strong selection to remain constant because of the redundancy of the amino acid coding system (Hames and Hooper

2005; Hershberg and Petrov 2009). The advantage of using COI as a barcoding gene along with other protein coding genes is that analyses can be done either through amino acid or nucleic acid sequences, allowing a two way phylogenetic approach for subtle and deeper relationships study (Mills 2006).

However, there are potential limitations to using mtDNA for inferring species boundaries and these principally includes: retention of ancestral polymorphisms, resulting in paraphyly of the species tree; male-biased gene flow, that constitutes a much stronger barrier (pre zygotic or post zygotic) to mtDNA than nuclear DNA

(Tegelström and Gelter 1990; Gantenbein and Largiadèr 2003); introgression where nuclear genes maintain polymorphisms for a longer period of time compared to mtDNA which reaches fixation sooner due to lineage sorting events (Quinn and

White 1987; Degnan 1993; Lovette and Bermingham 2001; Weckstein et al. 2001); and nuclear mitochondrial pseudogenes (numts), which is a result of incorporation of mtDNA into the nuclear genome, introducing ambiguity into DNA barcoding.

NUMT’s (Nuclear mitochondrial DNA), which are copies of mtDNA genes or almost complete mitochondrial genomes that have been translocated to the nuclear genome, result in the pseudogeneic sequence of mitochondrial origin that are untranslatable due to differences between the nuclear and mitochondrial genetic codes (Bensasson et al. 2001). These unusual mtDNA like sequences, which are often mistaken for genuine mtDNA sequences, have been found in plants, fungi, protists and animals (Williams and Knowlton 2001; Buhay 2009; Hazkani-Covo et al. 2010). The inclusion of Numts in species identification leads to erroneous interpretation of mtDNA data sets and misleading patterns of population subdivision as observed in grasshoppers and crayfish (Song et al. 2008). Genome sequencing has also revealed horizontal or lateral gene transfer (HGT) which is “the non- genealogical transmission of genetic material from one organism to other”

(Goldenfeld and Woese 2007) common in bacterial evolution. Moreover, it has been reported in protists, bdelloid rotifers and plants, resulting in phylogenetic incongruence and conflictive phylogenies while determining relationships among organisms (Andersson 2005; Keeling and Palmer 2008; Nedelcu et al. 2008).

Additionally, COI gene does not work effectively for molecular identification of all taxa. For example, COI gene is not applicable for vascular plants because of much slower rates of COI gene evolution in higher plants than in animals (Kress et al.

2005). In addition, the single gene approach is less precise when understanding phylogenetic resolution at species, genus and higher taxon levels; and so analyses should involve multiple genes for better understanding of taxa, hybridisation, rates of evolution and saturation (Avise 2000; 2004; Tavares and Baker 2008). Ribosomal mitochondrial genes, like 16S and 12S, which evolve more slowly than COI, are often used as alternatives to the COI marker. As they are easy to amplify, and are a

good source of synapomorphies due to shared traits with their most recent common ancestor, whose ancestor in turn does not possess those traits (Lefébure et al. 2006).

Barnett et al. (2007) emphasised that genetics has become an increasingly important parameter in the classification and identification of organisms in comparison to more traditional morphological descriptors. The success of using COI gene region to distinguish species from a range of taxa and to reveal cryptic species has been remarkable. This method of matching unknown molecular sequences to species, however, is only effective for those which have been studied extensively using a variety of characters such as morphology, reproduction, ecology and geographical distribution that have been well documented by researchers (Sites and Marshall

2004). For example, Hebert et al. (2004) studied COI barcodes from 260 species of

North American birds whose species level taxonomy was well resolved with the long-term database of mtDNA available (Gill and Slikas 1992; Avise and Walker

1998), resulting into proper assignment of specimens to known species. Four of the

120 species studied using COI gene showed two distinct barcode clusters, revealing cryptic species. This assumption of cryptic speciation was supported by subtle differences in the song and morphology in three of the four bird species studied

(Rohwer 1976; Kroodsma 1989; Sibley and Monroe 1990).

Johnson and Cicero (2004) studied genetic divergence in sister species of North

American birds. In contrast to the intraspecific study of Herbert et al. (2004), the intraspecific divergences of COI averaged 0.27 %, whereas congener divergences averaged 7.93 % Hebert et al. (2004).

Traits for reproductive and species barriers are likely to reside primarily in nuclear genes, mtDNA is not necessarily a good proxy for these. Species boundaries are formed over extended periods due to a complex interaction of physiological, behavioural, reproductive, and geographical changes. The reflection of these changes in the mtDNA of diverse genera is likely to vary widely depending upon their unique evolutionary histories. This is highlighted by the reproductive isolation experiment on Brachionus plicatilis s. str. by Suatoni et al. (2006), which showed a threshold value of 8.3 %, which is approximately three times higher than the threshold value proposed by Hebert et al. (2004) for speciation. In addition, the proposed species delimitation threshold of 0.16 substitutions per site in crustaceans has proven to be useful for copepods (Bucklin et al. 1999; Hill et al. 2001; Heuch et al. 2007;

Lefébure et al. 2007).

DNA barcoding is playing an important role in uncovering hidden biodiversity where morphological studies have failed to indicate it (Goetze 2003; Gómez et al. 2007).

This is evident in rotifers, where phenotypic characters are concomitant with reproductive isolation or adaptation to diverse habitats (Birky 2007; Mills et al.

2007). The only hard part of the body is their jaw, which is a key phenotypic characteristic in identifying the species, but because of their minute size, it is difficult to detect changes. As a result, morphology is not always a reliable guide in the identification of species and this is often due to a lack of detailed morphological study. This morphological constraint in rotifers and for less studied groups like

Ceriodaphnia makes it difficult to distinguish species among populations, which are likely to have many cryptic species.

Traditional taxonomy and cataloguing biodiversity

Morphological taxonomy has not been able to keep pace with accurate formal identification and classification of the same or different species when compared with other branches of the scientific community (Mora et al. 2011). The high level of expertise required for the identification process, resulted in a slow rate of species discovery. This is highlighted by the fact that, till date, only 25 to 30 % of all

Australian biota, excluding plants, have been described (Cassis 2007). In addition, morphological taxonomy often fails to identify cryptic taxa which are common in many groups (Knowlton 1993; Jarman and Elliott 2000), and morphological keys are often only effective for particular life stages or gender.

Historically, a good drawing was one way of adding value to the written description of an organism in systematic studies. Enhancement in microscopes, especially with respect to improved numerical aperture, reduced chromatic aberration, exchangeable objective lenses, and phase contrast microscopes, helped scientists refine anatomical structures. These improvements enabled researchers discriminate finer diagnostic features to distinguish species.

The categorization of species requires a detailed examination for observing taxonomically subtle differences, which can still be poorly detectable or visible under a light microscope, even at high magnification. For example, morphology of trophi and spine formation in rotifers is equally important as shape and size of the organism for morphological description. This requires tools or technologies such as

Transmission Electron Microscopy (TEM), Scanning Electron Microscopy (SEM) and Micro-CT scanning for imaging specimens.

Cataloguing biodiversity has generated improvements in the field of photography, by bringing concepts like image processing, which take a small fraction of time with high fidelity. The small depth of field, however, often left the micrographs blurred in some regions. Today digital imaging systems, like Syncroscopy®, overcome the problem of depth of field, allowing researchers to focus upon all structures simultaneously (www.gbif.es). Another technique currently used is known as Digital inking by Coleman (2003), which is a fast and accurate way of making scientific

Illustrations using Adobe illustrator®.

Integrated taxonomy

The taxonomy of Daphnia has been the subject of intense investigations for over a century owing to its intraspecific variation. The gradual increase in the species discovery rate of Daphnia is due to the succession of molecular genetics from traditional taxonomy (Fig. 1.3). The advancement in molecular techniques, especially the introduction of allozyme technique to study interspecific hybridisation in D. carinata by Hebert (as described previously), followed by DNA barcoding in 1994 saw a steady rise in species discovery, especially of cryptic species. The study by

Colbourne et al. (2011) provided draft genomes of 200 mega bases for D. pulex, helping to understand environmental influences on gene function.

Fig. 1.3. The number of Daphnia sp. discovered from 1785 to 2011. Source: Web of Science Research – 21st June 2013.

Taxonomic status of zooplankton in Australia

Although the study of zooplankton in Australian water bodies has not been extensive, it reveals a wealth of biodiversity. The Australian Faunal Directory includes 33 families of Rotifera, 9 families of the class Branchiopoda and 83 families of the sub class Copepoda (http://www.environment.gov.au/biodiversity/abrs/online- resources/fauna/index.html, data accessed on 20-05-2013). This provides a snapshot of the Australian situation with many first records and novel species identified. It is widely accepted that the current state of taxonomic knowledge regarding Australian zooplankton is poor and requires major revisionary work. Dr Russell J. Shiel, one of

Australia’s foremost experts on rotifers, suggests there are many more species than mentioned in the Australian Faunal Directory (including cryptic species), but due to the small pool of expert taxonomists, discovery and documentation of this biodiversity has been restricted (Shiel, pers. comm.).

In South Australia, the study of zooplankton has been largely limited to the River

Murray (Walker and Hillman 1977; Shiel 1978; 1979; 1981; 1982; Shiel and Walker 22

1984), with some attention to the combined Murray-Darling system (Shiel 1981).

Geddes (1984) studied the zooplankton community structure in Lake Alexandrina, a shallow turbid lake at the mouth of the River Murray. These studies resulted in the identification of 133 zooplankton taxa at Mannum, of which eight species were recorded for the first time in Australia, whereas Lake Alexandrina revealed 28 species of zooplankton, including one new species. Studies of floodplain and alpine sites in Victoria and Tasmania by Ricci et al. (2003) identified 20 bdelloid rotifer species. The study of the Bora channel in the Macquarie marshes of New South

Wales revealed Lecane shieli, a monogonont rotifer which was thought to be endemic to Thailand (Kobayashi et al. 2007). Shiel (pers. comm.) is studying

Rotifera extensively in various water bodies across Australia and his work has already documented 746 morphospecies across 102 genera, of which 110 species are new to science.

The community structure of zooplankton has been studied for species diversity or distribution in various reservoirs across the world, for example Billings reservoir in

São Paulo (Sendacz 1984), Broa reservoir, São Carlos, Brazil (Angelini and Petrere

2000), Petit Saut reservoir, French Guyana (Pourriot 1996) and Miyun reservoir,

China (Du 2004).

Thesis Aims/objectives

Given the incomplete knowledge of taxonomy in Ceriodaphnia, which currently comprises 14 valid described species worldwide, 21 “species inquirendae” and 24 species which are synonymous forms of already described species

(http://fada.biodiversity.be/CheckLists/Crustacea-Cladocera.pdf, 2012), biology of the described species is poorly understood. The major objective of this study is to provide an insight into the taxonomic position of Australian members of

Ceriodaphnia Dana 1853, species complex using modern taxonomic approaches, including DNA barcoding and morphological techniques. Focus is placed on cryptic species initially identified in two South Australian reservoirs; Myponga and South

Para. Ceriodaphnia (Dana 1853) samples from these reservoirs were supplemented by Australian specimens from the collections of Dr Shiel and Dr Tsuyoshi

Kobayashi. Molecular and morphological relationships among the species within this group were examined using two mitochondrial (COI and 16s) and one nuclear genes

(28s).

Limited COI gene fragment data exists in GenBank for Ceriodaphnia sp. (Elías-

Gutiérrez et al. 2008; Jeffery et al. 2011). This study extends the available data substantially and whether COI sequence diversity can successfully resolve species level differences.

This thesis is organised into five data chapters and a final discussion chapter. The following are the major aims of the study:

Molecular approach to identify sibling species of the Ceriodaphnia cornuta

species group (Cladocera: Daphniidae) from Australia with notes on the

continental endemism of this group (Chapter 2)

Taxonomy of genus Ceriodaphnia Dana, 1853 (Cladocera: Daphniidae) has been uncertain for a long time, the species richness was often underestimated due to (1) high morphological similarity among the species and (2) their great morphological inter- and intra- populational variability. Support for this conclusion comes from the first analysis of three molecular markers for Australian representatives of this genus, two mitochondrial (COI and 16s) and one nuclear (28s). Sequence analysis supports the existence of three sibling Australian species belonging to the complex.

Morphological and molecular identification for three Ceriodaphnia sp.

(Cladocera: Daphniidae) from Australia (Chapter 3 and 4)

A great amount of confusion surrounds the taxonomy of Ceriodaphnia due to the complexity of differentiating species based on their morphology. There are eight

Ceriodaphnia species recorded from Australia which includes one beaked species

(‘beak’ = a rostral projection) i.e. C. cornuta Sars, 1885, and seven non-beaked species C. dubia Richard, 1894, C. laticaudata Müller, 1867, C. quadrangula (Müller, 1785), C. rotunda Sars, 1862 (Smirnov and Timms, 1983), C. pulchella Sars, 1862, and C. planifrons Smith, 1909 and C. spinata Henry, 1919 which were re-instated by Berner (2003). The current study provides a robust understanding for three non-beaked species of this group using line drawings, SEM images and genetic barcodes.

The literature on Ceriodaphnia sp. generally points towards the absence of divergent morphological characters for this group. Additionally, the historical taxonomic descriptions are incomplete and focused on the head, antennule, antennae, postabdomen, carapace, reticulation, and rarely trunk appendages of Ceriodaphnia

(Chapter 3 and Appendix 3). Where morphological evidence is unclear, molecular techniques can be used to improve our understanding of taxonomic divergence and speciation. Australian Ceriodaphnia species are studied for the first time using two mitochondrial DNA (COI and 16s) and one nuclear DNA (28s) gene fragments to identify known species and to aid in the discovery of new or cryptic species.

The use of genetic analyses in taxonomic studies has added a new dimension to the traditional phenotypic approach and allows the investigator to understand patterns of genetic variability. To achieve this, samples of Ceriodaphnia were obtained from the personal collection of Dr Russell Shiel. These specimens were collected from across

Australia over the past 20 years and preserved in 70 % denatured ethanol. Samples from New South Wales were obtained through Dr Kobayashi and team (refer

Chapter 4).

For a better understanding of global species diversity in this genus, DNA barcodes were downloaded from GENBANK and BOLD for COI, 16s and 28s markers. These sequences, along with data generated from this study, were analysed to understand the diversity of Australian Ceriodaphnia.

DNA barcoding and zooplankton taxonomy – a case study of common

cladocerans and calanoids in two South Australian reservoirs and a

comparison with GenBank and Barcode of Life Data System databases

(Chapter 5).

The aim of this study was to examine (1) whether DNA barcoding is sensitive enough to reveal discrete biological entities (2) how DNA barcoding complements traditional morphological taxonomy and explores species diversity within these reservoirs, and (3) is DNA barcoding sensitive enough to reveal cryptic species.

Are “Universal” DNA primers, really universal? (Chapter 6)

The gene of primary interest for biologists is the 500 to 700 base pairs (bp) long COI fragment, which can be amplified easily from different life stages for identifying and classifying species. Amplification has resulted in the development of various primers, but geneticists have mostly used the Universal Folmer primers, LCO 1490 and HCO 2198, (Folmer et al. 1994) due to their robust nature in successfully amplifying the COI fragment. This chapter seeks to investigate the limitations of a

"Universal” primer, exposing its ability or lack of as primers, to amplify the gene.

References

Abel LR, Parfitt S, Ashton N, Lewis GS, Scott B & Stringer C 2011. Digital preservation and dissemination of ancient lithic technology with modern micro -CT. Computer and Graphics 35: 878-884.

Adams J 2005. Nuclear and Mitochondrial DNA In the Courtroom. Brook Law: 69- 97.

Andersson JO 2005. Lateral gene transfer in eukaryotes. Cellular and Molecular Life Sciences 62: 1182-1197.

Angelini R & Petrere JM 2000. A model for the plankton system of the Broa reservoir, São Carlos, Brazil. Ecological Modelling 126: 131-137.

Arnason U & Janke A 2002. Mitogenomic analyses of eutherian relationships. Cytogenetic and Genome Research 96: 20-32.

Avise JC 2000. Phylogeography: The history and formation of species. Harvard University Press.: Cambridge (Massachusetts). p: 447.

Avise JC 2004. Molecular markers, natural history and evolution Sinauer Associates: Sunderland (Massachusetts). p: 684.

Avise JC & Walker D 1998. Pleistocene phylogeographic effects on avian populations and the speciation process. Proceedings of the Royal Society B: Biological Sciences 265: 457–463.

Bensasson D, Zhang D, Hartl DL & Hewitt GM 2001. Mitochondrial pseudogenes: evolution's misplaced witnesses. Trends in Ecology and Evolution 16: 314– 321.

Benzie JAH 1986. The systematics of Australian Daphnia (Cladocera : Daphniidae). Multivariate morphometrics. Australian Journal of Marine and Freshwater Research 37: 251-60.

Birky C 2007. Workshop on barcoded DNA: application to rotifer phylogeny, evolution, and systematics. Hydrobiologia 593: 175-183.

Birky CWJ 1995. Uniparental inheritance of mitochondria and chloroplast genes: mechanisms and evolution. Proceedings of the National Academy of Sciences 92: 11331–38.

Brown MW, George MR. & Wilson CA. 1979. Rapid evolution of animal mitochondrial DNA. Proceedings of the National Academy of Sciences 76: 1967-1971.

Bucklin A, Guarnieri M, Hill RS, Bentley AM & Kaartvedt S 1999. Taxonomic and systematic assessment of planktonic copepods using mitochondrial COI sequence variation and competitive, species-specific PCR. Hydrobiologia 401: 239-254. 28

Buhay JE 2009. ‘COI-like’ sequences are becoming problematic in molecular systematic and DNA barcoding studies. Journal of Crustacean Biology 29: 96−110.

Cassis G 2007. Proceedings of the National Taxonomy Forum. Hall K, ed. FASTS/ABRS, Australian Museum, Sydney, NSW.

Chen H, Rangasamy M, Tan SY, Wang H & Siegfried BD 2010. Evaluation of five Methods for total DNA extraction from western corn rootworm beetles. PLoS One 5:e11963.

Chen X, Prosser R, Simonetti S, Sadlock J, Jagiello G & Schon EA 1995. Rearranged mitochondrial genomes are present in human oocytes. American Journal of Human Genetics 57: 239-247.

Clayton DA 1984. Transcription of the mammalian mitochondrial genome. Annual Review of Biochemistry 53: 573-94

Colbourne JK, Pfrender ME, Gilbert D, Thomas WK, Tucker A, Oakley TH, Tokishita S, Aerts A, Arnold GJ, Basu MK, Bauer DJ, Cáceres CE, Carmel L, Casola C, Choi J-H, Detter JC, Dong Q, Dusheyko S, Eads BD, Fröhlich T, Geiler-Samerotte KA, Gerlach D, Hatcher P, Jogdeo S, Krijgsveld J, Kriventseva EV, Kültz D, Laforsch C, Lindquist E, Lopez J, Manak JR, Muller J, Pangilinan J, Patwardhan RP, Pitluck S, Pritham EJ, Rechtsteiner A, Rho M, Rogozin IB, Sakarya O, Salamov A, Schaack S, Shapiro H, Shiga Y, Skalitzky C, Smith Z, Souvorov A, Sung W, Tang Z, Tsuchiya D, Tu H, Vos H, Wang M, Wolf YI, Yamagata H, Yamada T, Ye Y, Shaw JR, Andrews J, Crease TJ, Tang H, Lucas SM, Robertson HM, Bork P, Koonin EV, Zdobnov EM, Grigoriev IV, Lynch M & Boore JL 2011. The Ecoresponsive Genome of Daphnia pulex. Science 331: 555-561.

Coleman OC 2003. "Digital inking": How to make perfect line drawings on computers. Organisms Diversity and Evolution. Electronic Supplementary 3:1-14.

Dana J 1853. United States Exploring Edition during the years 1838-1842. In: Crustacea. Sherman,C., Philadelphia. C. Sherman Vol. 14 p: 691-1618. 9e5cd470-ad36-4947-92b4-209060e31508

Dentinger BTM, Margaritescu SA, & Moncalvo JM 2010. DNA barcoding: Rapid and reliable high-through put methods of DNA extraction for use in barcoding and molecular systematics of mushrooms. Molecular Ecology Resources. 10: 628–633.

Du G-SL, Xiao-Duan; Song, Fu; Liu, Jing and Hua, Zhen-Ling 2004. Study on plankton community in Miyun reservoir. Xibei Zhiwu Xuebao 24: 1485- 1488.

Elías-Gutiérrez M, Jerónimo MF, Ivanova VN, Valdez-moreno M & Hebert PDN 2008. DNA barcodes for Cladocera and Copepoda from Mexico and Guatemala, highlights and new discoveries. Zootaxa 42:1-42. 29

Folmer OF, Black M, Hoeh W, Lutz R & Vrijenhoek R 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294-299.

Forro L, Korovchinsky NM, Kotov AA & Petrusek A 2008. Global diversity of cladocerans (Cladocera; Crustacea) in freshwater. Hydrobiologia 595: 177- 184.

Gantenbein B & Largiadèr CR 2003. The phylogeographic importance of the Strait of Gibraltar as a gene flow barrier in terrestrial arthropods: a case study with the scorpion Buthus occitanus as model organism. Molecular Phylogenetics and Evolution 28: 119-130.

Geddes MC 1984. Limnology of Lake Alexandrina, River Murray, South Australia, and the effects of nutrients and light on the phytoplankton. Australian Journal of Marine and Freshwater Research 35: 399-415.

Gill FB & Slikas B 1992. Patterns of Mitochondrial DNA Divergence in North American Crested Titmice. The Condor 94: 20-28.

Godfray HCJ 2002. Challenges for taxonomy. Nature 417: 17-19.

Goetze E 2003 Cryptic speciation on the high seas; global phylogenetics of the copepod family Eucalanidae. Proceedings of the Royal Society B: Biological Sciences 270: 2321–2331.

Goldenfeld N & Woese C 2007. Biology's next revolution. Nature 445: 369-369.

Gómez A, Montero-Pau J, Lunt DH, Serra M & Campillo S 2007. Persistent genetic signatures of colonization in Brachionus manjavacas rotifers in the Iberian Peninsula. Molecular Ecology 16: 3228-40.

Hames D & Hooper N 2005. Bios Instant Notes In Biochemistry Taylor and Francis: New York, US.

Hazkani-Covo E, Zeller RM & Martin W 2010. Molecular poltergeists: mitochondrial DNA copies (numts) in sequenced nuclear genomes. PLoS Genetics 6. DOI: 10.1371/journal.pgen. 1000834.

Hebert PDN 1977. A revision of the taxonomy of the genus Daphnia (Crustacea: Daphnidae) in south-eastern Australia. Australian Journal of Zoology. 25: 371-398.

Hebert PDN, Stoeckle MY, Zemlak TS & Francis CM 2004. Identification of Birds through DNA Barcodes. PLoS Biology 2:e312.

Hebert PDN & Finston TL 1996. A taxonomic reevaluation of North American Daphnia (Crustacea: Cladocera). II. New species in the Daphnia pulex group from the south-central United States and Mexico. Canadian Journal of Zoology 74: 632–653. 30

Hebert PDN & Wilson CC 1994. Provincialism in plankton: endemism and allopatric speciation in Daphnia. Evolution 48:1333-1349.

Hershberg R & Petrov DA 2009. General Rules for Optimal Codon Choice. PLoS Genetics 5:e1000556.

Heuch PA, Øines Ø, Knutsen JA & Schram TA 2007. Infection of wild fishes by the parasitic copepod Caligus elongatus on the south east coast of Norway. Diseases of Aquatic Organisms 77: 149–158.

Hill RS, Allen LD & Bucklin A 2001. Multiplexed species-specific PCR protocol to discriminate four N. Atlantic Calanus species, with an mtCOI gene tree for ten Calanus species. Marine Biology (Berlin) 139: 279-287.

Hubert N, Hanner R, Holm E, Mandrak NE, Taylor E, Burridge M, Watkinson D, Dumont P, Curry A, Bentzen P, Zhang J, April J & Bernatchez L 2008. Identifying Canadian Freshwater Fishes through DNA Barcodes. PLoS ONE 3: e2490.

Jarman SN & Elliott NG 2000. DNA evidence for morphological and cryptic Cenozoic speciations in the Anaspididae,‘living fossils’ from the Triassic. Journal of Evolutionary Biology 13: 624–633.

Jeffery NW, Elias-Gutierrez M & Adamowicz SJ 2011. Species diversity and phylogeographical affinities of the Branchiopoda (Crustacea) of Churchill, Manitoba, Canada. PLoS ONE 6. DOI: 10.1371/journal.pone.0018364.

Johnson N, K. & Cicero C 2004. New mitochondrial DNA data afﬁrm the importance of Pleistocene speciation in North American birds. Evolution 58 (5): 1122-30.

Keeling PJ & Palmer JD 2008. Horizontal gene transfer in eukaryotic evolution. Nature Reviews Genetics 9: 605-618.

Knowlton N 1993. Sibling species in the sea. Annual Review of Ecology, Evolution, and Systematics 24: 189–216.

Kobayashi T, Shiel RJ & Segers H 2007. First record of the rotifer Lecane shieli Segers & Sanoamuang, 1994 from Australia. Australian Journal of Zoology 34: 181-183.

Kondo R, Matsuura E, T. & Chigusa S, I. 1992. Further observation of paternal transmission of Drosophila mitochondrial DNA by PCR selective amplification method. Genetics Research 59: 81–4.

Kroodsma DE 1989. Two North American song populations of the marsh wren reach distributional limits in the central Great Plains. The Condor 91: 332- 340.

Laforsch C, Imhof H, Sigl R, Settles M, Heß M & Wanninger A 2012. Applications of Computational 3D–Modeling in Organismal Biology. 298 p.

Lefébure T, Douady CJ, Gouy M & Gibert J 2006. Relationship between morphological taxonomy and molecular divergence within Crustacea: Proposal of a molecular threshold to help species delimitation. Molecular Phylogenetics and Evolution 40: 435-447.

Lefébure T, Douady CJ, Malard F & Gibert J 2007. Testing dispersal and cryptic diversity in a widely distributed groundwater amphipod (Niphargus rhenorhodanensis). Molecular Phylogenetics and Evolution 42: 676-686.

Manfredi G, Thyagarajan D, Papadopoulou LC, Pallotti F & Schon EA 1997. The fate of human sperm-derived mtDNA in somatic cells. American Journal of Human Genetics 61(4): 953-960.

Meusel MS & Moritz RF 1993. Transfer of paternal mitochondrial DNA during fertilization of honeybee (Apis mellifera) eggs. Current Genetics 24: 539– 43.

Milligan BG 1998. Total DNA isolation. In: Hoelzel AR, Molecular Genetic Analysis of Population: A Practical Approach Oxford University Press: New York, Tokyo.

Mills S 2006. Investigations of the Brachionus plicatilis spp complex, with particular reference to south west Western Australia, University of Western Australia. 224 p.

Mills SC, Lunt HD & Gómez A 2007. Global isolation by distance despite strong regional phylogeography in a small metazoan. BMC Evolutionary Biology 7: 225

Mora C, Tittensor DP, Adl S, Simpson AGB & Worm B 2011. How Many Species Are There on Earth and in the Ocean? PLoS Biol 9:e1001127.

Nedelcu AM, Miles IH, Fagir AM & Karol K 2008. Adaptive eukaryote-to- eukaryote lateral gene transfer: stress-related genes of algal origin in the closest unicellular relatives of animals. Journal of Evolutionary Biology 21: 1852-1860.

Pakendorf B & Stonekin M 2005. Mitochondrial DNA and Human Evolution. Annual Review of Genomics and Human Genetics 6: 165–83.

Penev L, Roberts D, Smith V, Agosti D & Erwin T 2010. Taxonomy shifts up a gear: New publishing tools to accelerate biodiversity research. ZooKeys 50: i-iv.

Pourriot R 1996. Rotifers from Petit Saut reservoir (French Guyana), with the description of a new taxon. Hydrobiologia 331: 43-52.

Ricci C, Shiel R, J. , Fontaneto D & Melone G 2003. Bdelloid rotifers recorded from Australia with description of Philodinavus aussiensis n. sp. Zoologische Anzeiger 242: 241-248.

Rohwer SA 1976. Specific distinctness and adaptive differences in Southwestern meadowlarks Museum of Natural History, University of Kansas (Lawrence).

Sars GO 1890. Oversigt af Norges Crustaceer, med foreløbige bemærkninger over de nye eller mindre bekjendte Arter- II. (Branchiopoda - Ostracoda - Cirripedia). Forh. Videnskselskab. Christiania aar 1890: 1-80.

Schwenk K 1996. Evolutionary genetics of Daphnia species complex: hybridism in syntopy.Nieuwersluis, The Netherlands: Netherlands Institute of Ecology, Centre for Limnology. Publication 2231.

Schwenk K, Sand A, Boersma M, Brehm M, Mader E, Offerhaus D & Spaak P 1998. Genetic markers, genealogies and biogeographic patterns in the cladocera. Aquatic Ecology 32:37-51.

Sendacz S 1984. A study of the zooplankton community of Billings’s reservoir – São Paulo. Hydrobiologia 113: 121–7.

Shiel RJ 1979. Synecology of the Rotifera of the River Murray, South Australia. Australian Journal of Marine and Freshwater Research 30: 255-63.

Shiel RJ 1981. Plankton of the Murray-Darling river system, University of Adelaide.

Shiel RJ 1978. Zooplankton communities of the Murray-Darling system. Proceedings of the Royal Society of Victoria 90: 193-202.

Shiel RJ 1982. Zooplankton dynamics in Mt Bold Reservoir, South Australia. In: Proceedings of Plankton Ecology Group. Trondheim, Norway.

Shiel RJ & Walker KF 1984. Zooplankton of regulated and unregulated rivers: the Murray-Darling system, Australia. In: Proc. 2nd Int. Conf. Regulated Streams, Oslo.

Sibley GC & Monroe LBJ 1990. Distribution and taxonomy of birds of the world Yale University Press, c1990: New Haven. p: 1111.

Sites JW, Jr & Marshall JC 2004. Operational criteria for delimiting species. Annual Review of Ecology, Evolution, and Systematics 35: 199-227.

Song H, Buhay EJ, Whiting FM, and & Crandall AK 2008. Many species in one: DNA barcoding overestimates the number of species when nuclear mitochondrial pseudogenes are coamplified. Proceedings of the National Academy of Sciences 105: 13486-13491.

Speers L 2005. E-types – A new resource for taxonomic research. Pp. 13-18 in Digital imaging of biological type specimens. A manual of best practice. Results from a study of the European network for biodiversity information (C.L. Häuser, A. Steiner, J. Holstein and M.J. Scoble, eds.). Stuttgart.

Suatoni E, Vicario S, Rice S, Snell T & Caccone A 2006. An analysis of species boundaries and biogeographic patterns in a cryptic species complex: The rotifer Brachionus plicatilis. Molecular Phylogenetics and Evolution 41:8 6- 98.

Sutovsky P, Moreno RD & Ramalho-Santosl J 1999. Ubiquitin tag for sperm mitochondria. Nature: 371–2.

Sutovsky P, Navara CS & Schattenm G 1996. Fate of the sperm mitochondria, and the incorporation, conversion, and disassembly of the sperm tail structures during bovine fertilization. Biology of Reproduction 55: 1195–205.

Tavares E & Baker A 2008. Single mitochondrial gene barcodes reliably identify sister-species in diverse clades of birds. BMC Evolutionary Biology 8: 81.

Taylor DJ & Hebert PDN 1993. A Reappraisal of Phenotypic Variation in Daphnia galeata mendotae: The Role of Interspecific Hybridization. Canadian Journal of Fisheries and Aquatic Sciences 50: 2137–2146.

Tegelström H & Gelter H, P. 1990. Haldane's rule and sex-biased gene flow between two hybridizing flycatcher species (Ficedula albicollis and F. hypoleuca, Aves: Muscicapidae). Evolution 44: 2012-2021.

Venetis C, Theologidis I, Zouros E & Rodakis GC 2006. No evidence for presence of maternal mitochondrial DNA in the sperm of Mytilus galloprovincialis males. Proceedings of the Royal Society B: Biological Sciences 273: 2483– 2489.

Walker KF & Hillman TJ 1977. Limnological survey of the River Murray in relation to Albury-Wodonga, 1973-1976. Report on behalf of Gutteridge, Haskins & Davey to the Albury-Wodonga Development Corporation, Albury.

Walter TC & Boxshall GA 2008. World of Copepods database.

Weider LJ & Hobaek A 1994. Molecular biogeography of clonal lineages in a high- arctic apomictic Daphnia complex. Molecular Ecology 3: 497–506.

Williams ST & Knowlton N 2001. Mitochondrial pseudogenes are pervasive and often insidious in the snapping shrimp genus Alpheus. Molecular Biology and Evolution 18: 1484−1493.

Winston E, J. 1999. Describing Species: Practical Taxonomic Procedure for Biologists Columbia University Press; 1 edition (October 15, 1999).

Wolstenholme DR 1992. Animal mitochondrial DNA: Structure and evolution. International Review of Cytology 141: 173-216.

Zouros E, Oberhauser Ball A, Saavedra C & Freeman KR 1994. An unusual type of mitochondrial DNA inheritance in the blue mussel Mytilus. Proceedings of the National Academy of Sciences 91:7463-7467.

Chapter 2: Molecular approach to identify sibling species of the Ceriodaphnia cornuta species group (Cladocera: Daphniidae) from Australia with notes on the continental endemism of this group

PRANAY SHARMA1 & ALEXEY A. KOTOV2*

1 School of Earth and Environmental Science, University of Adelaide, Adelaide,

Australia.

2 A. N. Severtsov Institute of Ecology and Evolution, Leninsky Prospect 33, Moscow

119071, Russia.

* Corresponding author

E-mail: [email protected]

A Sharma, P. & Kotov, A. (2013) Molecular approach to identify sibling species of the Ceriodaphnia cornuta complex (Cladocera: Daphniidae) from Australia with notes on the continental endemism of this group. Zootaxa, v. 3702 (1), pp. 79-89

NOTE: This publication is included on pages 37-47 in the print copy of the thesis held in the University of Adelaide Library.

It is also available online to authorised users at:

http://doi.org/10.11646/zootaxa.3702.1.5

Chapter 3: Morphological description for three Ceriodaphnia sp. (Cladocera: Daphniidae) from Australia

Introduction

Currently, Freshwater Animal Diversity Assessment (FADA) defines a number of species as synonymous under genus Ceriodaphnia. There is limited morphological or genetic evidence to support this assumption, due to difficulty naming a species, which has augmented the synonymous name as listed below. According to Smirnov and Timms (1983), there are only five Ceriodaphnia species from Australia which includes one beaked species (‘beak’ = a rostral projection) i.e. C. cornuta Sars, 1885, and four non-beaked species C. dubia Richard, 1894, C. laticaudata Müller, 1867, C. quadrangula (Müller, 1785) and C. rotunda Sars, 1862. One further, non-beaked species, C. pulchella Sars, 1862, has been recorded since (Shiel 1995). In addition to these, two more non-beaked species, C. planifrons Smith, 1909 and C. spinata

Henry, 1919 were re-instated by Berner (2003), thereby increasing the total number of recorded species from Australia to eight. In this chapter, I aim to describe and illustrate three non-beaked Ceriodaphnia species from Australia by examining their morphological characteristics and comparing them to the eight known species.

Taxonomic records of Ceriodaphnia.

From the time of Linnaeus until the latter part of the 19th century, taxonomic descriptions of Ceriodaphnia were mostly based on exomorphic characteristics such as head, antennae, antennules, fornix, cervical notch, postero dorsal angle, anal denticles, postabdomen and postabdominal claw which were much easier and quicker to observe than internal microscopic structures (Table 3.1). Twentieth century advancements in microscopy brought attention to the finer details of Ceriodaphnia morphology. These included fine structure of trunk limbs I, II and V (Paggi 1986;

Alonso 1996), spinulation pattern on inner margin of carapace (Paggi 1986; Alonso

1996), presence or absence of a cervical fenestra in adults, as well as the pattern of reticular meshes surrounding rostral pore (Berner 1987), and presence and position of carapace glands (Margaritora 1983; Berner 1987).

Much of the anatomical terminology used by taxonomists for describing

Ceriodaphnia was developed independently, which resulted in a number of synonymous terms. An accurate and standardized nomenclature for Ceriodaphnia anatomy is thus vital to reduce confusion when describing species. Therefore, in this chapter I provide a detailed discussion of anatomical features of Ceriodaphnia including size, shape and position of structures. The chapter does not detail the functions of these structures.

Materials and Methods

Based on the original published descriptions, images which formed part of these descriptions were extracted using GIMP® software. They were obtained at the highest resolution possible to avoid loss of potentially important taxonomic characters. In order to analyze and compare images of Ceriodaphnia at the same scale, it was necessary to develop a uniform scale bar. This proved useful in inferring relationships between size and character(s) when comparing different species. The first step was to measure the actual specimen size as drawn in literature. Once measured (a = measurement) and with the magnification provided (b = magnification), actual size of the organism was calculated by dividing the two values

(a / b) and all the images were then resized to the same scale. Morphological terms are largely based from Berner (1986) and Smirnov and Kotov (2009; 2010).

Line drawings based on the actual specimens. Ephippial females (N = 5) were transferred into petri dishes containing distilled water to remove traces of ethanol and debris and then transferred onto a glass slide containing a drop of distilled water.

Under a dissecting microscope, eggs or young adults were teased out from the brood chamber and stored in new 0.5 mL microtubes containing 90 % denatured ethanol for genetic analysis. Remainder of the body was transferred onto a new slide containing

PVA and left in a Greiner petri dish for 24 h. After 24 h equilibration, the specimen was dissected using tungsten needles and examined under a compound microscope for further fine morphological analysis. Digital photographs were taken using

Olympus BX51 microscope under high resolution using polarizing filters and composite line drawings were made from these photographs for different parts of the specimens. Inbuilt imaging software Image J ® was used to calculate all measurements. 51

Ceriodaphnia samples for SEM analysis were prepared as described by Berner

(Berner 1987; Berner and Rakhmatullaeva 2001) the specimens were sputter-coated with gold and their morphology examined under a Philips XL 20 SEM with an accelerating voltage of 10 - 20 KV, working distance between 9.6 to 14 mm and spot size at 3 / 4.

Each species listing contains information with respect to authorship, location of type material, Museum catalogue number(s) and whether the specimen is slide mounted or alcohol preserved (see Appendix 3).

Abbreviations used throughout for museum collections are:

 AMNH = American Museum of Natural History, New York, USA;  AMS = Australian Museum, Sydney, Australia;  HP = Institute of Hydrobiology, Hupei Province, China;  NHMUO = Natural History Museum, University of Oslo, Norway;  NMCL = Naturkunde-Museum, Coburg, Germany;  NCB = Nederlands Centrum voor Biodiversiteit Naturalis; Lead, Holland;  SMHN = Swedish Museum of Natural History, Stockholm, Sweden;  USNM = National Museum of Natural History, Smithsonian Institution, Washington, D.C., USA;  UUZM = Zoological Museum at Uppsala, Sweden;  ZIN = Zoological Institute of Russian Academy of Sciences, St. Petersburg, Russia;  ZMUC = Zoological Museum of the University of Copenhagen, Denmark.

Taxonomy of the genus Ceriodaphnia Dana, 1853 (Cladocera: Daphniidae) is confusing. The genus currently comprises 14 valid species worldwide, excluding the two reinstated species C. planifrons and C. spinata by Berner (2003), but also includes 21 species inquirenda, and 24 species which are probably junior synonymon of previously described taxa (Kotov 2013) as shown below. There is limited morphological and genetic evidence to support this proliferation of names.

The current list of Ceriodaphnia species and their synonyms in FADA list (2010-13) is as follows. Where, ANT = Antartic; AU = Australasian; AT = Afrotropical; NA = Neoarctic; NT = Neotropical; OL = Oriental (Indomalaya); PAC = Pacific (Oceania) and PA = Palaearctic:

Ceriodaphnia Dana, 1853.

Ceriodaphnia acanthina Ross, 1897 NA. Ceriodaphnia alabamensis Herrick, 1883 NA. Ceriodaphnia bicuspidata Weltner, 1897 PA. Species inquirenda (FADA 2010). Ceriodaphnia carolinensis Coker, 1926 NA. Species inquirenda (FADA 2010). Ceriodaphnia consors Birge, 1879 NA. Species inquirenda (FADA 2010). Ceriodaphnia cornuta Sars, 1885 AT, AU, NA, NT, OL, PAC, PA. Syn: Ceriodaphnia cornigera Jiang Xiezhi, 1977 PA. Syn: Ceriodaphnia rigaudi Richard, 1894 OL. Ceriodaphnia dentata Birge, 1879 NA. Species inquirenda (FADA 2010). Ceriodaphnia dubia Richard, 1894 AT, AU, NA, NT, OL, PAC, PA. Syn: Ceriodaphnia acuminata Ekman, 1900. Syn: Ceriodaphnia affinis Lilljeborg, 1901. Syn: Ceriodaphnia limicola Ekman, 1900. Syn: Ceriodaphnia richardi Sars, 1901. Ceriodaphnia globosa Brady, 1906 AU. Species inquirenda (FADA 2010). Ceriodaphnia lacustris Birge, 1893 NA. Ceriodaphnia laticaudata P. E. Müller, 1867 AT, AU, NA, OL, PA. Ceriodaphnia laticaudata deserticola Manuilova, 1972. Species inquirenda (FADA 2010). Syn.: Ceriodaphnia transylvana Daday, 1888. Syn.: Ceriodaphnia valentina Arévalo, 1916. Ceriodaphnia megops Sars, 1862 NA, PA. Syn: Ceriodaphnia alata Werestchagin, 1911. Syn: Ceriodaphnia cristata Birge, 1879. Syn: Ceriodaphnia intermedia Hartmann, 1917. Syn: Ceriodaphnia leydigi Schödler, 1877. Syn: Ceriodaphnia megalops Sars, 1890. Ceriodaphnia minor Sars, 1916 AT. Species inquirenda (FADA 2010). Ceriodaphnia natalis Brady, 1907 AT. Species inquirenda (FADA 2010). Ceriodaphnia nitida Schödler, 1877 PA. Species inquirenda (FADA 2010). Ceriodaphnia parva Herrick, 1883 NA. Species inquirenda (FADA 2010). Ceriodaphnia planifrons Smith, 1909 AU. Reinstated by D. Berner, 2003. Syn: Ceriodaphnia hakea Smith, 1909. Ceriodaphnia producta Sars, 1916 AT. Species inquirenda (FADA 2010). Ceriodaphnia pulchella Sars, 1862 NA, PA Syn: Ceriodaphnia microcephala Sars, 1890. Syn: Ceriodaphnia pseudohamata Bowkiewicz, 1926. Ceriodaphnia quadrangula (O. F. Müller, 1785) AT, AU, NA, NT, OL, PA. Daphnia quadrangula O. F. Müller, 1785. Syn: Ceriodaphnia connectens Drost, 1925. Syn: Ceriodaphnia hamata Sars, 1890. Syn: Ceriodaphnia muelleri Langhans, 1911.

Syn: Ceriodaphnia punctata P. E. Müller, 1867. Syn: Monoculus clathratus Jurine, 1820. Ceriodaphnia reticulata (Jurine 1820) : AT, NA, NT, OL, PA. Monoculus reticulatus Jurine, 1820. Syn: Ceriodaphnia fisheri Leydig, 1860. Syn: Ceriodaphnia kurzii Stingelin, 1895. Syn: Ceriodaphnia occulata Werestchagin, 1911. Syn: Ceriodaphnia serrata Sars, 1890. Ceriodaphnia rotunda (Straus, 1820) AU, NA, PA. Daphnia rotunda Straus, 1820. Ceriodaphnia scitula Herrick, 1884 NA. Species inquirenda (FADA 2010). Ceriodaphnia setifera Brehm, 1935 NT. Species inquirenda (FADA 2010). Ceriodaphnia setosa Matile, 1890 PA. Syn: Ceriodaphnia echinata Moniez, 1887. Ceriodaphnia silvestrii Daday, 1902 ANT, NT. Ceriodaphnia solis Moniez, 1889 NT. Species inquirenda (FADA 2010). Ceriodaphnia spinata Henry, 1919 AU. Reinstated by D. Berner, 2003. Ceriodaphnia sublaevis Sars, 1894 AU. Species inquirenda (FADA 2010). Ceriodaphnia turkestanica Berner & Rakhmatullaeva, 2001 PA.

The following Table 3.1, is based on the literature for the 14 valid and two reinstated species, comparing the irregularities in distinctive morphological characteristics described and documented by the authors. For detailed analysis of all species see Appendix 3.

Table 3. 1 Disparity and similarity in explanation of taxonomically relevant features for 14 valid and two reinstated Ceriodaphnia in the literature, where √ = Described and X = Not described.

Ocellu

depression

Morphological traits

Head Eye size. Fore head. lenses Crystalline Size Position size Antennule aesthetascs Terminal sensillae Anterior Supraocular Fornix Fenestra Cervial notch Antennae chamber Brood appendage Abdominal setae Abdominal angle Dorsal Postero Post abdomen Anal denticles claw Post Abdominal Pecten shape Reticulation Carapace. carapace of edges Free I to V limb Trunk Ephippium C.cornuta Sars,1885 √ √ √ X √ X √ √ √ X √ X √ √ X √ √ √ √ 8 √ X √ √ √ X X 9 C. acanthina Ross, √ √ √ √ √ √ √ √ X √ √ X √ √ X √ √ √ √ to √ √ √ √ √ X X 1897 11 C. alabamensis X X X X X X X X X X X X X X X X X √ √ √ √ X √ X X X X Herrick, 1883 8 C.dubia (Richard √ √ √ √ √ √ √ √ √ √ √ X √ X X √ √ √ √ to √ X √ X X X X 1897). 10 6 C.lacustris (Birge √ √ √ √ √ X √ √ √ √ √ X √ √ X X X √ √ to √ X X √ X X X 1879). 8 9 C. laticaudata √ √ √ √ √ √ √ X X √ X X √ X X X X √ √ to √ X √ √ √ X X P.E.Müller, 1867. 11 C. megops (Sars 1890). √ X √ X X X √ √ X X √ X √ √ X X √ √ √ 6 √ X √ √ X X X

to 9 C. pulchella Sars, 12 X X √ X X X √ X X X X X √ X X X X X √ X X X √ X X X 1862. 6 √ ( C. quadrangula O.F. to √ √ √ √ √ X √ X X √ √ X √ X X X X √ √ √ X √ √ X I X Müller, 1785. 10 & II ) 7 C. reticulata (Jurine √ √ √ √ X X √ √ √ X √ X √ X X X X √ √ to √ √ √ √ √ X X 1820). 10 C. rotunda (Jurine 7 √ √ √ √ √ X √ √ √ √ √ X X √ X X X X √ √ X X X X X X 1820). 7 C. setosa (Matile √ √ √ X √ X √ √ √ √ √ X √ √ X X X √ √ to √ X √ X √ X X 1890). 12 9 C. silvestrii (Daday √ √ √ √ √ X √ √ √ √ √ X √ X X √ X X √ to √ √ √ X √ X X 1905). 12

C. turkestanica (Berner 6 √ ( to and Rakhmatullaeva √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ √ I X 2001). 8 to V 58

) √ (I C. spinata Henry, 1919 √ X √ √ √ √ √ √ √ X √ √ √ √ X √ √ √ √ 10 √ √ √ √ √ & X II ) √ C. planifrons Smith (I √ X X X X X √ X √ X X X X √ X X X X X X √ √ √ √ & X 1909 II )

a. Ventral side of carapace b. Dorsal side of carapace c. Distal end of post abdomen d. Median e. Proximal end of post abdomen

Fig 3A. Typical morphological structure of a parthenogenetic female Ceriodaphnia, modified from Berner (1986).

Anatomy of Ceriodaphnia

Ceriodaphnia has a cylindrical, flattened or globose body, which is divided into

two parts; anterior (head) and posterior (post cephalic body) (Fig. 3A).

The head is angled downward and comprises the eye, ocellus, antennules,

antennae, fornix, supraocular depression, fenestra, and a cervical notch. Head

size is generally referred to as small or large, a measurement defined in relation

to body length, and head shape as depressed or raised (Fig. 1). The posterior end

of forehead margin sometimes forms a beak like structure (‘beak’ = a rostral

projection) just above antennule as in Ceriodaphnia cornuta Sars, 1885 (Fig. 1c),

or forms a slight angulation as in Ceriodaphnia acanthina Ross, 1897 (Fig. 2b).

Ceriodaphnia has a single black compound eye, which is located near the

anterior distal margin of forehead. Generally it is referred to as small, moderate

or large, a measurement defined in relation with head length. Eye pigment is

surrounded by a row of crystalline lenses, which may or may not project away

from the eye (Fig. 3B).

The ocellus of Ceriodaphnia is a single black spot located between the eye and

antennules; its location and size (pinpoint, oval or pellucid) can be a

distinguishing species characteristic (Fig. 3) (Berner 1986; 1987).

Aesthetascs (Fig. 5) are considered short if the measured length is smaller than

the overall antennule length and vice versa. The antennule also bears anterior

sense hair, which may or may not arise from the peduncle. The peduncle is a

stalk like structure which serves as an attachment for the anterior sense hair, and can arise from any aspect of antennule. Peduncle position and anterior sense hair on antennule can be useful in species delineation (Fig. 5). Sometimes the posterior head surface shows a slight angulation near the antennule base (Fig. 2).

The antennule size is considered long when it crosses or equals the forehead angle and vice versa (Fig. 4).

1c 1a 1b

Fig. 1. Variation in size and shape of head. 1a: Depressed head, C. lacustris Birge, 1893; 1b: Raised head, C. scitula Herrick, 1884; 1c: Beak shaped, C. cornuta Richard, 1894. All figures redrawn from original literature.

2a 2b 2c

Fig. 2. Angulation in the forehead region. 2a: without angulation, C. producta Sars, 1916; 2b: with angulation, C. pulchella Sars, 1862, 2c: forehead with frontal denticles, C. rotunda Sars, 1862. All figures redrawn from original literature. 

3c 3a 3b

Fig. 3. Variation in shape and size of ocellus. 3a: Pin Point, C. producta Sars, 1916; 3b: Oval, C. dubia Richard, 1894; 3c: Pellucid, C. pulchella Paggi, 1986. All figures redrawn from original literature.

4a 4b

Fig. 4. Antennule size. 4a: Small, C. pulchella Paggi, 1986; 4b: Long, C. laticaudata Müller, 1867.All figures redrawn from original literature.

5a 5b

Fig. 5. Peduncle. 5a: Present, C. laticaudata Müller, 1867; 5b: Absent, C. pulchella Sars, 1862. All figures redrawn from original literature. 

6a 6b

Fig. 6. Variation in shape of fornices. 6a: Obtuse, C. producta Sars, 1916; 6b: Acute, C. silvestrii Daday, 1902. All figures redrawn from original literature.

There is a pair of biramous antennae on Ceriodaphnia (Fig. 3B), which have not been studied in detail by most authors. The basal antennal portion is called a basipod, the dorsal portion is divided into two branches, the outer branch is called an exopod and the internal branch is called an endopod. The exopod is four segmented and endopod has three segments bearing numerous setae and short spines; the number of setae can be used for further species characterization.

The fornix is located just above the antenna section and can range from acute to blunt shaped structure (Fig. 6).

Berner (1987) described how the fenestra structure can be used for confirming species discrimination or identiﬁcation. For example, the fenestral structure present in young specimens of the American C. cornuta (s.l.) is lacking in Australian

Ceriodaphnia cornuta (s.str.).

The cervical notch on Ceriodaphnia is a groove like structure located near the antero-dorsal section and separates the head from the body, it can be characterized as deep or shallow (Fig. 7).

The posterior section or body of Ceriodaphnia comprises carapace, trunk appendages, postabdomen, postabdominal claw, abdominal appendages, postabdominal setae, and posterodorsal angle (Fig. 3C).

The carapace of Ceriodaphnia is composed of two valves (bivalve) and encloses entire body except the head. The two valves are fused on the posterior dorsal side, which is also referred to as “midline”, whereas the ventral section is open. The free

edge of the ventral carapace is also referred to as marginal armament, which can be either smooth or serrated. If serrated it signifies the presence of spinules, denticulate hair or setules (Fig. 3C).

The overall carapace shape is an important characteristic feature and can be oval, sub quadrangular or sub spherical with moderately convex dorsal and ventral margins

(Fig. 3C).

1. Cervical notch. 2. Fenestra. Head. 3. Fornix. 4. Supraocular depression. 5. Crystalline lenses. 6. Compound eye. 7. Frons. 8. Ocellus. 9. Anterior sensillae. 10. Peduncle. 11. Terminal. Antennule. 12. Antennule.

Antennae. 13. Coxa. 14. Basipod. 15. Exopod. 16. Endopod. 17. 1st segment of endopod. 18. 2nd segment of endopod. 19. 3rd segment of endopod. 20. Setae.

Antennae. Fig. 3B. Anatomy of Ceriodaphnia. All SEM images are from this study.

Body and carapace. 21. Cardiac bulge. 22. Ecdysial line. 23. Free edge of the ventral carapace. 24. Carapace. 25. Reticulations. 26. Midline. 27. Posterodorsal angle.

Fig. 3C. Anatomy of Ceriodaphnia. All SEM images are from this study.

Postabdomen. 28. Abdominal appendage. 29. Post abdominal claw. 30. Anal denticles. 31. Post abdominal claw with / without a pecten. 32. Setae natatoriae. 33. Setule arrangement on post abdominal claw. 34. Chevrons.

Fig. 3D. Anatomy of Ceriodaphnia, postabdomen. All SEM images are from this study.

Trunk appendage position as defined in this thesis. Abbreviation: TA1 - 5 = Trunk appendages 1 to 5.

Fig. 3E. Anatomy of Ceriodaphnia.

The carapace surface forms a distinct pattern and differs among species. It is generally reticulate, and under high magnification sometimes shows punctuations with or without stippled structure (Fig. 3C). The edges of the reticulations may or may not show an acute V-shaped spines.

For thoracic limbs of Ceriodaphnia, the terminology of Smirnov and Kotov (2009) is followed.

The thoracic limbs of Ceriodaphnia comprise five concordant limbs and each limb is oriented at a certain angle to other limbs (Fig. 3E and Figs 11 to 16). The number and size of setulated setae and soft setae present on the exopodite and endopodite, for each of the appendage vary among the species. Trunk limb I with setulated setae on endites two to five (E2 to E5), ejector hooks situated on the anterior side of the limb

(Fig. 11). Trunk limb II with endites E1 to E5 with setulated and soft setae (Fig. 12).

Trunk limb III with exopodite and five endites (Fig. 14). Trunk limb IV with eight setulated setae (Fig. 15). Trunk limb V with a small sized exopodite bearing setae

(Fig. 16).

The postabdominal form in Ceriodaphnia has wide variation (Fig. 3D) which has been well studied and documented (Berner 1994; Ekman 1900; Greenwood, Green et al. 1991; Langhans 1911; Lilljeborg 1900b; Paggi 1986; Sars 1901).

The number of anal denticles has traditionally been considered a key characteristic feature, despite evidence reported in literature showing numbers do vary within a population in C. dubia Richard (1894), for example eight to ten anal denticles. The

anal denticles are either crescent or recurved shaped, size variation is observed from the distal (near postabdominal claw) to the proximal end (away from the postabdominal claw). In some cases, there are fine hair like projections (setules) present near the spines (Fig. 8).

The posterior dorsal side of the postabdomen has a crescent shaped arrangement of fine hair referred to as “chevrons” arranged in rows. The number of chevrons can be used as distinctive features but no detailed data are available for Ceriodaphnia (Fig.

8).

The postabdominal claw is situated at the distal end and is a hook like structure, with the outer side of the claw having a series of fine setules. In early descriptions, the postabdominal claw was referred to as “smooth”, however this may be due to low microscopic magnification failing to discriminate the fine setules. Thick setules

(stouter) forming a comb like structure is referred to as pecten (Fig. 9). The abdominal appendage is positioned on the proximal end of the postabdomen, and varies in number, size and shape (Fig. 8 (ii)). The abdominal setae (setae natatoriae) are bisegmented and arise from the proximal corner of the postabdomen (Fig. 3D).

7a 7b

Fig. 7. Variation in groove on cervical notch. 7a: Shallow groove, C. pulchella Lilljeborg, 1901; 7b: Deep grove, C. dubia Richard, 1894.  All figures redrawn from original literature.     ii ii ii ii i 8a 8c i 8b i i 8d

Fig. 8. Variation in (i) Base of postabdomen. (ii) Abdominal appendage. 8a: (i) Flat base,C. dubia Richard, 1894; 8b: (i) Curved, C. quadrangula Müller, 1785; 8c: (i) Boat shaped, C.laticaudata Paggi ( 1986); 8d: (i) Convex or Ax shaped, C.laticaudata Müller, 1867, 8e: three needle like spines at posterior anal aperture, C. pulchella Sars, 1862. All figures redrawn from original literature.

9a 9b 9c

Fig. 9. Postabdominal claw with pecten: shape and size variation. 9a: Thin and long comb shaped,C.silvestrii Daday, 1902; 9b:

Thin and long closely packed,C. dubia Richard, 1894; 9c: Thick and long, C.turkestanica Berner and Rakhmatullaeva, 2001. All figures are redrawn from original literature. 

Midline

10a 10b 10c

Fig.10. Variation in shape of posterodorsal angle. 10a: Mid line and acute posterodorsal angle, C. carolinensis Coker, 1926; 10b: Acute, C.cornuta Sars, 1885; 10c: Blunt, C. pulchella Sars, 1862. All figures are redrawn from original literature.

Figs 11 and 12. Trunk appendages I and II.Line drawings for trunk appendages are contributed by current author.

13 14

Figs 13 and 14. Trunk appendages II and III. Line drawings for trunk appendages are contributed by current author.

15 16

Figs 15 and 16. Trunk appendages IV and V. Line drawings for trunk appendages are contributed by current author.

The posterodorsal angle is the junction of the dorsal and ventral margins of the carapace and is either blunt or an acute spine shaped structure. Position of the posterodorsal angle could be important and is referred through the midline of the body. Sometimes the posterodorsal angle shows spines on the outer surface, termed as spinulated (Fig. 10).

It should be noted that not all the characteristics listed above could be compared for all taxa due to lack of or inconsistencies in taxonomic precision in original species descriptions (see Table 3.1 above for the 14 valid species).

Key to species of Ceriodaphnia The following dichotomous key should serve to differentiate the eight described species of Ceriodaphnia from Australia (Modified from Shiel, 1995 and Kořinek, 2002).

1. Head with an acute rostrum (Fig. 1c); adult small (<0.5mm)...... C. cornuta Sars, 1885 Head without acute rostrum (Fig. 2b), adult large (> 0.5mm)...... 2 2. Head with frontal denticles (Fig. 2c) ……...... 3 No frontal denticles (Fig. 2b) ……………...... 5 3. Forehead slightly angulated and almost forming a right angle in front of antennules (Fig. 2b) ………………...... 4

Forehead non-angulated and with presence of protruding tiny spines (Fig. 2c) ……………………………………..………………….C. rotunda Sars, 1862 4. Three needle like spines posterior to anal aperture (Fig. 8e) ……C. pulchella Sars, 1862. 5. Three needles like spines on post abdomen absent (Fig. 8a) ...... 6 6. Post abdomen broad and large with securiform or axe-shaped structure appearance (Fig. 8c) ………………………………… C. laticaudata Müller, 1867

Not as above (Fig. 8b) ...... 6 7. Middle pecten of post abdominal claw with fine setules present (Fig.9a)...... ………………………………………………………7

Middle pecten of post abdominal claw with fine denticles present (Fig. 9c)... ……………………………….... C. dubia Richard, 1894

8. Line of fine spinules ‘punctuated’ with spines on posterior valve margin absent...... C. quadrangula Müller, 1785

Line of fine spinules ‘punctuated’ with spines on posterior valve margin absent...... 8

9. Three setae present on endite 4 of trunk limb 1 and 5 brush setae on gnathobase of trunk limb 2 ...... C. spinata Henry, 1909

Two setae present on endite 4 of trunk limb 1 and 4 brush setae on gnathobase of trunk limb 2 ...... C. planifrons, Smith 1909

Results

Genus Ceriodaphnia Dana, 1853.

Ceriodaphnia Dana, 1853: 1273; Müller, 1868: 125; Schoedler, 1877: 19; Winchell,

1883: 35; Stingelin, 1896: 211; Lilljeborg, 1900: 183; Lilljeborg, 1901: 675; Smith,

1909: 80; Sars, 1916: 315; Henry, 1922: 32.

Type species: Ceriodaphnia quadrangula (O.F. Müller, 1785)

Ceriodaphnia quadrangula (O.F. Müller, 1785)

Ceriodaphnia quadrangula, Lilljeborg, 1901: 193; Sars, 1916: 36; Nachtrieb, 1895: no description, Plate No. XLI. Fig. No. 16 to 18. Type material. Australia. AMS P.4327. Type locality. Australia. Corowa, NSW.

Specimens identified as Ceriodaphnia quadrangula Müller, 1785 Material examined. Australia. Corowa, NSW, no other data, AMS P.4327, China. Soochow, no other data, USNM 59382 (100 specimens in ethanol), Germany. Tiergarten, Berlin, no other data, NMCL 5533; Brandenburg, no other data, NMCL 10690; Grunewald See, 1898-08-05, no other data, NMCL 10691; Brandenburg, no other data, NMCL 11912; Brandenburg, no other data, NMCL 16047, Japan, no other data, NMCL 15434 and NMCL 15492, Norway, no other data, NHMUO F19361 (in ethanol), AMNH 4576 (slide collection); 17474 (in ethanol), South Africa. Cape of Good Hope, no other data, NHMUO F9269 (slide collection).

Brief diagnosis.

Valves of carapace end in posterior angle or a short spine. Head small, depressed and separated from body by a deep cervical groove. Carapace marked by polygonal pattern. Antennules in female not freely movable. Ocellus always present.

Ephippium triangular, containing more than one egg.

Ceriodaphnia dubia Richard, 1894, p. 570-572.

Figs 6-8

Ceriodaphnia dubia Richard, 1894: 570; Delachaux, 1917: 80; Sars, 1916:

317; Berner, 1986: 16 ; Greenwood et al. 1991: 285.

Syn Ceriodaphnia affinis Lilljeborg, 1901: 675.

Syn Ceriodaphnia limicola Ekman, 1900: 70.

Syn Ceriodaphnia acuminata Ekman, 1900: 69.

Syn Ceriodaphnia richardi Sars, 1901: 21.

Type series. Type locality. “lac Toba”, N Sumatra, Indonesia.

Type material: David G. Frey (DGF) collection housed in Smithsonian

Institution’s Museum Support Center in Suitland, Maryland, U.S.A.

“According to the hand written catalogue, sample DGF 723 was from “Balige

(Lac Toba, Sumatra)”, coll. in 1891-11-24 by M. E. Modigliani. However,

according to the label, this sample is from Lake Titicaca and collected in

1969. So, the initial sample with number 723 is no longer present in the

collection, and there are no other samples from Lake Toba in Richard’s

collection " (Kotov and Ferrari, 2010).

Specimens identified as Ceriodaphnia dubia Richard, 1894.

Material examined. Australia. Victoria, no other data, NHMUO F19258 (in ethanol). Central Africa. Lake Victoria, no other data, NHMUO F9309 (slide collection). Indonesia. Lake Toba, Sumatra, 1891–02–24, Frey, D. G. USNM

1120420 (100 specimens in ethanol), South Africa. Cape of Good Hope, no other data, NHMUO F9266 (slide collection); Cape of Good Hope, no other data,

NHMUO F9267 (slide collection).

Specimens identified as Ceriodaphnia affinis Lilljeborg, 1901

Material examined. Australia. Slide of a dissected parthenogenetic female from

Parramatta Lake near Sydney, NSW (33°47’26” S/ 151°00’28” E). Dr John Chapman

(Office of Environment and Heritage, NSW, Sydney) collected this species in 1986 from

Parramatta lake in Sydney and since then has been cultured and maintained in a laboratory

(Moreno Jully, OEH NSW, personal communication, 23rd June 2014). Sample specimens of the species were provided by Dr Tsuyoshi Kobayashi (OEH, NSW) on 26-10-2010. Genetic

Reference No: COI + 16s = SYDCB001 – 05. Five ephippial females (undissected) stored in a vial containing 70 % denatured alcohol deposited in the SAM, accession number SAM

C7024. Germany. Umgebung von Berlin, Hartwig, no other data, NMCL 11913,

Sweden. Blekinge, Sturberg, no other data, NHMUO F9583 (slide collection);

Blekinge, Sturberg no other data, NHMUO F18489a (in ethanol) and NHMUO

F18489b (in ethanol).

Antennules short, anterior sense hair arising from small peduncle, one-third to one- half the distance from apex, anterior sense hair longer than antennule body or aesthetascs. Ridge of cuticle encircles rostral pore. Fornices smoothly rounded without lateral extensions, with a minute spine at broadest portion. Coxal portion of antennae folded, with one to two sensory setae. Surface of basipod with six to nine irregular rows of fine spinules varying in length and thickness. Posterior ventral carapace margin with an inner row of fine spinules punctuated partially or entirely

with 10 to 12 spines and with one to three short, heavier, plumose spines dorsally, about 40 % of the distance below posteroventral margin.

Trunk limb I with setulated setae on endites two to five (E2 to E5). Two ejector hooks situated on anterior side of limb. Trunk limb II with five endites E1 to E5 consisting of seven setulated setae and two soft setae. Trunk limb III with one exopodite and five endites. Trunk limb IV with eight setulated setae. Trunk limb V with a small sized exopodite with five setae of which three are long and two small in size.

Postabdomen slightly tapered and obliquely truncated distally, with setules of proximal group short and slightly lighter in weight than those of distal group. Middle pecten of claws with 21 long and stouter teeth.

Description: Parthenogenetic female. Length of ovigerous females: 1 to 1.4 mm. Shape, lateral aspect: ovoid, length about 1.5 times height (depending on number of eggs in brood chamber) (Fig. 17A). General appearance delicate and pellucid.

Head. Small, 4.8 to 5.6 times in body length, moderately depressed and with supraocular depression; frons in line with a tangent to anterior ventral margin of valve, decorated with faint, slightly elongated polygonal reticulations (Fig. 17B).

Lappets of edges heavier, nearly circular polygons anterior to antennules may appear as spines from lateral aspect (Fig. 17C). Ridge of rostral area anterior to antennules bordered by a heavy line of contiguous meshes, central one encircling rostral pore

(Fig. 17B). Socket of antennule bounded posteriorally by a strong, lateral arch of

integument (Fig. 17D). Antennule long, round and cylindrical with 10 aesthetascs as long as antennules. Antennules extend beyond line of head, anterior sensory seta long, arising from a distant peduncle one-third distance above apex of antennule

(Fig. 17D). Eye moderately large, 2.1 to 2.6 times in head length, nearly filling anterior-ventral portion of head lenses prominent, width about half the distance between the base of antennule and lower margin of supraocular depression. Ocellus ovoid, positioned midway between eye and antennule. Cervical notch distinct.

Carapace. Nearly circular from lateral aspect. Surface of valves distinctly reticulated with relatively large, polygonal mesh (Fig. 18A). Ventral margin raises gradually, anteriorally to a steeper curve adjacent to the antennules and curves evenly posteriorally and dorsally to a high posterodorsal angle which is only slightly produced into an obtuse angle. Reticulation evenly sized polygonal in shape with heavy edges and dotted surfaces. Ventral margin with a sub marginal inner row of setae that commences anteriorally on lower part of steep curve with 10 short, non- plumose setae.

D E

Fig. 17. Anatomy of Ceriodaphnia dubia, Parramatta, Sydney, NSW. A: Lateral view; B: Head and Antennule; C: Lappets of circular polygons; D: Antennule; E: Antennae.

A B

Fig. 18. Anatomy of Ceriodaphnia dubia (carapace), Parramatta, Sydney, NSW. A: Polygonal meshes on the surface of carapace; B: Blunt posterodorsal angle.

A B

Fig. 19. Anatomy of the carapace edge of Ceriodaphnia dubia, Parramatta, Sydney, NSW. A: Arrangement of spine like setae on the edge of the carapace; B: Arrangement of short pennate spines.

Periphery of antero ventral carapace with arrangement of fine setules. Posterior margin with a submarginal line of fine spinules running dorsally to posteriodorsal angle, interrupted by 12 short pennate spines at about 60 to 70 % of distance towards posterodorsal angle, and punctuated fine spines at regular intervals between intermediate spine like setae and pennate spines (Figs 19A and B).

Coxal portion of antenna folded and supplied with two sensory setae. Basipod with a cluster of long spines on dorsal margin distal to basal setae. Surface of basipod with nine irregular rows of fine spinules, length and thickness varies among population.

Spine on ventrolateral end of basipod projects slightly over first segment of exopod.

Terminal, inter-ramal seta of basipod arises from a projection and is half the length of first endopodal segment. Second segment of exopod with clusters of fine hair on medial surface. Terminal segment of endopod with two clusters of hair on lateral surface (Fig. 17E).

Trunk limb I (Fig. 20) with setulated setae on endites two to five (E2 to E5). Endite 2 with four setulated setae (ss1 to ss4) and one soft seta or also called as sensillium

(sn1); first setulated seta being shortest (ss1), second seta (ss2) is 1.5 times longer than previous, third seta (ss3) slightly longer than second and fourth seta (ss4) is longest of the rest. Soft seta (sn2) of E2 is at proximal end. Endite 3 of trunk limb I with two setulated setae (ss5 and ss6) and one soft seta (sn3), first setulated seta is slightly smaller than second. Endite 4 with two setulated setae (ss7 and ss8) and one soft seta (sn4). Endite 5 with one-setulated seta (ss9) and one soft seta (sn5).

Exopodite with two long setulated setae (ss10 to ss11). Anterior side of the limb with two ejector hooks (Ejh1 and Ejh2) (Fig. 20).

Trunk limb II (Figs 21 and 22) with five endites E1 to E5. E1 with one long serrated seta (Ses1) and one smaller soft seta (sn1) followed by five bud like setules (gn1 to gn5) and ends in three soft setae (gn6 to 8) and a small gnathobase. E2 with one long setulated seta (ss1), E3 with one short smooth seta (sn2); E4 with one setulated seta

(ss2) and one soft seta (sn3). Exopodite with two long setae, anterior end one slightly smaller than posterior (ss3 and ss4).

Trunk limb III (Fig. 23) exopodite consists of four setulated setae on distal end and one small setulated seta on lateral end. There are five endites on trunk limb III of which endites 1 to 4 are highly reduced and endite 5 bears a number of gnathobasic filtering setae (47 to 51 setae).

Trunk limb IV with six setulated setae (ss1 to ss6) distal end one is smallest, followed by three equal sized setulated setae that are equidistant. Posterior end with one long and one short seta. Distal end of trunk limb IV with fine hair like projections arising from base. Endite consists of only gnathobasic filtering setae (30 to 35 setae).

Trunk limb V (Fig. 24) with a small sized exopodite bearing five setae of which ss1 and ss4 are long and of almost equal size. Compared with ss4, ss2 and ss3 are almost

1/3rd in size. Basal portion of ss3 seta shows three smaller spine-like structures arising from a small rounded armature on dorsal side. Fifth seta (ss5) is smallest of all arising from dorsal side of trunk limb V (Fig. 24).

Postabdomen (Fig. 25). First abdominal appendage is developed, more distal ones are reduced and with rows of short hair extending into lateral surface. Abdominal

setae bi-segmented with small patches of short setules on lateral surface that are about as long as the distance from their insertion to base of the claws. Dorsal margin is nearly parallel to ventral margin about half way distally then obliquely truncated with seven anal denticles lying in a crescent shape. Denticles slightly recurved (Fig.

26A); distal ones shorter compared to all other denticles. Five rows of fine, submarginal spinules arranged in crescent shape pattern called chevrons, each crescent with a finite number of spinules (Fig. 26B) and one or more scattered, stouter spinules laterally near base of the claws. Claw length almost 1/3rd smaller than length of abdominal setae. Top of claw has 19 fine long setules. Distal lateral pecten with fine spinules, terminal ones long and sometimes curled ventrally across tip, middle pecten with 21 stouter and slightly shorter spinules (Figs 26C and D), compared to proximal pecten usually with fine spinules longer than those of distal pecten(Figs 26A and E).

A B I II

III

C D

Fig. 26. SEM of Postabdomen of C. dubia. A: Anal claw and anal denticles; B: Post abdomen with chevrons; C: Middle pecten; D: Middle pecten with 21 stouter and shorter spinules.

E III

Fig. 26 contd…. SEM of Postabdomen of C. dubia. E: Terminal pecten with thin and longer setules.

Distribution. Australia; Brazil; Bergvliet (South Africa); Norway; Nyanza

(Kenya); New Zealand; Indonesia (Sumatra); USA.

Comments. Berner’s (1986) study of Ceriodaphnia cultures used by the US EPA as biological indicators for determining the quality of ambient water, revealed phenotypic variation in C. dubia. There were two species of C. dubia within the stock culture one with a toothed pecten variety (Fig. 9.13, Appendix 3) and the other with fine heavy setules (Fig. 9.9, Appendix 3). The shape and other characteristics of both the species are mostly the same, with following exceptions; toothed pecten variety (Figs 9.10 to 9.13, Appendix 3) showed reticulation on the carapace and head with deep edges and variation in forms of the central pecten on the postabdominal claw. In Form 1 the pecten has 18 to 24 heavy fine setules (Fig. 9.9, Appendix 3) slightly longer than adjacent groups similar to that of C. dubia Richard (1894), in the 2nd form the central pecten showed 7 to 14 close of ovately tapered denticles (Fig. 9.13, Appendix 3). The variation in the toothed pecten variety of C. dubia according to Berner (1986) was due to contamination with the original C. reticulata culture. Postabdomens of C. reticulata and C. dubia are similar except for pectation on the claw of C. dubia. Also emphasized in her report, this toothed pecten variation of C. dubia was observed only under controlled environmental and nutritional conditions and, hence, she recommended carrying out specific tests on interspecific breeding and nutrition to confirm polymorphism in the species. The description of C. dubia from New Zealand by Greenwood et al. (1991) is similar to the description of C. dubia Form 1 toothed pecten variety with a central pecten on the claw showing 18 to 24 finely setules, which are slightly longer than those of the adjacent setules ( Berner, 1986).

Ceriodaphnia spinata Henry, 1919 (Plate No. XL)

Figs 1 and 2

Ceriodaphnia spinata Henry, 1919: 466.

Type material: Holotype AMP 27728 (1 ovigerous female).

Type series. Type locality. "Corowa", Australia.

Non Type material. Australia. Victoria, Thornton, 1998-10-09, USNM 1121570

(5♀ in isopropyl alcohol); 1121571 (6♀, in isopropyl alcohol); 1 female, Golburn

Billabong, Alexandria, Victoria, Australia, 06.08.1974 (AMP 27728); Five ephippial females each from South Para, Myponga Reservoirs, Mannum and Snuggery

Adelaide, SA; one parthenogenetic female from Mannum SAMAN001

(36°16'29.99"S S/ 139°54'40.41"E), SA, sample collected by the author on 15 – 02 –

2009, deposited in SAM. Genetic Reference: COI + 16s = SAMAN001 - 02,

SASNU001. Five ephippial females from Mandina (undissected) stored in a vial containing 70 % denatured alcohol deposited in SAM, accession number

SAMC7572.

Diagnosis: Parthenogenetic female. The holotype (P: 4327) is a mounted slide of ovigerous female. The second slide- mounted specimen (P: 27728) of same length, from Goulburn Billabong is poorly preserved. Smirnov and Timms (1983) reported the total length of females in the range 0.8 to 1.2 mm.

Head. Small, 5 to 5.5 times in body length, moderately depressed with absence of supraocular depression and presence of irregular polygonal reticulations (Figs 28A and B). Edges or nodes of these reticulations are an acute V-shaped structure (Fig.

28D) along with flat round pore located at the centre of the antennules. Cervical notch shallow. Eye moderately large size, 1.8 to 2.5 times in head length, lenses

prominent. Antennules long, anterior sense hair rise from small peduncle which is approximately half distance from apex, anterior sense hair longer than either antennule body or aesthetascs (Fig. 28B). Fornix smooth with small denticles at broadest portion. Coxal portion of antennae folded, with two sensory setae; lateral basal section of basipod with seven to ten plumose setae. Basipod surface with eight to ten irregular rows of fine spinules varying in length and thickness (Fig. 28C).

Anterior end of inner ventral edge of carapace shows a series of short smooth setae placed at regular intervals followed distally with 8 to 11 long flexible setules (Figs

29C, 30C and 30D). Row of fine thin spines continues and ends at tip of posterodorsal angle (Fig. 30B). Around 1/3rd of posterior end of carapace shows spines projecting from its edge (Figs 29D and 30E). Posterodorsal angle pointed and spiny (Fig. 29E).

A B C

Fig. 27. The three panels of this figure demonstrate variation and similarity in gross morphology of Ceriodaphnia species. A: C. spinata (AMS: P4327); B: C. quadrangula (NHMUO: F8517) and C: C. spinata (SAMAN001) from Mannum, Adelaide, SA.

100

A B

C D

Fig. 28. Anatomy of Ceriodaphnia spinata. A: Whole body; B: Antennule; C: Basipod; D: Flat round pore.

101

A B

C D

Fig. 29. Anatomy of Ceriodaphnia spinata. A: Fornix smooth small denticles; B: Hexagonal reticulation on carapace; C: Setules on edge of ventral carapace; D: Rows of spine projecting from carapace edge

102

Fig. 29. Contd Anatomy of Ceriodaphnia spinata. E: Acute postero dorsal angle.

Trunk limb I with setulated setae on endite 2 to 5 (E2 to E5). Trunk limb II with five endites E1 to E5. Trunk limb III exopodite with three setulated setae on distal end and one small setulated seta on lateral end. Trunk limb IV with four setulated setae in distal end and posterior end has a single seta. Trunk limb V with a small sized exopodite bearing three setae of which distal and proximal ones are longest compared to middle seta.

Postabdomen almost half the length compared to maximum body width. Distal end slightly concave and base curved, with setules of proximal group shorter and thinner than distal group. Postabdomen provided with eight to nine recurved anal denticles.

Description: Parthenogenetic female. Length of ovigerous females: 0.75 mm to 0.95 mm. Shape, lateral aspect: ovoid, length about 1.5 times height (depending on number of eggs in brood chamber), width of head is about half maximum body width. General appearance delicate and pellucid.

Head. Small, 5 to 5.5 times in body length, moderately depressed with absence of supraocular depression. Forehead prominent, rounded with irregular polygonal

103

reticulations, fornix shows small smooth denticles (Fig. 29A). Edges or nodes of these reticulations are an acute V-shaped structure (Fig. 28D). Posterior end of forehead does not form angulation above antennule. Socket of antennule bounded posteriorally by a strong, lateral arch of integument (Fig. 28C). Antennule short and cylindrical with nine aesthetascs as long as antennules and just reaches line of head, anterior sensory seta long, arising from a distant peduncle approximately half from a distance above apex of antennule (Fig. 28B). Eye moderately large, 1.8 to 2.5 times in head length, nearly filling anterior-ventral portion of the head, eye lenses prominent, width about half the distance between base of antennule and lower margin of supraocular depression. Ocellus ovoid, positioned nearer to eye than antennule. Cervical notch distinct but shallow.

Carapace. Oval shape, dorsal and ventral margin of carapace is evenly curved (Fig.

28A). Surface of carapace distinctly reticulated with relatively large raised hexagonal meshes. Edges of polygon meshes do not show an acute V-shaped raised structure like spines (Fig. 29B). Leading edge of carapace margin has bristles or spines, while anterior end of ventral side shows a row of short smooth setae placed at regular interval followed distally by 8 to 11 long flexible setules (Fig. 30D). After this series of long flexible setules follows a row of fine thin spines that finishes into the tip of the posterodorsal angle tip. Posterodorsal angle is acute and shows presence of spines on its surface (Fig. 29E).

104

A B

C D

Fig. 30. Anatomy of ventral edge of the carapace of C. spinata.

105

Coxal portion of antenna folded and supplied with two sensory setae. Lateral basal portion of basipod with 8 to 10 plumose setae. Surface of basipod with 8 to 10 irregular rows of fine spinules whose length and thickness varies among population.

Spine on ventrolateral end of basipod projects slightly over first segment of exopod.

Trunk limb I (Fig. 31) with setulated setae on endites 2 to 5 (E2 to E5). Endite 2 with four setulated setae (ss1 to ss4) and one soft seta (sn1), first setulated seta being shortest, second seta is 1.5 times longer than previous, third seta slightly longer than second, and fourth seta is longest of the rest. Endite 3 of trunk limb one with two setulated setae (ss5 and ss6) and one soft seta (sn2) arising from ventral side, second setulated seta is slightly smaller than first. Endite 4 with two setulated setae (ss7 and ss8) of almost equal length and one soft seta (sn3), which is half of the size of setulated seta. Endite 5 with three soft setae (sn4, sn5 and sn6). Exopodite with one long setulated seta and one small soft seta arising from posterior end. Anterior side of limb with two ejector hooks (Ejh1 and Ejh2).

106

107

Trunk limb II (Fig. 32) with five endites (E1 to E5). E1 with one long and one short setulated setae (ss1 and ss2) followed by five bud like setules (gn1 to gn5) and ends with two soft setae (sn1 and sn2) and a small gnathobase. E2 with one long setulated seta (ss3), E3 absence of setae, E4 with one short smooth seta (sn3) and one setulated seta (ss4), soft seta measures approximately half of setulated seta, E5 with two setulated setae (ss5 and ss6) anterior slightly smaller than posterior setules.

Exopodite with two long serrated setae (ss7 and ss8) anterior one slightly smaller than posterior.

108

109

Trunk limb III exopodite with three setulated setae, on distal end and one small setulated setae on lateral end. Trunk limb III with five endites, of which endites 1 to

4 are highly reduced and E5 bears a number of gnathobasic filtering setae (50 to 60 setae).

Trunk limb IV exopodite with six setulated setae. At the distal end, there are four setulated setae of which distal end is smallest, followed by two equal sized setulated setae, separated by a definite distance. Posterior end with one short seta and one long seta, which is almost twice in size of the former. Distal and proximal ends of trunk limb IV shows fine hair like projections arising from base. Endite consists of only gnathobasic filtering setae (35 to 40 setae).

Trunk limb V (Fig. 33) with a small sized exopodite bearing three setae of which two are long (ss1 and ss3) and one small in size (ss2).

110

Postabdomen. First abdominal appendage is developed (Figs 34 and 35), distal ones are reduced and with rows of short hair extending into lateral surface. Abdominal setae bi-segmented with small patches of short hair on lateral surface. Dorsal margin nearly parallel to ventral margin about half way distally and then obliquely truncated with 8 to 10 anal denticles lying in a crescent shape (Fig. 35A). Denticles slightly recurved; proximal ones are shorter compared to all other denticles (Fig. 35B). Five to seven rows of fine, submarginal spinules arranged in crescent shape patterns. Total claw length is almost one-third in length of post abdomen. Claws are curved and show presence of spinules which are thin and of equal length (Fig. 35C).

111

A B

Fig. 35. SEM of postabdomen of C. spinata. A: Postabdomen; B: Anal denticles with presence of chevrons; C: Postabdominal claws.

Comments. Henry’s, 1919 description of C. spinata was relatively inadequate and did not mention differences in trunk appendages, because at that time trunk appendage features were not know for most other species. This species somewhat resembles C. reticulata in general shape but differs by not having a pecten on the postabdominal anal claw.

112

C. sp. 1

Holotype. Slide of a parthenogenetic female, Yanga lake, Sydney, NSW

(34°42'19.04° S, 143°35'30.73"E). Collected by Dr T. Kobayashi (OEH, NSW) on

2010-10-26 (SAM C7551).

Material examined. Australia. Five parthenogenetic females from Yanga Lake near

Sydney, NSW (34°42'19.04° S / 143°35'30.73"E) in a vial containing 70 % denatured alcohol deposited in SAM, accession number SAM C7551. Barcode

Reference: COI + 16s = NSYAN001 – 02, NSSTE002, NSMER003 - 05.

Diagnosis: Parthenogenetic female. Head small, 3.9 to 4.33 times in body length and moderately depressed with a shallow supraocular depression and irregular polygonal reticulations over frons. Cervical notch shallow. Eye large in size, 1.9 to 2.25 times in head length, lenses prominent. Antennules long, anterior sense hair arises from small peduncle one-third distance from apex, anterior sense hair longer than either antennule body or aesthetascs. Fornices smoothly rounded with lateral extensions, spine at broadest portion. Coxal portion of antennae folded, with two to three sensory setae. Basipod surface with 8 to 10 irregular rows of fine spinules varying in length and thickness. Anterior end of ventral edge shows a row of 12 to 15 short smooth setae placed at regular intervals followed distally by 13 to 15 long flexible setules.

This series of long flexible setules is followed by a row of fine thin spines and interrupted with fine spiniform setules rising parallel from the edge.

Trunk limb I with setulated setae on endites 2 to 5 (E2 to E5). Trunk limb II with five endites E1 to E5. Trunk limb III exopodite with four setulated setae on distal end and

2 small setulated setae on lateral end. Trunk limb III with five endites, of which endites 1 to 4 are highly reduced and E5 bears a number of gnathobasic filtering

113

setae. Trunk limb IV with five setulated setae at distal end. Posterior end with two setae. Trunk limb V with a small sized exopodite bearing three setae of which two are long and one smaller in size.

Postabdomen almost half in length (318 µm) compared to maximum body width

(630 µm). Distal end slightly concave and base straight, with setules of proximal group short and slightly lighter in weight than those of distal group. There are 10 recurved anal denticles.

Description: Parthenogenetic female. Length of ovigerous females: 0.9 to

1.2 mm. Shape, lateral aspect: ovoid, length about 1.5 times height (984 µm)

(depending on number of eggs in brood chamber), width of head (322 µm) is about half of the maximum body width (630µm). General appearance delicate and pellucid.

Head. Small, 3.9 to 4.33 times in body length, moderately depressed and with a supraoptical depression (Fig. 36). Forehead prominent, rounded with smooth surface.

Posterior end of forehead forms a slight angulation above antennule. Socket of antennule bounded posteriorally by a strong, lateral arch of integument. Antennule short and cylindrical with nine aesthetascs as long as antennules. Antennules just reaches line of head, anterior sensory seta long, arising from a distant peduncle one- third distance above apex of antennule. Eye moderately large, 1.9 to 2.25 times in head length, nearly filling anterior-ventral portion of head, lenses prominent, width about half the distance between base of antennule and lower margin of supraocular depression. Fornices rounded and smooth. Ocellus ovoid, positioned nearer to eye than antennule. Cervical notch distinct but shallow.

114

Fig. 36. Lateral view of C. sp.1.

Carapace. Suboval in shape. Its surface distinctly reticulated with relatively large, polygonal meshes (Fig. 37B). Leading edge of carapace margin has no bristles or spines, while anterior end of ventral side with a row of 15 short smooth setae placed at regular intervals followed distally by 15 long flexible setules. After this series of long flexible setules there follows a row of fine thin spines interrupted, by fine spiniform setules rising parallel from the edge (Figs 37A, 37C, and 37D). Row of fine thin spines continues and finishes at tip of posterodorsal angle (Fig. 37E).

Posterodorsal angle smooth with blunt tip and absence of spine on its surface.

115

A B

D E

Fig. 37. Ventral edge of carapace of C. sp. 1.

Coxal portion of antenna folded, with two sensory setae. Basipod with a cluster of long spines on dorsal margin distal to basal seta. Surface of basipod with 10 irregular rows of fine spinules whose length and thickness varies among population. Spine on ventrolateral end of basipod projects slightly over first segment of exopod. Terminal, inter-ramal seta of basipod arises from a projection and is half the length of first endopodal segment. Second segment of exopod with clusters of fine hair on medial surface. Terminal segment of endopod with two clusters of hair on lateral surface.

116

Trunk limb I (Fig. 38) with setulated setae on endites 2 to 5 (E2 to E5). E2 with four setulated setae (ss1 to ss4), first setulated seta being shortest, second seta is 1.5 times longer than previous, third seta slightly longer than second and fourth seta. Endite 3 of trunk limb 1 with two setulated setae (ss5 and ss6), first is slightly smaller than second seta and one soft seta (sn1). E4 with two setulated setae (ss7 and ss8) and one soft seta (sn2). E5 with one-setulated seta (ss9) and two soft setae (sn3 and sn4).

Exopodite with one long setulated seta (ss10) and one small soft seta (sn3) arising from posterior end. Two ejector hooks (Ejh1 and Ejh2) situated on anterior side of limb.

Trunk limb II (Fig. 39) with five endites E1 to E5. E1 with one long setulated seta

(ss1) and one smaller soft seta (sn1). E2 with one long setulated seta (ss2), E3 with one short smooth seta (sn2), E4 with two setulated setae (ss3 and ss4) anterior slightly smaller than posterior setule. Exopodite with two long serrated setae (Ses5 and Ses6) anterior slightly smaller than posterior followed by five buds like setules

(gn1 to gn4) and ends with three soft setae (gn6 to gn8) and a small gnathobase.

Trunk limb III (Fig. 40) exopodite with four setulated setae (ss1 to ss4) on distal end and two small setulated setae on lateral end. Trunk limb III with five endites, endites

1 to 4 are highly reduced and E5 bears a number of gnathobasic filtering setae (51 setae).

Trunk limb IV (Fig. 41) with five setulated setae (ss1 to ss5) distal end is smallest, followed by two equal sized setulated setae, which are separated by a certain distance. Posterior end with one long and one short seta. Distal and proximal end of

117

trunk limb IV shows fine hair like projections arising from base. Endite consists of only gnathobasic filtering setae (35 setae).

Trunk limb V (Fig. 42) with a small sized exopodite bearing four setae of which proximal and distal setulated setae are long and almost equal in size, whereas in between are two short setulated setae which are nearly one-third of total size of distal setulated setae.

118

119

120

Postabdomen. First abdominal appendage is developed, more distal ones are reduced and with rows of short hair extending into lateral surface. Abdominal setae bi- segmented with small patches of short hair on lateral surface. Dorsal margin nearly parallel to ventral margin about half way distally then obliquely truncated to 10 (and two short hair like projection) anal denticles lying in a crescent shape. Denticles slightly recurved, proximal ones are shorter compared to all other denticles. Five to seven rows of fine, submarginal spinules arranged in crescent shape patterns (Fig.

44b). Total claw length is almost third smaller than length of postabdomen. Claws curved with presence of setules (Figs 44C and D). Distal lateral pecten with fine spinules, terminal ones long and sometimes curled ventrally across tip; middle pecten with heavier and slightly longer spinules, compared to proximal pecten usually with fine spinules longer than those of distal pecten (Figs 43 and 44A).

121

A B

C D

Fig. 44. Postabdomen of C. sp.1. A: Postabdomen; B: Anal denticles with chevrons; C: Postabdominal claw; D: Postabdominal claw with pecten.

122

Table 3.2. Comparisons of selected morphological characters of eight Ceriodaphnia spp. - = no information available.

Character C. dubia C. spinata C. sp. 1 C. quadrangula C. laticaudata C. rotunda C. pulchella C. dubia (N= 5) (N= 5) (N= 5) (Müller, 1785) Müller, 1867 Sars, 1862 Sars, 1862 Richard, 1894 Size of adult female ( mm) 1 – 1.4 0.75 – 0.95 0.9 – 1.2 0.5 – 0.9 0.7 - 1 0.8 – 1 0.5 – 0.86 0.7 - 1 Row of fine Approx. 1/3rd Long flexible Is acute and Long flexible Is convex Row of thin - spinules of the posterior setules followed spine shaped. setules shaped with hairs continues punctuated end shows by a row of fine followed by a clear and till the rear partially or spines thin spines row of fine thin coarse edge, where it entirely with projecting interrupted in spines reticulation reaches to its 10 to 12 from the edge between with interrupted in and serrated highest point spines. of the fine spiniform between with spines at the near the carapace. setules rising fine spiniform edge of the junction of the Posterior margin parallel from the setules rising carapace. It posterodorsal of carapace edge. parallel from ends on angle. the edge. posterior side Posterodorsal at a angle shows posterodorsal presence of angle with spine which is blunt spine laid almost parallel to its edge Evenly sized Distinctly Distinctly Coarser Is irregular in Thick regular strong cross- polygonal in reticulated reticulated with reticulation on shape. hexagonal polygonal linking Reticulation and shape with with relatively relatively large the surface with reticulation. reticulation regular sculpture of heavy edges large raised flattened nearly hexagonal polygonal carapace and dotted nearly polygonal structure. structure surfaces. hexagonal meshes. meshes.

123

Moderately Narrow and Broad and almost Narrow and of Broad with the Broad with Post abdominal Moderately long and wide half the length half in length medium size securiform (ax) two small shape towards long and that tapers compared to compared to the with rounded shape. obtuse and the end has been wide that gradually in the maximum maximum body end. horn shaped mentioned as tapers width towards body width. width. angles or wide (Lilljeborg gradually in the terminal abdominal 1900b), narrow width Postabdomen claw. appendages at and elongated towards the the posterior (Hellich 1877; terminal end. Herrick 1884), claw approximately straight or slightly concave (Paggi 1986). Anal denticles 8. 8 – 10. 9 – 10. 8 - 10. 9 – 11. 7 - 9 7 - 14 8 - 10 Total no of 6 4 - 5 4 - - - - - setulated setae on E1 = 2; Ex1 = E1 = 1; Ex1 = E1 = 0; Ex1 = 4. III 4. 3 / 4. (E = Endopodite; Ex = Exopodite) Number of setae 5. 3. 4. - 4 - 4 5 on exopodite V 21 long and Presence of With heavier and - Presence of - Presence of Form 1 stouter teeth. fine setules. slightly longer larger spinules. larger spinules. toothed spinules, pecten compared to variety with proximal pecten. a central Middle pecten pecten on the claw showing 18 to 24 finely setulated pecten

124

Discussion

In this study only ovigerous Ceriodaphnia were identified. Although these samples do not provide a complete geographical or seasonal coverage, they give an initial indication of the distribution of C. dubia Richard, 1894, C. spinata Henry, 1919 and

C. sp. 1 in Australia. Ephippia of these specimens were used for molecular analysis in Chapter 4.

Polymorphisms in body shape are common in zooplankton populations. These polymorphisms are the result of adaptation to changing environmental conditions, reproductive isolation and predation. These conditions can act either individually or in combination on population. Early taxonomists did not take into consideration the environmental plasticity of species within Ceriodaphnia, have made it difficult to establish an identity in relation to known species and resulted in most of the species being synonyms.

As is the case with Ceriodaphnia, most taxonomists favour using a variety of taxonomic characters for describing a species. Unfortunately, because of incomplete description of many species, the choice of morphological characters for comparison study were quite limited and restricted to post abdomen, anal denticles, body size, antennule, antennae, eye, carapace and posterodorsal angle (Table 3.1 and 3.2).

These characters are physically distinct and have been described by almost all authors for Ceriodaphnia. However, with advancements in microscopy, researchers have gained access to complex structures like trunk appendages and arrangements of setules on the edge of the carapace, which are significant characters for species description, as demonstrated for C. laticaudata Paggi (1986) and C. spinata, Henry

125

1919 for trunk appendage I, II, and V. With the use of scanning electron microscopy, understanding some taxonomic characters, like intersetular distances on feeding appendages, ephippium and chevrons has improved significantly. This has helped in resolving the status of some taxa, C. hakea is a synonym of C. planifrons and C. spinata is not a synonym of C. quadrangula Müller (1785) as thought previously

(Berner 2003); in both cases information on trunk appendages and posterior valve margin of carapace was valuable.

Although literature provides basic taxonomic information, one cannot rule out the importance of looking at type specimens, despite this not being a cost-effective way.

Most museums have started digitization of the specimens in their collections; this is a slow process as most of them do not have dedicated curators to actively conduct research on each group. Consequently, taxonomists have to rely either on illustrative images provided by the author, which at certain times may be blurred or distorted, or the type specimens requiring observation may be housed in distant museums or in personal collections.

The specimen from Sydney, NSW (SYDCB), appears to be morphologically similar to C. dubia, Richard 1894. The variation in number of setules on pecten has been highlighted by Berner (1986), where two forms of toothed pecten of C. dubia were observed under controlled environmental and nutritional conditions. The description of C. dubia from New Zealand by Greenwood et al. (1991) is similar to the description of Form 1 toothed pecten variety with a central pecten on the claw showing 18 to 24 finely setulated pecten (Berner, 1986), which are slightly longer than those of the adjacent setules, similar to C. dubia studied here.

126

The two species C. planifrons and C. spinata was easily mistaken for C. quadrangula because of its similar postabdomen structure, with C. quadrangula

(Smirnov and Timms 1983). The two important differences in the trunk appendage I and II, along with other characters, revealed a diagnostic difference in the number of setulated setae on the endite of the two Ceriodaphnia species from C. quadrangula

(Berner, 2003). Additionally there are significant differences in the spinulation of the posterior inner margin of the valves in the two species. In C. quadrangula there is absence of line of fine spinules with punctuated spines on the free edge of the posterior carapace valve, compared to C. spinata which shows row of fine spinules punctuated by numerous spines that are fairly heavy and occur at regular intervals.

Smirnov and Timms (1983) synonymised C. spinata with C. quadrangula based on the characteristics of the body form and postabdominal structure which closely resembled it by examining the mounted holotype specimen. However, Berner (2003) provided a very detailed description of specimens from the Gouldburn Billabong,

Victoria, and noted the variation of the trunk appendages I and II, fornix and the posterior valve of the carapace, with C. quadrangula, and reinstated C. spinata as a separate species.

Ceriodaphnia planifrons was identified by Smith (1909), and the characteristics that separated it from C. hakea were based on elongated carapace, posterior spine and arched postabdominal claw. However, the image provided by Smith reveals a small curve instead of posterior spine for C. planifrons and does not provide detailed drawings of the post abdominal claw and carapace (Appendix 3). However, morphological similarity studied by Berner (2003) (reported in conference presentation) allowed C. hakea to be merged with C. planifrons. The C. sp. 1, share

127

the morphological characters of C. hakea, and high quality SEM and line drawings of the trunk appendages and fornix along with the validated data could be considered to form an acceptable specimen. The morphological detail of the posterior valve margin, trunk limb I and II, shape of the rostral region and fornix proved useful for separating the species from C. quadrangula. In C. sp. 1. the punctuating spines are lacking, and instead there are multiple gland openings, character similar to C. planifrons highlighted by Berner (2003).

Apart from the printed publication reported in conference presentation by Berner,

2003, there is no original museum material for C. planifrons and C. hakea to use for comparative purposes. Importantly for C. planifrons the type is the specimen or specimens illustrated and/or photographed or described, but not the illustration/photograph itself or its description (Article 72.5.6, ICZN). On the other hand the fact that the specimens illustrated no longer exist or cannot be traced does not invalidate the type designation (Article 73.1.4, ICZN). An attempt to obtain specimens from the type locality, unfortunately failed.

The genetic analyses of the ephippia from these species also correspond to the three barcode lineages examined in Chapter 4. The complete description of the three species further expands the knowledge of the trunk appendages which is a key characteristic for differentiating species.

128

References

Berner DB 1986. Taxonomy of Ceriodaphnia (Crustacea: Cladocera) in U.S. Environmental Protection Agency Cultures. Environmental Monitoring and Support Laboratory, Cincinnati. Berner DB 1987. Significance of head and carapace pores in Ceriodaphnia (Crustacea, Cladocera). Hydrobiologia 145:75-84. Berner DB 1994. On the Freshwater Crustaceans Occurring in the Vicinity of Christiania by G. O. Sars. Journal of Crustacean Biology 14:609-611. Berner DB 2003. Rediscriptions of Ceriodaphnia planifrons and C. hakea, Smith 1909 and of C. spinata Henry,1919 (crustacea, Cladocera, Anomopoda, Daphniidae). Joint Congress of ASL & NZLS. Berner DB & Rakhmatullaeva G 2001. A new species of Ceriodaphnia from Uzbekistan and Kazakhstan. Hydrobiologia 442:29–39. Birge A, E 1879. Notes on Cladocera. Department of Natural Sciences, Wisconsin Academy of Sciences, Arts and Letters. Daday VE 1905. Untersuchungen über die : Süsswasser-Mikrofauna Paraguays, Stuttgart. Ekman S 1900. Cladoceren aus Patagonien, gesammelt von der schwedischen Expedition nach Patagonien 1899.. Zoologische Jahrbücher abteilung Für Systematik Geographie Und Biologie Der Tiere 14:62-84. Greenwood TL, Green JD & Chapman MA 1991. New Zealand Ceriodaphnia species: Identification of Ceriodaphnia dubia Richard, 1894 and Ceriodaphnia cf. pulchella Sars, 1862. New Zealand Journal of Marine and Freshwater Research 25:283-288. Jurine L 1820. Histoire Des Monocles Qui Se Trouvent Aux Environs De Genéve J.J. Paschoud, Imprimeur- Libraire: Genéve. Keeling PJ & Palmer JD 2008. Horizontal gene transfer in eukaryotic evolution. Nat Rev Genet 9:605-618. Kotov AA & Ferrari DF 2010. The taxonomic research of Jules Richard on Cladocera (Crustacea: Branchiopoda) and his collection at the National Museum of Natural History, U.S.A. Zootaxa:37-64. Langhans VH 1911. Die Biologie der litoralen Cladoceren-Untersuchungen über die Fauna des Hirschberger Grossteiches. Lilljeborg W 1900. Cladocera Suecivi; Oder Beiträge Zur Kenntniss Der In Schweden Lebenden Krebsthiere Von Der Ordnung Der Branchiopoden Und Der Unterordnung Der Cladoceren. Upsala, Druck der Akademischen buchdruckerei E. Berling. Matile P 1890. Die Cladoceren der umgegend von Moskau Imprimerie de l'univérsité Impériale. Paggi JC 1986. Aportes Al Conocimiento De La Fauna Argentina De Cladoceros, V :Ceriodaphnia laticaudata Müller 1867 y C. pulchella Sars 1862. Rev Asoc Cienc Nat Litoral 17:39-49. Richard J 1894. Cladoceres recueillis par le Dr. Theod. Barrois en Pelestine, en Syrie et en Égypte. Revue biologique du nord de la France, Lille 6:360-378. Richard J 1897. Mémoirs de la societe Zoologique de France Au Siége de la Société: Paris. Sars GO 1890. Oversigt af Norges Crustaceer, med foreløbige bemærkninger over de nye eller mindre bekjendte Arter- II. (Branchiopoda - Ostracoda - Cirripedia). Forh. Videnskselskab. Christiania aar 1890:1-80.

129

Sars GO 1901. Contributions to the knowledge of the fresh-water Entomostraca of South America, as shown by artificial hatching from dried material- 1. Cladocera. Arch. Math. Naturv. 23:1-102. Shiel RJ 1995. A guide to identification of Rotifers, Cladocerans and Copepods from Australian Inland waters Co-operative Research centre for Freshwater Ecology, Murray - Darling Freshwater Research Centre: Ellis Street, Thurgoona, Albury, NSW. 135 p. Smirnov N, N & Kotov AA 2009. Morphological radiation with reference to the carapace valves of the Anomopoda (Crustacea: Cladocera). Int Rev Hydrobiol 94:580-594. Smirnov NN & Kotov AA 2010. The morphological radiation of setae in the Cladocera (Crustacea) and their potential for morphogenesis. Int Rev Hydrobiol 95:482-519. Smirnov N, N., & Timms BV 1983. Revision of the Australian Cladocera (Crustacea) The Australian Museum: Sydney, Australia. 132 p. Smith G 1909. The Freshwater Crustacea of Tasmania, with Remarks on their Geographical Distribution. Transactions of the Linnean Society of London. 2nd Series: Zoology 11:61-92.

130

Chapter 4: Morphological and molecular identification of three Ceriodaphnia sp. (Cladocera: Daphniidae) in Australia

131

Morphological and molecular identification of three Ceriodaphnia species

(Cladocera: Daphniidae) in Australia

PRANAY SHARMA1

1 School of Earth and Environmental Sciences, University of Adelaide, Adelaide,

Australia.

Corresponding author

E-mail: [email protected]; [email protected]

Abstract

Australian Ceriodaphnia (Cladocera: Daphniidae) are examined using

morphological attributes and two mitochondrial DNA (COI and 16s) and one

nuclear DNA (28s) gene fragments to differentiate the species. The sequence

data supports the existence of three species i.e. C. dubia, one reinstated

species C. spinata Henry, 1919 and one new species C. sp. 1. Morphological

characteristics were also able to accurately separate the three species.

Furthermore, phylogenetic analysis of COI sequences from Ceriodaphnia

supported three clades. The high degree of correlation between

morphological and molecular identification in this study indicates that

mitochondrial markers COI and 16s are appropriate molecular markers for

species discrimination and identification of Ceriodaphnia.

Keywords: Phylogenetic analysis, invertebrates, Ceriodaphnia, Australia.

132

Introduction

Ceriodaphnia Dana, 1853 (Cladocera: Daphniidae) displays little diversification in terms of species richness and morphological disparity (Sharma and

Kotov, 2013), with the genus currently comprising 14 “valid” species worldwide, predominantly based on morphology (Kotov 2013). In addition, there are 21 species inquirenda, and 24 species that are probably junior synonyms of previously described species (Kotov 2013). There is limited morphological and genetic evidence to support this proliferation of the large number of proposed names. There are eight

Ceriodaphnia species recorded from Australia which includes one beaked species

The objective of the present study was to consider all available data, morphological and molecular (ribosomal and nuclear genes) of the valid eight

Ceriodaphnia species to clarify the taxonomic position of selected Australian

Ceriodaphnia species.

133

Materials and Methods

Sixty female specimens of Ceriodaphnia (excluding C. cornuta, Sars, 1890 a beaked variety) preserved in 70 % ethanol from 11 sampling sites in Australia (see

Table 1) were used for morphological and molecular analyses.

Morphological analysis

Eggs and young adults from a total of 60 ovigerous females were teased out from the brood chamber and stored in new 0.5 mL micro-tubes containing 90 % denatured ethanol for genetic analysis. The rest of the body was transferred onto a slide containing Poly Vinyl Alcohol (PVA) and left in a Greiner petri dish for 24 h.

After 24 h equilibration, the specimen was dissected using tungsten needles and examined under a compound microscope for further detailed morphological analysis.

Digital photographs were taken using Olympus BX51 microscope under high resolution using polarizing light and composite line drawings were made from these photographs for different parts of the specimen. Inbuilt imaging software Image J® was used to calculate sizes of body parts. Ceriodaphnia were identified morphologically using keys of Shiel (1995) and Kořinek (2002). Slide mounted

Ceriodaphnia collections from Australian Museum, Sydney, Australia (AMS);

Natural History Museum,, University of Ohio, Norway (NHMUO); Naturkunde-

Museum, Coburg, Germany (NMCL) museums were also examined and their morphological characteristics were compared with the Australian Ceriodaphnia specimens used during this study.

In addition to light microscopy, specimens were prepared for SEM as described in Berner and Rakhmatullaeva (2001). The specimens were sputter-coated with gold and were examined under a Philips XL 20 SEM with an accelerating voltage of 10 - 20 KV, working distance between 9.6 to 14 mm and spot size at 3 / 4.

134

DNA extraction, PCR and sequencing

DNA extraction was performed on eggs or young adults with DNeasy®

Tissue kit (Qiagen Inc.) according to the manufacturer’s instructions.

Polymerase chain reaction was subsequently utilized to amplify the COI gene with Folmer primer pair (LCO 1490 and HCO 2198) (Folmer et al., 1994). Each 50

µL PCR reaction consisted of 5 µL of genomic DNA template, 3 µL of 50 mM

MgCl2, 5 µL of 10X Buffer, 1.5 µL of each primer, 1 µL of 10 µM dNTP’s’, 0.24 µL of Taq platinum polymerase and 32.76 µL of DNA free Milli-Q water. PCR thermocycling was performed under the following conditions: 1 cycle of 2 min 30 sec at 94 ºC; 5 cycles each of 94 ºC for 35 sec, 48 ºC for 40 sec and 72 ºC for 1 min; followed by 35 cycles each of 94 ºC for 30 sec, 56 ºC for 40 sec and 72 ºC for 1 min, finishing with a step of 72 ºC for 10 min.

16s rDNA mitochondrial gene was amplified using PCR reaction as mentioned above; the primer used for amplification was

16s1 5' – CCGGAATTCCGCCTGTTTATCAAAAACA - 3’ and 16s2 5' -

CCCAAGCTTCTCCGGTTTGAACTCAGAT – 3' (modified Simon et al. 1994).

PCR thermocycling was performed under the following conditions: 1 cycle of 2 min

30 sec at 94 ºC; 5 cycles each of 94 ºC for 35 sec, 60 ºC for 40 sec and 72 ºC for 1 min; followed by 35 cycles each of 94 ºC for 30 sec, 64 ºC for 40 sec and 72 ºC for 1 min, finishing with a step of 72 ºC for 10 min. For 28s rRNA; the primer used for amplification was

28s1 5' - CCCGCTGAATTTAAGCATAT - 3' and 28s2 5' - TAGATGGTTCGATTAGTCTTTCGC - 3' (Fontaneto et al. , 2007),

PCR thermo cycling was performed under the following conditions: 1 cycle of 2 min

30 sec at 94 ºC; 5 cycles each of 94 ºC for 35 sec, 56 ºC for 40 sec and 72 ºC for 1

135

min; followed by 35 cycles each of 94 ºC for 30 sec, 62 ºC for 40 sec and 72 ºC for 1 min, finishing with a step of 72 ºC for 10 min.

The PCR products were run in 2 % agarose gels containing 10 µL of SYBR®

Safe DNA gel stain (Invitrogen® Inc) for 2 to 4 h at 80 to 100V and visualized using

UV-transillumination. When ampliﬁed bands were sharp and clean, the target band was cut and puriﬁed from the agarose gel using QIAquick® Gel Extraction Kit to avoid contamination from any other non-specific bands. PCR purified products were cycle-sequenced using BigDye® Sequencing kit Terminator 3.1 (Applied

Biosystems) for both forward and reverse directions, and then analysed on AB

3730xl Platform sequencer. Cycle-sequencing reactions were carried out in 10 µL total volume, containing 1 to 3 µL of purified PCR product, 3.5 µL of sequencing buffer, 1 µL of Big Dye Terminator, 0.5 µL of forward and reverse primer with total volume made up to 10 µL using DNA free Milli-Q water . The sequencing thermal cycle consisted of 1 cycle of 1 min at 95 °C, followed by 25 cycles of 95 °C for 15 sec, 50 °C for 10 sec and 60 °C for 4 min with final overnight incubation at 25 °C.

The sequencing product was then purified using Millipore® TM384 - SEQ Filter plates and 1X Tris Buffer.

Phylogenetic analysis based on cmtDNA

Both forward and reverse DNA sequences were analyzed and aligned using

Clustal W application implemented in software Bioedit Ver. 7.0.0. (Hall, 1999), with gap open penalty set to 100, so gaps become less frequent. The protein coding sequences of COI were translated into amino acids using MEGA v. 5.05 (Tamura et al. , 2011), to check for stop codons. Phylogenetic analysis was conducted using

Mega, PhyML and Mr. Bayes, both on separate and concatenated mitochondrial

(cmtDNA = 16s + COI, 1185 bp) data sets. Phylogenetic trees were inferred by

136

Neighbour-Joining (NJ), Maximum likelihood (ML) and Bayesian interface (BI).

Estimates of sequence divergence were also calculated for individual genes by applying the best fit models of nucleotide substitution which were selected using

Model Generator (Keane et al. , 2006), ML tree was constructed using PhyML ver.

3.0 (Guindon and Gascuel, 2003) and BI analysis was performed using Mr. Bayes v.

3.1.2 (Huelsenbeck et al. , 2001). NJ trees were constructed using MEGA v. 5.05 and

Kimura 2-parameter (K2P) distance with complete deletion of missing information.

Four substitution rate categories were considered while gamma shape parameters, transition/transversion ratios, and nucleotide frequencies were estimated from the data. Proportions of invariable sites were set according to values given by models obtained from Model Generator (Keane et al. , 2006). Alignment gaps were treated as unknown characters. For Bayesian analysis the Markov Chain Monte Carlo chains were run for 106 generations and trees were sampled every 100 generations. Of the generated trees, the first 25% were eliminated as burn-in. Runs were checked for convergence and normal distribution in Tracer v. 1.5 (Rambaut and Drummond,

2007).

The sequences have been deposited in GenBank under accession numbers

KC154268 – KC154287; KC020651 – KC020671 for COI gene fragments;

KC154322 – KC154345 for 16s gene fragments; and KC154358 – KC154372 for

28s gene fragments.

COI gene sequences for Ceriodaphnia used in this study are compared with published COI sequences available from GenBank (Number of taxa = 124; Number of haplotypes = 31; base pair length = > 500), most of which originated from North

American taxa (Elías-Gutiérrez et al. , 2008).

Abbreviations used for museum collections are:

137

AMS = Australian Museum Sydney, Australia;

NHMUO = Natural History Museum, University of Oslo, Norway;

NMCL = Naturkunde-Museum, Coburg, Germany.

SAM = South Australian Museum, Adelaide, Australia.

138

Results

Descriptions of species based on morphological characteristics

Ten key morphological characteristics were used in the present study, and are summarised in Table 2. Accordingly, of the Australian female specimens examined, the following three species were identified: C. dubia, C. spinata and C .sp 1.

139

Genus Ceriodaphnia Dana, 1853.

Ceriodaphnia Dana, 1853: 1273; Müller, 1868: 125; Schoedler, 1877: 19; Winchell,

1883: 35; Stingelin, 1896: 211; Lilljeborg, 1900: 183; Lilljeborg, 1901: 675; Smith,

1909: 80; Sars, 1916: 315; Henry, 1922: 32.

Type species: Ceriodaphnia quadrangula (O.F. Müller, 1785)

Specimens identified as Ceriodaphnia quadrangula Müller, 1785.

Ceriodaphnia quadrangula Müller, 1785 (Plate No.27) Figs 16 to 25.

Ceriodaphnia quadrangula, Lilljeborg, 1901: 193; Sars, 1916: 36; Nachtrieb, 1895: no description, Plate No. XLI. Fig. No. 16 to 18. Syn: Ceriodaphnia hamata Sars, 1890: 36. Syn: Monoculus clathratus Jurine, 1820: 140. Syn: Ceriodaphnia punctata Müller, 1867:172. Syn: Ceriodaphnia muelleri Langhans, 1911. Syn: Ceriodaphnia connectens Drost, 1925: 70.

Type material. AMS P.4327. Type locality. Australia. Corowa, NSW.

Material examined. Australia. Corowa, NSW, no other data, AMS P.4327, China.

Soochow, no other data, USNM 59382 (100 specimens in ethanol), Germany,

Tiergarten, Berlin, no other data, NMCL 5533; Brandenburg, no other data, NMCL

10690; Grunewald See, 1898-08-05, no other data, NMCL 10691; Brandenburg, no other data, NMCL 11912; Brandenburg, no other data, NMCL 16047, Japan, no other data, NMCL 15434, and NMCL 15492, ), Norway, no other data, NHMUO

F19361 (in ethanol), AMNH 4576 (slide collection); 17474 (in ethanol), South

Africa. Cape of Good Hope, no other data, NHMUO F9269 (slide collection).

140

Brief diagnosis.

Valves of the carapace ending in a posterior angle or a short spine. Head small, depressed and separated from body by a deep cervical groove. Carapace marked by a polygonal pattern. Antennules in female not freely movable. Ocellus always present.

Ephippium triangular, containing more than one egg.

141

Ceriodaphnia dubia Richard, 1894, p. 570-572.

Figs 6-8

Ceriodaphnia dubia Richard, 1894: 570; Delachaux, 1917: 80; Sars, 1916:

317; Berner, 1986: 16 ; Greenwood et al. 1991: 285.

Syn Ceriodaphnia affinis Lilljeborg, 1901: 675.

Syn Ceriodaphnia limicola Ekman, 1900: 70.

Syn Ceriodaphnia acuminata Ekman, 1900: 69.

Syn Ceriodaphnia richardi Sars, 1901: 21.

Type series. Type locality. “lac Toba”, N Sumatra, Indonesia.

Type material: David G. Frey (DGF) collection housed in Smithsonian

Institution’s Museum Support Center in Suitland, Maryland, U.S.A.

“According to the hand written catalogue, sample DGF 723 was from “Balige

(Lac Toba, Sumatra)”, coll. in 24.xi.1891 by M. E. Modigliani. However,

according to the label, this sample is from Lake Titicaca and collected in

1969. So, the initial sample with number 723 is no longer present in the

collection, and there are no other samples from Lake Toba in Richard’s

collection " (Kotov and Ferrari, 2010).

Specimens identified as Ceriodaphnia dubia Richard, 1894.

Material examined. Australia. Victoria, no other data, NHMUO F19258 (in ethanol), Indonesia. Lake Toba, Sumatra, 1891 – 02 – 24, Frey, D. G. USNM

1120420 (100 specimens in ethanol), South Africa. Cape of Good Hope, no other data, NHMUO F9266 (slide collection); Cape of Good Hope, no other data,

NHMUO F9267 (slide collection). Central Africa. Lake Victoria, no other data,

NHMUO F9309 (slide collection).

142

Specimens identified as Ceriodaphnia affinis Lilljeborg, 1901

Material examined. Germany. Umgebung von Berlin, Hartwig, NMCL

11913, Sweden. Blekinge, Sturberg, no other data, NHMUO F9583 (slide collection); Blekinge, Sturberg no other data, NHMUO F18489a (in ethanol) and

NHMUO F18489b (in ethanol).

Material examined. Australia. Slide of a dissected parthenogenetic female from

Parramatta Lake near Sydney, NSW (33°47’26” S/ 151°00’28” E) deposited in the South

Australia Museum (SAM). Dr John Chapman (Office of Environment and Heritage, NSW,

Sydney) collected this species in 1986 from Parramatta lake in Sydney and since then has been cultured and maintained in a laboratory (Moreno Jully, OEH NSW, personal communication, 23rd June 2014). Sample specimens of the species were provided by Dr

Tsuyoshi Kobayashi (OEH, NSW) on 26-10-2010. Genetic Reference No: COI + 16s =

SYDCB001 – 05. Five ephippial females (undissected) stored in a vial containing 70 % denatured alcohol deposited in the SAM, accession number SAM C7024.

Diagnosis. Parthenogenetic females Head small, 4.8 to 5.6 times in body length, moderately depressed with shallow supraocular depression, elongated polygonal reticulations over frons, no fenestra on anterior surface of cervical notch. Eye moderately large in size, 2.1 to 2.6 times in head length, lenses prominent. The rostral region with flat round pore (Fig. 4). Antennules short, anterior sensory hair arising from small peduncle, one-third the distance from apex, anterior sensory hair longer than either antennule body or aesthetascs. Ridge of cuticle encircles rostral pore. Fornices smoothly rounded without lateral extensions and without a minute spine at broadest portion (Fig. 1). Coxal portion of antennae folded, with two sensory setae. Surface of basipod with nine irregular rows of fine spinules varying in length and thickness. Posterior ventral carapace margin with inner row of fine spinules punctuated partially or entirely with 12 spines and with one to three short, heavier,

143

plumose spines dorsally at about 40 % of distance below the posterior ventral margin.

Trunk limb I with setulated setae on endites two to five (E2 to E5). Two ejector hooks situated on the anterior side of the limb. Trunk limb II with five endites

E1 to E5 consisting of seven setulated setae and two soft setae. Trunk limb III with one exopodite and five endites. Trunk limb IV with eight setulated setae. Trunk limb

V with a small sized exopodite bearing five setae of which three are long and two small in size (Fig. 10).

Postabdomen slightly tapered and obliquely truncated distally, with setules of proximal group short and slightly lighter in weight than those of the distal group.

Middle pecten claws with 21 long and stouter teeth (Figs 13 and 14).

144

Ceriodaphnia spinata Henry, 1919 (Plate No. XL)

Figs 1 and 2

Ceriodaphnia spinata Henry, 1919: 466.

Type material: Holotype AMP 27728 (1 ovigerous female).

Type series. Type locality. "Corowa", Australia.

Mateial examined. Australia. Victoria, Thornton, 1998-10-09, USNM 1121570 (5♀ in isopropyl alcohol); USNM 1121571 (6♀, in isopropyl alcohol).

Material examined. 1 female, Golburn Billabong, Alexandria, Victoria, Australia,

1974-08-06 (AMP 27728); Five ephippial females each from South Para, Myponga

Reservoirs, Mannum and Snuggery Adelaide, SA; one parthenogenetic female from

Mannum SAMAN001 (36°16'29.99"S S/ 139°54'40.41"E), SA, sample collected by the author on 2009-02-15, deposited in SAM. Genetic Reference: COI + 16s =

SAMAN001 - 02, SASNU001. Five ephippial females from Mandina (undissected) stored in a vial containing 70 % denatured alcohol deposited in SAM, accession number SAMC7572.

Diagnosis. The holotype (P: 4327) is a mounted slide of ovigerous female. The second slide- mounted specimen (P: 27728) of same length, from Goulburn billabong, Alexandria, Victoria, Australia is poorly preserved. Smirnov and Timms

(1983) reported the total length of females in the range 0.8 to 1.2 mm.

Parthenogenetic females. Head small, 5 to 5.5 times in body length, moderately depressed with absence of supraocular depression and presence of irregular polygonal and hexagonal reticulations, which are punctuated and stippled. Eye moderately large, 1.8 to 2.5 times in head length, lenses prominent. Edges or nodes of these reticulations are an acute V-shaped structure. Cervical notch shallow. 145

Rostral region shows flat round pore (Fig. 6). Antennules long, anterior sensory hair arises from small peduncle which is approximately ½ distances from apex, anterior sensory hair longer than the antennule body or aesthetascs. Fornices smoothly rounded without lateral extensions, with two small denticles, and no spine at the broadest portion (Fig. 3). Coxal portion of antennae is folded and supplied with two sensory setae; lateral basal section of the basipod with ten plumose setae. Surface of basipod with ten irregular rows of fine spinules varying in length and thickness.

Posterior margin of the carapace lacks punctuating spine. Posterodorsal angle is pointed and spiny.

Trunk limb I with setulated seta on endite 2 to 5 (E2 to E5), E5 with three setae. Trunk limb II with five endites E1 to E5, gnathobase bears five brush setae and

E2 bears two long accessory spines. Trunk limb III exopodite with three setulated setae on distal end and one small setulated setae on the lateral end. Trunk limb IV with four setulated setae in the distal end and the posterior end has a single seta.

Trunk limb V with a small sized exopodite bearing three setae of which the distal and proximal one is longest compared to the middle setae (Fig. 12).

Postabdomen almost half the length compared to maximum body width. The distal end is slightly concave and base is curved, with setules of proximal group shorter and thinner than those of the distal group. Postabdomen provided with nine recurved anal denticles (Figs 17 and 18).

146

Ceriodaphnia sp 1

Holotype. Slide of a parthenogenetic female, Yanga lake, Sydney, NSW

(34°42'19.04° S / 143°35'30.73"E). Collected by Dr T. Kobayashi (OEH, NSW) on

26-10-2010 (SAM C7551).

Material examined. Five parthenogenetic females from Yanga Lake near Sydney,

NSW (34°42'19.04° S / 143°35'30.73"E) in a vial containing 70 % denatured alcohol deposited in SAM, accession number SAM C7551. Barcode Reference: COI + 16s =

NSYAN001 – 02, NSSTE002, NSMER003 - 05.

Diagnosis: Parthenogenetic females. Head small, 3.9 to 4.33 times in body length and moderately depressed with shallow supraocular depression and irregular polygonal reticulations over frons. Cervical notch shallow. Eye large in size, 1.9 to

2.25 times in head length, lenses prominent. Rostral region shows bulging vertical pore (Fig. 5). Antennules long, anterior sensory hair arises from small peduncle 1/3rd distance from apex, anterior sensory hair longer than the antennule body or aesthetascs. Fornices smoothly rounded with lateral extensions, and no spine at the broadest portion (Fig. 2). Coxal portion of antennae is folded and supplied with three sensory setae. Surface of basipod with 10 irregular rows of fine spinules varying in length and thickness. Posterior margin of carapace shows a line of fine spinules which are punctuated with spines.

Trunk limb I with setulated setae on endites 2 to 5 (E2 to E5), and two setae on E5. Trunk limb II with five endites E1 to E5, and four brush setae on gnathobase with two short accessory spines on E2. Trunk limb III exopodite with four setulated setae on the distal end and two small setulated setae on the lateral end. Trunk limb III with five endites of which E1 to E4 are highly reduced and E5 bear a number of gnathobasic filtering setae. Trunk limb IV has five setulated setae at the distal end.

147

Posterior end has two setae. Trunk limb V has a small sized exopodite with three setae of which two are long and one small in size (Fig. 11).

Postabdomen almost half in length compared to the maximum body width.

Distal end is slightly concave and base is straight, with setules of proximal group short and slightly lighter in weight than those of the distal group. Postabdomen provided with 8 to 10 recurved anal denticles (Figs 15 and 16).

Phylogenetic relationships derived from cmtDNA

Basic statistics and selected substitution models for mtDNA sequences are shown in Table 3. The cmtDNA set yielded a total of 14 unique sequences, consisting of 1185 aligned nucleotides, of which 220 sites were variable and 216 sites were parsimony informative. No internal stop codons and indels were detected.

Trees based on individual gene fragments (not shown) and on cmtDNA (Fig. 19) as well as nuclear marker 28s (Fig. 20) yielded similar topologies in which

1. Clade 1 and Clade 2 comprising C. sp. 1 and C. spinata were supported by

100 % bootstrap support and includes populations from NSW, WA and SA.

Intra- specific pairwise differences for cmtDNA ranged between 0 and 1 %,

while minimal observed inter-specific distance was 10 % (ML corrected = 13

%) (Table 4).

2. Clade 3 comprising C. dubia was represented by laboratory cultured

species from Parramatta, NSW with bootstrap value of 100 % and intra-

specific divergence of 0 % for cmtDNA (Table 4).

148

Comparison between Australian and North American populations of Ceriodaphnia

Analysis of COI sequences between Australian C. sp. 1 and C. spinata and

North American species of Ceriodaphnia (Fig. 21) showed raw p-distance analysis between 2 to 21 % whereas corrected ML-distance analysis is 18 to 103 % (Table 5).

The exceptions to this are SYDCB001 and SYDCB003 specimens from Parramatta,

NSW, which shows genetic similarity with ZPLMX 452 and ZPLMX453

(Ceriodaphnia cf. laticaudata, Mexico); ZPLMX095 and ZPLMX859 (Ceriodaphnia cf. acanthina, Mexico) with 1 – 4 % (raw p-distance) and ML distance of 1 to 6 %.

Discussion

Molecular analysis of the published COI sequences available from GenBank including the sequences generated from this study (Figs 19 and 20) indicates the presence of three distinct Ceriodaphnia species. This is also well supported by morphology which showed consistent differences of ten key characters, between C. dubia, C. sp. 1 and C. spinata.

The specimens of C. dubia from Sydney, NSW (SYDCB), and specimens identified as C. dubia Richard, 1894 are morphologically the same. The description of C. dubia from New Zealand by Greenwood et al.(1991) is similar to the description of Form 1 toothed pecten variety with a central pecten on the claw showing 18 to 24 finely setulated pecten by Berner (1986), which are slightly longer than those of the adjacent setules, similar to C. dubia studied here.

The lack of sufficient taxonomic detail for Australian Ceriodaphnia has resulted in incorrect identifications, leading to a great deal of confusion, with synomization or clustering several distinct species like C. planiformis and C. spinata with C. quadrangula Lilljeborg (1900a), a holarctic species. C. planiformis and C. spinata are endemic Australian species and therefore are not synonymous with C. quadrangula. The variations in size and shape of the post abdomen, number of setae

149

on endopodite of limbs I, II and V, presence or absence of punctuating spines along the posterior margin of the carapace, and variation in thickness of spinules of the middle pecten, are stable characters that all point toward C. planifrons and C. spinata being distinctly separate species. These characters are also comprehensively documented by line drawings and SEM images by Berner (2003).

Despite close morphological similarities of C. sp. 1 with C. planifrons reported by Berner (2003), the loss of the holotype and lack of well-preserved specimens of C. planifrons, nothing definitive can be said about this species.

There are a total of 11 unmounted specimens, approximately 30 years old, of

C. spinata lodged in the Smithsonian Institution under accession codes 1121570 and

1121571 in Isopropyl alcohol. Isopropyl alcohol or isopropanol (IPA) has been a preferred choice for museums to store specimens for long term storage. The failure in extracting and amplifying DNA from > 5 yrs preserved samples, available unmounted original material of C. spinata was not available for the genetic study.

However, comparative light microscopical analysis of the type slide specimen and comparison with documented SEM and line drawings of Berner (2003) helped narrow the third species to C. spinata.

Phylogenetic analysis

Phylogenetic relationships among studied species of Ceriodaphnia in

Australia, showed congruence between cmtDNA and nuclear gene tree topology with strong bootstrap support (Figs 19 and 20). The average bootstrap support values were moderate to high, suggesting that topologies estimated are reliable. Nevertheless, closely related species living in the same region formed a strongly supported monophyletic group C. sp. 1 and C. spinata. The low level of genetic divergence seen for C. dubia is probably due to the specimens being from a panmictic

150

population from Parramatta River and laboratory cultured and maintained since 1986

( Julli, pers. comm.).

Phylogenetic analysis of mt COI sequences for Ceriodaphnia from different sites, many of which are from Mexico (Elías-Gutiérrez, 2008), provided the first direct molecular evidence for genetic divergence between geographically isolated populations of Ceriodaphnia. Close genetic similarities between C. cf. laticaudata

(raw p –distance of 2 to 3 %, ML distance of 2 to 3 %) and C. cf. acanthina (raw p – distance of 4 to 5 %, ML distance of 5 to 6 %) from Mexico to C. dubia, and conversely large genetic differences with C. dubia (raw p –distance of 10 to 11, ML distance of 24 to 27 %) from Guatemala and Mexico, indicates that the Australian population of C. dubia is genetically distinct and morphologically discrete.

In this work an integrated approach was used for achieving the goal of species identification and discrimination of Ceriodaphnia from Australia. The correlation between morphological and molecular identifications in this study indicates that both COI and 16s rRNA are appropriate molecular markers for species discrimination and identification of genus Ceriodaphnia. From this perspective the present study not only illustrates the usefulness of a combined morphogenetic approach for the relatively under-studied genus Ceriodaphnia, but also provides first the DNA barcode reference for the three Australian Ceriodaphnia species studied.

151

Acknowledgments

The author thanks the Sir Mark Mitchell Research Foundation, ANZ Holsworth

Grant and ABRS Travel Bursary for financial support. I very much appreciate the helpful suggestions on the manuscript from Dr John Jennings. I extend my sincere thanks to SA Water, Microbiology Department, for granting permission and providing me with the necessary facilities to carry out the genetic work. I greatly appreciate the helpful suggestions on the English from Ms Samantha –Ann

Schneider. Thanks also go to all the staff at Adelaide Microscopy, for there assistance with the SEM.

152

References

Berner DB, 1986. Taxonomy of Ceriodaphnia (Crustacea: Cladocera) in U.S. Environmental Protection Agency Cultures. Environmental Monitoring and Support Laboratory. Berner DB, 1987. Significance of head and carapace pores in Ceriodaphnia (Crustacea, Cladocera). Hydrobiologia 145:75-84. Berner DB, 2003. Rediscriptions of Ceriodaphnia planifrons and C. hakea, Smith 1909 and of C. spinata Henry,1919 (crustacea, Cladocera, Anomopoda, Daphniidae). Joint Congress of ASL & NZLS. Berner DB, Rakhmatullaeva G, 2001. A new species of Ceriodaphnia from Uzbekistan and Kazakhstan. Hydrobiologia 442:29–39. Elías-Gutiérrez M, Jerónimo MF, Ivanova VN, Valdez-Moreno M, Hebert PDN, 2008. DNA barcodes for Cladocera and Copepoda from Mexico and Guatemala, highlights and new discoveries. Zootaxa 42:1-42. Folmer OF, Black M, Hoeh W, Lutz R, Vrijenhoek R, 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3:294- 299. Fontaneto D, Herniou EA, Boschetti C, Caprioli M, Melone G, Ricci C, Barraclough TG, 2007. Independently evolving species in asexual bdelloid rotifers. PLoS Biol 5:e87. Greenwood TL, Green JD, Chapman MA, 1991. New Zealand Ceriodaphnia species: Identification of Ceriodaphnia dubia Richard, 1894 and Ceriodaphnia cf. pulchella Sars, 1862. New Zealand Journal of Marine and Freshwater Research 25:283-288. Guindon S, Gascuel O, 2003. A Simple, Fast, and Accurate Algorithm to Estimate Large Phylogenies by Maximum Likelihood. Systematic Biology 52:696- 704. Hall TA, 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41:95 - 98. Huelsenbeck JP, Ronquist FR, Nielsen R, Bollback PJ, 2001. Bayesian inference of phylogeny and its impact on evolutionary biology. Science 2310-2314. Keane TM, Creevey CJ, Pentony MM, Naughton TJ, Mcinerney JO, 2006. Assessment of methods for amino acid matrix selection and their use on empirical data shows that ad hoc assumptions for choice of matrix are not justified. BMC Evolutionary Biology 6:29. Kořinek V, 2002. Cladocera. In Fernando C.H. (Ed.) A Guide to Tropical Freshwater Zooplankton. Backhuys Publishers. Kotov AA, Ferrari DF, 2010. The taxonomic research of Jules Richard on Cladocera (Crustacea: Branchiopoda) and his collection at the National Museum of Natural History, U.S.A. Zootaxa:37-64. Lilljeborg W, 1900. Cladocera Suecivi; Oder Beiträge Zur Kenntniss Der In Schweden Lebenden Krebsthiere Von Der Ordnung Der Branchiopoden Und

153

Der Unterordnung Der Cladoceren.. Upsala, Druck der Akademischen buchdruckerei E. Berling. Rambaut A, Drummond A, 2007. Tracer version 1.5 available from http://beast. bio. ed. ac. uk. Tracer. Sars GO, 1890. Oversigt af Norges Crustaceer, med foreløbige bemærkninger over de nye eller mindre bekjendte Arter- II. (Branchiopoda - Ostracoda - Cirripedia). Forh. Videnskselskab. Christiania aar 1890:1-80. Shiel RJ, 1995. A guide to identification of Rotifers, Cladocerans and Copepods from Australian Inland waters. Co-operative Research centre for Freshwater Ecology, Murray - Darling Freshwater Research Centre. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S, 2011. MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution 2731-2739.

154

Table 1. Localities with coordinates and the Genbank accession numbers for Ceriodaphnia collected across Australia, - means not amplified.

155

Sites Location State Sampling Location Water Latitude Longitude GenBank Accession Numbers Date code body type COI 16s 28s 1 Yanga New 26/10/2010 NSYAN Lake 34°42'19.04"S 143°35'30.73"E KC020663 KC154331 - National South - 66 - 34 Park Wales (NSW) 2 Yanga New 26/10/2010 NSMER Lake 34°22'44.94"S 143°47'12.80"E KC020667 KC154336 KC154371 National South - 71 – 40 - 72 Park, Wales Mercedes (NSW) 3 Yanga New 26/10/2010 NSSTE Lake 34°28'58.26"S 143°40'33.20"E KC020662 KC154330 - National South Park, Steam Wales Engine (NSW) 4 Parramatta New Sample SYDCB Lake 33°47'26.00"S 151° 0'28.00"E KC154279 KC154341 KC154358 South collected - 83 - 45 – 62 Wales in 1986 by (NSW) Moreno Julli. Since then, cultured and maintained in a laboratory. 5 Mannum, South 26/10/2009 SAMAN Flood 36°16'29.99"S 139°54'40.41"E KC154284 KC154326 KC154363 Mandina Australia plain - 85 – 29 – 65 (SA) 6 Snuggery South 20/10/2009 SASNU Flood 36°33'45.00"S 140° 0'7.88"E KC020660 KC154322 KC154366 Australia Plain – 25 - 70 (SA) 7 Myponga South 2008 - 2010 SAMYP Reservoir 35°24'10.06"S 138°25'43.14"E KC154270 - - Reservoir Australia - 75 (SA) 8 South Para South 2008 - 2010 SASPA Reservoir 34°41'47.28"S 138°51'41.63"E KC154276 - - Reservoir Australia - 78 (SA) 156

Sites Location State Sampling Location Water Latitude Longitude GenBank Sites Location Date code body type Accession Numbers COI 16s 28s 9 Chowilla South 10/02/2011 SACHOW Flood 34° 3'33.76"S 140°45'44.48"E KC020655 - - Australia Plain – 59 (SA) 10 Woorabinda South 15/10/2009 SAWOO Flood 30° 0'59.90"S 134°32'1.88"E KC020661 - - Australia Plain (SA) 11 Runaway Western 10/03/2010 WARPER Pond 31°56'11.10"S 115°58'31.78"E KC020651 - - Perth Australia - 54 (WA)

157

Table 2. Comparisons of selected morphological characters of eight non-beaked Ceriodaphnia spp. - = no information available.

Character C. dubia C. spinata C. sp. 1 C. quadrangula C. laticaudata C. rotunda C. pulchella C. dubia (N= 5) (N= 5) (N= 5) (Müller, 1785) Müller, 1867 Sars, 1862 Sars, 1862 Richard, 1894 Size of adult female in mm 1 – 1.4 0.75 – 0.95 0.9 – 1.2 0.5 – 0.9 0.7 - 1 0.8 – 1 0.5 – 0.86 0.7 - 1 Row of fine Approx. 1/3rd Long flexible Is acute and Long flexible Is convex Row of thin - spinules of the posterior setules followed spine shaped. setules shaped with hairs continues punctuated end shows by a row of fine followed by a clear and till the rear partially or spines thin spines row of fine thin coarse edge, where it entirely with projecting interrupted in spines reticulation reaches to its 10 to 12 from the edge between with interrupted in and serrated highest point spines. of the fine spiniform between with spines at the near the carapace. setules rising fine spiniform edge of the junction of the Posterior margin parallel from the setules rising carapace. It posterodorsal of carapace edge. parallel from ends on angle. the edge. posterior side Posterodorsal at a angle shows posterodorsal presence of angle with spine which is blunt spine laid almost parallel to its edge Evenly sized Distinctly Distinctly Coarser Is irregular in Thick regular strong cross- polygonal in reticulated reticulated with reticulation on shape. hexagonal polygonal linking Reticulation and shape with with relatively relatively large the surface with reticulation. reticulation regular sculpture of heavy edges large raised flattened nearly hexagonal polygonal carapace and dotted nearly polygonal structure. structure surfaces. hexagonal meshes. meshes.

158

159

Table 3. Sequence information for the different gene fragments without the out group. Fragment length in base pair, number of variable sites (V), number of Parsimony informative sites (Pi), number of gap positions or missing data (G/M).

Gene Fragments Length V Pi G/M Model test

mtDNA 16s 540 75 72 - K81uf + I

COI 645 148 144 - K81uf + G

cmtDNA 1185 220 216 - TVM + G

Nuclear 28s 575 479 83 - GTR + I

Table 4. Minimum and Maximum cmt mtDNA (upper line in each cell) and 28s (bottom line in each cell) raw pairwise divergence within and between species A to C with ML corrected divergence value inside the closed bracket ( ) of the Ceriodaphnia. The figures are in percentage (%) and 0 represents the sequence divergence value being < 0.005 %.

Species C. sp. 1 C. spinata C. dubia

0 – 1 (0 – 1) C. sp. 1 0 – 1 (0 – 1)

10 (13 – 15) 0 – 1 (0 – 1) C. spinata 8 (9 – 10) 0 (0)

14 (24 – 25) 15 (26 – 27) 0 (0)

C. dubia 12 – 14 (17 – 9 – 10 (12 – 14) 0 – 2 (0 – 2)

19)

160

Table 5. Minimum and Maximum COI raw pairwise divergence within and between species with ML corrected divergence value inside the closed bracket () of the Ceriodaphnia complex. The figures are in percentage (%) and 0 represents the sequence divergence value being < 0.005 %. Asterisk represents species from Australia.

161

. B C D E rigaudi rigaudi reticulata laticaudata acanthina A .

Ceriodaphnia sp C. laticaudata Ceriodaphnia sp. Ceriodaphnia sp. Ceriodaphnia sp Ceriodaphnia cf. Ceriodaphnia cf. Ceriodaphnia sp. Ceriodaphnia spinata* Ceriodaphnia sp 1 Ceriodaphnia cf. Ceriodaphnia sp. Ceriodaphnia cf. Ceriodaphnia cf. C. dubia C. dubia Cerio daphn 0 (0) ia sp A C. 20 latica 0 (0) (80) udata Cerio 15 – 18 – 19 0 – 3 daphn 16 (64 – (0 – ia sp. (64 – 67) 4) B 66) Cerio 16 – daphn 15 17 18 (73) 0 (0) ia sp. (58) (57 – C 60) Cerio 16 – daphn 17 17 17 (83) 15 (51) 0 (0) ia sp. (68) (67 – D 70) Cerio 15 – daphn 17 18 – 19 6 0 – 1 17 15 ia cf. (60 – (75 – (10 – (0 - (59 – (42 -43) rigaud 61) 76) 11) 1) 62) i Cerio 17 – daphn 14 18 19 15 0 – 1 ia cf. 20 (79) 14 (46) (35 – (64) (63 – (43) (0 – 1) rigaud 36) 65) i 2 Cerio 17 – 14 daphn 18 18 15 0 – 1 20 (79) 14 (46) (35 – 0 (0) ia sp. (64) (63 – (43) (0 – 1) 36) E 66)

162

Cerio 18 – daphn 17 – 15 – 16 19 16(67 – 17 (73 - ia 18 20 (89) 16 (69 – 17 (73) 0(0) (73 – 68) 74) spinat (64) (78) 70) 76) a* Cerio 16 – 17 – 17 18 19 daphn 17 17(64 – 19 19 (70 – 13 (31 – 0 – 2 (0 (61 - 19 (86) (74 – (70 - ia sp 1 (70 – 65) (66 – 71) 32) – 2) 62) 75) 71) * 73) 67) Cerio 18 – daphn 19 21 21 16 16 15 – 16 16 – 17 ia cf. 17 (82) 16 (88) 19 (69) 0(0) (79) (103) (87 – (92) (84) (87) (72) reticul 90) ata 18 – Cerio 20 16 16 21 21 17 (79 – 16 16 (85 – 19 (67 - daphn (76 – (81 – (85 - 16 (70) 3 (3) 1 (1) (101) (85 - 80) (90) 86) 68) ia sp. 77) 82) 86) 87) Cerio 20 – 17 – daphn 19 17 18 – 19 14 – 20 (90 – 21 19 (68 - 18 18 – 19 18 (59 – 18 (55 - 14 – 15 0 – 2 (0 ia cf. (65 – (78 – (74 - 15(37 – 92) (73 – 70) (70 - (74 -76) 61) 58) (35 -37) – 2) latica 67) 80) 76) 39) 77) 72) udata Cerio 20 – 17 – daphn 18 – 19 18 – 19 18 21 16 18 4 – 5 (5 ia cf. 20 (96) 19 (74) 19 (80) 19 (80) (64 – (61 – 15 (43) 14(41) 0 (0) (71) (79 – (84) (76 – – 6) acanth 65) 62) 82) 77) ina 20 – C. 17 19 – 20 13 – 4 – 5 19 21 17 19 -20 18 (61 - 18(58 - 2 – 3(2 0(0 dubia 20 (92) 19(71) (73 – (76 – 14(40) 14(37 – (5 – (68) (76 – (81) (77) 62) 59) – 3) ) * 74) 77) 38) 6) 79) 10 17 – 17 – 15 – 16 – 11 – – 19 – 20 17 – 18 18 – 19 18 – 19 18 – 19 14 – 14 – 11 – 12 0 – C. 18 20 16 17 17 – 18 12 11( (96 – (74 – (80 – (80 – (62 – 15(43 – 15(41 – (18 – 3 dubia (71 – (80 – (84 – (76 – (65 -68) (24 - 24 99) 78) 83) 83) 65) 47) 45) 23) (3) 74) 84) 87) 80) 27) – 27)

163

C. dubia C. sp. 1 C. spinata

Figs 1-6: SEMs of fornix. 1: absence of denticles; 2: smooth extended hooks; 3: smooth small denticles. SEMs of the rostral pore. 4: flat; 5: bulging; 6: flat.

164

C. dubia C. sp. 1 C. spinata

Figs 7-12: SEMs of reticulation on the carapace. 7: polygonal reticulation; 8 and 9: hexagonal reticulation. Line drawing of trunk appendage V for the three species.

165

C. dubia C. sp. 1 C. spinata

Figs 13-18: SEMs of post abdomen and denticles of the three species.

166

Fig. 19. Phylogenetic trees inferred from concatenated mtDNA gene sequences for Ceriodaphnia within Australia. Numbers above branches are maximum likelihood (100 replicates) and numbers in bold are from Bayesian analysis. For location details see Table 1.

167

Fig. 20. Tree indicating the phylogenetic relationship inferred from 28s gene sequences for Ceriodaphnia within Australia. Numbers above branches are maximum likelihood (100 replicates) and numbers in bold are from Bayesian analysis. For location details see Table 1.

168

Fig. 21. Maximum likelihood analysis of COI gene for Ceriodaphnia complex. Numbers above branches are Maximum likelihood (100 replicates) and numbers in bold are from Bayesian Analysis.

169

Chapter 5: The identification of common Cladocerans and Calanoids in two South Australian reservoirs using DNA barcoding and morphological analysis: an integrative approach

P. SHARMA1), M. ELIAS. GUTIERREZ2) and T. KOBAYASHI3)

1 School of Earth and Environmental Sciences, University of Adelaide, Adelaide, Australia 2 El Colegio de la Frontera Sur, Av. Centenario km 5.5, Chetumal 77014, Quintana Roo, Mexico 3 Science Division, Office of Environment and Heritage NSW, PO Box A290, Sydney South, New South Wales 1232, Australia

1Corresponding Author: [email protected]

170

171

172

173

174

175

176

177

178

179

180

181

182

183

184

185

186

187

188

189

190

191

192

193

Supplementary Table I. Percentage pairwise divergence matrix, both raw (p-distance, lower left) and corrected (ML), for Bosmina species COI sequences. Sequences starting in an asterisk were contributed by the current study; all other sequences were sourced from GenBank. The figures are in percentage (%) and 0 represents the sequence divergence value being < 0.005 %

SASPBM01* SASPBM02* E. tubicen Bosmina sp E. huaronensis Bosmina sp Bosmina sp Bosmina sp

SASPBM01* 0 17 17 16 22 21 22 SASPBM02* 0 17 17 16 23 21 22 E. tubicen 48 - 50 48-51 0 - 3 (0 -3) 16 - 17 17 22 - 24 21 22 Bosmina sp 50 50 55 - 57 8 21 21 23 E. huaronensis 62 62 67 - 69 12 20 21 23 Bosmina sp 87 87 92 - 94 74 85 - 86 23 23 Bosmina sp 99 100 104 - 106 86 97 - 98 94 12 Bosmina sp 105 106 110 - 112 92 103 - 104 100 22

194

Supplementary Table II. Percentage pairwise divergence matrix, both raw (p- distance, lower left) and corrected (ML), for D. lumholtzi COI sequences. Sequences starting in an asterisk were contributed by the current study; all other sequences were sourced from GenBank. The figures are in percentage (%) and 0 represents the sequence divergence value being < 0.005 %

AY921417 SASPDL01* AF308970 SASPDL02* SAMYDL01* SAMYDL02* SASPDL03* D. lumholtzi AY921417 1 0 1 0 4 3 7 SASPDL01* 1 1 0 2 4 2 7 AF308970 0 1 1 0 3 4 7 SASPDL02* 1 0 1 1 4 3 7 SAMYDL01* 0 2 0 1 4 4 7 SAMYDL02* 6 5 7 5 7 3 9 SASPDL03* 4 3 4 3 4 3 8 D. lumholtzi 9 9 9 8 9 14 11 0

195

Supplementary Table III. Percentage pairwise divergence matrix, both raw (p- distance, lower left) and corrected (ML), for D. carinata s.str COI sequences.

Sequences starting in an asterisk were contributed by the current study; all other sequences were sourced from GenBank. The figures are in percentage (%) and 0 represents the sequence divergence value being < 0.005 %

YDC04*

D.magniceps SAM SAMYDC03* SAMYDC02* SAMYDC01* D. carinata D.magniceps D. magniceps 6 6 6 6 12 19 SAMYDC04* 7 0 0 0 11 17 SAMYDC03* 7 0 0 0 11 17 SAMYDC02* 7 0 0 0 11 17 SAMYDC01* 7 0 0 0 17 D. carinata 21 17 17 17 17 17 D.magniceps 40 36 36 36 36 37

196

Supplementary Table IV. Percentage pairwise divergence matrix, both raw (p-distance, lower left) and corrected (ML), for

Ceriodaphnia complex COI sequences. Sequences starting in an asterisk were contributed by the current study; all other sequences were sourced from GenBank. The figures are in percentage (%) and 0 represents the sequence divergence value being < 0.005 %

spp

C. spp C. spp C. ZPLMX458 SASP0003* SAMYP001* SAMYP002* SAMYP003* SASP0001* SASP0005* C cf. rigaudi ZPLMX449 ZPLMX470 2 C cf. rigaudi dubia C. ZPLCA027 laticaudata C cf. acanthina C cf. laticaudata C cf. C cf. reticaulata SAMYPCom4* SAMYPCom1* SAMYPCom3* SASPACom1* SAMYPCom7* 16 - 17 - 19 - 15 21 19 19 19 20 19 19 17 14 17 17 18 18 18 19 17 17 17 17 18 C. spp 17 18 20 18 - 18 - 18 - 18 - 18 - 18 - 18 - 15 - 18 - 77 2-3 17 16 17 19 20 20 21 19 18 19 18 18 19 C. spp 19 19 19 19 19 19 19 17 19 78 0 - 1 17 20 20 21 20 18 19 18 18 19 - 19 - 18 - 18 - 18 - 19 - 19 - 18 - 16 - 20 - 20 - - 2-4 (0 - 17 ------20 20 20 19 19 19 20 20 19 18 21 21 C. spp 91 1) 18 21 21 22 22 19 20 19 19 ZPLMX 71 - 19 - 20 - 92 69 20 19 19 20 20 20 21 19 17 21 20 21 20 21 20 20 20 20 21 458 72 20 21 SASP00 89 - 14 - 19 - 18 - 91 88 103 2 2 3 1 1 17 15 15 20 20 21 20 18 18 18 17 18 03* 91 15 20 19 SAMYP 89 - 14 - 20 - 18 - 91 88 103 3 0 0 1 1 16 15 15 21 20 21 20 17 17 17 17 18 001* 90 15 21 19 SAMYP 89 - 14 - 20 - 18 - 91 88 103 3 0 0 1 1 16 15 15 21 20 21 20 17 17 17 17 18 002* 90 15 21 19 SAMYP 89 - 14 - 20 - 18 - 91 88 103 3 0 0 1 1 16 15 15 21 20 21 20 17 18 17 17 18 003* 90 15 21 19 SASP00 88 - 14 - 19 - 90 87 102 1 2 2 2 0 16 15 15 20 20 21 20 18 17 18 17 17 18 01* 89 15 21 86 88 - 14 - 19 - SASP00 90 - 101 2 1 1 2 0 16 15 15 20 20 21 20 18 17 18 17 17 18 89 15 20 05* 87 72 0 - 1 74 - 87 - 62 - 62 - 60 - 17 - 16 - C cf. 76 - 62 62 61 (0 - 14 15 14 18 19 20 18 17 18 17 17 18 76 88 63 63 61 19 17 rigaudi 73 1) ZPLMX 71 - 53 - 14 - 72 69 84 69 69 69 69 67 67 14 17 18 19 20 19 17 17 17 17 17 17 449 72 54 15 ZPLMX 76 - 15 - 78 75 90 64 64 64 64 63 63 49 55 6 16 16 17 17 18 15 17 15 15 17 470 77 16 C cf. 70 67 48 0 - 1 16 17 18 18 16 17 16 16 17 68 - 82 - 56 - 56 - 56 - 56 - 55 - 55 - 41 - 10- 16 - 16 - rigaudi - - - (0 ------70 83 57 57 57 57 56 56 42 11 17 17 2 71 68 49 1) 17 18 19 19 17 18 17 17 18 197

87 96 110 110 110 110 0 - 2 19 98 - 95 - 89 - 10- - - 111 - - - - 109 109 92 97 (0 - 1-2 11 11 14 18 19 18 18 - 99 96 91 11 C. dubia 88 97 111 111 111 111 2) 20 94 96 - 93 - 14 - ZPLCA 86 - 109 109 108 108 109 107 107 90 95 88 2 10 11 11 18 19 18 18 19 97 94 15 027 95 C cf. 101 19 90 - 87 - 82 - 21 - 13 - laticaud 80 89 104 103 103 103 103 102 - 84 90 - 4 1 18 19 18 18 20 91 88 83 22 14 ata 102 20 C cf. 94 96 - 93 - 88 - acanthi 86 - 109 109 108 108 109 107 107 90 95 27 25 6 4 14 19 20 19 18 21 97 94 89 na 95 C cf. 92 - 89 - 84 - laticaud 82 91 105 105 105 105 105 104 103 86 91 23 21 2 5 14 19 20 19 18 20 93 90 85 ata C cf. 86 95 109 109 109 109 108 107 90 96 45 39 45 41 96 - 110 93 - 88 - 47 - 0 - 3 reticaul ------17 18 17 17 19 100 -112 97 91 50 (1 -3) ata 88 97 111 111 111 111 110 110 93 98 48 42 48 44 SAMYP 92 - 89 - 84 - 82 91 106 105 105 105 105 104 103 86 92 72 70 65 70 66 73 5 0 0 6 Com4* 93 90 85 96 98 - 95 - 89 - 77 - SAMYP 88 - 111 111 110 110 111 109 109 92 97 76 70 76 72 79 8 6 6 0 99 96 90 78 Com1* 97 SAMYP 92 - 84 - 82 91 106 105 105 105 105 104 104 90 86 92 72 70 65 70 67 73 0 8 0 6 Com3* 94 85 SASPA 93 - 90 - 84 - 72 - 82 91 106 105 105 105 105 104 104 87 92 71 65 71 67 73 0 8 0 6 Com1* 94 91 85 73 SAMYP 98 - 90 - 88 97 112 111 111 111 111 110 110 96 92 98 78 76 71 76 73 79 8 1 9 9 Com7* 100 91

198

Supplementary Table V. Percentage pairwise divergence matrix, both raw (p-distance, lower left) and corrected (ML), for Chydorus complex COI sequences. Sequences starting in an asterisk were contributed by the current study; all other sequences were sourced from

GenBank. The figures are in percentage (%) and 0 represents the sequence divergence value being < 0.005 %

brevilabris

C. brevilabris Chydorus sp C. sphaericus SAMYPCE001* SAMYPCE002* C. sphaericus Chydorus spp C. sphaericus C. C. brevilabris 16 16 15 15 14 16 14 - 15 2 Chydorus sp 34 5 4 4 9 11 16 16 C. sphaericus 35 6 3 3 8 11- 12 16 17 SAMYPCE001* 34 5 3 8 11 15 15 - 16 SAMYPCE002* 34 5 3 0 8 11 15 15 - 16 C. sphaericus 31 13 14 12 12 10 16 14 Chydorus spp 32 20 20 19 19 16 18 16 C. sphaericus 27 - 28 41 - 42 42 40 - 41 40 - 41 38 39 - 40 0 - 1 (1) 16 C. brevilabris 2 37 38 36 36 34 35 30

199

Supplementary Table VI. Percentage pairwise divergence matrix, both raw (p-distance, lower left) and corrected (ML), for Boeckella spp. COI sequences. Sequences starting in an asterisk were contributed by the current study; all other sequences were sourced from GenBank. The figures are in percentage (%) and 0 represents the sequence divergence value being < 0.005 %

meteoris B. bergi B. B. poppei B. B. gracilis B. antiqua B. B. gibbosa B. B.titicacae B. michaelseni BTRIMYP2* BTRIMYP1* BTRIMYP3* gracilipes B. B.poopoensis BSYMMSP1* brasilienss B. BSYMMYP1* B. diamantina B. B. 18 18 19 19 18 17 18 18 - 19 17 - 18 19 19 21 20 17 17 - 19 19 - 21 michaelseni 16 - B. gracilis 60 12 17 17 16 16 16 13 14 - 15 15 14 18 14 - 15 14 - 17 17 - 19 17 14 - B. bergi 61 27 17 16 17 17 17 14 15 14 18 15 14 - 15 16 - 17 18 - 19 15 16 - BSYMMYP1* 78 55 56 0 10 10 11 15 - 16 16 16 17 17 16 - 17 15 - 17 19 - 21 17 BSYMMSP1* 78 54 55 1 10 10 10 15 16 16 16 17 17 17 15 - 17 19 - 21

BTRIMYP2* 73 50 50 19 19 0 0 14 14 16 16 18 18 16 14 - 16 18 - 19

BTRIMYP1* 73 50 51 20 19 0 0 14 - 15 14 16 16 18 18 16 14 - 17 18 - 19

BTRIMYP3* 74 50 51 20 19 0 0 14 - 15 14 17 16 19 18 16 14 - 17 18 - 19

61 - 38 - 38 - 44 - 43 - 38 - 39 - 39 - 0 - 3 17 - B. brasilienss 12-13 12 11 16 15 - 16 13 - 16 16 - 18 63 39 40 45 44 40 40 40 (2) 18 66 - 43 - 48 - 43 - 43 - 0 - 1 15 - B. poppei 43 48 44 26 - 28 13 12-13 18 15 16 - 18 19 - 20 67 44 49 44 44 (1) 16 B. gibbosa 65 41 42 47 46 42 42 42 27 - 29 32 - 33 10-11 16 18 15 - 16 15 - 17 18 - 20

39 - 40 - B. antiqua 63 40 45 45 40 40 25 - 27 30 - 31 20 14 19 16 - 17 15 - 17 18 - 20 40 41 80 - 57 - 19 - B. diamantina 57 58 63 62 58 58 43 - 44 47 - 48 37 30 -31 19 - 20 18 - 20 20 - 22 81 58 20 63 - 67 - 69 - B.poopoensis 49 50 67 62 63 63 50 - 52 55 - 56 54 52 15 - 16 17 - 20 18 - 19 64 68 70 56 - 42 - 42 - 60 - 59 - 55 - 55 - 55 - 46 - 44 - 62 - 38 - 0 - 6 (0 - B. meteoris 43 - 46 47 - 49 15 - 18 17 - 19 57 43 44 61 61 56 56 56 48 46 63 40 4) 51 - 46 - 47 - 64 - 63 - 59 - 59 - 59 - 50 - 49 - 66 - 49 - 0 - 3 (0 - B. gracilipes 47 - 52 52 - 56 41 - 46 13 - 15 55 49 50 67 67 62 62 63 54 52 70 52 2) 56 - 50 - 51 - 69 - 68 - 63 - 64 - 64 - 55 - 53 - 70 - 54 - 0 - 6 (0 - B.titicacae 51 - 56 56 - 61 46 - 52 27 - 35 61 55 56 73 73 68 68 68 60 58 75 58 5)

200

Supplementary Table VII. Percentage pairwise divergence matrix, both raw (p- distance, lower left) and corrected (ML), for Calamoecia spp. COI sequences.

DQ437741 SASPCA02* SAMYCA02* SAMYCA04* SAMYCA03* SASPCA03* SAMYCA01* C. clitellata DQ437741 17 17 17 16 16 17 17 - 19 SASPCA02* 43 1 1 1 1 1 20 - 21 SAMYCA02* 43 0 0 0 0 0 20 - 21 SAMYCA04* 43 0 0 0 0 0 20 - 21 SAMYCA03* 43 0 0 0 0 0 20 - 21 SASPCA03* 43 0 0 0 0 0 20 - 21 SAMYCA01* 43 1 1 1 1 1 20 - 21 C. clitellata 62 - 67 67 - 72 67 - 72 67 - 72 67 - 72 67 - 72 67 - 72 0 - 4 (0 - 4)

201

Supplementary Fig. 1.

202

Supplementary Fig. 2.

203

Chapter 6 : Are “Universal” DNA primers really universal?

Pranay Sharma 1 and Tsuyoshi Kobayashi 2

1 School of Earth and Environmental Science, University of Adelaide, Adelaide,

Australia.

2 Science Division, Office of Environment and Heritage NSW, Department of Premier and Cabinet, PO Box A290, Sydney South, New South Wales 1232, Australia.

1Corresponding Author:

E-mail address: [email protected].

Telephone number: +61 8 8313 6207

Fax number: +61 8 8313 6222

204

205

A Sharma, P. & Kobayashi, T. (2014) Are "universal" DNA primers really universal? Journal of Applied Genetics, online May 2014

NOTE: This publication is included on pages 206-217 in the print copy of the thesis held in the University of Adelaide Library.

It is also available online to authorised users at:

http://doi.org/10.1007/s13353-014-0218-9

206

Chapter 7 – General Conclusions

This study provides a detailed investigation in identifying three Ceriodaphnia spp. from Australia, using both classical and molecular methods. These techniques were used initially to identify and barcode zooplankton diversity from two South

Australian (SA) reservoirs which resulted in the identification of cryptic species within the genus Ceriodaphnia. The genetic approach included standardizing DNA extraction and amplification protocol for common cladocerans and calanoids in two

SA reservoirs (Chapter 5), the revised taxonomic key for Ceriodaphnia produced and presented in Chapter 3, is built on the previous work of Shiel, 1995 and Kořinek,

2002, but now includes two additional species C. planifrons and C. spinata, will be more helpful. Work was also undertaken to develop a molecular approach for identification of these species, DNA barcoding was deemed effective for discriminating various species and the most well supported phylogeny was produced when additional mitochondrial marker (16s) and nuclear marker (28s) were used for inference (Chapters 2, 4 and 5). This is the first time that a genetic dataset for

Ceriodaphnia has been generated from Australia. The variations in the primer region of the mitochondrial molecular marker were studied by comparing 725 COI sequences from Kingdom Animalia. The Universal primers (LCO 1490 and HCO

2198) consisting of 25 bp and 26 bp in length were designed from three coding and six anticoding strands by comparing the conserved regions across 15 species of COI genes. These primers were found to be successful in amplifying 710 bp COI gene for more than 80 invertebrate species. However, with increasing the number of invertebrate sequences, it was found that the Folmer primer, especially LCO 1490 showed higher incompatibilities in the priming site, compared with HCO 2198, explaining the low amplification success rate and a need to design versatile forward primers for studies across taxonomic groups (Chapter 6). 218

The discovery of a cryptic species within Ceriodaphnia from two SA reservoirs increased the scale of this research to different states in Australia. Samples were obtained from the personal collections of Dr Russel Shiel and Dr Tsuyoshi

Kobayashi, and also collected by various contractors dating from 2000 - 2001. Most of these samples, 80 %, were stored in 100 % denatured ethanol and the remainder stored in formalin. For this genetic study, only samples stored in ethanol were used.

Before carrying out any taxonomic study of Ceriodaphnia specimens, their images were first digitized and then DNA extraction and amplification were carried out on ephippia obtained from the mature females (Chapters 2, 4 and 5).

The taxonomy of Ceriodaphnia is not well established and no study to date has completely resolved the number of species in this genus. The revised taxonomic key facilitates the species- level identification of female Australian Ceriodaphnia included the original descriptions and images of holotypes e.g. C. pulchella (Sars

1890; 1894), C. cornuta (Sars, 1885). This study also provides a complete description for three non-beaked species C. dubia and C. spinata and an unpublished new species (C. sp. 1), and includes drawings of trunk appendages (Chapter 3). Due to the complexity involved in morphological identification and cryptic speciation in

Ceriodaphnia, and the lack of informative characters, molecular techniques were used for a better understanding of genetic diversity. Australian Ceriodaphnia have been studied using two mitochondrial DNA (COI and 16s) and one nuclear DNA

(28s gene). The phylogenetic trees based on two mitochondrial (COI and 16s) and one nuclear (28s) genes, have identical topologies. Molecular analysis (Chapter 4,

Figs 19 and 20) indicates the presence of three distinct Ceriodaphnia species. This was also well supported by morphological analyses which showed consistent differences of ten key characters, among C. dubia, C. sp. 1 and C. spinata. The

219

mitochondrial and nuclear DNA sequences of specimens identified as Ceriodaphnia cf. cornuta showed the presence of three putative species, each with a high bootstrap support of 70 to 100 %. Moreover, mitochondrial and nuclear genetic analysis of

Ceriodaphnia cf. cornuta (Chapter 2) also supported three distinct clades in

Australia, with a strong bootstrap support, each probably representing a species.

The provisional species delineation standard of 10 times the intra–population species as proposed by Hebert et al. (2004) is found to be inconclusive in this study. The standard species delineation of Hebert (2004) is not applied in this study due to limited taxonomic knowledge and genetic information available for valid species from Ceriodaphnia.

It is widely acknowledged, and reflected in the Linnaean taxonomic system, that living organisms fall into largely discrete groupings recognizable by differences in morphology or other traits. It is the role of taxonomy to define and name these groupings. However, their recognition may be difficult because diagnostic traits are lacking, or species divergences are very small. Hence, even in cases of biologically distinct species, their delineation will depend on the thoroughness of the study and the interpretation of complex, sometimes variable, traits. Further, the accuracy of species delineation depends on the degree of sampling, as local variation may affect the conclusions about population separation. As more molecular data for

Ceriodaphnia become available, they will help to determine the intrinsic value to measure the distance for species delineation. The concept of a molecular clock has not been explored in detail in this work due to large COI divergence rates of 1.4 to

4.96 % per MYR for invertebrates. This is because the historical descriptions on

Ceriodaphnia remains a complex task, and is dependent on variables that include

220

individual life histories. The rate of molecular evolution is also demonstrated to differ across taxa, size, metabolic rate and generation time (Martin and Palumbi

1993).

DNA barcoding is widely accepted and has been seen as an aid to morphological taxonomic work by flagging genetically distinct lineages and rapidly identifying cryptic species. The gene of interest for most barcodes is 700 base pairs of a single molecular marker such as COI gene from the mitochondrial region. The main advantage of using the COI gene is the presence of robust primer locations and its ability to identify an individual to species using a very small amount of tissue. The most commonly used primers are Universal primers LCO 1490 and HCO 2198

(Folmer, Black et al. 1994a). In the current research I found that the universal primer failed most of the time to amplify the target gene, and is one of the reasons why species-specific primers are designed which requires reference sequences of the entire gene of interest in the current case its COI. This led to further study to understand the primer mismatch region in the COI gene (Chapter 6).

The variations in the primer region of the mitochondrial molecular marker were studied by comparing 725 COI sequences from the animal kingdom. The Universal primers (LCO 1490 and HCO 2198) which are 25 bp and 26 bp in length (HCO

2198) were designed from three coding and six anticoding strand by comparing the conserved regions across 15 species of COI genes. These primers were found to be successful in amplifying the 710 bp COI gene for more than 80 invertebrate species.

However, in this study it was found that for 177 invertebrate species, the forward primer (LCO 1490) showed only four conserved regions which further reduced to one conserved region for echinoderms. Whereas for ascidian, fungi and vertebrates it

221

showed approximately 50 % conserved regions. However, the reverse primer (HCO

2198) is highly conserved across the 725 COI primer sequences. A similar pattern is observed in amino acid distribution. The study carried out at different taxonomic level revealed that it is possible to design forward primers from reference sequences belonging to either the level Order (with maximum 5 bp differences), Family

(maximum 6 bp differences) or Genus (maximum 1 bp difference). Reverse primers can be designed from the level of Family (maximum 5 bp differences) or Genus

(maximum 2 bp differences). It also showed that the newly designed three forward primers from the level of Order (Primer F1), Family (Primer F5) and Genus (Primer

F7) (see Appendix 4), which have been tested only theoretically using the primer blast service provided by NCBI was more efficient when compared with LCO 1490.

The test strongly supports that an automated system can be developed in future, where a user can obtain a suggestion of primers that can be tested for a taxonomically related group when there is no reference sequence available for a particular species.

This research has made a novel and diverse contribution to our knowledge of the

Australian zooplankton species, with a special emphasis on Australian Ceriodaphnia.

The work documented here provides three alternative methods of identification for a broad range of users: a revised taxonomic key of Ceriodaphnia for experts; a detailed trunk appendages drawing for the three identified species; and a molecular identification method.

222

Future Directions

This work has provided a strong platform based on a combined genetic and morphological approach to identify three species within genus Ceriodaphnia, but to fully understand the processes promoting cryptic diversity further studies in ecology, physiology and morphology are needed to strengthen the case whether there is speciation occurring among various species. The results from the present study are based on a relatively small number of species, but have already demonstrated the general feasibility of using DNA based methods in the discovery of new species, even in a poorly characterized group like Ceriodaphnia. While more research is needed to establish a species delineation value, using DNA will include coalescent method i.e both phylogenetic and phenetic threshold.

223

References Abel, L.R., Parfitt, S., Ashton, N., Lewis, G.S., Scott, B., and Stringer, C. (2011). Digital preservation and dissemination of ancient lithic technology with modern micro-CT. Computer and Graphics 35, 878-884.

Adamowicz, S.J., Hebert, P.D.N., and Marinone, M.C. (2004). Species diversity and endemism in the Daphnia of Argentina: a genetic investigation. Zoological Journal of the Linnean Society 140, 171–205.

Adams, J. (2005). Nuclear and Mitochondrial DNA In the Courtroom. Brook Law, 69-97.

Akaike, H. (1974). A new look at the statistical model identification. A New Look at the Statistical Model Identification, 716-723.

Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P. (2002). 'Molecular Biology of the Cell.' 5th edn. (Garland Science: New York.) pp. 1,392.

Alonso, M. (1996). 'Crustacea Branchiopoda.' (Madrid.). Museo Nacional de Ciencias Naturales.Madrid, España Consejo Superior de Investigaciones Cientificas.

Andersson, J.O. (2005). Lateral gene transfer in eukaryotes. Cellular and Molecular Life Sciences 62(11), 1182-1197.

Andreson, R., Möls, T., and Remm, M. (2008). Predicting failure rate of PCR in large genomes. Nucleic Acids Research 36 (11): e66. DOI: 10.1093/nar/gkn290.

Angelini, R., and Petrere Jr, M. (2000). A model for the plankton system of the Broa reservoir, São Carlos, Brazil. Ecological Modelling 126(2-3), 131-137.

April, J., Mayden, R.L., Hanner, R.H., and Bernatchez, L. (2011). Genetic calibration of species diversity among North America's freshwater fishes. Proceedings of the National Academy of Sciences 108 (26), 10602-10607.

Arbogast, B. S., Edward, S. V., Wakele, J., Beerl, P., and Slowinski, J. B. (2002). Estimating divergence times from molecular data on phylogenetic and population genetic timescales. Annual Review of Ecology and Systematics 33, 707–40.

Arimoro, O. F, and Oganah, O.A. (2010). Zooplankton community responses in a perturbed tropical stream in the Niger Delta, Nigeria The Open Environmental & Biological Monitoring Journal 3, 1-11.

Avise, J.C. (2000). 'Phylogeography: The history and formation of species.' (Harvard University Press.: Cambridge (Massachusetts). pp. 447.

Avise, J. C. (2004). 'Molecular markers, natural history and evolution.' (Sinauer Associates: Sunderland (Massachusetts). pp. 242.

224

Avise J.C., and Walker, D. (1998). Pleistocene phylogeographic effects on avian populations and the speciation process. Proceedings of the Royal Society B: Biological Sciences 265, 457–463.

Baird, D.J., Pascoe, T.J., Zhou, X., and Hajibabaei, M. (2011). Building freshwater macroinvertebrate DNA-barcode libraries from reference collection material: formalin preservation vs specimen age. Journal of the North American Benthological Society 30 (1), 125-130.

Ballard, J.W.O., and Whitlock, M.C. (2004). The incomplete natural history of the mitochondria. Molecular Ecology 13, 729-744.

Bayly, I.A.E. (1962). Additions to the Inland water Genus Calamoecia (Copepoda: Calanoida). Marine and Freshwater Research 13 (3), 252-264.

Bayly, I.A.E. (1995). Distinctive aspects of the zooplankton of large lakes in Australasia, Antarctica and South America. Marine and Freshwater Research 46, 1109–1120.

Bayly, I.A.E. (1992). 'The non-marine Centropagidae (Copepoda: Calanoida) of the world. Guides to the identification of the microinvertebrates of the continental waters of the world. Vol. 2. Pp. 1-30. (SPB Academic bv, The Hague.).

Bayly, I.A.E. (1964). A Revision of the Australasian species of the freshwater genera Boeckella and Hemiboeckella (Copepoda: Calanoida). Australian Journal of Marine and Freshwater Research 15, 180-238.

Benita, Y., Oosting, R.S., Lok, M.C., Wise, M.J., and Humphery-Smith, I. (2003). Regionalized GC content of template DNA as a predictor of PCR success. Nucleic Acids Research 31(16), e99.

Bensasson, D., Zhang, D., Hartl, L. D., and Hewitt, M.G. (2001). Mitochondrial pseudogenes: evolution’s misplaced witnesses. Trends in Ecology & Evolution 16, 314-321.

Benzie, J.A.H. (1988). The systematics of Australian Daphnia (Cladocera: Daphniidae). Species descriptions and keys. Hydrobiologia 166 (2), 95-161.

Benzie, J.A.H. (1986a). Daphnia occidentalis, New Species (Cladocera: Daphniidae) from Western Australia: New Evidence on the Evolution of the North American D. ambigua-D. middendorffiana Group. Journal of Crustacean Biology 6 (2), 232-245.

Benzie, J.A.H. (1986b). The systematics of Australian Daphnia (Cladocera : Daphniidae). multivariate morphometrics. Australian Journal of Marine and Freshwater Research 37, 251-60.

Bergstrom, C.T., and Pritchard, J. (1998). Germline bottlenecks and the evolutionary maintenance of mitochondrial genomes. Genetics 149 (4), 2135-2146.

225

Berner, D. (1986). Taxonomy of Ceriodaphnia (Crustacea: Cladocera) in U.S. Environmental Protection Agency Cultures. Environmental Monitoring and Support Laboratory, Cincinnati.

Berner, D., and Rakhmatullaeva, G. (2001). A new species of Ceriodaphnia from Uzbekistan and Kazakhstan. Hydrobiologia 442, 29–39.

Berner, D. (1987). Significance of head and carapace pores in Ceriodaphnia (Crustacea, Cladocera). Hydrobiologia 145(1), 75-84.

Berner, D. (1994). On the Freshwater Crustaceans Occurring in the Vicinity of Christiania by G. O. Sars. Journal of Crustacean Biology 14(3), 609-611.

Birge, A.E. (1879). Notes on Cladocera. Department of Natural Sciences, Wisconsin Academy of Sciences, Arts and Letters.

Birky, C. (2007). Workshop on barcoded DNA: application to rotifer phylogeny, evolution, and systematics. Hydrobiologia 593(1), 175-183.

Birky , C.W Jr (1995). Uniparental inheritance of mitochondria and chloroplast genes: mechanisms and evolution. Proceedings of the National Academy of Sciences 92 (11331 -11338).

Bissett, A., Gibson, J., Jarman, S., Swadling, K., and Cromer, L. (2005). Isolation, amplification, and identification of ancient copepod DNA from lake sediments. Limnology and Oceanography: Methods 3 533-542.

Blankenship, L.E., and Yayanos, A.A. (2005). Universal primers and PCR of gut contents to study marine invertebrate diets. Molecular Ecology 14 (3), 891-899.

Bock, G.D., Zhan, A., Lejeusne, C., MacIssac, J., H, and Cristescu, E.M. (2011). Looking at both sides of the invasion: patterns of colonization in the violet tunicate Botrylloides violaceus. Molecular Ecology 20, 503–516.

Boehme, P., Amendt, J., and Zehner, R. (2011). The use of COI barcodes for molecular identification of forensically important fly species in Germany. Parasitology Research, 1-8.

Bradford, T., Adams, M., Humphreys, W.F., Austin, A.D., and Cooper, S.J.B. (2010). DNA barcoding of stygofauna uncovers cryptic amphipod diversity in a calcrete aquifer in Western Australia’s arid zone. Molecular Ecology Resources 10 (1), 41-50.

Branton, D., Deamer, W., D, Marziali, A., Bayley, H., Benner, A., S, Butler, T., Di Ventra, M., Garaj, S., Hibbs, A., Huang, X., Jovanovich, B., S, Krstic, S., P, Lindsay, S., Sean Ling, X., Mastrangelo, H., C, Meller, A., Oliver, S., O, Pershin, V., Y, Ramsey, M., J, Riehn, R., Soni, V., G, Tabard-Cossa, V., Wanunu, M., Wiggin, M., and Schloss, A., J (2008 ). The potential and challenges of nanopore sequencing. Nature Biotechnology 26 (10), 1146–1153.

Brehm, V. (1953). Contributions to the freshwater microfauna of Tasmania-Part 2. Papers and Proceedings of the Royal Society of Tasmania (87), 63-72. 226

Breslauer, K.J., Frank, R., Blocker, H., and Marky, L.A. (1996). Predicting DNA duplex stability from the base sequence. Proceedings of the National Academy of Sciences 83 (11), 3746-3750.

Brookes, D.J., Hipsey, R.M., Burch, D.M., Regel, H.R., Linden, G.L., Ferguson, M.C., and Antenucci, P.J. (2005). Relative value of surrogate indicators for detecting pathogens in Lakes and Reservoirs. Environmental Science & Technology 39, 8614- 8621.

Brower, A.V. (1994). Rapid morphological radiation and convergence among races of the butterfly Heliconius erato inferred from patterns of mitochondrial DNA evolution. Proceedings of the National Academy of Sciences 91 (14), 6491-6495.

Brown, M.W., George, M.R., and Wilson, C.A. (1979). Rapid evolution of animal mitochondrial DNA. Proceedings of the National Academy of Sciences 76 (4), 1967- 1971.

Bucklin, A., Guarnieri, M., Hill, R.S., Bentley, A.M., and Kaartvedt, S. (1999). Taxonomic and systematic assessment of planktonic copepods using mitochondrial COI sequence variation and competitive, species-specific PCR. Hydrobiologia 401(0), 239-254. [In English]

Buhay, E.J. (2009). ‘‘COI-Like’’ Sequences are becoming problematic in molecular systematic and DNA Barcoding studies. Journal of Crustacean Biology 29(1), 96– 110.

Bunn, S.E., Thoms, M.C., Hamilton, S.K., and Capon, S.J. (2006). Flow variability in dryland rivers: Boom, bust and the bits in between. River Research and Applications 22, 179 – 186.

Burckhardt, G. (1899). Faunistische und systematische Untersuchungen iiber das Zooplankton der groDeren Seen der Schweiz und ihrer Grenzgebiete. Revue Suisse de Zoologie 7, 353-715.

Burns, C.W., and Galbraith, L.M. (2007). Relating planktonic microbial food web structure in lentic freshwater ecosystems to water quality and land use. Journal of Plankton research 29 (2), 127-139.

Cáceres, C.E., and Hairston, N.G.J. (1998). Benthic-pelagic coupling in freshwater zooplankton: The role of the benthos. Archiv für Hydrobiologie. Advances in Limnology 52, 163-174.

Campillo, S., García-Roger, E.M., Carmona, M.J., Gómez, A., and Serra, M. (2009). Selection on life-history traits and genetic population divergence in rotifers. Journal of Evolutionary Biology 22 (12), 2542-2553.

Cantu, D., Govindarajulu, M., Kozik, A., Wang, M., Chen, X., Kojima, K.K., Jurka, J., Michelmore, R.W., and Dubcovsky, J. (2011). Next Generation Sequencing provides rapid access to the genome of Puccinia striiformis f. sp. tritici, the causal agent of Wheat stripe Rust. PLoS ONE 6 (8), e24230.

227

Cassis, G. Proceedings of the National Taxonomy Forum. 2007, Australian Museum, Sydney,NSW. (Ed. K Hall). http://www.environment.gov.au/node/13662.

Castro, J., Picornel, A., and Ramon, M. (1998). Mitochondrial DNA: a tool for population genetics studies. International Microbiology 1, 327-332.

Chen, H., Rangasamy, M., Tan, S.Y., Wang, H., and Siegfried, B.D. (2010). evaluation of five methods for total DNA extraction from Western Corn rootworm beetles. PLoS ONE 5(8), e11963.

Chen, X., Prosser, R., Simonetti, S., Sadlock, J., Jagiello, G., and Schon, E., A (1995). Rearranged mitochondrial genomes are present in human oocytes. American Journal of Human Genetics 57, 239-247.

Chomyn, A., and Attardi, G. (1987). Mitochondrial gene products. Current Topics in Bioenergetics 15, 295-329.

Christianson, M.L. (2005). Codon usage patterns distort phylogenies from or of DNA sequences. American Journal of Botany 92(8), 1221-1233.

Clayton, D.A. (1984). Transcription of the mammalian mitochondrial genome. Annual Review of Biochemistry 53, 573-94

Coker, E. (1926). Plankton Collections in Lake James. Journal of the Mitchell Society, 228-258.

Colbourne, J.K, and Hebert, P.D.N. (1996). The systematics of North American Daphnia (Crustacea: Anomopoda): a molecular phylogenetic approach. Philosophical Transactions of the Royal Society B: Biological Sciences 351, 349- 360.

Colbourne, J.K., Pfrender, M.E., Gilbert, D., Thomas, W.K., Tucker, A., Oakley, T.H., Tokishita, S., Aerts, A., Arnold, G.J., Basu, M.K., Bauer, D.J., Cáceres, C.E., Carmel, L., Casola, C., Choi, J.-H., Detter, J.C., Dong, Q., Dusheyko, S., Eads, B.D., Fröhlich, T., Geiler-Samerotte, K.A., Gerlach, D., Hatcher, P., Jogdeo, S., Krijgsveld, J., Kriventseva, E.V., Kültz, D., Laforsch, C., Lindquist, E., Lopez, J., Manak, J.R., Muller, J., Pangilinan, J., Patwardhan, R.P., Pitluck, S., Pritham, E.J., Rechtsteiner, A., Rho, M., Rogozin, I.B., Sakarya, O., Salamov, A., Schaack, S., Shapiro, H., Shiga, Y., Skalitzky, C., Smith, Z., Souvorov, A., Sung, W., Tang, Z., Tsuchiya, D., Tu, H., Vos, H., Wang, M., Wolf, Y.I., Yamagata, H., Yamada, T., Ye, Y., Shaw, J.R., Andrews, J., Crease, T.J., Tang, H., Lucas, S.M., Robertson, H.M., Bork, P., Koonin, E.V., Zdobnov, E.M., Grigoriev, I.V., Lynch, M., and Boore, J.L. (2011). The Ecoresponsive Genome of Daphnia pulex. Science 331 (6017), 555-561.

Coleman, O.C. (2003). "Digital inking": How to make perfect line drawings on computers. Organisms Diversity & Evolution Electronic Supplement 3 (14), 1 - 14.

Collura, R.V, and Stewart, C.B. (1995). Insertions and duplications of mtDNA in the nuclear genomes of Old World monkeys and hominoids. Nature (378), 485-489.

Cox, A.J., and Hebert, P.D.N. (2001). Colonization, extinction, and phylogeographic patterning in a freshwater crustacean. Molecular Ecology 10 (2), 371-386. 228

Crick, F.H. (1966). Codon–anticodon pairing: The wobble hypothesis. Journal of Molecular Biology 19, 548–555.

Cummins, J.M. (2001). Mitochondria: potential roles in embryogenesis and nucleocytoplasmic transfer. Human Reproduction Update 7, 217-228.

Daday, V.E. (1905). Untersuchungen über die : Süsswasser-Mikrofauna Paraguays. Stuttgart. pp. 349.

Dana, J. (1853). United States Exploring Edition during the years 1838-1842. In 'Crustacea. Vol. 14.'. (Sherman,C.: Philadelphia.). pp. 318.

Davis, J.I, and Nixon, K.C. (1992). Populations, genetic variation, and the delimitation of phylogenetic species. Syst. Biol. 41, 421–435.

De Gelas, K., and De Meester, L. (2005). Phylogeography of Daphnia magna in Europe. Molecular Ecology 14 (3), 753-764.

De Melo, R., and Hebert, P. D.N (1994). A taxonomic reevaluation of North American Bosminidae. Canadian Journal of Zoology 72, 1808–1825.

Dentinger, B.T.M, Margaritescu, S.A, and Moncalvo, J.M. (2010). DNA BARCODING : Rapid and reliable high-throughputmethods of DNA extraction for use in barcoding and molecular systematics of mushrooms. Molecular Ecology Resources. 10, 628–633.

Derycke, S., Vanaverbeke, J., Rigaux, A., Backeljau, T., and Moens, T. (2010). Exploring the Use of Cytochrome Oxidase c Subunit 1 (COI) for DNA Barcoding of free-Living marine Nematodes. PLoS ONE 5 (10), e13716.

Dieffenbach, C.W., and Dveksler, G.S. (2003). 'PCR Primer: A Laboratory Manual.' (Cold Spring, Harbor laboratory Press: USA.). pp. 520.

Dieffenbach, C.W., Lowe, T.M.J., and Dveksler, G.S. (1993). General concepts for PCR primer design. In: PCR Methods and Applications, Cold Spring Harbor Laboratory. In '. Vol. 3.' pp. S30-S37. (Cold Spring Harbor Laboratory Press.)

Doublet, V., Raimond, R., Grandjean, F., Lafitte, A., Souty-Grosset, C., and Marcadé, I. (2012). Widespread atypical mitochondrial DNA structure in isopods (Crustacea, Peracarida) related to a constitutive heteroplasmy in terrestrial species. Genome 55 (3), 234-244.

Du, G.S.L., Xiao-Duan; Song, Fu; Liu, Jing and Hua, Zhen-Ling (2004). Study on plankton community in Miyun reservoir. Xibei Zhiwu Xuebao 24 (8), 1485-1488. [In Chinese]

Dussart, B., and Defaye, D. (2002). World Directory of Crustacea Copepoda of Inland waters. I Calaniformes, Backhuys,Leiden.

Dvorak, J., Luo, M.C., and Yang, Z.L. (1998). Restriction fragment length polymorphism and divergence in the genomic regions of high and low recombination 229

in self-fertilizing and cross-fertilizing Aegilops species. Genetics 148 (1), 423-434. [In English]

Eisen, J.A. (2000). Horizontal gene transfer among microbial genomes: new insights from complete genome analysis. Current Opinion in Genetics & Development 10 (6), 606-611.

Ekman, S. (1900). Cladoceren aus Patagonien, gesammelt von der schwedischen Expedition nach Patagonien 1899. Zoologische Jahrbücher abteilung Für Systematik Geographie Und Biologie Der Tiere 14, 62-84.

Elías-Gutiérrez, M., Jerónimo, M.F , Ivanova, V.N , Valdez-moreno, M., and Hebert, P.D.N. (2008). DNA barcodes for Cladocera and Copepoda from Mexico and Guatemala, highlights and new discoveries. Zootaxa 42(1839), 1-42.

Esser, C., Ahmadinejad, N., Wiegand, C., Rotte, C., Sebastiani, F., Gelius-Dietrich, G., Henze, K., Kretschmann, E., Richly, E., Leister, D., Bryant, D., Steel, M.A., Lockhart, P.J., Penny, D., and Martin, W. (2004). A genome phylogeny for mitochondria among α-proteobacteria and a predominantly eubacterial ancestry of yeast nuclear genes. Molecular Biology and Evolution 21 (9), 1643-1660.

Folmer,O., Black, M., Hoeh, W., Lutz, R., and Vrijenhoek, R. (1994a). DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3 (5), 294- 299.

Forro, L., Korovchinsky, N.M., Kotov, A.A., and Petrusek, A. (2008). Global diversity of cladocerans (Cladocera; Crustacea) in freshwater Hydrobiologia 595, 177-184.

Fourment, M., and Gibbs, M.J. (2006). PATRISTIC: a program for calculating patristic distances and graphically comparing the components of genetic change. BMC Evolutionary Biology 6(1).

Frank, S.A. (1996). Host-Symbiont conflict over the mixing of symbiotic lineages. Proceedings of the Royal Society of London. Series B: Biological Sciences 263 (1368), 339-344.

Frati, F., Simon, C., Sullivan, J., and Swofford, D.L. (1997). Evolution of the mitochondrial cytochrome oxidase II gene in Collembola. Journal of Molecular Evolution 44, 145-158.

Frey, G.D. (1987). The taxonomy and biogeography of the Cladocera. Hydrobiologia 145, 5 - 1 7.

Friedrich, M., and Tautz, D. (1997). An episodic change of rDNA nucleotide substitution rate has occurred at the time of the emergence of the insect order Diptera. Molecular Biology and Evolution Molecular Biology and Evolution 14, 644- 653.

Gantenbein, B., and Largiadèr, C.R. (2003). The phylogeographic importance of the Strait of Gibraltar as a gene flow barrier in terrestrial arthropods: a case study with 230

the scorpion Buthus occitanus as model organism. Molecular Phylogenetics and Evolution 28 (1), 119-130.

Geddes, M.C. (1984). Limnology of Lake Alexandrina, River Murray, South Australia, and the effects of nutrients and light on the phytoplankton. Australian Journal of Marine and Freshwater Research 35, 399-415.

Geraldes, A., Basset, P., Smith, K.L., and Nachman, M.W. (2011). Higher differentiation among subspecies of the house mouse (Mus musculus) in genomic regions with low recombination. Molecular Ecology 20 (22), 4722-4736.

Gerbi, S.A. (1985). Evolution of ribosomal DNA. In 'Molecular evolutionary genetics.' (Ed. RJ MacIntyre) pp. 419-517 (Plenum: New York. .)

Gibson, F.J, Kelso, S., Jackson, D.M, Kits, H.J, Miranda, G.F, and Skevington, H.J. (2011). Diptera-specific polymerase chain reaction amplification primers of use in molecular phylogenetic research. Annals of the Entomological Society of America 104 (5), 976-997.

Gill, F.B., and Slikas, B. (1992). Patterns of Mitochondrial DNA divergence in North American crested Titmice. The Condor 94 (1), 20-28.

Gillespie, J.J., Yoder, M.J., and Wharton, R.A. (2004). Predicted Secondary Structure for 28S and 18S rRNA from Ichneumonoidea (Insecta: Hymenoptera: Apocrita): Impact on sequence alignment and phylogeny estimation. Journal of Molecular Evolution 61 (1), 114-137.

Godfray, H.C.J. (2002). Challenges for taxonomy. Nature 417 (6884), 17-19.

Goetze, E. ( 2003 ). Cryptic speciation on the high seas; global phylogenetics of the copepod family Eucalanidae. Proceedings of the Royal Society B: Biological Sciences 270, 2321–2331.

Goldenberger, D., Perschil, I., Ritzler, M., and Altwegg, M. (1995). A simple "Universal" DNA Extraction procedure using SDS and Proteinase K is Compatible with direct PCR amplification Genome Research 4, 368--370.

Goldenfeld, N., and Woese, C. (2007). Biology's next revolution. Nature 445 (7126), 369-369.

Gómez, A., Montero-Pau, J., Lunt, D., H, Serra, M., and Campillo, S. ( 2007). Persistent genetic signatures of colonization in Brachionus manjavacas rotifers in the Iberian Peninsula. Molecular Ecology 16 (15), 3228-40.

Gonzalez-Ittig, E.R., and Gardenal, N.C. (2008). Co-amplification of mitochondrial pseudogenes in Calomys musculinus ( Rodentia, Cricetidae): a source of error in phylogeographic studies. Genome 51, 73-78.

Goulden, C.E, and Frey, D.G. (1963). The occurrence and signiﬁcance of lateral head pores in the genus Bosmina (Cladocera). Internationale Revue der gesamten Hydrobiologie und Hydrographie 48, 513–522.

231

Grabherr, M.G , Haas, J.B , Yassour , M., Levin , Z.J , Thompson , A.D, Amit, I., and Adiconis, X. (2011 ). Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nature Biotechnology 29, 644-652.

Graffelman, J., and Hoekstra, R.F. (2000). A statistical analysis of the effect of warfare on the human secondary sex ratio. Human Biology 72(3), 433-45.

Gray, M.W., Burger, G., and Lang, B.F. (1999). Mitochondrial evolution. Science 283 (5407).

Greenspoon, S.A., Scarpetta, M.A., Drayton, M.L., and Turek, S.A. (1998). QIAamp Spin Columns as a method of DNA isolation from forensic casework. Journal of Forensic Sciences 43, 1024-1030.

Greenwood, T.L., Green, J.D., and Chapman, M.A. (1991). New Zealand Ceriodaphnia species: Identification of Ceriodaphnia dubia Richard, 1894 and Ceriodaphnia cf. pulchella Sars, 1862. New Zealand Journal of Marine and Freshwater Research 25, 283-288.

Guindon, S., and Gascuel, O. (2003). A simple, fast and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology 52, 696–704.

Gutierrez, M.E., Jeronimo, F.M., Ivanova, N.V., Moreno, M.V., and Hebert, P.D.N. (2008). DNA barcodes for Cladocera and Copepoda from Mexico and Guatemala,highlights and new discoveries. Zootaxa 1839 (1-42).

Haas, S., Vingron, M., Poustka, A., and Wiemann, S. (1998). Primer design for large scale sequencing. Nucleic Acids Research 26 (12), 3006-12.

Haas, S.A., Hild, M., Wright, P.A., Hain, T., Talibi, D., and Vingron, M.M. (2003). Genome-scale design of PCR primers and long oligomers for DNA microarrays. Nucleic Acids Research 31 (19), 5576–81.

Hall, B. (2004). 'Update #1: Better gap penalties. In: B. Hall, Editor, Basic Elements in Creating and Presenting Trees. .' Second edn. (Sinauer: Sunderland, MA.)

Hall, T.A. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41, 95 - 98.

Hames, D., and Hooper, N. (2005). 'Bios Instant Notes In Biochemistry.' 3 edn. (Taylor and Francis: New York, US.)

Hamilton, C.A., Formanowicz, D.R., and Bond, J.E. (2011). Species delimitation and phylogeography of Aphonopelma hentzi (Araneae, Mygalomorphae, Theraphosidae): Cryptic diversity in North American Tarantulas. PLoS ONE 6 (10), e26207.

Hassouna, N., Michot, B., and Bachellerie, J.-P. (1984). The complete nucleotide sequence of mouse 28S rRNA gene. Implications for the process of size increase of the large subunit rRNA in higher eukaryotes. Nucleic Acids Research 12, 3563-3583.

232

Havel, J.E., Colbourne, J.K., and Hebert, P.D.N. (2000). Reconstructing the history of intercontinental dispersal in Daphnia lumholtzi by Use of Genetic Markers. Limnology and Oceanography 45(6), 1414-1419.

Havel, J.E., Mabee, W.R., and Jones, J.R. (1995). Invasion of the exotic cladoceran Daphnia lumholtzi into North American reservoirs. Canadian Journal of Fisheries and Aquatic Sciences 52 (1), 151-160. [In English]

Hebert, P.D.N. (1977a). A revision of the taxonomy of the genus Daphnia (Crustacea : Daphnidae) in south-eastern Australia. Australian Journal of Zoology 25 (2), 371- 398.

Hebert, P.D.N, and Wilson, C.C. (1994). Provincialism in plankton : endemism and allopatric speciation in Daphnia. Evolution 48, 1333-1349.

Hebert, P.D.N , Stoeckle, M.Y., Zemlak, T.S., and Francis, C.M. (2004). Identification of Birds through DNA Barcodes. PLoS Biology 2 (10), e312.

Hebert, P.D.N., Cywinska, A., Ball, S.L., and deWaard, J.R. (2003a). Biological identifications through DNA barcodes. Proceedings of the Royal Society B: Biological Sciences 270 (1512), 313-321.

Hebert, P.D.N., Remigio, E.A., Colbourne, J.K., Taylor, D.J., and Wilson, C.C. (2002). Accelerated molecular evolution in halophilic crustaceans. Evolution 56 (5), 909-926

Hebert, P.D.N. (1977b). Revision of taxonomy of genus Daphnia (Crustacea- Daphnidae) in Southeastern Australia. Australian Journal of Zoology 25 (2), 371- 398. [In English]

Hebert, P.D.N., Cywinska, A., Ball, S.L., and deWaard, J.R. (2003b). Biological identifications through DNA barcodes. Proceedings of the Royal Society B: Biological Sciences 270, 313 - 321.

Hebert, P.D.N., and Finston, T.L. (1996). A taxonomic reevaluation of North American Daphnia (Crustacea: Cladocera). II. New species in the Daphnia pulex group from the south-central United States and Mexico. Canadian Journal of Zoology 74 (4), 632–653.

Hebert, P.D.N., and Gregory, R.T. (2005). The Promise of DNA Barcoding for Taxonomy. Systematic Biology 54 (5), 852-859.

Hebert, P.D.N., Penton, E.H., Burns, J.M., Janzen, D.H., and Hallwachs, W. (2004c and d). Ten species in one: DNA barcoding reveals cryptic species in the neotropical Skipper Butterfly Astraptes fulgerator. Proceedings of the National Academy of Sciences 101 (41), 14812 - 14817.

Hebert, P.D.N., Ratnasingham, S., and DeWaard, R.J. (2003c). Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proceedings of the Royal Society B: Biological Sciences 270 (S96–S99).

233

Hebert, P.D.N., Stoeckle, M.Y., Zemlak, T.S., and Francis, C.M. ( 2004e). Identification of Birds through DNA Barcodes. PLoS Biology 2 (10), 1657-1663.

Hebert, P.D.N., Witt, J.D.S., and Adamowicz, S.J. (2003d). Phylogeographical Patterning in Daphnia ambigua: Regional Divergence and Intercontinental Cohesion. Limnology and Oceanography 48 (1), 261-268.

Hedges, S.B., and Kumar, S. (2003). Genomic clocks and evolutionary timescales. Trends in Genetics 19 (4), 200-206.

Hellich, B. (1877). 'Die Cladoceren Böhmens.' ( Prag : In Commissions-Verlag bei F. Rivnác.)

Herrick, C.L. (1883). Heterogenetic development in Diaptomus. The American Naturalist 17 (5), 499-505.

Herrick, C.L. (1884). A Final Report On the Crustacea of Minnesota included in the orders Cladocera and Copepoda. Minneapolis.

Hershberg, R., and Petrov, D.A. (2009). General Rules for Optimal Codon Choice. PLoS Genetics 5 (7), e1000556.

Heuch, P.A., Øines, Ø., Knutsen, J.A., and Schram, T.A. (2007). Infection of wild fishes by the parasitic copepod Caligus elongatus on the south east coast of Norway. Diseases of Aquatic Organisms 77, 149–158.

Hewitt, G. M. (2001). Speciation, hybrid zones and phylogeography or seeing genes in space and time. Molecular Ecology 10 (3), 537-49.

Hill, R.S., Allen, L.D., and Bucklin, A. (2001). Multiplexed species-specific PCR protocol to discriminate four N. Atlantic Calanus species, with an COI gene tree for ten Calanus species. Marine Biology (Berlin) 139 (2), 279-287. [In English]

Ho Kim, S., Elango, N., Warden, C., Vigoda, E., and Yi, S., V. (2006). Heterogeneous genomic molecular clocks in primates. PLoS Genetics 2 (10), e163.

Hoelzel, A.R. (2001). Shark fishing in fin soup. Conservation Genetics 2 (1), 69-72.

Hubert, N., Hanner, R., Holm, E., Mandrak, N.E., Taylor, E., Burridge, M., Watkinson, D., Dumont, P., Curry, A., Bentzen, P., Zhang, J., April, J., and Bernatchez, L. (2008). Identifying Canadian Freshwater Fishes through DNA Barcodes. PLoS ONE 3 (6), e2490.

Huelsenbeck, J.P., Ronquist, F.R., Nielsen, R., and Bollback, P.J. (2001). Bayesian inference of phylogeny and its impact on evolutionary biology. Science (294), 2310- 2314.

Hwang, U.W., Kim, W., Tautz, D., and Friedrich, M. (1998). Molecular phylogenetics at the Felsenstein-zone: New approaches to the Strepsiptera problem using 5.8S and 28S rDNA sequences. Molecular Phylogenetics and Evolution 9, 470-480.

234

Innis, M.A., Gelfand, H.D., Sninsky, J.J., and White, J.T (1990). 'PCR protocols: A guide to methods and applications.' pp. 482. (CA: Academic Press.: San Diego.).

Innis, M.A , and Gelfand, D.H. (1990). Optimization of PCRs. In 'PCR Protocols.' (Eds. Innis MA, Gelfand DH, Sninsky JJ and W TJ.) pp. 3–12. (New York, USA: Academic Press.)

Irwin, D.E. (2002). Phylogeographic breaks without geographic barriers to gene flow. Evolution 56, 2383-2394.

Jarman, S.N., and Elliott, N.G. (2000). DNA evidence for morphological and cryptic Cenozoic speciations in the Anaspididae,‘living fossils’ from the Triassic. Journal of Evolutionary Biology 13, 624–633.

Jeffery, N.W., Elias-Gutierrez, M., and Adamowicz, S.J. (2011). Species diversity and phylogeographical affinities of the Branchiopoda (Crustacea) of Churchill, Manitoba, Canada. PLoS ONE 6(5): e18364.

Jiggins, F.M., Hurst, G.D.D., von der Schulenburg, J.H.G., and Majerus, M. (2001). Two malekilling Wolbachia strains coexist within a population of the butterfly Acreae encedon. Heredity 86, 161-166.

Johnson, D.S. (1956). Systematics and ecological notes on the Cladocera of Lake Toba and the surrounding country. North Sumatra. Journal of the Linnean Society of London (43), 72-91.

Johnson, N.K., and Cicero, C. (2004). New mitochondrial DNA data afﬁrm the importance of Pleistocene speciation in North American birds. Evolution 58(1122– 1130).

Jolly, V.H (1966). The limnetic Crustacea of six reservoirs in the Sydney area of New South Wales. Negotiations of the International Association of Theoretical and Applied Limnology 16, 727-734.

Jukes, T.H, and Osawa., S. (1993). Evolutionary changes in the genetic code. Comparative Biochemistry and Physiology - Part B: Biochemistry & Molecular Biology 106 (3), 489-94.

Jurine, L. (1820). 'Histoire Des Monocles Qui Se Trouvent Aux Environs De Genéve.' (J.J. Paschoud, Imprimeur- Libraire: Genéve.)

Kampke, T., Kieninger, M., and Mecklenbug, M. (2001). Efficient primer design algorithms. Bioinformatics 17 (3), 214-225.

Karp, A., Ingram, D.S, and Peter, G. (1997). 'Primers for Animal Mitochondrial DNA: The importance of Species-specific primers.' pp. 249 - 55(Chapman and Hall: United Kingdom.)

Kayal, E., Bentlage, B., Collins, A.G., Kayal, M., Pirro, S., and Lavrov, D.V. (2012). Evolution of linear mitochondrial genomes in medusozoan Cnidarians. Genome Biology and Evolution 4 (1), 1-12.

235

Keane, T., M., Creevey, C.J., Pentony, M.M., Naughton,T.J., and McInerney, J.O. (2006). Assessment of methods for amino acid matrix selection and their use on empirical data shows that ad hoc assumptions for choice of matrix are not justified. BMC Evolutionary Biology 6, 29.

Keane, T.M., Naughton, T.J., and McInerney, J.O. ( 2004). ModelGenerator: amino acid and nucleotide substitution model selection. National University of Ireland, Maynooth.

Keeling, P.J., and Palmer, J.D. (2008). Horizontal gene transfer in eukaryotic evolution. Nature Reviews Genetics 9 (8), 605-618.

Kircher, M., and Kelso, J. (2010). High-throughput DNA sequencing – concepts and limitations. Bioessays 32, 524–536.

Knowlton, N. (1993). Sibling species in the sea. Annual Review of Ecology, Evolution, and Systematics 24, 189–216.

Knowlton, N., Weigt, L., Solorzano, L., Mills, D., and Bermingham, E. (1993). Divergence in proteins, mitochondrial DNA, and reproductive compatibility across the isthmus of Panama. Science 260 (5114), 1629-1632.

Knowlton, N., and Weigt, L.A. (1998). New dates and new rates for divergence across the Isthmus of Panama. Proceedings of the Royal Society of London. Series B: Biological Sciences 265 (1412), 2257-2263.

Kobayashi, T., Shiel, R.J., and Segers, H. (2007). First record of the rotifer Lecane shieli Segers & Sanoamuang, 1994 from Australia. Australian Zoologist 34, 181-183.

Kondo, R., Matsuura, E.T., and Chigusa, S.I. (1992). Further observation of paternal transmission of Drosophila mitochondrial DNA by PCR selective amplification method. Genetics Research 59 (2), 81–4.

Kořinek, V., and Hebert, P.D.N. (1996). A new species complex of Daphnia (Crustacea, Cladocera) from the Pacific Northwest of the United States. Canadian Journal of Zoology 74(8), 1379–1393.

Kotov, A.A. (1995). The development of cephalic and thoracic appendages of Eurycercus lamellatus (Daphniiformes, Chydoridae) in later embryogenesis. Zoologicheskii Zhurnal 74, 39-50.

Kotov, A.A., and Gololobova, M.A. (2005). Types of cladoceran species described by Sven Ekman in the Swedish Museum of Natural History, with redescription of Daphnia cavicervix Ekman, 1900 (Daphniidae, Anomopoda, Cladocera). Journal of Natural History 39 (33), 3059-3074.

Kotov, A.A., and Ferrari, D.F. (2010). The taxonomic research of Jules Richard on Cladocera (Crustacea: Branchiopoda) and his collection at the National Museum of Natural History, U.S.A. Zootaxa ( 2551), 37-64.

Kotov, A., Ishida, S., and Taylor, J.D. (2009). Revision of the genus Bosmina Baird, 1845 (Cladocera: Bosminidae), based on evidence from male morphological 236

characters and molecular phylogenies. Zoological Journal of the Linnean Society 156, 1-51.

Kroodsma, D.E. (1989). Two North American song populations of the marsh wren reach distributional limits in the central Great Plains. Condor 91, 332-340.

Kumar, S. (2005). Molecular clocks: four decades of evolution. Nature Reviews Genetics 6(8), 654-662.

Kwok, S., Kellogg, D., E,, McKinney, N., Spasic, D., Goda , L., Levenson, C., and Sninsky, J. (1990). Effects of primer-template mismatches on the polymerase chain reaction: Human Immunodeficiency Virus 1 model studies. Nucleic Acids Research (18), 999-1005.

Laforsch, C., Imhof, H., Sigl, R., Settles, M., Heß, M., and Wanninger, A. (2012). 'Applications of Computational 3D–Modeling in Organismal Biology.' 298

Langhans, V.H. (1911). 'Die Biologie der litoralen Cladoceren-Untersuchungen über die Fauna des Hirschberger Grossteiches.'

Lefébure, T., Douady, C.J., Gouy, M., and Gibert, J. (2006). Relationship between morphological taxonomy and molecular divergence within Crustacea: Proposal of a molecular threshold to help species delimitation. Molecular Phylogenetics and Evolution 40 (2), 435-447.

Lefébure, T., Douady, C.J., Malard, F., and Gibert, J. (2007). Testing dispersal and cryptic diversity in a widely distributed groundwater amphipod (Niphargus rhenorhodanensis). Molecular Phylogenetics and Evolution 42 (3), 676-686.

Lewis, M.D., Elliottc, A.J., Lambert, F.M., and Reynolds, S.C. (2001). The simulation of an Australian reservoir using a phytoplankton community model: Protech. Ecological Modelling 150 (1-2 ), 107-16.

Leydig, F. (1860). 'Naturgeschichte Der Daphniden (Crustacea Cladocera).' (Tübingen, H. Laupp'sche Buchhandlung, Laupp & Siebeck.)

Lilljeborg, W. (1900a). 'Beiträge zur Kenntniss der in Schweden Lebenden krebsthiere thiere von der ordnung der Branchiopoden und der unterordnung der Cladoceren.' (Drück der akademischen buchdruckerei: Upsala.)

Lilljeborg, W. (1900b). 'Cladocera Suecivi; Oder Beiträge Zur Kenntniss Der In Schweden Lebenden Krebsthiere Von Der Ordnung Der Branchiopoden Und Der Unterordnung Der Cladoceren. (Upsala, Druck der Akademischen buchdruckerei E. Berling.)

Linnaeus, C. (1753). 'Species plantarum.' (Salvius: Holmiae (Stockholm), Sweden.)

Liu, H. and Beckenbach, A.T. (1992). Evolution of the mitochondrial cytochrome oxidase II gene among 10 orders of insects. Molecular Phylogenetics and Evolution 1, 41-52.

237

Lynch, M., Koskella, B., and Schaack, S. (2006). Mutation pressure and the evolution of organelle genomic architecture. Science 311 (5768), 1727-1730.

Mahuku, G., S (2004). A simple extraction method suitable for PCR-based analysis of plant, fungal, and bacterial DNA. Plant Molecular Biology Reporter 22, 71-81.

Maly, E.J. (1984). Dispersal ability and relative abundance of Boeckella and Calamoecia (Copepoda: Calanoida) in Australian and New Zealand waters Oecologia 62(2), 173-181.

Maly, J.E., Halse, A.S., and Maly, P.M. (1997). Distribution and incidence patterns of Boeckella, Calamoecia, and Hemiboeckella (Copepoda : Calanoida) in Western Australia. Marine & Freshwater Research 48, 615–621.

Manfredi, G., Thyagarajan, D., Papadopoulou, L.C., Pallotti, F., and Schon, E.A. (1997). The fate of human sperm-derived mtDNA in somatic cells. American Journal of Human Genetics (61), 953-960.

Mann, T., Humbert, R., Dorschner, M., Stamatoyannopoulos, J., and Noble, W.S. (2009). A thermodynamic approach to PCR primer design. Nucleic Acids Research 37 (13), e95.

Markmann, M., and Tautz, D. (2005). Reverse taxonomy: an approach towards determining the diversity of meiobenthic organisms based on ribosomal RNA signature sequences. Philosophical Transactions of the Royal Society B: Biological Sciences 360 (1462), 1917-1924.

Martin, A.P., and Palumbi, S.R. (1993). Body size, metabolic rate, generation time, and the molecular clock. Proceedings of the National Academy of Sciences 90, 4087– 4091.

Matile, P. (1890). 'Die Cladoceren der umgegend von Moskau.' (Imprimerie de l'univérsité Impériale.)

Mayr, E. (1966). The Proper Spelling of Taxonomy. Systematic Zoology 15 (1), 88.

McDowell, D. (2006). The polymerase chain reaction patents: going, going, still going. Journal of the Royal Society of Medicine 99 (2), 62-64.

Meier, R. (2008). DNA sequences in taxonomy, opportunities and challenges. The new taxonomy, 95 - 128.

Meier, R., Shiyang, K., Vaidya, G., and Ng, P. (2006). DNA barcoding and taxonomy in Diptera: a tale of high intraspecific variability and low identification success. Syst Biol 55 (5), 715 - 728.

Meusel, M.S, and Moritz, R.F. (1993). Transfer of paternal mitochondrial DNA during fertilization of honeybee (Apis mellifera L.) eggs. Current Genetics 24 (6), 539–43.

Meyer, C., and Paulay, G. (2005a). DNA barcoding: error rates based on comprehensive sampling. PLoS Biology 3 (12), e422. 238

Milligan, B.G. (1998). 'Total DNA isolation. In: Hoelzel AR, Molecular genetic analysis of population: A practical approach.' 2nd edn. pp. 468. (Oxford University Press: New York, Tokyo.)

Mills, S. (2006). Investigations of the Brachionus plicatilis spp complex, with particular reference to south west Western Australia. University of Western Australia,

Mills, S., Lunt, H.D., and Gómez, A. (2007). Global isolation by distance despite strong regional phylogeography in a small metazoan. BMC Evolutionary Biology 7, 225

Mitsuhashi, M. (1996). Technical report: Part 2; Basic requirements for designing optimal PCR primers. Journal of Clinical Laboratory Analysis 10 (5), 285–93.

Monaghan, M.T., Balke, M., Gregory, T.R., and Vogler, A.P. (2005). DNA-based species delineation in tropical beetles using mitochondrial and nuclear markers. Philosophical Transactions of the Royal Society B: Biological Sciences 360, 1925- 193.

Moniez, R., Barrois, T., and Hallez, P. (1889). 'Sur Quelques Cladocéres Et Sur Un Ostracode Nouveaux : Du lac Titicaca.'

Monteiro, F.A, Wesson, D.A, Dotson, E.M, Schofield, C.J, and Beard, C.B. (2000). Phylogeny and molecular taxonomy of the Rhodniini derived from mitochondrial and nuclear DNA sequences. American Journal of Tropical Medicine and Hygiene 62, 460-465.

Mora, C., Tittensor, D.P., Adl, S., Simpson, A.G.B., and Worm, B. (2011). How Many Species Are There on Earth and in the Ocean? PLoS Biology 9(8), e1001127.

Moritz, C., and Cicero, C. (2004). DNA barcoding: promise and pitfalls. PLoS Biology 2(10), e354.

Moriyama, E.N., and Gojobori, T. (1992). Rates of synonymous substitution and base composition of nuclear genes in Drosophila. Genetics 130 (4), 855-864.

Morton, D.W, and Bayly, I.A.E. (1977). Studies on the ecology of some temporary freshwater pools in Victoria with special reference to microcrustaceans Australian Journal of Marine and Freshwater Research 28, 439-54.

Morton, D.W. (1985). Revision of the Australian Cyclopidae (Copepoda : Cyclopoida). I Acanthocyclops Kiefer, Diacyclops Kiefer and Australocyclops, gen. nov. Australian Journal of Marine and Freshwater Research 36, 615-34.

Muller, H.J. (1964). The relation of recombination to mutational advance. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis 1 (1), 2-9.

Nachtrieb, F.H. (1895). Second report of the State Zoologist including a Synopsis of the Entomostraca of Minnesota. Geological and Natural History Survey of Minnesota, Saint Paul Minnesota. 239

Nedelcu, A.M., Miles, I.H., Fagir, A.M., and Karol, K. (2008). Adaptive eukaryote- to-eukaryote lateral gene transfer: stress-related genes of algal origin in the closest unicellular relatives of animals. Journal of Evolutionary Biology 21 (6), 1852-1860.

Newton, C.R., and Graham, A. (1994). In: PCR, BIOS Scientific Publishers, Ltd., Oxford, UK. 13. (U.K.: BIOS Scientific Publishers.: Oxford.)

Niu, C., Kebede, H., Auld, L.D., Woodward, E.J., and Wright, J.R. (2008). A safe inexpensive method to isolate high quality plant and fungal DNA in an open laboratory environment. African Journal of Biotechnology 7 (16), 2818-2822.

Noller, H.F. (1984). Structure of Ribosomal RNA. Annual Review of Biochemistry 53 (1), 119-162.

O'hUigin, C., and Wen-Hsiung, L.W. (1992). The molecular clock ticks regularly in muroid rodents and hamsters. Journal of Molecular Evolution 35 (5), 377-384.

O'Neill, G. (2010). Feature: Towards the $1000 genome. Available at http://www.lifescientist.com.au/article/354668/feature_towards_1000_genome/ Accessed 27 July 2010

Osawa, S., Jukes, T.H., Watanabe, K., and Muto, A. (1992). Recent evidence for evolution of the genetic code. Microbiological Reviews 56 (1), 229-64.

Owczarzy, R., Moreira, G.B., You, Y., Behlke, A.M., and Walder, A.J. (2008). Predicting stability of DNA duplexes in solutions containing Magnesium and Monovalent cations. Biochemistry 47 (19), 5336-5353.

Owczarzy, R., Vallone, P.M., Gallo, F.J., Paner, T.M., Lane, M.J., and Benight, A.S. , (1997). Predicting sequence-dependent melting stability of short duplex DNA oligomers. Biopolymers 44 (3), 217–239.

Pääbo, S., Higuchi, R.G, and Wilson, A.C. (1989). Ancient DNA and the polymerase chain reaction. The Journal of Biological Chemistry 264, 9709-9712.

Paggi, J.C. (1986). Aportes Al Conocimiento De La Fauna Argentina De Cladoceros, V :Ceriodaphnia laticaudata Müller 1867 y C. pulchella Sars 1862. Revista de la Asociacion de Ciencias Naturales del Litoral 17 (1), 39-49.

Pakendorf, B., and Stonekin, M. ( 2005). Mitochondrial DNA and Human Evolution. Annual Review of Genomics and Human Genetics 6, 165–83.

Pálsson, S. (2000). Microsatellite variation in Daphnia pulex from both sides of the Baltic Sea. Molecular Ecology 9 (8), 1075-1088.

Penev, L., Roberts, D., Smith, V., Agosti, D., and Erwin, T. (2010). Taxonomy shifts up a gear: New publishing tools to accelerate biodiversity research. ZooKeys 50, i-iv.

Penton, E.H., Hebert, P.D.N., and Crease, T.J. (2004). Mitochondrial DNA variation in North American populations of Daphnia obtusa: continentalism or cryptic endemism? Molecular Ecology 13, 97–107 240

Perkins, S.L. (2000). Species concepts and malaria parasites: detecting a cryptic species of Plasmodium. Proceedings of the Royal Society of London. Series B: Biological Sciences 267, 2345–2350.

Peyret, N. (2000). Prediction of Nucleic Acid Hybridization: Parameters and Algorithms. pp. 710. Wayne State University, Wayne State University.

Pigram, J.J. (2006). 'Australia's Water Resources: From Use to Management.' pp. 240. (CSIRO: Melbourne.)

Pinel-Alloul, B., Méthot, G., Verreault, G., and Vigneault, Y. (1990). Zooplankton species associations in Quebec Lakes: variation with abiotic factors, including natural and anthropogenic acidification. Canadian Journal of Fisheries and Aquatic Sciences 47 (1), 110-121.

Porreca, G.J. (2010). Genome sequencing on nanoballs. Nature Biotechnology 28 (1), 43-44.

Posada, D., and Buckley, T., R (2004). Model Selection and Model Averaging in phylogenetics: Advantages of Akaike Information Criterion and Bayesian Approaches Over Likelihood Ratio Tests. Systematic Biology 53 (5), 793-808.

Pourriot, R. (1996). Rotifers from Petit Saut reservoir (French Guyana), with the description of a new taxon. Hydrobiologia 331 (1-3), 43-52. [In English]

Rand, D.M., Haney, R.A., and Fry, A.J. (2004). Cytonuclear coevolution: The genomics of cooperation. Trends in Ecology & Evolution 19, 645-653.

Rawlings, T.A., Collins, T.M., and Bieler, R. (2001). A major mitochondrial gene rearrangement among closely related species. Molecular Biology and Evolution 18 (8), 1604-1609.

Ricci, C., Shiel, R.J. , Fontaneto, D., and Melone, G. (2003). Bdelloid rotifers recorded from Australia with description of Philodinavus aussiensis n. sp. Zoologische Anzeiger 242, 241-248.

Richard, J. (1894). Cladoceres recueillis par le Dr. Theod. Barrois en Pelestine, en Syrie et en Égypte. Revue biologique du nord de la France, Lille 6, 360-378.

Richard, J. (1897). 'Mémoirs de la societe Zoologique de France.' (Au Siége de la Société: Paris.)

Richly, E., and Leister, D. (2004). NUMTs in sequenced eukaryotic genomes. Molecular Biology and Evolution 21 (6), 1081-1084.

Rietzler, C.A , Rocha, O., Roche, F.K, and Ribeiro, M.M. (2008). Laboratory demonstration of morphological alterations in Ceriodaphnia cornuta Sars (1885) fa rigaudi induced by Chaoborus brasiliensis Theobald (1901). Brazilian journal of biology Revista brasleira de biologia 68 (2), 453-454.

241

Robeson, M.S., King, A.J., Freeman, K.R., Birky, C.W., Martin, A.P., and Schmidt, S.K. (2011). Soil rotifer communities are extremely diverse globally but spatially autocorrelated locally. Proceedings of the National Academy of Sciences 108 (11), 4406-4410.

Rohwer, S., A. (1976). 'Specific distinctness and adaptive differences in Southwestern meadowlarks.' (Museum of Natural History, University of Kansas (Lawrence).

Roselli, M.I. (2008). The influence of predator detection on life history strategies in Ceriodaphnia reticulata (Cladocera: Daphniidae). Eastern New Mexico University, Mexico.

Ross, S.L. (1897). Some Manitoba Cladocera, with description of one new species. The American Naturalist 31 (364), 293-303.

Rychlik, W., Spencer, J., W., and Rhoads, E., R (1990). Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Research 18 (21), 6409–12.

Rzóska, J. (1956). On the variability and status of the Cladocera Ceriodaphnia cornuta and C. rigaudi. Journal of Natural History Series 12 9 (103), 505-10.

SA Water (2004). Water Storage (Reservoirs). Available at http://www.sawater.com.au/SAWater/Education/OurWaterSystems/Water+Storage+( Reservoirs).htm Accessed 31 December 2011.

Saccone, C., Gissi, C., Reyes, A., Larizza, A., Sbisa, E., and Pesole, G. (2002). Mitochondrial DNA in metazoa: degree of freedom in a frozen event. Gene 286, 3- 12.

SantaLucia, J., Jr., and Hicks, D. (2004). The thermodynamics of DNA structural motifs. Annual Review of Biophysics and Biomolecular Structure 33, 415–440.

SantaLucia, J.J. (1998). A uniﬁed view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. Proceedings of the National Academy of Sciences 95 (4), 1460–1465.

Sars, G.O. (1862a). Fortsatte sit Foredrag over de af ham i Omegmen af Christiania iagttanne Crustacea. Forhandlinger i Videnskabs-Selskabet i Christiania(1861), 250- 302.

Sars, G.O. (1862b). Meddeelte en af talrige Afbildninger ledsaget ovesigt af de ham i Omegmen af Christiania iagtagne Crustacea Cladocera. Forhandlinger i Videnskabs- Selskabet i Christiania (1861).

Sars, G.O. (1890). Oversigt af Norges Crustaceer, med foreløbige bemærkninger over de nye eller mindre bekjendte Arter- II. (Branchiopoda - Ostracoda - Cirripedia). Forh. Videnskselskab. Christiania aar 1890, 1-80.

242

Sars, G.O. (1894). 'Contributioins to the knowledge of the Fresh-water Entomostraca of New Zealand as shown by artificial hatching from dried mud.' (A. W. Broggers Printing Office).

Sars, G.O. (1896). On freshwater Entomostraca from the neighbourhood of Sydney. Archiv for Mathematik og Naturvidenskab,Oslo 19, 1 - 35.

Sars, G.O. (1901). Contributions to the knowledge of the fresh-water Entomostraca of South America, as shown by artificial hatching from dried material- 1. Cladocera. Arch. Math. Naturv. 23, 1-102.

Sars, G.O. (1908). Freshwater Copepoda from Victoria, Southern Australia. Archiv for Mathematik og Naturvidenskab,Kristiania 29 (7), 1.

Sars, G.O. (1916). The Fresh-water Entomostraca of Cape Province (Union of South Africa). Part I. : Cladocera. Plates XXIX.-XLI. In 'Annals of the South African Museum. Vol. 15.' (Trustees of the South African Museum : By Adlard and Son and West Newman, Ltd London).

Schiødte, C.J. (1868-1869). 'Naturhistorisk tidsskrift stiftet ak Henrik Krøyer.' (Copenhagen).

Schnare, M.N., Damberger, S.H., Gray, M.W., and Gutell, R.R. (1996). Comprehensive comparison of structural characteristics in eukaryotic cytoplasmic large subunit (23 S-like) ribosomal RNA. Journal of Molecular Biology 256, 701– 719.

Schödler, J.E. (1877). Zur Naturgeschichte der Daphniden Jahresbericht Über Die Dorotheenstädtische Realschule Berlin 1877, 1-24.

Schubart, C.D., Diesel, R., and Hedges, S.B. (1998). Rapid evolution to terrestrial life in Jamaican crabs. Nature 393 (6683), 363-365.

Schwenk, K. (1996). Evolutionary genetics of Daphnia species complex: hybridism in syntopy. Nieuwersluis, The Netherlands: Netherlands Institute of Ecology, Centre for Limnology. Publication 2231.

Schwenk, K., Sand, A., Boersma, M., Brehm, M., Mader, E., Offerhaus, D., and Spaak, P. (1998). Genetic markers, genealogies and biogeographic patterns in the cladocera. Aquatic Ecology 32 (1), 37-51. [In English].

Scourfield, J.D. (1892). 'Some New Records of British Cladocera.' (Williams and Norgate: Edinburgh).

Sendacz, S. (1984). A study of the zooplankton community of Billings reservoir – São Paulo. Hydrobiologia 113, 121–7.

243

Sergeev, V., and Williams, W.D. (1985). Daphniopsis australis nov.sp. (Crustacea: Cladocera), a further daphniid in Australian salt lakes. Hydrobiologia 120 (2), 119- 128.

Sergeev, V.N. (1990). The Ephippial female of a new species of Daphniopsis Sars, 1903 (Anomopoda, Daphniidae) from Queensland, Australia. Crustaceana 59 (2), 146-155.

Sharma, P., and Kotov, A. (2013) Molecular approach to identify sibling species of the Ceriodaphnia cornuta complex (Cladocera: Daphniidae) from Australia with notes on the continental endemism of this group. Zootaxa 3702 (1), 079–089.

Sheffield, V.C., Cox, D.R., Lerman, L.S., and Myers, R.M. (1989b). Attachment of a 40 base pair G+C rich sequence (GC-clamp) to genomic DNA fragments by polymerase chain reaction results in improved detection of single base changes. Proceedings of the National Academy of Sciences 86, 232-236.

Shen, P., Wang, W., Krishnakumar, S., Palm, C., Chi, K.A., Enns, M.G., and Davis, W.R. (2011). High-quality DNA sequence capture of 524 disease candidate genes. Proceedings of the National Academy of Sciences, USA 108, 6549 – 6554.

Shiel, R.J. (1979). Synecology of the Rotifera of the River Murray, South Australia. Australian Journal of Marine and Freshwater Research 30, 255-63.

Shiel, R.J. (1981). Plankton of the Murray-Darling river system. University of Adelaide.

Shiel, R.J. (1978). Zooplankton communities of the Murray-Darling system. Proceedings of the Royal Society of Victoria 90, 193-202.

Shiel, R.J. Zooplankton dynamics in Mt Bold Reservoir, South Australia. In 'Proceedings of Plankton Ecology Group', 1982, Trondheim, Norway.

Shiel, R.J., and Walker, K.F. (1984). Zooplankton of regulated and unregulated rivers: the Murray-Darling system, Australia. In 'Proc. 2nd Int. Conf. Regulated Streams, Oslo).

Sibley, G.C., and Monroe, L.B.,Jr (1990). 'Distribution and taxonomy of birds of the world.' ( Yale University Press, c1990.: New Haven.).

Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., and Flook, P. (1994). Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87, 651–701.

Singh, V.K., Govindarajan, R., Naik, S., and Kumar, A. (2000). The effect of hairpin structure on PCR Amplificaiton efficiency. Molecular Biology Today 1, 657-659.

Sites, J.W.Jr.,and Marshall, J.C. (2004). Operational criteria for delimiting species. Annual Review of Ecology, Evolution, and Systematics 35, 199-227.

244

Smirnov, N.N, and Kotov, A. (2009). Morphological radiation with reference to the carapace valves of the Anomopoda (Crustacea: Cladocera). International Review of Hydrobiology 94 (5), 580-594.

Smirnov, N.N., and Kotov, A. (2010). The morphological radiation of setae in the Cladocera (Crustacea) and their potential for morphogenesis. International Review of Hydrobiology 95 (6), 482-519.

Smirnov, N.N., and Timms, B.V. (1983). 'Revision of the Australian Cladocera (Crustacea).' (The Australian Museum: Sydney, Australia.) 132

Smith, G. (1909). The Freshwater Crustacea of Tasmania, with remarks on their geographical distribution. Transactions of the Linnean Society of London. 2nd Series: Zoology 11 (4), 61-92.

Song, H., Buhay, E.J., Whiting, F.M., and, and Crandall, A.K. ( 2008). Many species in one: DNA barcoding overestimates the number of species when nuclear mitochondrial pseudogenes are coamplified. Proceedings of the National Academy of Sciences 105 (36), 13486-13491.

Sorensen, K.H., and Sterner, R.W. (1992). Extreme cyclomorphosis in Daphnia lumholtzi. Freshwater Biology 28 (2), 257-262. [In English].

Speers, L. (2005). E-types – A new resource for taxonomic research. Pp. 13-18 in Digital imaging of biological type specimens. A manual of best practice. Results from a study of the European network for biodiversity information (C.L. Häuser, A. Steiner, J. Holstein and M.J. Scoble, eds.). Stuttgart. In ).

Steiper, M.E., and Young, N.M. (2006). Primate molecular divergence dates. Molecular Phylogenetics and Evolution 41 (2), 384-394.

Stryer, L. (1995). 'Oxidative phosphorylation. In Biochemistry.' 2'nd edn. (W.H Freeman and Company.: New York.).

Suatoni, E., Vicario, S., Rice, S., Snell, T., and Caccone, A. (2006). An analysis of species boundaries and biogeographic patterns in a cryptic species complex: The rotifer Brachionus plicatilis. Molecular Phylogenetics and Evolution 41, 86-98.

Sugimoto, N., Nakano, S., Yoneyama, M., and Honda, K. (1996). Improved thermodynamic parameters and helix initiation factor to predict stability of DNA duplexes. Nucleic Acids Research 24 (22), 4501–5.

Suthers, M.I., and Rissik, D. (2009). 'Plankton: a guide to their ecology and monitoring for water quality.' (CSIRO Publishing: Collingwood,Vic.).

Sutovsky, P., Moreno, R.D, and Ramalho-Santosl J (1999). Ubiquitin tag for sperm mitochondria. Nature(402), 371–2.

Sutovsky, P., Navara, C.S, and Schattenm, G. (1996). Fate of the sperm mitochondria, and the incorporation, conversion, and disassembly of the sperm tail structures during bovine fertilization. Biology of Reproduction 55, 1195–205.

245

Svennblad, B. (2008). Consistent estimation of divergence times in phylogenetic trees with local Molecular Clocks. Systematic Biology 57 (6), 947-954.

Tamura, K.D.J., Nei, M., and Kumar, S. (2007). MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24, 1596-1599.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. (2011). MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution 28 (10), 2731-2739.

Tan, Z.J., and Chen, S.J. (2006). Nucleic acid helix stability: effects of salt concentration, cation valence and size, and chain length. Biophysical Journal 90 (4), 1175–1190.

Tavares, E., and Baker, A. (2008). Single mitochondrial gene barcodes reliably identify sister-species in diverse clades of birds. BMC Evolutionary Biology 8 (1), 81.

Taylor, D.J., Ishikane, C.R., and Haney, R.A . (2002). The systematics of Holarctic bosminids and a revision that reconciles molecular and morphological evolution. Limnology and Oceanography 47, 1486–1495.

Taylor, D.J., and Hebert, P.D.N. (1993). A reappraisal of phenotypic variation in Daphnia galeata mendotae: The role of interspecific hybridization. Canadian Journal of Fisheries and Aquatic Sciences 50 (10), 2137–2146.

Taylor, W.R. (1986). The classification of amino acid conservation. Journal of Theoretical Biology 119 (2), 205-218.

Tegelström, H., and Gelter, H.P. (1990). Haldane's rule and sex-biased gene flow between two hybridizing flycatcher species (Ficedula albicollis and F. hypoleuca, Aves: Muscicapidae). Evolution 44, 2012-2021.

Thomas, J.A., Welch, J.J., Lanfear, R., and Bromham, L. (2010). A generation time effect on the rate of molecular evolution in invertebrates. Molecular Biology and Evolution 27 (5), 1173-1180.

Thompson, J.D., Higgins, D.G., and Gibson, T.J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Research 22 (22), 4673-80.

Van Houdt, J.K.J., Breman, F.C., Virgilio, M., and De Meyer, M. (2010). Recovering full DNA barcodes from natural history collections of Tephritid fruitflies (Tephritidae, Diptera) using mini barcodes. Molecular Ecology Resources 10 (3), 459-465.

246

Vences, M., Thomas, M., Meijden, A., Chiari, Y., and Vieites, R.D. (2005). Comparative performance of the 16S rRNA gene in DNA barcoding of amphibians. Frontiers in Zoology 2: 5.

Venetis, C., Theologidis, I., Zouros, E., and Rodakis, G.C. (2006). No evidence for presence of maternal mitochondrial DNA in the sperm of Mytilus galloprovincialis males. Proceedings of the Royal Society B: Biological Sciences 273 (1600), 2483– 2489. von Ahsen, N., Wittwer, C.T., and Schu¨ tz, E. (2001). Oligonucleotide melting temperatures under PCR conditions: nearest-neighbor corrections for Mg 2+ , deoxynucleotide triphosphate, and dimethyl sulfoxide concentrations with comparison to alternative empirical formulas. Clinical Chemistry 47 (11), 1956– 1961. von Ahsen, N., Wittwer, C.T., and Schütz, E. (2011). Monovalent and divalent salt correction algorithms for Tm prediction—recommendations for Primer3 usage. Briefings in Bioinformatics 12 (5), 514-517.

Walker, K.F., and Hillman, T.J. (1977). Limnological survey of the River Murray in relation to Albury-Wodonga, 1973-1976. Report on behalf of Gutteridge, Haskins & Davey to the Albury-Wodonga Development Corporation, Albury.

Walter, T.C. and Boxshall, G.A. (2008). World of Copepods database. Available at http://www.marinespecies.org/copepoda Accessed 31 December 2011.

Wang, Y.T, Wang, L., Zhang, H.J, and Dong, H.W. (2011). A simplified universal genomic DNA extraction protocol suitable for PCR. Genetics and Molecular Research 10 (1), 519-525.

Wares, J.P., and Cunningham, C.W. (2001). Phylogeography and historical ecology of the North Atlantic Intertidal. Evolution 55 (12), 2455-2469.

Weider, L.J., and Hobaek, A. (1994). Molecular biogeography of clonal lineages in a high-arctic apomictic Daphnia complex. Molecular Ecology 3, 497–506.

Weir, J.T., and Schluter, D. (2008). Calibrating the avian molecular clock. Molecular Ecology 17, 2321–2328.

Wilke, T., Schultheiß, R., and Albrecht, C. (2009). As time goes by: A simple fool’s guide to molecular clock approaches in invertebrates. American Malacological Bulletin Special Edition 27, 25-45.

Williams, H.P., Brown, F.J., Carolan, C.J, An, J., Goulson, D., Murat Aytekin, A., Best, R.L., Byvaltsev, M.A., Cederberg, B., Dawson, R., Huang, J., Ito, M., Monfared, A., Raina, H.R., Schnmid-Hempel, P., Sheffield, S.C., Sima, P., and Xie, Z. (2012). Unveiling cryptic species of the bumblebee subgenus Bombus s. str. worldwide with COI barcodes (Hymenoptera: Apidae). Systematics and Biodiversity iFirst, 1–36.

Williams, W.D. (1999). Conservation of wetlands in drylands: a key global issue. Aquatic Conservation: Marine and Freshwater Ecosystems 9, 517-522. 247

Winchell, H.N (1883). The Geological and Natural History Survey of Minnesota.The Twelfth Annual Report, for the year 1883. N.H. Winchell State Geologist, Minneapolis.

Winston, E.J. (1999). 'Describing Species: Practical taxonomic procedure for biologists.' (Columbia University Press; 1 edition (October 15, 1999).

Witt, J.D.S., Doug, L.T., and Hebert, P.D.N. (2006). DNA barcoding revelas extraordinary cryptic diversity in an amphipod genus: implication for desert spring conservation. Molecular Ecology 15, 3073-3082.

Wolstenholme, D. (1992a). Animal mitochondrial-DNA: structure and evolution. International Review of Cytology 141, 173-216.

Wu, Y.D., Ugozzoli, L., Pal, K.B., QIan, J., and Wallace, B.R. (1991). The effect of temperature and oligonucleotide primer length on the specificity and efficiency of amplification by the Polymerase Chain Reaction. DNA and Cell Biology 10 (3), 233- 38.

Xu, Z.H., Jiang, X.D., Wang, G.Z., He, J.F., Cai, M.H., Wu, L.S., Jiang, J.L., and Chen, X.L. (2011). DNA extraction, amplification and analysis of the 28S rRNA portion in sediment-buried copepod DNA in the Great Wall Bay and Xihu Lake, Antarctica. Journal of Plankton research 33 (6), 917-25.

Yuryev, A. (2007). 'PCR Primer Design.' pp. 431. (Human Press: Totowa, New Jersey.)

Zanata, L.H., Espindola, E.L.G., Rocha, O., and Pereira, R.H.G. (2003). First record of Daphnia lumholtzi (Sars, 1885), exotic cladoceran, in Sao Paulo State (Brazil). Brazilian Journal of Biology 63 (4), 717-720. [In English]

Zaret, M.T. (1972). Predators, Invisible prey, and the nature of Polymorphism in the cladocera (class: Crustacea). Limnology and Oceanography XVII (2), 171-184.

Zhang, D.X., and Hewitt, G.M. (2003). Nuclear DNA analyses in genetic studies of populations: practice, problems and prospects. Molecular Ecology 12 (3), 563-584.

Zhang, D.X., and Hewitt, M.G. (1996). Highly conserved nuclear copies of the mitochondrial control region in the desert locust Schistocerca gregaria: some implications for population studies. Molecular Ecology 5, 295-300.

Zouros, E., Oberhauser Ball, A., Saavedra, C., and Freeman, K.R. (1994). An unusual type of mitochondrial DNA inheritance in the blue mussel Mytilus. Proceedings of the National Academy of Sciences 91 (16), 7463-7467.

Zuckerkandl, E., and Pauling, L. (1962). 'In Horizons in Biochemistry ' pp. 319. (Academic Press: New York.).

248

Appendix 1 COI barcode divergences for Cladocera (Order Diplostraca), where n/c = not comparable due to presence of one sequence. Within Species Within Genus Within Family

- Order Family Genus No of Species Species No of sequences Min Max Mean Std Deviation +/ Minimum Maximum Mean Standard deviation Minimum Maximum Mean Standard deviation Chydoridae Alona 3 dentifera 4 0 0 0 0 0 20 6 8 7 35 25 5 glabra 30 0 3 1 1 setulosa 3 0 19 13 11 Chydorus 1 brevilabris 27 0 3 1 1 n/c Diplostraca Dunhevedia 1 odontoplax 4 0 2 1 1 n/c

Eurycercus 1 longirostris 13 0 2 1 1 n/c

Leberis 2 chihuahuensis 2 0 1 - - 0 16 9 8

davidi 3 0 0 0 0

Picripleuroxu 1 striatus 10 0 0 - - n/c

Pleuroxus 2 procurvus 3 0 1 1 0 0 14 8 7

varidentatus 4 0 0 0 0

Bosminidae Bosmina 2 liederi 4 0 1 1 0 0 24 10 12 19 31 25 4

longirostris 1 n/c

Eubosmina 2 huaronensis 12 0 0 0 0 0 19 8 9 tubicen 5 0 3 2 2

Cercopagidi Bythotrephes 1 longimanus 10 0 3 2 1 n/c 0 30 30 -

249

dae Cercopagis 1 pengoi 6 0 3 1 1 n/c

Daphniidae Ceriodaphnia 2 dubia 14 0 3 1 1 0 25 4 8 1 35 24 3 laticaudata 1 n/c Daphniopsis 9 australis 1 n/c 16 32 25 3 ephemeral 1 n/c pusila 1 n/c quadrangula 1 n/c queenslandica 1 n/c studeri 1 n/c truncata 1 n/c wardi 1 n/c tibetana 1 n/c Daphnia 60 332 0 17 8 7 0 33 22 7

Moinodaphni 1 macleayi 8 0 0 0 0 n/c

Scapholeberis 1 armata 2 0 1 0 0 n/c

Simocephalus 6 exspinosus 9 0 1 1 1 1 23 15 7

heliongjiangensi 3 0 0 0 0

mixtus 6 0 1 0 0

punctatus 6 0 0 0 0

serrulatus 3 1 23 16 13 Diplostraca vetulus 8 0 16 5 7

250

Podonidae Cornigerius 1 maeoticus 8 0 2 1 1 n/c 2 26 20 6 Evadne 1 nordmanni 8 0 2 1 1 n/c Pleopis 1 polyphemoides 12 0 7 3 3 n/c Podon 2 intermedius 8 0 1 0 0 0 20 10 9 leuckartii 9 0 3 2 1 Podonevadne 1 trigona 7 0 2 1 1 n/c

Sididae Diaphanosom 3 birgei 4 0 0 0 0 0 30 19 13 22 31 27 2 a brevireme 3 0 2 1 1 dubium 1 n/c Latonopsis 1 australis 4 0 0 0 0 n/c Penilia 1 avirostris 11 0 2 1 0 n/c Sarsilatona 1 serricauda 4 0 0 0 0 n/c Sida 1 crystallina 35 0 25 7 7 n/c

Diplostraca Leptodoridae Leptodora 2 kindtii 147 0 19 9 7 0 19 9 7 n/c richardi 15 0 9 3 4

Macrothricid Macrothrix 1 elegans 3 1 2 1 0 n/c ae

Moinidae Moina 1 macrocopa 8 0 12 7 6 n/c

Polyphemidae Polyphemus 1 pediculus 203 0 23 13 6 n/c

251

For Genus Daphnia Genus Species No of sequences Within Species Min Max Mean Std Deviation +/- ambigua 29 0 7 3 2 angulata 2 1 1 arenata 1 - - - - atkinsoni 1 - - - - barbata 1 - - - - carinata 2 0 0 0 0 catawba 1 - - - - cephalata 1 - - - - cheraphila 7 0 3 1 1 citrina 1 cucullata 3 0 0 0 0 curvirostris 3 1 2 1 1 dadayana 14 0 3 2 1 dentifera 1 - - - - dubia 1 - - - - exilis 4 0 2 1 1 galeata 3 0 1 1 0 Daphnia gessneri 2 0 0 0 0 hispanica 1 - - - - hrbaceki 1 - - - - jollyi 1 - - - - lacustris 2 1 1 1 - laevis 2 1 1 - - longicephala 1 - - - - longiremis 2 2 2 longispina 4 1 15 8 8 lumholtzi 8 0 7 3 4 magna 55 0 6 2 2 magniceps 2 22 22 22 - mediterranea 1 - - - - melanica 60 0 2 1 1 mendotae 4 0 1 0 0 menucoenis 8 0 2 1 1 middendorffiana 1 - - - - 252

minnehaha 1 - - - - muddensis 1 - - - - neocitrina 1 - - - - neoobtusa 3 0 5 4 3 neosalinifera 1 - - - - nivalis 1 - - - - obtusa 31 0 23 4 6 occidentalis 1 - - - - oregonensis 1 - - - - parvula 2 14 14 - - peruviana 1 - - - - pileata 1 - - - - projecta 1 - - - - prolata 1 - - - - pulex 12 0 17 8 7 pulicaria 3 0 2 2 1 reflexa 1 - - - - salina 1 - - - - salinifera 1 - - - - similis 5 2 21 13 9 similoides 2 1 1 spinulata 21 0 3 1 1 tenebrosa 7 0 3 2 1 thomsoni 1 - - - - umbra 3 0 1 1 1 villosa 1 - - - -

253

Appendix 2 COI barcode divergences for Maxillopoda in %. Within Species Within Genus Within Family

- +/ Std Mean Mean Mean No of No of Genus Family Speceis Species Standard Standard deviation deviation Deviation Minimum Minimum Minimum sequences Maximum Maximum Maximum

bifilosa 16 0 32 16 17 californiensis 16 0 29 10 7 clausi 28 0 25 10 15 danae 2 0 1 0 1 discaudata 9 0 1 0 0 erythrea 1 0 0 0 0 0 40 8 20 Acartia hudsonica 13 4 0 29 13 17 margalefi 7 0 4 1 2 0 40 8 21 Acartiidae negligens 8 0 2 1 1 ohtsukai 1 0 0 0 0 omrorii 1 0 0 0 0 pacifica 6 0 27 12 9 tonsa 121 0 18 6 10 grani 11 0 32 11 7 Paracartia 2 0 32 9 11 latisetosa 8 0 3 1 1 Pteriacartia josephiane 1 10 0 1 0 0

hyperboreus 4 0 2 1 1 Calanidae Calanus 6 0 31 10 5 0 35 13 16 helgolandicus 19 0 3 1 1

254

glacialis 329 0 27 2 1 euxinus 2 0 0 0 0 chilensis 1 0 0 0 0 australis 1 0 0 0 0 robustior 5 1 1 0 1 plumchrus 47 0 25 5 5 Neocalanus gracilis 5 3 1 11 5 8 0 35 9 16 flemingeri 56 0 6 2 2 cristatus 53 0 3 1 1 Undinula vulgaris 1 16 0 9 2 3

gracilipes 12 0 1 0 1 Boeckella 2 0 21 8 8 titicacae 36 0 5 2 2 clitellata 18 0 5 1 2 Calamoecia 2 0 21 5 4 salina 1 0 0 0 0 abdominalis 5 0 0 0 0 furcatus 3 3 21 9 16 hamatus 10 0 11 3 2 Centropages 6 0 31 10 8 tenuiremis 3 0 1 0 1 Centropagidae 0 35 11 20 typicus 126 0 4 1 1 violaceus 2 0 0 0 0 Isias clavipes 1 5 0 1 0 1

johanseni 5 0 1 0 0 Limnocalanus 2 0 25 7 3 macrurus 114 0 25 3 2 Osphranticum labronectum 1 4 0 15 7 8

sinensis 7 0 2 0 1 Sinocalanus 2 0 20 8 10 tenellus 10 0 19 7 4

255

mastigophorus 1 0 0 0 0 parapergens 2 0 2 0 2 lividus 37 0 8 3 4 arcuicornis 48 0 7 2 2 furcatus 5 0 2 1 1 Clauscocalanus 10 0 27 8 13 ingens 1 0 0 0 0 jobei 4 0 10 4 5 laticeps 1 0 0 0 0 Clauscocalanidae paululus 1 0 0 0 0 0 29 8 15 pergens 2 0 1 0 1 Ctenocalanus citer 1 2 0 1 0 1

Psedoclanus acuspes 1 1 0 0 0 0

elongatus 9 0 3 1 1 mimus 1 0 0 0 0 Pseudocalanus minutus 5 1 0 0 1 0 0 23 9 13 moultoni 6 0 1 0 0 newmani 2 2 2 0 2 Diaptomidae Acanthodiaptomous pacificus 1 61 0 23 8 10

256

Appendix 3 World species catalogue of Ceriodaphnia spp.

1 Ceriodaphnia acanthina Ross, 1897, p. 296. Fig. 1.

Ceriodaphnia acanthina Ross, 1897: 296. Ceriodaphnia acanthinus Ross, 1897a: no description.

Type material: Probably lost. Type locality: "Deep weedy slough at Portage la Prairie", 25 miles W of Winnepeg, Manitoba, Canada (Ross, 1897). Canada. Assiniboin river; Lake Manitoba; Canadian Pacific Rail road; Prairie slough near Portage La Prairie; Deep weedy slough at Portage La Prairie; Rat creek at McDonnell on Portage plains.

Diagnosis. Ceriodaphnia acanthina (Fig. 1) has a large, rounded body with a well-developed posterior spine. Length is between 0.8 to 1 mm. Deep cervical notch separates head. Head depressed, small and rounded, lacks spines; ocellus located between the eye and antennules. Eye moderate size; lenses not projecting far from eye pigment. Ocellus small, rounded and at lower portion of eye at a distance almost half way from eye. Antennules short and thick and reach to or just beyond the line of forehead. Antennules with aesthetascs towards distal end. Antennae long and slender, setae reach almost to posterior margin of the shell.

Carapace strongly reticulated with very sharp and small hexagonal shaped reticulations, measures about 0.016 to 0.021 mm across. Carapace edge with small sharp spines, many of which project almost at right angles to the surface of the shell, which closely resembles the arrangement of spines in Ceriodaphnia setosa Matile (1890). Dorsal margin of shell curved and arched to form a clear posterior spine or posterodorsal angle, which is close to 1/3rd of distance from dorsal to ventral margin. Posterodorsal angle not divided into two parts and with a blunt end, similar to Ceriodaphnia lacustris Birge (1893). Fornices well developed, broad and extend almost to a width of the shell, not sharply angled and do not end in sharp teeth as seen in Ceriodaphnia lacustris. 257

Postabdomen moderate size and tapers slightly towards the end with 9 to11 strong recurved anal denticles, first and last anal denticles smaller compared to remainder which are approximately equal in size. Postabdominal claws long, curved and denticulate with two different sizes of setules. Basal 2/5th of claw with 40 to 50 teeth, which are two or more, times longer than the distal portions.

Comments. Although reticulations and presence of spines on the edge of the carapace of Ceriodaphnia acanthina are similar to C. setosa Matile (1890), the total number of spines are more in C. acanthina; the length and height of C. setosa being half that of C. acanthina. The difference in the armature of the postabdominal claws of C. acanthina, which is smaller and less curved, compared to more curved and longer claws in C. reticulata.

Fig. 1: Anatomy of Ceriodaphnia acanthina Ross, 1897.

258

2 Ceriodaphnia alabamensis Herrick, 1883 (Plate No. 6) Figs 11, 12 and 12a.

Ceriodaphnia alabamensis Herrick, 1883: 38; Winchell, 1883: 503.

Type material: Lost (D.G. Frey, personal communication to Prof. N.N. Smirnov). Type locality: USA. Tuscaloosa, Ala; Madison, Wisconsin.

Diagnosis. Length equals 1 mm. Head remarkably small and pressed downward (Figs 2.1 and 2.4), which extends into beak like prolongation just below the small eye. Antennules long and hanging as seen in Moina (Fig. 2.1). Body size similar in length to C. reticulata (1 mm compared to 0.82 mm to 1.1 mm) and reticulation on carapace shows double contour lines similar to C. pulchella (Fig. 2.3). Postabdomen is slender with nearly parallel sides, claws short and truncate with similar spine size (Fig. 2.2).

Comments. Herrick (1883) failed to provide a complete diagnosis for C. alabamensis, but Winchell (1883) provided additional detail, for example, presence of nine or more spines on postabdomen (Fig. 2.2); postabdominal claw smooth and truncated, cervical notch cannot be seen that separate head from body instead a small spine like projection is observed (Figs 2.1 and 2.4); hexagonal shaped reticulation on carapace. Antennule large segmented and extends well beyond the angle of head.

My observations are similar to those of Winchell (1883), and the only additional information is that the anterior sense hair which arises from the peduncle is located almost 1/3rd from base of the antennule (1884). Ocellus box shaped and located nearer to eye (Fig. 2.1).

Parameters like ocellus shape distance of the anterior sense hair and peduncle size has to be verified by looking at the type specimen for supplementary elucidation of the species.

259

Fig. 2: Anatomy of Ceriodaphnia alabamensis Herrick, 1883.

260

3 Ceriodaphnia bicuspidata Weltner, 1897 (Tafel I) Figs 10, 11 and 14.

Ceriodaphnia bicuspidata Weltner, 1897: 5.

Type material: Is not known. Type locality: German East Africa Emin Pasha and Stuhlmann Reamer.

Specimen identified as Ceriodaphnia bicuspidata Weltner, 1897.

Material examined. NHMUO F18492 (in ethanol), Africa. 1891-V-25, no other data, NMCL 16180; 1890-IX-29, no other data, NMCL 16181.

Diagnosis. Head small and strongly depressed which is separated from the body by a deep cervical notch. Forehead smooth without any spine; eye large surrounded with crystalline lenses and covers most part of the forehead. Forehead slightly angulated near the antennule; antennules are short and conical in shapes, which bear sensory hairs. Fornix well developed and has an acute end which sometime is provided with few thorns. Dorsal and ventral carapaces are globular in shape (Fig. 3.1); central part of the carapace shows double contour hexagonal reticulation whereas near the free edges of the ventral carapace shows irregular shaped polygonal reticulation. Postabdomen is broad and tapering gradually towards the rear, distal margin is convex shaped and bears five to eight slim anal denticles; postabdominal claw is curved and denticulate including pecten which is a set of fine long teeth (Figs 3.1 to 3.3).

261

Fig. 3: Anatomy of Ceriodaphnia bicuspidata Weltner, 1897.

262

4 Ceriodaphnia carolinensis Coker, 1926 (Plate No.44) Figs 5-10.

Ceriodaphnia lacustris sub spp. carolinensis Coker, 1926: 258.

Type material: Not stated. Type locality: USA. Lake James, North Carolina.

Diagnosis. The description of C. carolinensis Coker (1926) covers all the essential taxonomic features of this species and is as follows. Length between 0.33 to 0.49 mm. Head small and downwardly directed with no rostrum, but the ventral contour bends upward with a distinct angle just before the antennules (Fig. 4.1). Slight supra ocular depression at half the distance from the vertex to cervical notch (Figs 4.1 and 4.2), vertex of head shows presence of very fine spinules. Head divided from body by deep cervical notch (Figs 4.2 and 4.3). Anterior portion of forehead nearly filled by large eye, ocellus is small slightly elongated in a vertical direction and located nearer to posterior margin of head than to the eye. Antennules short and stout, anterior sense hair located near the tip and there is half a dozen of aesthetascs. Fornices over the bases of antennae are highly developed and spread out on each side as a broad triangular plate with truncate tip bearing two to three spinules; tip of fornices are much narrower than as described by Birge for C. lacustris.

Carapace smooth oval shaped and slightly curved in dorsal ventral section of body. Posteriodorsal angle ends in a blunt projection bearing two or three spinules; free margin of the ventral carapace bears spinules.

Postabdomen large and narrows towards end; its contour forms a smooth, curve slightly before abdominal seta, and has a strong smooth curve in the region of anal denticles. There are six anal denticles, second and third from the distal end being the largest; postabdominal claws are strong and without spines but very finely denticulate (Figs 4.4 and 4.5).

Comments. The characteristic features of C. carolinensis are very similar to the description of C. lacustris Birge (1893). The distinguishing characters that separate C. carolinensis from C. lacustris are the size of eye which is larger (Fig. 263

4.1); dorsal ridge which is not arched; tip of the fornices which seem to be narrower compared to the broad triangular plate of C. lacustris. Posterodorsal angle not developed and is blunt shape compared to the “well developed and stout” posterodorsal of the C. lacustris as described by Birge (1893).

264

Fig. 4: Anatomy of Ceriodaphnia carolinensis Coker, 1926.

265

5 Ceriodaphnia consors Birge, 1879 (Plate No. 1) Figs 3 and 4.

Ceriodaphnia consors Birge, 1879: 5; Nachtrieb, 1894: 171; Winchell, 1883: 40.

Type material: No information, but it could be found in the collection of E.A. Birge, incorporated to D.G. Frey's collection in USNM. Type locality: USA. Madison, Wisconsin.

Diagnosis. Length between 0.5 to 0.55 mm. Body colour of C. consors transparent or opaque with reddish brown or black tinge on surface of the carapace. Head prolonged and rounded at the apex, not angulated in front of antennules (Fig. 5.1). Carapace is large, round or square with rounded angles, but with a more or less prominent angled behind (Figs 5.3 and 5.4). Carapace strongly reticulated with hexagonal meshes. Fornices project moderately, and are rounded and smooth. Postabdomen broad toward apex and obliquely truncated, anal denticles, which are slightly recurved lie on lower margins, which are about eight in number on each side. Postabdominal claws large and smooth (Fig. 5.2).

Comments. The shape of the postabdomen distinguishes this species from all the other species of Ceriodaphnia except C. rotunda, Straus (1820). Whereas, C. consors differs in respect to head structure, angulation and lack of spines projecting from the forehead.

Nachtrieb, points out that other than the total body size of C. consors, which is half of the body size of C. laticaudata, and less number of anal denticles, all the other characteristic are related to C. laticaudata. Birge’s (1879) description of the postabdomen as broad and not narrowed toward the apex are also not clearly noticeable and hence should be considered as synonymous form of C. laticaudata.

These morphological variations with respect to body size and difference in spine number is known to occur in this genus due to factors like predators kairomones

266

concentration and predator type which has been documented well in literature (Zaret, 1972; Rietzler et al., 2008; Roselli, 2008).

267

Fig. 5: Anatomy of Ceriodaphnia consors Birge, 1879.

268

6 Ceriodaphnia cornuta Sars, 1885 (Tab. 5) Fig. 1-3

Ceriodaphnia cornuta Sars, 1885: 26; Richard, 1894:82; Henry, 1922: no description, Plate No.4, Fig. 4; Rzoska, 1956: 508; Daday, 1905: 205. Syn: Ceriodaphnia cornigera Jiang Xiezhi, 1977: 287. Syn: Ceriodaphnia rigaudi Richard, 1894: 82; Sars, 1916: no description, Plate No.34; Figs 3, 3a and 3b; Turner, 1923: Plate No. IV; Daday, 1905: 206. Type locality. North Vietnam: "Une mare dela citadelle de Lao-Kay, poste avance du Tonkin" (Richard, 1894).

Material examined. Australia, no other data, F18329 (in ethanol), East Africa. Lake Burigi, Tanzania, 1911-07-17, NMCL 16361, Central Africa. Lake Victoria, no other data, NHMUO F9265 (slide collection); F18491 (in ethanol). . Australia, no other data, NHMUO F9731 (slide collection); Mudgee, NSW, no other data, AMS P.27727; Corona, NSW, no other data, AMS P.5895.

Specimens identified as C. rigaudi. Richard, 1894 Material examined Australia: "Gracemere Lagoon, situated at a distance of about 7 miles west of Rockhampton, in North Queensland". Many females, DGF 728, DGF 749, DGF 756, “Peche effective a Lao-Kay, Mare de la Citadelle, Fr. Indo-China”. (Kotov and Ferrari, 2010), Australia. Victoria, no other data NHMUO F19284 (in ethanol), Brazil, no other data, NHMUO F18443 (in ethanol); Itatiba, no other data, NHMUO F18444 (in ethanol); Itatiba, no other data, NHMUO F18445 (in ethanol); São Paulo, no other data, NHMUO F18446 (in ethanol); Temporary Pool On Grassland Near Porto Alegre, Rio Grande do Sul, USNM 93389 (slide collection); Corumba, Baia Jacadigo, Rio Grande do Sul, 1987-04-03, USNM 285010 (in ethanol); Corumba, Paraguay River, Near Airport Corumba, Point 2, Rio Grande do Sul, 1986-04-02, USNM 285009 (in ethanol), Philippines. Luzon Island, San Juan River, Rizal, 1951-02-15, USNM 92921 (slide collection), South Africa. Knysna, no other data, NHMUO F9270 (slide collection); NHMUO F9271 (slide collection); NHMUO F9272 (slide

269

collection); NHMUO F18355 (in ethanol), Sri Lanka, no other data, NMCL 11854; NMCL 18407; NMCL 18408.

Diagnosis. The description of C. cornuta by Sars (1885) is expansive and covers all the general characters of the species. Length is between 0.5 to 0.6 mm. General form of the body is short, thick and somewhat tumid. Head small, depressed and separated from the body by deep cervical notch; dorsal margin of the head is rather convex in the upper part then further down where it forms a slight concavity above the eye. Forehead region projects two acute spines which point in the opposite direction, posterior ventral process is large and represents like a rostrum projecting in front of the antennule whereas the anterior one is in the form of a small conical structure that points straight upward or forward (Fig. 6.15). Eye moderate size almost filling the forehead region; ocellus is small and punctiform, placed at a short distance from the insertion of the antennule. Antennule small and fairly reaches the line of head, tip of which bears fine sensory hairs and the anterior sense hair arises from the middle of the antennule. Fornix is a short triangular lappet shaped structure that rises from a little above the base of the antennae. Exopod of antennae is smaller than the endopod (Figs

6.1, 6.4, 6.5 and 6.16).

Carapace when seen laterally is regular, broadly oval shape structure with the upper and lower margin gently arched; posterodorsal angle is short spine shaped and bifurcated. Reticulation on the carapace is regular polygonal shaped structure; free edges of the carapace are smooth without any traces of bristles or denticles (Fig. 6.2).

Dorsal margin of the postabdomen is straight and bears eight pairs of denticles of almost equal size and two well-marked dorsal abdominal appendages. Postabdominal claws are gently curved with a trace of secondary teeth at the base. Abdominal seta is of moderate length and distinctly bi-articulate (Figs 6.3 and 6.14).

Ceriodaphnia cornigera is synonymised with C. cornuta primarily due to the presence of beak like structure near antennule (Fig. 6.8). Sars (1885) refer this beak like structure as posterior ventral process, which is large and represents a 270

rostrum, projecting in front of the antennule. The other feature that matches description of C. cornuta is the total number of anal denticles recorded as eight to nine in numbers. Body is somewhat oval shaped and surface of the carapace is faintly reticulated. Postabdominal claw of C. cornigera is large, smooth and without basal spines (Fig. 6.9).

Comments. Daday (1905) recorded five to six anal denticles on the postabdomen of C. cornuta from Paraguay River (Fig. 6.14) (length = 0.35 to 0.55mm) compared to eight pairs of denticles of equal size recorded by Sars. Also, according to Sars (1885) there are two well-marked dorsal abdominal appendages (Fig. 6.18), the anterior one conical shaped and the posterior one broad sub quadrangular and is furnished with a cluster of delicate hairs. Daday (1905) indicated only one conical appendage with no description on the cluster of hairs.

The free edge of the ventral carapace is smooth without any traces of bristles or denticles according to Sars (1885) description. However, Richard in 1894 recorded that it is not so and in fact the free edge of the carapace has a saw teeth like projection (Fig. 6.6) and this can be confirmed by looking at the high- resolution image of the original specimen (Fig. 6.12).

The variation in horn development has been found to be a case of polymorphism in the natural populations of C. cornuta as demonstrated by Rzóska (1956) (Fig. 6.7). The discrepancy in the description is with respect to the position of the secondary spine, which is located in the middle part of the dorsal edge (Figs 6.8 to 6.10).

Ceriodaphnia rigaudi (Figs 7.1 to 7.13) and Ceriodaphnia cornuta has been a subject to open discussion for a long time focussing on whether the first species has to be considered a synonymous form of C. cornuta as discussed above.

Distribution: Australia; Brazil; China; Ceylon; Guinea; Germany; Java; Khartoum; Nyanza; New Paraguay River; Palestine; Philippines; Sumatra; Tonkin.

271

Fig. 6: Anatomy of Ceriodaphnia cornuta Sars, 1885.

272

Fig. 6: contd Anatomy of Ceriodaphnia cornuta Sars, 1885. Figs 6.15 to 6.18 images were obtained from the Natural History Museum Universities Oslo.

273

Fig. 7: Anatomy of Ceriodaphnia rigaudi Richard, 1894.

274

7 Ceriodaphnia dentata Birge, 1879

Ceriodaphnia dentata Birge, 1879: 4.

Type material: Not stated. Type locality: USA."Cambridge.

Southampton and vicinity, Mass.; Madison, Wis”.

Diagnosis. Length between 0.5 to 0.6 mm. Head prolonged, and distinctly angulated in front of the antennules. Reticulation with hexagonal meshes of the frons on head is similar to the reticulation on the carapace. The lines of reticulation vary from almost imperceptible to strongly marked in different specimens. Carapace is transparent or opaque. There is a distinct projection at junction of the dorsal and posterior margins of carapace, almost like a spine. Fornices are broad and projecting, but smoothly rounded over and have no angular projection. Postabdomen moderate size, truncated, with seven or eight anal denticles on each side with chevrons. Postabdominal claws armed with zero to eight (usually six) bristles on the outer side. The bristles are often exceedingly fine and are rarely absent. There is a row of very fine teeth extending to the tip of the claw. This is only seen in good specimens and under high power, and sometimes cannot be seen at all. Abdominal process is rather blunt shaped with fine chevrons on its surface.

Comments. Ceriodaphnia dentata Birge, 1879 differs from C. reticulata Jurine (1820) by having short bristles inside, of postabdominal claws and with less prominent fornices. C. reticulata head has an “obscure angulatum” in front of the antennules and postabdominal claw has no fine setules but has three to five distinct spinules.

275

8 Ceriodaphnia deserticola Manujilova, 1972 Figs 1-3.

Ceriodaphnia deserticola Manujilova, 1972: 74.

Type material: Not stated. Type locality: Not stated.

Diagnosis. Head small and raised with shallow supraocular depression. Supraorbital region of the forehead is a flattened structure (Fig. 8.2) rather than semicircular in shape; eye large in size and surrounded by crystalline lenses; ocellus is pellucid in shape and located nearer to the antennule than to the eye. Antennule size according to Manujilova is short but the Fig. 8.2 illustrates it as long, tip of which bears fine sensory hairs, anterior sense hair is short and positioned halfway between the base and the tip of the antennule. Head separated from body by a cervical notch.

Carapace sub quadrangular in shape, ventral section of carapace is more convex than the dorsal section (Fig. 8.1). Antero dorsal section concave shaped than the posterior dorsal section which ends in a short blunt shaped posterodorsal angle. The overall structure of the postabdomen represents a boat structure, which reaches the greatest height in the middle. Distal end of the postabdomen with six to seven slender anal denticles of equal length; postabdominal claw smooth and denticulate (Fig. 8.3).

Fig. 8: Anatomy of Ceriodaphnia deserticola Manujilova, 1972.

276

9 Ceriodaphnia dubia Richard, 1894, p. 570-572. Figs 6-8

Ceriodaphnia dubia Richard, 1894: 570; Delachaux, 1917:80; Sars, 1916:317; Berner, 1986: 16; Greenwood et .al 1991:285. Syn Ceriodaphnia affinis Lilljeborg, 1901 :675. Syn Ceriodaphnia limicola Ekman, 1900:70. Syn Ceriodaphnia acuminata Ekman, 1900:69. Syn Ceriodaphnia richardi Sars, 1901: Plate No. 3.

Type material: David G. Frey (DGF) collection housed in Smithsonian

Institution’s Museum Support Center in Suitland, Maryland, U.S.A.

“According to the hand written catalogue, sample DGF 723 was from

“Balige (Lac Toba, Sumatra)”, coll. in 24.xi.1891 by M. E. Modigliani.

However, according to the label, this sample is from Lake Titicaca and collected in 1969. So, the initial sample with number 723 is no longer present in the collection, and there are no other samples from Lake Toba in Richard’s collection " (Kotov and Ferrari, 2010). Type locality. “lac

Toba”, N Sumatra, Indonesia.

Specimens identified as Ceriodaphnia dubia Richard, 1894.

Material examined. Australia. Victoria, no other data, NHMUO F19258

(in ethanol), Indonesia. Lake Toba, Sumatra, 1891 – 02 – 24, Frey, D. G.

USNM 1120420 (100 specimens in ethanol), South Africa. Cape of

Good Hope, no other data, NHMUO F9266 (slide collection); Cape of

Good Hope, no other data, NHMUO F9267 (slide collection) Central

Africa. Lake Victoria, no other data, NHMUO F9309 (slide collection).

277

Specimens identified as Ceriodaphnia affinis Lilljeborg, 1901

Material examined. Germany. Umgebung von Berlin, Hartwig, no other

data, NMCL 11913, Sweden. Blekinge, Sturberg, no other data, NHMUO

F9583 (slide collection); Blekinge, Sturberg no other data, NHMUO

F18489a (in ethanol) and NHMUO F18489b (in ethanol).

Diagnosis. The description of C. dubia by Richard (1894) (Figs 9.1 to 9.3) is expansive. Length between 0.7 to 1 mm. Head small; forehead is upright compared to most other species of the genus, average length not exceeding one sixth of the length of the animal. A deep cervical notch separates head and body. From the side view, dorsal edge of head shows supraocular depression and another smaller depression closer to the eye; forehead shows angulation near the tip of antennule, which is somewhat similar to that seen in C. pulchella, forehead also bears few very short spines similar to those seen in C. rotunda and are protruding from the forehead region. The greatest width of the carapace is about 1.5 times the width of head and much narrower than the carapace. Carapace are not much longer than wide (in the ratio of six to seven approximately). Ventral margin of carapace more convex than the dorsal margin, posterodorsal angle short and acute located far behind the midline of the body. Reticulation on the carapace is cross-linking regular polygonal structure and their free edge is smooth.

Eye medium size located near the top part of forehead surrounded with round crystalline lenses, which are distinct. Ocellus small and closer to the origin of the antennule. Antennule long and slender extending beyond line of the head, fine sensory hairs is shorter than the size of the antennule. Anterior sense hair located 1/3rd distance from the tip of the antennule. The relatively underdeveloped fornix forms an angle more or less rounded and bears one or two rudimentary spines, sometimes hardly even noticeable.

Postabdomen moderately long and wide that tapers gradually in width towards the terminal claw, which is slightly curved. Abdominal setae are long; their second article is fine and densely ciliate. Postabdomen bears eight to ten anal

278

denticles; postabdominal claw is smooth without any secondary denticles or pecten. The lateral surface of the postabdomen shows patches of chevrons. Abdominal appendage sometime shows a conical projection.

Berner, (1986) study of Ceriodaphnia cultures used by the US EPA as biological indicators for determining the quality of ambient water, revealed phenotypic variation in C. dubia. There were two species of C. dubia within the stock culture one with a toothed pecten variety (Fig. 9.13) and the other with fine heavy setules (Fig. 9.9). The shape and other characteristics of both the species are mostly the same, with following exceptions; toothed pecten variety (Figs 9.10 to 9.13) showed reticulation on the carapace and head with deep edges and variation in forms of the central pecten on the postabdominal claw. In Form 1 the pecten showed 18 to 24 heavy fine setules (Fig. 9.9) slightly longer than adjacent groups similar to that of C. dubia Richard (1894), in the 2nd form the central pecten showed 7 to 14 close of ovately tapered denticles (Fig. 9.13).

The characteristic features of C. limicola Ekman, 1900 are very similar to C. dubia (Richard, 1894) with only exception being in the number of anal denticles recorded on the postabdomen, which are 10 to 12 in number, along with the cervical notch which is shallow as in C. dubia (Richard, 1894).

279

Fig. 9: Anatomy of Ceriodaphnia dubia Richard, 1894.

Ceriodaphnia richardi Sars, 1901 has been synonymised with C. dubia (Richard, 1894). Sars (1901) describes C. richardi body as pellucid shaped with a faint greenish tinge. Head depressed and procumbent; forehead rounded and forms an obtuse angle at the posterior end. Eye large and covers most of the forehead region along with numerous crystalline lenses; ocellus small, punctiform and is 280

located half way between eye and antennule. Antennule short, anterior sense hair arises near to the tip of the antennule, which also shows presence of aesthetascs.

Cervical notch is distinct (Figs 9.29 to 9.32). Carapace not very tumid, when seen laterally looks like an oval quadrangular in outline, with hexagonal reticulation on the surface. Dorsal margin of the carapace slightly arched and ventral margin is almost straight in the middle, posterodorsal angle is prominent. Postabdomen of nearly equal breadth throughout and with eight anal denticles. Postabdominal claw with six secondary denticles in the proximal part (Fig. 9.33).

Lilljeborg, 1901 described Ceriodaphnia affinis body as light greyish yellow or greyish white in colour, sometimes with a greyish red tinge. When seen in lateral view, body is broad or oval with arched antero ventral and curved dorso ventral sections of the body (Lilljeborg, 1900b). Head moderately depressed; forehead rounded with supraocular depression. Eye large and has crystalline lenses, ocellus is small and located close to the antennule. Section of the forehead near the antennules at a slightly obtuse angle and barely noticeable; antennules short with fine sensory hairs whereas the anterior sense hair is further away almost situated 1/3rd distance from the tip of antennule (Fig. 9.24). Head separated from body through cervical notch. Fornices have evenly rounded outer edges on each side with a hint of an angle formed by the anterior parts of the fornices (Fig. 9.23). Carapace shows reticulation on the surface that is not coarse. The anterior ventral margin of carapace more convex than the posterior ventral margin; posterodorsal angle small, blunt and tapering a bit towards the posterior ventral margin end. Postabdomen broad and tapering towards the end, variation with respect to the size and shape of the posterior end of the postabdomen has been noted by author; with 10 to 12 anal denticles; abdominal appendage is either flat or horn shaped (1862a; Sars). Johnson (1956) work on European populations of C .affinis provided good arguments in support of synonymising C. affinis with C. dubia, which was accepted by Scourfield and Harding in 1958.

281

Fig. 9: contd... Anatomy of Ceriodaphnia dubia Richard, 1894.

282

Comments. The variation of toothed pecten variety of C. dubia according to Berner (1986) was due to contamination of the original C. reticulata culture. Postabdomen of C. reticulata and C. dubia are alike except for pectation on the claw of C. dubia. Also emphasized in her report, that this toothed pecten variation of C. dubia was observed only under controlled environmental and nutritional conditions and, hence, recommended carrying out specific tests on interspecific breeding and nutrition to confirm polymorphism in the species.

Ceriodaphnia dubia description from New Zealand by Greenwood et al (1991) is similar to C. dubia Berner, (1986) description of Form 1 toothed pecten variety with a central pecten on the claw showing 18 to 24 finely setulated pecten (Fig. 9.9), which are slightly longer than those of the adjacent setules (Figs 9.19 and 9.20).

Ceriodaphnia acuminata (Fig. 9.28) shares similar characteristics of C. dubia (Richard, 1894). The description of Ekman (1900) mentions the presence of mid length hair arising from the ventral edge of the carapace which could be seen only in the dorsal position. This feature has not been described by any other authors and cannot be verified.

Distribution: Australia; Bergvliet; Brazil; Nyanza; New Zealand; Norwegian; Sumatra; USA.

283

10 Ceriodaphnia globosa Brady, 1906 (Pl: XLVIII) Figs 1 to 3.

Ceriodaphnia globosa Brady, 1906: 695.

Type material: Not stated. Type locality: New Zealand."Rotokakahi

Lake, Taupo Lake, Waikareiti Lake", all in basin of the Waikato River,

(Brady, 1906).

Diagnosis. Length = 0.76 mm .When seen in lateral view C. globosa is sub quadrangular and rounded in shape. Head not depressed and is well separated from the body by a deep cervical notch; forehead rounded with a flattened end. Eye large and covers most of the forehead; posterior end of the head shows a rounded lobe just above the cervical notch (Fig. 10.1). Dorsal margin of the carapace is much more boldly arched than the ventral margin. Margin of the carapace is devoid of any setules and does not show any reticulation, except for uniform dotting all over the surface. Posterior part of body is circular with pointed triangular shaped posterodorsal angles (Figs 10.1 and 10.2). Postabdomen is long with eight slender anal denticles. Postabdominal claw slender and devoid of any pecten (i.e. they are smooth) (Fig. 10.3).

284

Fig. 10: Anatomy of Ceriodaphnia globosa Brady, 1906.

Comments. Supplementary information can be retrieved from the image; for example, Brady (1906) has mentioned in its original description “the antennae and other appendages are of the usual form” which raises doubt as to which particular form it is usual to. From the image, it is clear that antennule is slender, long, reaches up to the margin of the head, and does not show any angulation near the antennule, with absence of supraocular depression. In addition, total number of denticles as mentioned by Brady is eight but his image (Fig. 10.3) shows nine denticles. By looking at the description, the current author has a view that there can be eight to nine anal denticles on postabdomen; variation in number of anal denticles is common in this genus.

285

11 Ceriodaphnia hakea Smith, 1909 (Plate No. 15) Figs 10-16 Ceriodaphnia hakea Smith, 1909: 80.

Type material: Not stated. Type locality: Australia. Tasmania.

Diagnosis: Length equals 1 mm .Head remarkably recurved with no supraocular depression, with a remarkable curved hook on the dorsal side, which is not shared by any other species of Ceriodaphnia. There is no spine or swelling in front part of the head. Ocellus clearly marked and located halfway between eye and antennule. Constriction between body and head is not sharply marked (Fig. 11.1). Body green in colour.

Carapace rounded and has no clear posterior spine, only a slight angle. Antennule carries a short sensory hair and long anterior sense hair on a peduncle which is at a little distance (Richard, 1894) from the apex edge. Distal end of the antennae shows two compound plumose setae (Fig. 11.2).

Postabdomen with five anal denticles with decreasing size, largest being the anterior one, anal claws are smooth. Between anal claws and the two abdominal setae at the back, the hind end of the body is arched without any distinct angulation (cornered formation) or sinuosity (curved end) (Figs 11.1 and 11.6).

Additional information about Trunk appendage I, II and III can be gathered from the original images, something explored by the current author.

Trunk Appendage I (Fig. 11.3). The anterior side of the appendage I show the presence of two ejector hooks (EJH) which are common in suborder Anomopoda. According to Kotov (1995) this ejector hook may be the derivative of the posterior setae which appear in the embryo near to the inner limb margin.

The exopodite comprises of two portions, accessory setae and the Outer Distal Lobe (ODL). The accessory setae are absent in C. hakea but the ODL shows a long setae armed distally with shorter setules as shown in Fig. 11.3. The 286

remaining part of the inner distal position is sub-divided into endites 1 to 5 (En1 to 5). En 1 or also sometimes referred as gnathobase (Gn) is absent in Daphniidae and Moinidae for appendage I (Alonso, 1996; Kotov and Gololobova, 2005). On each of the remaining endites 2 to 5 there are several posterior setae, like 4 setae (s1 to s4) on endite 2; 3 in endite 3; 2 in endite 4 and 1 in endite 5. Size of the posterior setae differs between endites.

Trunk Appendage II (Fig. 11.4). The exopodite of appendage II is elongated and bears two long setae (distally and laterally), four endites (En1 to 5) bearing six setae and rudimentary setae near gnathobase (Gn). Gnathobase with two clear rows of setae: Two anterior setae and seven posterior setae “filter plate”.

Trunk Appendage III (Fig. 11.5). The appendage III shows a large flat exopodite with four distal (d1 to 4) and two lateral setae (l1 to 2). The inner distal position of the endite has been shown as two different parts, the current author assumes that two setae belongs to endite 5, which (rest of the En1 to 4 are missing) has one posterior and one anterior setae .Again, this has to be verified by looking at the type specimen. The rest of the inner distal portion of the limb is a singular large lobe bearing 21 posterior setae.

Comments. The current author would like to point out that the original Fig. 11.4 doesn’t show En 4 for trunk appendage II, which is missing; it might be a distinguishing characteristic of the organism but has to be verified by looking at the type specimen which has not been done in this study.

287

Fig. 11: Anatomy of Ceriodaphnia hakea Smith, 1909.

288

12 Ceriodaphnia lacustris Birge, 1893 (Plate.XII) Figs 6-9.

Ceriodaphnia lacustris Birge, 1893: 294.

Type locality. USA. "Madison, Minocqua, Tomahawk lake, Twin lakes, and Rhinelander (Lake Julia), all in Wisconsin, and at Gogebic Lake, Michigan" (Birge, 1893).

Specimens identified as Ceriodaphnia lacustris Birge, 1893. Material examined. USA. West Okoboji Lake, Iowa, NHMUO F12631 (slide collection); Indiana, no other data, USNM 79767 (10 specimens in ethanol); Lake country, California, 1938-06-10, USNM 81664 (200 specimens in ethanol).

Diagnosis. Ceriodaphnia lacustris has a large, rounded yellowish transparent coloured body with a well-developed spine shaped posterodorsal angle. Length is between 1 to 1.3 mm. Head small, greatly depressed and slightly angulated near the front of antennule with shallow supra-ocular depression and a deep cervical notch. Eye moderate size with numerous crystalline lenses that project out. Ocellus small and quadrangular in shape. Frons shows presence of numerous small spines at the angle of reticulations. Fornices are much larger than any other species noted in this genus with a broad triangular plate that extends out and whose distance between the tips equals greatest breadth of the animal. Apex of the fornices blunt and armed with three or four spines (Figs 12.1 and 12.2).

Antennules short and thick, and almost equal in length to that of sensory hairs. Anterior sense hairs are located near the apex of the terminal joint. Antennae are small and slender (Fig. 12.3).

Carapace swollen at the posterior ventral portion and the dorsal line is slightly arched with no strong reticulation on its surface. Postero dorsal angle is well developed and stout with blunt apex showing 2 to 4 spines and occasionally divided at the tip into right and left parts (Fig. 12.2).

289

Postabdomen long and narrow, with six to eight recurved anal denticles, which increase in size towards the posterior end of the abdomen. Anal claws are long, recurved and denticulate (Fig. 12.4).

Comments. We can get supplementary information from the original illustration,

Fig. 12.2 shows ocellus circular shaped and located near to base of the antennule. Frons on forehead shows irregular pentagonal arrangement.

Ceriodaphnia lacustris has been closely related to C. hamata, which is synonymous with C. quadrangula (Müeller, 1785), in respect to form and habitat but differs in fornices shape with presence of the spine on the head. When compared C. lacustris to C. punctata Müeller (1867) (which is also synonymous form of Ceriodaphnia quadrangula (Müeller, 1785), C. lacustris shows similarity with respect to head and postabdomen morphology with C. punctata Müeller (1867) but differs in antennule size which are shorter and with bigger fornices when compared to C. punctata.

Distribution: Canada, Toronto (Georgian Bay); USA, Madison.

290

Fig. 12: Anatomy of Ceriodaphnia lacustris Birge, 1893.

291

13 Ceriodaphnia laticaudata Müller, 1867 (Plate No.4) Fig. 5.

Ceriodaphnia laticaudata Müller, 1867: 53; Lilljeborg, 1901: 208; Sars, 1916: 318; Paggi, 1986: 42; Arévalo, 1916: 140; Hartmann, 1917: 92; Herrick, 1884: 95. Syn: Ceriodaphnia transylvana Daday, 1888. Syn: Ceriodaphnia valentina Arévalo, 1916: 142.

Syn Type material. ZMUC 7032. Type locality: Not stated.

Specimens identified as Ceriodaphnia laticaudata Müller, 1867 Material examined. Australia.Victoria, no other data, NHMUO F19281

(in ethanol), Germany. Berlin, no other data, NMCL 11914; Berlin,

1900-10-08, NMCL 11915; Berlin, no other data, NMCL 15138;

Brandenburg, no other data, NMCL 16050; Nordrhein-Westfalen;

Münster, no other data, NMCL 8338, Norway, no other data, NHMUO

F19352 (in ethanol), South Africa. Cape of Good Hope, no other data,

NHMUO F9275 (slide collection), USA, District of Columbia, no other

data, USNM 62627 (100 specimens in ethanol).

Diagnosis. Ceriodaphnia laticaudata description by Müller (1867) can be compared to a certain extent with Herrick (1884); Schiødte (1868-1869); Sars (1916); Lilljeborg (1900a) and Paggi (1986) descriptions.

Length = 0.7 to 1 mm. When seen laterally body is rounded and quadrangular in shape. Head small and procumbent depressed with rounded or slightly angled rear end; forehead narrowly rounded without any prominent angulation near the front of the antennule (Fig. 13.1). Eye moderate size with crystalline lenses (Figs 13.8 and 13.13); Ocellus small and located nearer to antennule; supraocular depression is deep; cervical notch is not prominent (Fig. 13.6). Antennules short (Figs 13.1, 13.5 and 13.10) except in the case of Herrick’s (1884) description 292

which has reported it as “rather large” (Fig. 13.8). From the original illustrative figures, fornices appear to be smooth rounded structure, which was later supported by Paggi (1986) description of this species. Posterodorsal angle is almost securiform in shape and pointed in some cases even blunt; reticulation on carapace is very conspicuous. Edges of carapace are smooth, but as shown by Paggi (1986) (Figs. 13.18 i to iii) it is not so, and has a peculiar arrangement of setules and setae on its edges. Postabdomen broad and large with the securiform

(ax) shape (Figs 13.4 and 13.7), bearing 9 to 11 anal denticles of nearly equal size; in case of Herrick’s (1884) description, postabdomen is broad, narrowed from the middle to the end and anal denticles are “small and equal” in size (Fig. 13.30). Postabdominal claws are curved and shows denticulation, variation in size of spines on the postabdominal claw was recorded by Paggi (1986) (Figs

13.22 and 13.23) shows three rows of spines, length of the spines of the proximal and distal pecten are more or less similar compared to larger spines in the middle pecten.

293

Fig. 13: Anatomy of Ceriodaphnia laticaudata Müller, 1867. Figs 13.2 and 13.3 is a retouched version for the desired level of clarity.

294

Fig. 13: contd... Anatomy of Ceriodaphnia laticaudata Müller, 1867.

Comments. Advances in technology have revealed previously overlooked characteristics in species. Paggi (1986), for example, describes a species that has a short row of spines located below the proximal pectin (Fig. 13.17). Prior to Paggi’s observation, these spines had been overlooked due to their position beneath the thorns. Paggi’s observation is an example of how new characteristics of known species may be revealed with technological advancement. It is

295

important to note, however, that these characteristics should not be interpreted as evidence of a new species, but rather as new characteristics of a known species.

The trunk appendage V has a gnathobase with a flexible feathery setules, which is absent in C. pulchella, exopodite shows a long and robust proximal setules whose length is approximately 2/3rd of that found in the gnathobase (Fig. 13.20).

Ceriodaphnia valentina Arévalo (1916) head raised with prominent and large ocellus. Antennule larger in size that extends well beyond the margin of head; tip of the antennule bears sensory setae and anterior sense hair. Reticulation on the carapace is irregular in shape; ventral edge of carapace shows fine long setules. Postabdominal claw lacks pecten. As seen in the original figures 13.1, 13.3 and 13.7 there are seven to nine anal denticles on the postabdomen.

Distribution: Australia; Argentina; Europe; Germany (Berlin); Madagascar; Sweden; Spain; Turkestan; USA (Wisconsin).

296

14 Ceriodaphnia megops Sars, 1862

Ceriodaphnia megops Sars, 1862, 277; Winchell, 1883: 36; Scourfield, 1894: Plate 4; Fig. 1 and 3 Syn: Ceriodaphnia alata Werestchagin, 1911: 558. Syn: Ceriodaphnia cristata Birge, 1879: 6. Syn: Ceriodaphnia intermedia Hartmann, 1917: 89. Syn: Ceriodaphnia leydigii Schödler, 1877 Syn: Ceriodaphnia megalops Sars, 1890:190. Type locality: Not stated.

Specimens identified as Ceriodaphnia megops Sars, 1862

Material examined. Germany. Berlin, Plötzensee, no other data, NMCL

15004, NCB RMNH.CRUS.P.198.

Specimens identified as Ceriodaphnia megalops Sars, 1890

Material examined. Norway. Østensjøvann, no other data, NHMUO

F8509 (mounted); Drøbak, no other data, F8510 (mounted); Norge, no

other data, F19344 (in ethanol), AMNH 4664 (slide collection).

Diagnosis. The original description of C. megops by Sars (1862a) is comparable to Linnaeus, (1753); Hellich (1877); Schödler, (1877) and Scourfield, (1892) description. The current author has summarized characters as follows. Length is 0.9 to 1 mm. Head raised and slightly angulated in front of the antennule; cervical notch at the posterior section of the head, which separates the head from the body (Figs 14.3 and 14.5). Forehead is broad and evenly rounded; eye large with crystalline lenses and covers most part of the forehead; antennules are short and thick and just reach to the margin of head. Antennule tip shows presence of 8 to 10 aesthetascs, which are longer than the length of the antennule itself; fornix moderately convex with rounded sides and without spines; antenna are large and robust. Carapace long and somewhat rectangular; reticulation on surface of the carapace and near the margin manifest as a faint elongated transversely placed

297

irregular shaped polygonal striation which is very similar to striation seen in S. serrulatus and S. vetulus. Posterodorsal angle is obliquely truncated at its extremity and spinulated. Postabdomen is long and narrow at the end and shows presence of six to nine anal denticles, distal one of which is the longest; it also shows the presence of secondary smaller spines like structure after anal denticles, which are the characteristic feature for this species. Postabdominal claw is denticulate and does not show pecten. Postabdominal setae are finely serrated, posterior setae being an only quarter of the length of the anterior (Figs 14.1, 14.2, 14.4 and 14.6).

Ceriodaphnia alata Werestchagin, 1911. Length is 0.8 to 0.9 mm. Head small and strongly depressed; upper dorsal margin of the head slightly indented and does not show the presence of spines while lower back part of the head show a broad hump. Head separated from the body by deep cervical notch. Eye large and surrounded by a row of crystalline lenses which occupies most of the forehead. (Fig. 14.8) The feature of antennule, shape of the carapace and posterodorsal angle is similar to that of C. megops Sars (1862a).

Ceriodaphnia cristata Birge, 1879. Length is 0.7mm. Head not angulated in front of the antennules. Postabdomen with a dorsal row of denticles. Carapace with irregular meshes around edges and perpendicular strip across middle, as in Simocephalus. Postabdomen broad and somewhat truncate below, with large smooth postabdominal claws, and four teeth on each side of the arms. Dorsal margin of the postabdomen is in the form of crest shaped which bears eight or nine anal denticles, the largest of which is at the distal end of the row. The apices of these denticles are directed upward. This feature curiously recalls the teeth of the postabdomen in Eurycercus. Eye large; macula nigra is of moderate size, and is angular. The name C. cristata is given on account of the crest shaped structure of the postabdomen.

Ceriodaphnia intermedia Hartmann, 1917. Length is 0.9 to 1.04mm. Head small and depressed. Forehead slightly angulated near the antennule; the surface at the angle shows presence of few spines (Fig. 14.11). Eye small and located near the forehead region, fornix rounded and without spine. Antennule short and strong with bunch of aesthetascs and a single anterior sense hair. The third segment of 298

the exopod shows presence of two tiny spines (Fig. 14.12). Head separated from the body by cervical notch. The surface of the carapace is smooth without spines, ventral side of the carapace is much more convexed than the dorsal side, posterodorsal region not prominent and somewhat blunt shaped. Postabdomen structure to some extent similar to C. pulchella (Sars, 1962), but lacks indentation on the dorsal edge of the postabdomen. Postabdomen has 11 to 12 anal denticles (Figs 14.13 and 14.14), the first three anal denticles from the distal end are the shortest than the rest of the anal denticles. Postabdominal claw denticulate.

299

Fig. 14: Anatomy of Ceriodaphnia megops Sars, 1862.

Ceriodaphnia megalops Sars, 1890. Length is 1 to 1.3 mm. In lateral view is oval in shape (Fig. 14.15). Head not pressed vertically, and separated from the body by a clear deep cervical notch; forehead thick and shows a slight angulation near the antennule. Eye large and covers most of the forehead, fornices are evenly convex and not angular shaped or with spines. Antennae without “swimming 300

setules” and, when laid back, they reach almost to the middle of the carapace; posterodorsal angle is small but not pointed. The upper and lower edges of the carapace not strongly convex (Fig. 14.15), reticulation is of an oblong irregular mesh with fine reticulation in the middle part of the carapace form vertical angled rows which are similar to the striations that occur in Simocephalus. Postabdomen wide and tapering at the end and bears seven to nine fine tipped anal denticles that increase in size towards the distal end; postabdominal claws smooth but show an arrangement of very fine rows of hairs or denticulation (Figs 14.16 and 14.17).

The body colour varies from greyish white to reddish white, pale gray green, pale yellow - green and pale greyish red.

301

Fig.14: contd... Anatomy of Ceriodaphnia megops Sars, 1862. Figs 14.15 to 14.17 images were obtained from the Natural History Museum Universitetet i Oslo.

Comments. From the illustrations we could get information on Ceriodaphnia megops Sars (1862a), ocellus small and punctiform and situated near to

302

antennule, eye surrounded with crystalline lenses. Abdominal appendage conical and pointed.

Ceriodaphnia alata (Werestchagin, 1911) shows a special facet on the carapace that has not been recorded in any other species of Ceriodaphnia; along the either side of the midline of the body, carapace shows an unusual projection which looks like longitudinal ridges. These ridges rise from near the fornices reaches greatest height in the middle of the body and then lower near the posterodorsal angle. Werestchagin (1911) studied these projections and concluded that it’s made up of chitin similar to that of ephippial (cross section of ridges see Figs 14.9 and 14.10). These ridges were found to be present in all females (parthenogenetic and ephippial) of this species within the populations and have to be considered as a true character. There is no description of the fornix, reticulation on carapace, postabdomen or postabdominal claw in literature, and it is difficult to get any relevant information from the illustrating figure as well.

The current author has a view that C. alata (Werestchagin, 1911) has characteristics very similar to that of C. quadrangula (Lilljeborg, 1900a, b) and could be the same species, but due to lack of information on the carapace and postabdominal structure it is difficult to conclude.

In general, the shape of C. cristata Birge, 1879 resembles to C. dentata. Head is rounded over in front and not angulated in front of the antennules. Carapace are marked much as in Simocephalus.

Ceriodaphnia leydigii description by Schödler is sketchy, and the only relevant information that could be retrieved from the literature is that C. leydigii is bright red in colour, slightly smaller when compared to C. megops (0.9 to 1 mm), carapace shows polygonal or often regular hexagonal reticulation. Postabdomen tapers towards the end and has six to seven anal denticles increasing in size from distal to proximal end. Postabdominal claws are smooth without denticulation.

Distributions: Poland; Sweden; USA (Minnesota; Southampton; Mass).

303

15 Ceriodaphnia minor Sars, 1916 (Plate No. 33)

Figs 2a-c.

Ceriodaphnia reticulata var. minor Sars, 1916: 346.

Type locality: A small pool in the Cape Flats, Republic of South Africa.

Specimen identified as Ceriodaphnia minor Sars, 1916. Material examined. Algeria, no other data, NHMUO F18649 (2 specimens in ethanol); F18512 (in ethanol), Sweden. Dørby, no other data, NHMUO F9582 (slide collection); Småland, no other data, NHMUO F18490 (in ethanol).

Diagnosis. Length equals 0.9 mm. Head small compared to Ceriodaphnia producta and less depressed, with a distinct deep cervical notch that separates the head from the body. Forehead region near to antennule has a protruding edge; distinct supraocular depression on the anterior head surface. Eye is of moderate size covering the anterior ventral portion of the head with numerous pigments or crystalline lenses that project away from the eye. Ocellus looks to be circular in shape and is situated 1/3rd distance from the antennule to the eye (Figs 15.1 and 15.2).

Antennule and anterior sensory setae structure of C. minor shares similar characteristics to that of C. producta.

The antero and postero ventral carapace margins are evenly and equally curved (rounded oval), “with the posterior protuberance rather slight and issuing far above the axis of the body”. Posterodorsal angle is not as well developed as that in C. producta, but the margins are slightly sinuate from the middle (Fig. 15.1).

Postabdomen is long and tapered with a slight bulge near the anal claw; anal denticles are eight in numbers on each side the outermost or posterior anal denticles smaller than the middle one. Postabdominal claw is long and narrow with six setules located slightly away from the base of the claw (Fig. 15.3). 304

Fig. 15: Anatomy of Ceriodaphnia minor Sars, 1916.

305

Comments. Sars has expressed his view that it is difficult to distinguish C. reticulata var. minor, C. sublaevis and C. richardi from the C. reticulata Jurine, 1820 description and suggests that they are the same species.

Distribution: Algerie; Sweden (Dorby; Smaland).

306

16 Ceriodaphnia natalis Brady, 1907 (Plate No. 32) Figs. 3-7.

Ceriodaphnia natalis Brady, 1907: 180.

Type material: No information. Type locality: "drinking-water pool close to "Rydal Mount", Witzies Hoek, Orange Free State" (Brady, 1913).

Diagnosis. Length equals 0.77 mm. Head depressed and rounded, separated from the body by a deep cervical notch (Fig. 16.1). Carapace when seen laterally is tumid, rounded and sub-quadrangular with a sharply pointed posterior dorsal angle with both dorsal and ventral margins being convex. When seen in dorsal view (Fig. 16.2) it looks ovate and rather acutely pointed and is about twice as long as broad. The margin of the carapace is marked throughout with a minute and closely set circular punctuation. Eye moderately large; antennules are short and club shaped.

Postabdomen small, terminal portion of which is rounded and wide with 8 to 9 anal denticles on each side, which are gradated in size from the middle to each end of the series. Postabdominal claws with four short spinules near the base (Fig. 16.3).

Fig. 16: Anatomy of Ceriodaphnia natalis Brady, 1907.

Comments. Supplementary information can be gained from the original illustration, Fig. 16.1 and 16.2 which show circular arrangement of crystalline lenses which projects outward; the forehead is circular and does not show any distinct angulation near the antennule; the supra ocular depression is prominent

307

and body is separated from head through a shallow cervical notch. The ventral section of the carapace is much more convexed than the dorsal side.

308

17 Ceriodaphnia nitida Schödler, 1877

Ceriodaphnia nitida Schödler, 1877: 41.

Type material: Not stated. Type locality: Germany. Berlin.

Diagnosis. Original description from Schödler is confusing as the species C. nitida was described from a single specimen. Although Schödler mentioned that more specimens were collected during the 1858 survey, he unfortunately kept the specimens in the same collection jar that contained C. reticulata.

According to Schödler, reticulation on the carapace of C. nitida is quadrangular in shape, distinguishing it from C. reticulata, which has sharp but simple reticulation and Ceriodaphnia megops, which has “fine anatomising striation which then breaks up into reticulation”.

Postabdomen with eight long anal teeth and the postabdominal claw shows the presence of a series of sharp spines at the base; both of these characteristics are similar to C. reticulata.

309

18 Ceriodaphnia parva Herrick, 1883

Ceriodaphnia reticulata var. parva Herrick, 1883: 504.

Type material: Lost, as is the whole of the collection of Herrick. Type locality: "Cold springs near Tuscaloosa", Alabama, USA (Herrick, 1883).

Diagnosis. Length measures between 0.58 to 0.63 mm. Body transparent. Head not depressed strongly and slightly angulated in front of antennules. Antennules short and conical; carapace is oblong shaped and reticulated, which ends in a sharp posterior spine. Fornices are not prominent. Postabdomen short and broad, and distally rounded at the extremity; anal claws are short, curved and denticulate.

Comments. The general appearance of C. parva has been described as similar to, or as a “reduced copy” of C. reticulata by Herrick (1883) with the exception, that C. parva shows denticulate claw. Nonetheless, Kurz has mentioned var of reticulata, which shows denticulate claws like C. parva but then differs with the presence of sharp and distinct fornices.

310

19 Ceriodaphnia planifrons Smith, 1909 (Plate No. 15) Fig. 17

Ceriodaphnia planifrons Smith, 1909: 81.

Type material: Not stated. Type locality: Australia. Lake Sorell, Tasmania.

Diagnosis. Length equals 0.9 mm. Head remarkably recurved with no sinuous or supraocular depression and does not bear spine, unlike C. hakea there is no spine or tumescence i.e. swelling on the front part of the head. Ocellus clearly marked and located nearer to the antennule. Cervical notch between the body and the head is not sharply marked (Fig. 19.1). Body green in colour.

According to Smith (1909) carapace is more elongated than C. hakea, with a clear posterior spine. The image however reveals it as a small curve instead of a spine. Antennule carries short terminal setae (sensory hair) and single long seta on a ridge close to the apex. Distal end of the antennae shows two compound plumose setae similar to C. hakea.

Postabdomen shows presence of five large spines, which are slightly curved with, last two posterior denticles being shorter than the rest; anal claw is smooth. Postabdomen with two abdominal setae or anal plumose setae at the back but the posterior end of the postabdominal claw is not arched as seen in C. hakea.

Fig. 19: Anatomy of Ceriodaphnia planifrons Smith, 1909.

311

20 Ceriodaphnia producta Sars, 1916 (Plate No. 33) Figs 1a-c.

Ceriodaphnia producta Sars, 1916: 346.

Type Locality: "a pond in the Gape Flats", Republic of South Africa.

Specimens identified as Ceriodaphnia producta Sars, 1916. Material examined. Australia, Saint Arnaud, no other data, NHMUO F9696 (slide collection), South Africa, no other data, NHMUO F9268 (slide collection).

Diagnosis. Length equals 1.5 mm. Head not fully depressed and separated from body with a sharp and clear cervical notch. Ventral surface of head smoothly curved, while the anterior surface shows supraocular depression. Eye large, almost filling up the front part of the head, with numerous pigments or crystalline lenses that project away from the eye. Ocellus very small and roundish and is located almost 1/3rd distance from the antennule to the eye. Antennule cylindrical and comparatively short which does not extend beyond the line of the head. Anterior sensory seta is long and arises from a peduncle 1/3rd of the distance above from apex of antennule (Figs 20.1 and 20.2).

Carapace nearly rounded from the lateral aspect; anteroventral carapace margin is more broadly curved than the posteroventral margin. Reticulation on carapace is close but not clearly visible, free edges of the carapace are minutely denticulate which continues on the dorsal margin as well. Posterodorsal angle is elongated and tapers slightly towards the end (Fig. 20.1).

Postabdomen long and narrow, with eight anal denticles on each side, of which the last two posterior denticles are the shortest, the others are long and decrease in size proximally. Postabdominal claws bear five spinules that are longer than the rest forming a pecten on the proximal part. Abdominal setae bear’s two abdominal setae and horn shaped abdominal appendages (Fig. 20.3).

312

Fig. 20: Ceriodaphnia producta Sars, 1916.

Comments. When compared with the European species of C. reticulata, C. producta differs with respect to its large body size and large posterodorsal angle.

313

21 Ceriodaphnia pulchella Sars, 1862 (Plate Q) Fig. 1.

Ceriodaphnia pulchella Lilljeborg, 1901: 674; Winchell, 1883: 37 Paggi, 1986: 46; Greenwood et al., 1991: 283.

Type locality: Not stated.

Specimens identified as Ceriodaphnia pulchella Sars, 1862. Material examined. Germany. Brandenburg, no other data, NMCL 16049, NMCL 18960, NMCL 18961, NMCL 26275, Norway, no other data, NHMUO F19351 (in ethanol); Frøn, no other data, NHMUO F8516 (slide collection); Odalen, Drøbak, no other data, NHMUO F8513 (slide collection); Østensjøvann, no other data, NHMUO F8514 (slide collection); Hognestad, no other data, NHMUO F8515 (slide collection), USA. White Sands Missile Range, Davies Tank East, 40 Km ENE of Las Cruces, New Mexico, 1997-04-02, USNM 291268 (in ethanol), NCB RMNH.CRUS.P.199; RMNH.CRUS.P.200.

Diagnosis. Sars (1862a) original description of C. pulchella (Figs 21.32, 21.33 and 21.35) describes it as a yellowish white colored organism. Length 0.5 to 0.86 mm. Head moderate size and slightly angled in front of the antennules, forming almost a right angle (Figs 21.2, 21.3, 21.6 to 21.8, 21.10 and 21.11). Postabdomen with 12 strong curved anal denticles on both sides and a smooth postabdominal claw. Carapace oval in shape (Figs 21.1, 21.6, 21.7, 21.10, and 21.34).

Additional descriptions of this species can be obtained from Lilljeborg, (1900b), Hellich, (1877); Herrick and Nachtrieb (1895); Paggi, (1986) and Greenwood et al. (1991) work. In all of the published descriptions, the head is described as slightly angled in front of antennules, almost forming a right angle; forehead wide and rounded; clear cervical notch present; eye of moderate size and surrounded by crystalline lenses; ocellus circular and situated near antennule; antennules long and slender that extend beyond line of head (Figs 21.4, 21.28 and 21.31); carapace oval shaped with coarse double contour lines of reticulation.

314

Fig. 21: Anatomy of Ceriodaphnia pulchella Sars, 1862.

315

Fig. 21: contd... Anatomy of Ceriodaphnia pulchella Sars, 1862.

316

Fig. 21: contd... Anatomy of Ceriodaphnia pulchella Sars, 1862. Figs 21.32 to 21.35 images were obtained from the Natural History Museum Universities Oslo.

Comments. Paggi’s (1986) (Figs 21.13 to 21.25) description revealed for the first time the arrangement of setae and setules as well as the observed distinction of this arrangement on the free edge of the ventral carapace from anterior to the posterior end. In addition, Paggi provides the description of the fifth limb.

Paggi (1986) description of C. pulchella from Argentina measures it as 0.54 mm to 0.76 mm. Carapace sub-oval in shape with a strong polygonal reticulation on

317

its surface; the free edge of the ventral carapace shows a series of submarginal internal structures (Figs 21.22 i to vi). On the anterior end of the ventral edge with a series of 16 to 17 short smooth setae, which is somewhat rigid and uniform in size (Fig. 21.22 i and ii) followed distally by another 6 to 7 long flexible setules (Fig. 21.22 iii). After this series of short and flexible setules, there is a series of another seven to nine thin spines with a row of thin hairs (Fig. 21.22 iv and v). This row of thin hairs continues till the rear edge, where it reaches to its highest point near the junction of the posterodorsal angle. Posterodorsal angle shows presence of spine which is laid almost parallel to its edge (Fig. 21.22 vi). Fifth trunk limb appendage shows gnathobase but the border between gnathobase and inner distal portion is not clear. Exopod bears proximal setules which is long and robust whereas of the two distal setules the one closest to the gnathobase is more robust and slightly shorter than the proximal setules.

The description vary in respect to the number of postabdominal anal denticles, which have been recorded between 7 to 14; postabdominal shape towards the end has been mentioned as wide (Lilljeborg, 1900b), narrow and elongated (Hellich, 1877; Herrick, 1884), approximately straight or slightly concave (Paggi, 1986). Postabdominal claw curved and denticulate according to Herrick and Nachtrieb

(1895); Lilljeborg (1900a) and Greenwood et al. (1991) (Figs 21.5, 21.9, 21.12, 21.29 and 21.30) but according to Paggi (1986) the claw shows a middle pecten whose spines are slightly longer than those of the other two (Fig. 21.25). The fornices are of moderate size by Herrick and Nachtrieb (1895), flat and rounded according to Lilljeborg (1900b) and triangular shaped according to Hellich (1877).

Green wood et al. (1991) C. cf. pulchella description from New Zealand; to certain extent matches with previously described C. pulchella species. Although Greenwood has her doubt about the presence of C. pulchella in New Zealand, as the specie is considered holistic according to Berner. Description by Greenwood and colleagues to a certain extent matches with Lilljeborg (1900b) description. The variation with respect to size, shape, postabdominal claw and total number of anal denticles can be morphological variations due to regional types (Zaret, 1972) which are frequent in cladocerans and hence can be confirmed as C cf. pulchella.

318

Ceriodaphnia microcephala (Sars, 1890) and Ceriodaphnia pseudohamata (Bowkiewicz, 1926) is a synonymous form of C. pulchella and differs with respect to body size it measures about 0.82 mm for previous and 0.3 mm to 0.64 mm for the latter species in length; it has a smaller head size compared to C. microcephala (Sars, 1890) . The proximal anal denticles of C. pseudohamata (Bowkiewicz, 1926) shows fine hair like projections similar to that of C. cf. pulchella described by Green wood et al. (1991) (Fig. 21.30) further evidence of morphological variation within species in regard to geographical context .

Distributions: Argentina; Canada (Toronto, Point Pelee); Hognestad; New Zealand; Norway (Drøbak; Østensjøvann); Odalen; Sweden; USA (Minnesota).

319

22 Ceriodaphnia quadrangula Müller, 1785 (Plate No.27) Figs 16 to 25.

Specimens identified as Ceriodaphnia quadrangula Müller, 1785 Material examined. Australia. Corowa, NSW, no other data, AMS P.4327, China. Soochow, no other data, USNM 59382 (100 specimens in ethanol), Germany, Tiergarten, Berlin, no other data, NMCL 5533; Brandenburg, no other data, NMCL 10690; Grunewald See, 1898-08-05, no other data, NMCL 10691; Brandenburg, no other data, NMCL 11912; Brandenburg, no other data, NMCL 16047, Japan, no other data, NMCL 15434 and NMCL 15492, Norway, no other data, NHMUO F19361 (in ethanol), AMNH 4576 (slide collection); 17474 (in ethanol),South Africa. Cape of Good Hope, no other data, NHMUO F9269 (slide collection).

Specimens identified as Ceriodaphnia hamata Sars, 1890. Material examined. Norway, no other data, NHMUO F8512 (slide collection), Skogsvann, no other data, NHMUO F19347 (in ethanol).

Specimens identified as Ceriodaphnia punctata Müller, 1867. SYN Type. ZMUC 7898. Type locality: Denmark. Material examined. Norway. Filefjell, no other data, NHMUO F19348 (in ethanol).

Diagnosis. Müller’s original description of C. quadrangula is not a complete description; the detailed taxonomic description of C. quadrangula is from the Lilljeborg (Ekman; 1900b) (Figs 22.38, 22.39) and (Winchell, 1883) studies. Lilljeborg’s (1900a) description furthermore includes information on the trunk 320

limb structure. The common characteristic of this species mentioned by the authors is summarized below.

Length 0.5 to 0.9 mm. Head small and depressed rounded at the end and only slightly angled with deep supraocular depression; the cervical notch is not that prominent when seen laterally. Forehead evenly rounded with (Figs 22.1, 22.2,

22.10 and 22.19 to 22.21) or without angulation near the antennule (Figs 22.30,

22.34 and 22.37); eye moderate size, surrounded by crystalline lenses; ocellus is small or punctiform in size located near to the antennule (Figs 22.19 to 22.21); fornices are prominent with rounded smooth edges and sometimes show traces of an angle or spine (Figs 22.10 and 22.11). Antennules are large and almost reach to the line of head (Figs 22.20, 22.26 and 22.37).

Carapace, when seen laterally, is rounded quadrangular (Fig. 22.9) to rounded oval (Figs 22.19, 22.26 and 22.29) in structure, with roughly or coarser reticulation on the surface with nearly hexagonal structure; the posterodorsal angle is acute and spine shaped.

Postabdomen narrow and of medium size with rounded end; anal denticles are eight in number. Although Lilljeborg (1900b) has mentioned six to nine anal denticles (Fig. 22.7) of which the 1st and the 2nd distal spine are longer and the rest are of same size compared to the Sars (1862a) (Figs 22.22 to 22.25) description, which increases the anal denticles count to 10 and describes them as small and slender in shape. Postabdominal claw smooth in all descriptions.

321

Fig. 22: Anatomy of Ceriodaphnia quadrangula Müller, 1785.

Trunk appendages. The characteristics of trunk appendage I and II of C. quadrangula are similar to that described in C. hakea (Figs 22.3 to 22.6).

Ceriodaphnia hamata Sars, 1890 has been described twice by Sars in 1862 and 1890 respectively. Sars (1862b) description of C. hamata measures it at about 0.8 322

mm to 0.9 mm in length. When seen in the lateral view body is broadly oval, head slightly depressed, forehead circular and sometimes shows the presence of tiny spines. Supraocular depression prominent; fornix shape and size varies in different developmental stage from thorn to sting to hook shaped (Figs 22.10 and 22.11), carapace is broad and oval, margins of the carapace are finely serrated, posteriodorsal angle distinct and acute spine shaped sometimes bearing two spines at the end. Sars has not given any description of the postabdomen or anal denticles count or anal claw, though he has mentioned the number of eggs carried by female varies during seasons i.e. in summer and autumn only two to three eggs were recorded in the brood chamber and six to seven eggs were recorded during spring.

Jurine (1820) alone has described Monoculus clathratus. The shape, size and colour of which is similar to the M. reticulata. Features that differ between the two species are the reticulation on the surface of the carapace and the shape of posterodorsal angle which is pointed and the “œfus finally, four in number” separate them from M. reticulata.

Ceriodaphnia punctata description by Müller (1867) matches all the characteristic feature of the C. quadrangula and is appropriately mentioned as a synonymous form of C. quadrangula.

323

Fig. 22: contd... Anatomy of Ceriodaphnia quadrangula Müller, 1785.

324

Fig. 22: contd... Anatomy of Ceriodaphnia quadrangula Müller, 1785. Figs 22.38 and 22.39 images were obtained from the Natural History Museum Universities i Oslo.

Comments. Additional information that can be gathered from the figures is as follows: there is a slight angulation near the forehead close to the antennule; ocellus is present, which looks circular and is located near the antennule; eye large, covering most of the forehead region and shows the presence of crystalline lenses.

Sars (1890) description of C. hamata n. spp. from “Skogsvand insulæ Sartoro prope Bergen” is 0.8 mm long, and in addition to the points discussed above provides additional information about postabdomen, describing nine anal denticles and a smooth anal claw and absence of pecten.

Distribution : Bergen; Central Asia; Essex; Germany (Berlin); Minnesota (USA); Lake Skogsv and, Toronto (Georgian Bay, Point Pelee). 325

23 Ceriodaphnia reticulata Jurine, 1820 (Plate No. 14) Fig. No.3.

Ceriodaphnia reticulata Jurine, 1820: 278; Nachtrieb, 1894: 170; Herrick, 1883: 38; Daday, 1905: 208. Syn : Ceriodaphnia kurzii Stingelin, 1895: 214. Syn : Ceriodaphnia occulata Werestchagin, 1911: 557. Syn : Ceriodaphnia serrata Lilljeborg, 1901: Plate No. 27, Fig. No. 9 and 10. Ceriodaphnia reticulata Hartmann, 1917: 91.

Specimen identified as Ceriodaphnia reticulata Jurine, 1820 Material examined. Algeria. No other data, NHMUO F9324 (slide collection) and NHMUO F18651 (in ethanol), Brazil. Rio Grande do Sul, Reservoir near Porto Alegre, no other data, USNM 93326 (slide collection) and 93292 (slide collection), Canada. British Colombia, Pond Near + On West Side Of B.C. Highway. 97, 11.9 Mile N Of Okanagan Falls, 1956-06-22, USNM 99538, No data, NCB RMNH.CRUS.P.229, Germany. Spree, Jungfernheide, Rixdorf, Berlin, no other data, NMCL 5532; Hundekehlesee, no other data NMCL 10693; Krumme Lanke, 1893-09-14, no other data, NMCL 10694; Grunewaldsee, no other data, NMCL 11908; Umgegend von Berlin, Brandenburg, no other data, NMCL 11909; Krumme Lanke, Müggelsee bei, no other data, NMCL 11917; Rixdorf, no other data, NMCL 15145, Umgegend von Berlin, Brandenburg, no other data, NMCL 16048; No data NMCL: 18409, 18410 and 20982, Norway. Ekeberg, no other data, NHMUO F8506 (slide collection); Oslo, no other data, NHMUO F8507 (slide collection); NHMUO F19350 (in ethanol), South Africa. Cape of Good Hope, no other data NHMUO F9273 (slide collection), USA. Massachusetts, Penikese Island, First Pond N of Leper Colony, 1947-07-06, USNM 85493(slide collection); Colorado, Gilpin County, Pine Glade Marsh, 1913-06-27, USNM 55054;New York, Cattaraugus County, Cattaraugus Creek, 1928-07-25, USNM 62572; Maryland, Rockville, Rock Creek Stream Valley Park, 1989-06-04, USNM 242065; South Carolina, Santee National Wildlife Refuge, 1983-06-14, USNM 234058,.

326

Specimen identified as Ceriodaphnia serrata. Material examined. No data, NHMUO F8508 (in ethanol).

Specimen identified as Ceriodaphnia reticulata rosea. Type locality: Not specified accurately, but all other species were described from Genève region, Switzerland. Material examined. Norway. Merdø, no other data, NHMUO F19354 (slide collection) and F8505 (slide collection).

Diagnosis: Jurine (1820) describe C. reticulata as a transparent bodied animal with reticulation on the carapace which could be easily confused with Daphnia quadrangula; it has small spine at the posterior end of the carapace and it swims with a reduced speed.

The proper taxonomic resolution of this species can be retrieved from Lilljeborg (1900b) Hellich (1877); Schödler (1877); Scourfield (1892).

Length 0.5 to 1.27 mm. Head long and bends in a sub vertical position, head is separated from the body with a clear cervical notch; forehead smooth and rounded off with angulation in front of the antennule. Eye large and located slightly back of the forehead and shows numerous crystalline lenses. Ocellus small oval-rounded structure situated near to the antennule. Fornices has been recorded in various shapes, for example Lilljeborg (1900b) has shown and mentioned it as an acute angle shaped structure with one to two spines at the back

(Figs 23.22 and 23.23), Hellich (1877) has described it as a triangular plate (Figs

23.2 and 23.4) and Scourfield (Scourfield) has put it as rounded and strong cusp shaped structure (Fig. 23.13) clearly showing variation within the species.

Antennule short and round in shape (Figs 23.4 and 23.14), nearly reaching to the margin of head. Tip of the antennule bears sensory seta but anterior sense hair arises from a peduncle very close to the tip of the antennule (Fig. 23.14). Carapace is an elongated oval shaped structure, the dorsal and ventral carapaces are almost convex shaped, and reticulation on the surface is well defined and consists regularly of five to six polygons. Margin of the carapace shows a light 327

pattern of “saw teeth” (Fig. 23.28); postero dorsal angle which is directed backwards and nearer to the midline of the body is sometimes acute and spine like or can be blunt shaped (Figs 23.1, 23.9 and 23.11). Postabdomen is long and narrow with a rounded front and can be moderate in size with 7 to 10 anal denticles decreasing in size from distal to proximal end. Above the denticles there are sets of fine spinules arranged in rows also referred to as “chevrons”

(Figs 23.6, 23.10 and 23.12). Postabdominal claw denticulate and shows the presence of pecten which consists of five to seven coarse spines (Figs 23.10 and 23.29).

328

Fig. 23: Anatomy of Ceriodaphnia reticulata Jurine, 1820.

329

Fig. 23: contd... Anatomy of Ceriodaphnia reticulata Jurine, 1820.

330

Fig. 23: contd... Anatomy of Ceriodaphnia reticulata Jurine, 1820.

Comments. G.O Sars in 1890 described C. serrata from a pit near “Farhult in Schonen” with strong projecting fornices, strong reticulation on the carapace and a spine shaped posterodorsal angle. This species was synonymised latter with C. reticulata, because the variation mentioned by Sars was a phenotypic plasticity within the species already mentioned above.

Ceriodaphnia kuerzii Stingelin (1895) is synonymous to the C. reticulata description, it varies only with respect to the number of anal denticles, which is recorded as six to eight and the postabdominal claw shows presence of pecten, which consists of four to five teeth like structure, these variations, are examples of phenotypic plasticity within this species (Figs 23.18 and 23.19).

Leydig’s (1860) description of C. fischeri is intensive but shares common taxonomic characteristics to that of C. reticulata (Jurine, 1820).

331

Ceriodaphnia occulata, Werestchagin (1911) description matches to C. reticulata in respect to the form of fornices, the position of ocellus, posterodorsal angle, anal denticles count and number of teeth in pecten on postabdominal claw which is three to five (Figs 23.20 and 23.21). The disparities recorded are concerning the small semicircular eye size, which is located far from the front edge of the head. This reduction in the eye size looks like a polymorphic variation to avoid predation as shown by Zaret, (1972) who suggested that the size of the black compound eye is the only noticeable part of the animal (transparent body) and thus the size of the eye determines its vulnerability to visual predation.

Another variation is in respect to the size of the antennule, the sensory fine hair and the antennae are slightly longer when compared to Ceriodaphnia reticulata (Antenna size: C. occulata = 0.34 mm to 0.37mm; C. reticulata = 0.3 to 0.325 mm).

Richard’s (1897) description talks about two more varieties of Ceriodaphnia reticulata from Brazil. The first form is described from a specimen collected near San Lourenceo (Brazil) which is differentiated by the fornix structure and has been mentioned as rounded, pecten with 10 to 11 fine teeth followed by eight to nine anal denticles in the postabdominal structure. The second form is described from “Rio craned do soul” (Brazil) which has a long postabdomen. The postabdominal claw is curved and shows two sets of teeth or pecten proximal form shows 10 to 13 fine teeth and distal one shows 20 strong teeth; followed by 10 anal denticles, this characteristic according to Richard (1897) has not been recorded previously and hence he considers it as a new species.

Distribution: Brazil; Canada Toronto (Bond lake, Point Pelee); Forest hamlet Bettinger; Germany; Norwegia; Paraguay River; USA.

332

24 Ceriodaphnia rotunda Straus, 1820 sensu Sars, 1862b (Plate No. A) Figs 12 and 23.

Ceriodaphnia rotunda Straus, 1862: 211; Lilljeborg, 1901: Tab XXIX Fig. 15 to 19.

Type material: Lost. Type locality: Not stated.

Specimen identified as Ceriodaphnia rotunda Straus, 1820 sensu Sars, 1862b. Material examined. NHMUO: F8518 (slide collection); F19355 (in ethanol), Germany. Berlin, no other data, NMCL:10698; bei Marienwerder am Finowsee, no other data, 11916; Hermsdorf (Mark), no other data.

Diagnosis. Ceriodaphnia rotunda described by Sars (1862b) measures organism as 0.5 to 0.8 mm long, with a small head and a broad abdomen. This species cannot be mistaken from others due to the presence of tiny spines or teeth like structures protruding from the forehead region (Fig. 24.1). Forehead is non- angulated; fornices have spines and the carapace shows broad reticulation. Postabdomen is broad with seven spines; anal claw is smooth, large and non- toothed.

Lilljeborg’s (1900b) description of C. rotunda from Denmark gives more descriptive taxonomic information; Lilljeborg also emphasized in his work that, due to an incomplete description by Straus, and suspicion that his quote of the posterodorsal angle as rounded, indicates that he had a C. laticaudata species and hence could not be considered as the type author for C. rotunda. The much better description of C. rotunda was provided by G.O .Sars and hence has to be mentioned as type author.

Lilljeborg describes of C. rotunda from Denmark as follows: it is about 0.8 mm to 1 mm long, when seen laterally, the body shape is oval-rounded and the carapace outline or contour is equally convex. Head small, strong and depressed or vertically inclined downward, head and body are separated by a deep depression or cervical notch; forehead is narrow and sometimes obtuse or 333

rounded with minute thorns, a characteristic that makes it different from all other species of the genus (Figs 24.1 and 24.5). Forehead near the tip of the antennule does not form an angle. Antennule is short and does not extend beyond the line of the head (Fig. 24.1), but antennae when laid backwards pass a little behind the middle of the carapace. Fornices are slightly angled with two to three teeth or spines (Figs 24.2 and 24.5).

Carapace convex shaped with clear and coarse reticulation and serrated spines at the edge of the anterior carapace. Carapace ends on posterior side at a posterodorsal angle with blunt spine (Fig. 24.1).

Postabdomen is broad with two small obtuse and horn shaped angles or abdominal appendages at the posterior end, there are seven to nine anal denticles of concave shape (Figs 24.4 and 24.6). According to Lilljeborg “end claws found only hairs” might be referring to denticulation on the anal claw.

Body colour is reddish brown to greyish red.

334

Fig. 24: Anatomy of Ceriodaphnia rotunda Straus, 1820 sensu Sars, 1862b. Fig. 24.2 is a retouched version for the desired level of clarity.

Comments. Hellich (1877) and Stingelin (1895) description of C. rotunda recorded from Böhmen and Rheinfelden is same. Body length is between 0.75 mm to 0.78 mm, and is spherical shaped. The characteristic feature of head is similar to that of Lilljeborg (1900b) description; forehead is not rounded as described in Lilljeborg (1900a), but shows slight supraocular depression and angle near the tip of antennule. Fornix triangular in shape, equipped with two to three spines. Eye small sized with crystalline lenses; and large ocellus. Antennule not reaching past line of the head and has 8 to 10 “olfactory rods” or terminal aesthetascs which are twice the length of the antennules. Anterior sense hair of antennule is located almost half way of antennule and arises from a peduncle.

Carapace wider than the head with large, thick regular hexagonal reticulation. Posterodorsal angle is pointed, blunt at the tip and armed with short spines.

335

Postabdomen broad and obliquely truncated with seven to eight anal denticles; along with long and thick abdominal appendages the anal claws is large and smooth.

Length = 0.78mm; Height = 0.58mm; Head height = 0.11mm; Body colour is reddish.

The description from Herrick and Nachtrieb (1895) for the species is same as to Hellich (1877) and Lilljeborg (1900a).

Distribution: Germany; Norway.

336

25 Ceriodaphnia scitula Herrick, 1884 (Plate No. XLII) Figs 5 and 6

Ceriodaphnia scitula Herrick, 1884: 40.

Type location: Georgian Bay; Point Pelee (Lake Pond), Toronto.

Specimen identified as Ceriodaphnia scitula Herrick, 1884. Material examined. Canada. Georgian Bay, no other data, NHMUO F9798 (in ethanol).

Diagnosis. Length is 0.8 to 1 mm. Herrick (1884) description of C. scitula mentions head is closely appressed to the body, eye and crystalline lenses are small, fornices are prominent and abruptly truncated at the tip, antennules are short (Figs 25.5 and 25.6). Carapace oblong shaped and heavily marked with minute regular hexagonal lining with a sharp upper angle. Postabdomen moderate size and narrowed toward the end it bears 10 strong curved anal denticles; postabdominal claw large, curved and denticulate that are extending down the entire inner side (Figs 25.1 to Fig. 25.4).

Postabdomen shape of C. scitula resembles closely to C. reticulata and C. dentata with respect to sharp angulation near the antennule.

337

Fig. 25: Anatomy of Ceriodaphnia scitula Herrick, 1884. Fig. 25.6 images were obtained from the Natural History Museum Universities Oslo.

Comments. When compared to C. quadrangula (Müller, 1785) description, C. scitula differs with respect to size and shape of head and fornices, anal spines and reticulation on the carapace. Herrick (1884) description also gives information of a var. scitula which differs in size (measures about 0.55 mm in length) and is almost half of the C. scitula size also the angle on fornices bears thorn and postabdominal claw is densely ciliated with no spines.

338

Additional information that can be useful for identifying species can be retrieved from figures such as forehead, which is circular, and smooth in shape, ocellus is located almost at halfway between antennule and eye. Head shows a deep supraocular depression, which is very prominent, cervical notch, separates head from body, the ventral carapace is long and convex the free edges of which bears fine hair like structure. The dorsal end of the carapace is much flat and starts well below the cervical notch section; posterior dorsal angle is blunt and located much towards the dorsal end (Fig. 25.5).

339

26 Ceriodaphnia setifera Brehm, 1935 Figs 1 to 3.

Ceriodaphnia setifera Brehm, 1935: 303.

Type material: Probably lost. Type locality: "72. Barra Santa Lucia, kleine Sandlöcher"; "73. Ohne Etikette"; "74. Kleine Löcher links der Chaussee. Barra Santa Lucia", Uruguay.

Diagnosis. Brehm’s description of C. setifera is concentrated on antennule, carapace and postabdomen. Antennule shows presence of fine sensory hairs and anterior sense hair that arises from the peduncle (Figs 26.1 and 26.3). Carapace outline of C. setifera is a short broad structure that ends into a pointed spine shaped posterodorsal angle; the posterior end of the carapace shows presence of short spines arising from the margin, which reminds Brehm of Simocephalus iheringi. Postabdomen shows presence of eight anal denticles, postabdominal claw is large, curved and armed only with fine spines that are extending down the entire inner side (Fig. 26.2).

Fig. 26: Anatomy of Ceriodaphnia setifera Brehm, 1935.

Comments. Additional information that can be useful for identifying species can be retrieved from figures such as forehead, which is circular and smooth in shape, ocellus is located almost at halfway between antennule and eye, head does not show a deep supraocular depression, cervical notch separates head from the body, and ventral carapace is more convex than the dorsal carapace. Postabdomen 340

shows presence of 10 anal denticles instead of eight as mentioned by the author in his description, first anal denticles from the distal end is shortest followed by six long and curved anal denticles and the last three anal denticles at the proximal end are again short.

341

27 Ceriodaphnia setosa Matile, 1890 Figs 17 and 17a.

Ceriodaphnia setosa Matile, 1890: 25; Lilljeborg, 1901: 205. Syn: Ceriodaphnia echinata Moniez (1889): 347.

Type material: Not stated. Type locality: "grossen Teiches in Zarizino", incorporated in Moscow City now, Russia.

Diagnosis. The general body description of C. setosa from Matile (1890) matches Sars (1890) and Herrick and Nachtrieb (1895). The current author has summarized all the relevant information from these authors.

Length is 0.7 to 0.8 mm. When seen in the lateral view the body is round or spherical in shape structure, which is similar to C. laticaudata and C. rotunda. Head small and depressed with a shallow supraocular depression; it is separated from the body by a clear cervical notch (Fig. 27.1). Antennule long and extends beyond the line of the head with sensory hairs (Fig. 27.3); anterior sense hair arises from peduncle, which is located nearer to the base than the tip. Forehead is uniformly rounded; does not show any angulation near antennule; eye is of moderate size; ocellus is sometime present. Antennae are short and when stretched back does not pass behind the middle of the carapace. Fornices are moderate and sharply angled backward and spiny.

Carapace strongly reticulated with beehive or polygonal structure (Fig. 27.2) and margin is armed with spines, which are perpendicular to the surface.

Postabdomen is broad in the middle and tapering toward the end, postabdominal claw is denticulate whereas the number of anal denticles according to Matile

(1890) is 10 to 12; Sars (1890) is 7 to 10 small spines (Figs 27.4 and 27.5) and Herrick and Nachtrieb (1895) seven to eight of equal length. Posterodorsal angle is pointed.

342

Fig. 27: Anatomy of Ceriodaphnia setosa Matile, 1890.

343

28 Ceriodaphnia silvestrii Daday, 1902 (Taf. XIII) Figs 18-20.

Ceriodaphnia silvestrii Daday, 1902.

Type material: No information. Type locality: "8. Rio Santa Cruz, Pfütze ... 50°11'55" 71°38'29"; 9. Lager, Sumpf 50°13'10" 71°55'45" ", vicinity of Rio Santa Cruz in Patagonia, Argentina.

Diagnosis. Length is 0.86 to 0.88 mm. Daday (1905) description of C. silvestrii describe body shape as a whole rounded structure when seen in sideways; forehead is circular; eye is large and ovoid that almost cover the forehead and also shows the presence of crystalline lenses. Ocellus is small and punctiform; supraocular depression is not that prominent; deep cervical notch separates head from the body; tip of the fornix is either pointed or blunt or half rounded in structure. Antennules are short and swollen in the middle, tip of antennule shows presence of sensory fine hair, which are markedly longer than antennule size itself also anterior sense hair does not arise from peduncle (Fig. 28.1). Surface of the carapace shows hexagonal and polygonal shaped finely granulated arrangement, free edge of the ventral carapace bears fine hair like structure with thorns at regular interval. Postabdomen slightly rounded near the end and bears 9 to12 anal denticles which are crescent shaped the distal most spine is shortest from the rest; side of the postabdomen shows presence of chevrons. Proximal end of the postabdomen shows four abdominal appendages; two from the rear ones are small and slightly raised, whereas the remaining two front abdominal appendages one is long, thin, finger shaped and without any hair like structure or setules compared to second one which is only 1/3rd compared to previous front appendage but is broad cone shaped and with setules. Postabdominal claw long, thin and rounded and shows three sets of the pecten, the proximal or upper or first basal pecten with 15 to 20 fine and short setules, middle or second sub-basal pecten with 10 to 14 spines and distally or third pecten bearing series of fine setules (Figs 28.2 and Fig. 28.3).

344

Fig. 28: Anatomy of Ceriodaphnia silvestrii Daday, 1902.

Comments. According to Daday (1905) description of C. silvestrii from South Africa is doubtful because of its near resemblance to C. dubia (Richard, 1894) in respect to general body shape and head structure. The dissimilarity between Daday (1905) C. silvestrii and C. dubia (Richard, 1894) is in respect to the shape of fornix which is pointed instead of blunt or rounded end; reticulation on carapace is hexagonal shaped. There are eight anal denticles in postabdomen of which the distal most is short, the proximal anal margin doesn’t shows series of minute setules. The postabdominal claw are long and crescent shaped which consist of upper or first basal pecten shorter setules, middle or second sub-basal pecten are with stronger and longer spines and third pecten which is a series of small setules.

The current author would like to mention that Daday (1905) description of C. silvestrii from South Africa is also similar to the C. dubia description by Berner, (1986) as mentioned previously in this chapter. The variations are in respect to the shape of the fornix which is blunt or rounded shape; proximal anal margin of the postabdomen shows a series of minute setules; and presence of 18 to 24 stronger and longer spines in sub basal pecten in C. dubia Berner, (1986). Daday (1905) description of C. silvestrii shows a similar arrangement of setules in the postabdominal claw accept the total number of spines are 15 in sub basal pecten (observed in the figure) instead of 18 to 24 as mentioned by Berner, (1986). 345

29 Ceriodaphnia solis Moniez, 1889 Figs 11-13. Ceriodaphnia solis Moniez, 1889: 428.

Type material: Not stated. Type locality: "Lac Titicaca", Bolivia-Peru border.

Diagnosis. Length is 0.76mm. Moniez 1889 description of C. solis is majorly focussed on postabdomen, which is broad, short and slightly curved at the proximal end, postabdominal claw, is 40 μm in length with no description on denticulation; postabdomen with eight slender anal denticles. Moniez has also referred to the rudimentary tail, which refers to posterodorsal angle, and cross- linked reticulation on carapace (Fig. 29.1.)

Fig. 29: Anatomy of Ceriodaphnia solis Moniez, 1889.

Comments. Looking at the original figure few more characteristics can be added to the existing features, like head which looks small with no supraocular depression, presence of cervical notch that separates head from the body; forehead is round and flattened it does not seem to be angulated near the front of antennule (Fig. 29.1). Ventral carapace is more convex shaped than the dorsal side (Fig. 29.1). Anal denticles are declining in size from distal to proximal end Figs 29.2 and 29.3).

346

30 Ceriodaphnia spinata Henry, 1919 9 (Plate No. XL) Figs 1 and 2.

Ceriodaphnia spinata Henry, 1919: 466. Type locality: "Corowa", Australia.

Specimen identified as Ceriodaphnia spinata Henry, 1919: Holotype material: AMP 27728. Type locality: "Corowa", Australia.

Material examined. Australia. Victoria, Thornton, 1998-10-09, USNM 1121570 (5♀ in isopropyl alcohol); USNM 1121571 (6♀, in isopropyl alcohol).

Diagnosis. Ceriodaphnia spinata has been described in detailed with respect to general morphological characteristics.

Length is 1.2 mm. Head when compared to other species of this genus is not very depressed; it is separated from body by a cervical notch, supraocular depression seems to be absent; forehead bears a large eye with clearly visible crystalline lenses, ocellus is small and sub-rectangular in shape located very near to antennule. Antennule is short and some-what rectangular which shows fine sensory hairs at the tip and sense hair at the edge of the antennule (Fig. 30.1).

Carapace when seen laterally is oval in outline, dorsal and ventral margin of carapace is evenly curved, and reticulation on the surface is not very distinct, free edges of the valves are minutely denticulate; posterodorsal angle is distinct and short pointed.

Postabdomen strongly built bearing 10 strong and curved anal denticles decreasing in size from distal to proximal end, posterior edge of the postabdomen is fairly straight. Postabdominal claw is long and curved with row of small spinules or denticulation it does not show secondary denticles or “pecten”. The abdominal setae are long and feathered anteriorally (Fig. 30.2).

347

Fig. 30: Anatomy of Ceriodaphnia spinata Henry, 1919.

Comments. This species somewhat resembles C. reticulata in general shape but differs with the absence of a pecten in the postabdominal anal claw.

348

31 Ceriodaphnia sublaevis Sars, 1894 9 (Plate No. 3) Figs 1-5.

Ceriodaphnia sublaevis Sars, 1894: 14.

Type material: Not stated. Type locality : "lagoons in the neighbourhood of Dunedin", New Zealand.

Syn Type. New Zealand, no other data, NHMUO F18342 (in ethanol).

The original description of C.sublaevis self-sufficient and the current author thinks that there is no need to re-describe (Figs 31.1 to 31.5).

Fig. 31: Anatomy of Ceriodaphnia sublaevis Sars, 1894.

349

32 Ceriodaphnia turkestanica Berner and Rakhmatullaeva, 2001

Ceriodaphnia turkestanica Berner and Rakhmatullaeva, 2001: 33.

Type locality: "Vernal pool on right hand side of road to Kirpichnij zavod, opposite old channel of Bozsu River, 15 km NW of Ring Road around Tashkent, Uzbekistan, 42 º N, 69 º E".

Specimens identified as C. turkestanica Berner and Rakhmatullaeva, 2001

Non Type material. Uzbekistan. Lake Aijdar, Dzhizak, 1996-06-24, USNM 1001050 (4♀ in ethanol); 1001048 (2 ♂in ethanol); 1001045( 1 female specimen in slide collection); 1001049 (3♀in ethanol); 1001047(1 male specimen in slide collection).

The original description of C. turkestanica is self-sufficient and I think that there is no need to re-describe (Figs 32.1 to 32.16).

350

Fig. 32: Anatomy of Ceriodaphnia turkestanica Berner and Rakhmatullaeva, 2001.

351

Fig. 32 : contd... Anatomy of Ceriodaphnia turkestanica Berner and Rakhmatullaeva, 2001.

352

Appendix 4

GenBank Accession numbers, genes and Location codes for the 157 individuals representing 153 sequences from Cladocera and 4 sequences from Copepoda.

GenBank Location Code Gene fragment Identification Accession Amplified Number KC154288 SAMYDL01 COI Daphnia lumholtzi KC154289 SAMYDL02 COI Daphnia lumholtzi KC154290 SASPDL01 COI Daphnia lumholtzi KC154291 SASPDL02 COI Daphnia lumholtzi KC154292 SASPDL03 COI Daphnia lumholtzi KC154293 SASPDL04 COI Daphnia lumholtzi KC154288 SAMYDL01 COI Daphnia lumholtzi KC154289 SAMYDL02 COI Daphnia lumholtzi KC154290 SASPDL01 COI Daphnia lumholtzi D.carinata var KC154294 SAMYDC01 COI magniceps D.carinata var KC154295 SAMYDC02 COI magniceps D.carinata var KC154296 SAMYDC03 COI magniceps D.carinata var KC154297 SAMYDC04 COI magniceps D.carinata var KC154298 SAMYDC05 COI magniceps D.carinata var KC154294 SAMYDC01 COI magniceps D.carinata var KC154295 SAMYDC02 COI magniceps D.carinata var KC154296 SAMYDC03 COI magniceps KC154268 NSDIG001 COI Ceriodaphnia spp.

353

KC154269 NSCEN001 COI Ceriodaphnia spp. KC154270 SAMYP001 COI Ceriodaphnia spp. KC154271 SAMYP002 COI Ceriodaphnia spp. KC154272 SAMYP003 COI Ceriodaphnia spp. KC154273 SAMYP004 COI Ceriodaphnia spp. KC154274 SAMYP005 COI Ceriodaphnia spp. KC154275 SAMYP006 COI Ceriodaphnia spp. KC154276 SASPA001 COI Ceriodaphnia spp. KC154277 SASPA003 COI Ceriodaphnia spp. KC154278 SASPA004 COI Ceriodaphnia spp. KC154279 SYDCB001 COI Ceriodaphnia spp. KC154280 SYDCB002 COI Ceriodaphnia spp. KC154281 SYDCB003 COI Ceriodaphnia spp. KC154282 SYDCB004 COI Ceriodaphnia spp. KC154283 SYDCB005 COI Ceriodaphnia spp. KC154284 SAMAN001 COI Ceriodaphnia spp. KC154285 SAMAN002 COI Ceriodaphnia spp. KC154286 SAMYP007 COI Ceriodaphnia spp. KC154287 SAMYP008 COI Ceriodaphnia spp. KC020651 WARPER01 COI Ceriodaphnia spp. KC020652 WARPER02 COI Ceriodaphnia spp. KC020653 WARPER03 COI Ceriodaphnia spp. KC020654 WARPER04 COI Ceriodaphnia spp. Contd....

354

GenBank Location Code Gene fragment Identification Accession Amplified Number KC020655 SACHOW01 COI Ceriodaphnia spp. KC020656 SACHOW02 COI Ceriodaphnia spp. KC020657 SACHOW03 COI Ceriodaphnia spp. KC020658 SACHOW04 COI Ceriodaphnia spp. KC020659 SACHOW05 COI Ceriodaphnia spp. KC020660 SAWOO001 COI Ceriodaphnia spp. KC020661 SASNU001 COI Ceriodaphnia spp. KC020662 NSSTE002 COI Ceriodaphnia spp. KC020663 NSYAN001 COI Ceriodaphnia spp. KC020664 NSYAN002 COI Ceriodaphnia spp. KC020665 NSYAN003 COI Ceriodaphnia spp. KC020666 NSYAN004 COI Ceriodaphnia spp. KC020667 NSMER001 COI Ceriodaphnia spp. KC020668 NSMER002 COI Ceriodaphnia spp. KC020669 NSMER003 COI Ceriodaphnia spp. KC020670 NSMER004 COI Ceriodaphnia spp. KC020671 NSMER005 COI Ceriodaphnia spp. Ceriodaphnia cf. KC020625 SACOPP01 COI cornuta Ceriodaphnia cf. KC020626 SACOPP02 COI cornuta Ceriodaphnia cf. KC020627 SACOPP03 COI cornuta Ceriodaphnia cf. KC020628 SACOPP04 COI cornuta Ceriodaphnia cf. KC020629 SACOPP05 COI cornuta Ceriodaphnia cf. KC020630 SAKUN02 COI cornuta Ceriodaphnia cf. KC020631 SAKUN03 COI cornuta

355

Ceriodaphnia cf. KC020632 QULILY01 COI cornuta Ceriodaphnia cf. KC020633 QULILY02 COI cornuta Ceriodaphnia cf. KC020634 QULILY03 COI cornuta Ceriodaphnia cf. KC020635 WAFFP01 COI cornuta Ceriodaphnia cf. KC020636 WAFFP02 COI cornuta Ceriodaphnia cf. KC020637 WAFFP03 COI cornuta Ceriodaphnia cf. KC020638 WAHPIL02 COI cornuta Ceriodaphnia cf. KC020639 WAHPIL04 COI cornuta Ceriodaphnia cf. KC020640 WAHPIL05 COI cornuta Ceriodaphnia cf. KC020641 WAPIL01 COI cornuta Ceriodaphnia cf. KC020642 WAPIL02 COI cornuta Ceriodaphnia cf. KC020643 WAPIL03 COI cornuta Ceriodaphnia cf. KC020644 SAMYP01 COI cornuta Ceriodaphnia cf. KC020645 SAMYP02 COI cornuta Ceriodaphnia cf. KC020646 SAMYP03 COI cornuta Ceriodaphnia cf. KC020647 SASP001 COI cornuta Ceriodaphnia cf. KC020648 SASP002 COI cornuta

356

Ceriodaphnia cf. KC020649 SASP003 COI cornuta Ceriodaphnia cf. KC020650 SASP004 COI cornuta KC154322 SASNU001 16s Ceriodaphnia spp. KC154323 SASNU002 16s Ceriodaphnia spp. KC154324 SASNU003 16s Ceriodaphnia spp. KC154325 SASNU004 16s Ceriodaphnia spp. KC154326 SAMAN001 16s Ceriodaphnia spp. KC154327 SAMAN002 16s Ceriodaphnia spp. KC154328 SAMAN003 16s Ceriodaphnia spp. KC154329 SAMAN004 16s Ceriodaphnia spp. KC154330 NSSTE002 16s Ceriodaphnia spp. KC154331 NSYAN001 16s Ceriodaphnia spp. Contd....

357

GenBank Location Code Gene fragment Identification Accession Amplified Number KC154332 NSYAN002 16s Ceriodaphnia spp. KC154333 NSYAN003 16s Ceriodaphnia spp. KC154334 NSYAN004 16s Ceriodaphnia spp. KC154335 WAPIL003 16s Ceriodaphnia spp. KC154336 NSMER002 16s Ceriodaphnia spp. KC154337 NSMER003 16s Ceriodaphnia spp. KC154338 NSMER004 16s Ceriodaphnia spp. KC154339 NSMER005 16s Ceriodaphnia spp. KC154340 NSMER006 16s Ceriodaphnia spp. KC154341 SYDCB001 16s Ceriodaphnia spp. KC154342 SYDCB002 16s Ceriodaphnia spp. KC154343 SYDCB003 16s Ceriodaphnia spp. KC154344 SYDCB004 16s Ceriodaphnia spp. KC154345 SYDCB005 16s Ceriodaphnia spp. Ceriodaphnia cf. KC154299 SACOPP01 16s cornuta Ceriodaphnia cf. KC154300 SACOPP02 16s cornuta Ceriodaphnia cf. KC154301 SACOPP03 16s cornuta Ceriodaphnia cf. KC154302 SAMYP002 16s cornuta Ceriodaphnia cf. KC154303 SAMYP003 16s cornuta Ceriodaphnia cf. KC154304 SAMYP004 16s cornuta Ceriodaphnia cf. KC154305 SAMYP005 16s cornuta Ceriodaphnia cf. KC154306 SAMYP006 16s cornuta KC154307 SAMYP001 16s Ceriodaphnia cf.

358

cornuta Ceriodaphnia cf. KC154308 SAMYP007 16s cornuta Ceriodaphnia cf. KC154309 QULILY01 16s cornuta Ceriodaphnia cf. KC154310 QULILY02 16s cornuta Ceriodaphnia cf. KC154311 QULILY03 16s cornuta Ceriodaphnia cf. KC154312 WAHPIL01 16s cornuta Ceriodaphnia cf. KC154313 WAHPIL02 16s cornuta Ceriodaphnia cf. KC154314 WAHPIL03 16s cornuta Ceriodaphnia cf. KC154315 WAPIL001 16s cornuta Ceriodaphnia cf. KC154316 SAKUN001 16s cornuta Ceriodaphnia cf. KC154317 SAKUN002 16s cornuta Ceriodaphnia cf. KC154318 WAFFP001 16s cornuta Ceriodaphnia cf. KC154319 WAFFP002 16s cornuta Ceriodaphnia cf. KC154320 WAFFP003 16s cornuta Ceriodaphnia cf. KC154321 QULILY04 16s cornuta KC154358 SYDCB01 28s Ceriodaphnia spp. KC154359 SYDCB02 28s Ceriodaphnia spp. KC154360 SYDCB03 28s Ceriodaphnia spp. KC154361 SYDCB04 28s Ceriodaphnia spp. KC154362 SYDCB05 28s Ceriodaphnia spp.

359

KC154363 SAMAN001 28s Ceriodaphnia spp. KC154364 SAMAN002 28s Ceriodaphnia spp. KC154365 SAMAN003 28s Ceriodaphnia spp. KC154366 SASNU01 28s Ceriodaphnia spp. KC154367 SASNU02 28s Ceriodaphnia spp. KC154368 SASNU03 28s Ceriodaphnia spp. KC154369 SASNU04 28s Ceriodaphnia spp. KC154370 SASNU05 28s Ceriodaphnia spp. KC154371 NSMER001 28s Ceriodaphnia spp. KC154372 NSMER002 28s Ceriodaphnia spp. Ceriodaphnia cf. KC154346 SAKUN001 28s cornuta Contd....

360

GenBank Location Code Gene fragment Identification Accession Amplified Number Ceriodaphnia cf. KC154347 SAKUN002 28s cornuta Ceriodaphnia cf. KC154348 WAFFP001 28s cornuta Ceriodaphnia cf. KC154349 WAFFP002 28s cornuta Ceriodaphnia cf. KC154350 WAHPIL001 28s cornuta Ceriodaphnia cf. KC154351 WAHPIL002 28s cornuta Ceriodaphnia cf. KC154352 WAHPIL003 28s cornuta Ceriodaphnia cf. KC154353 WAPIL001 28s cornuta Ceriodaphnia cf. KC154354 WAPIL002 28s cornuta Ceriodaphnia cf. KC154355 WAPIL003 28s cornuta Ceriodaphnia cf. KC154356 SACOPP001 28s cornuta Ceriodaphnia cf. KC154357 SACOPP002 28s cornuta KC020622 BankIt1577674 COI Boeckella triarticulata KC020623 BankIt1577683 COI Australocyclops australis KC020624 BankIt1577688 COI Chydorus spp. KC007430 BankIt1577165 COI B.symmeterica JX436336 BankIt1555061 COI Calamoecia ampulla

361

Appendix 5

Traditional Sequencing requires Primers

The role of phylogenetic study, is to aid research to find where the species fit in a unified tree of life. To achieve this one has to amplify the gene of interest using primers. The Universal primers designed by (Folmer, Black et al. 1994b), LCO 1490 and HCO 2198, which are 25 and 26 base pairs in length, are an example of widely used primers in the animal kingdom. A Folmer primer amplifies the first half of the mt COI gene, which is a gene fragment of approximately 700 base pair long.

The universal primers were selected from three coding and six anticoding strands, which in turn were designed by comparing conserved regions of COI genes across 15 species. These primers were successful in amplifying 710 base pair gene fragment for more than 80 invertebrate species across 11 invertebrate phyla (Folmer, Black et al. 1994b). The high success rate of the primers in amplifying the COI fragment in highly divergent animal species has been remarkable due to its conserved 3’ ends (Folmer, Black et al. 1994a). In addition several species-specific primers have been applied in numerous studies, for example Gibson et al. (2011) designed 94 new primers from 11 mitochondrial and nuclear gene regions to facilitate the better phylogenetics understanding of order Dipteria (Bock, Zhan et al. 2011; Bucklin, Guarnieri et al. 1999; Derycke, Vanaverbeke et al. 2010; Hoelzel 2001).

Efforts to amplify the COI gene using the LCO 1490 and HCO 2198 primers, however, have also sometime shown a relatively low success rate or even failed, raising speculation about it being “universal”. These failures are due to either degradation of the DNA or when one or both primer fails to amplify the target gene (Bock, Zhan et al. 2011; Van Houdt, Breman et al. 2010). In this chapter, I test whether the number of conserved regions in Folmer primer (LCO 1490 and HCO 2198) remains constant when compared to 725 COI sequences from species belonging to 18 animal phyla.

362

Currently there is no automated system in place (except “Primer Bank” by BOLD, which only offers a list of primers) to provide users with suggested primer sets that can be trialled for a given organism or a group of organisms in a PCR reaction. If the sequence of an organism were known then specific primers could be designed by going through conserved blocks of the sequences for a given organism or group of organisms. Even then, this will include checking the kinetics of primers like annealing and extension temperature, duplex stability of mismatched nucleotides and the efficiency of the primer to recognise and extend a mismatched duplex for successful recovery of the barcode region. This appendix will therefore investigate whether domain eukarya-specific primers can be designed at a descending level of taxonomic depth (i.e. at level of Phylum, Class, Order, Family, and Genus).

Primer Design

Sets of oligonucleotide primers were designed from an alignment of 725 complete mtDNA belonging to a diverse range of animal species. The efficiency of the PCR is affected the way a primer is designed and used. To design taxon- specific primers successfully, standard recommendations for primer design were followed, including parameters like primer length, primer-melting temperature, primer annealing temperature, GC content, GC clamp, primary secondary structure, repeats, runs, 3' end stability and cross homology (Dieffenbach, Lowe et al. 1993; Sheffield, Cox et al. 1989a; Singh, Govindarajan et al. 2000; Wu, Ugozzoli et al. 1991).

Primer length

A primer length between 18 to 30 bases long is considered acceptable because this minimizes the chances of random alignment with target genomic sequences in the PCR reaction. Primer size shorter than 18 base pairs increases the chance of nonspecific PCR amplifications; longer than 30 base pairs reduces specificity and increases the chance of secondary structure like hair pin loops that can terminate DNA polymerisation (Karp, Ingram et al. 1997; Newton and Graham 1994).

363

Melting temperature (Tm)

Regardless of the type of PCR to be conducted, a melting temperature of the primers between 55 º to 65 ºC gives the most consistent results. Melting temperature of the forward and reverse primer within 5 ºC of each other gives consistent performance by avoiding inadvertent preferential amplification of the product and thus maximising the yield of the PCR product. There are numbers of software packages available that can calculate the Tm of the primers based on various reaction conditions, which uses either the original or complex nearest neighbour thermodynamic theory (Breslauer, Frank et al. 1996; Haas, Hild et al. 2003; Sugimoto, Nakano et al. 1996). A good working approximation of this value (generally valid for oligonucleotides in the 18 – 30 base range) can be calculated using the formula of Wallace et al. (1979).

Tm = 2 (Number A + C) + 4 (Number of G + C) ºC. Where A = Adenine, T = thymine, G = Guanine and C = Cytosine.

The melting profiles of primers also depend on the millimolar (mM) concentration of monovalent (Na+ or K+) and divalent (Mg+2) salt cations used during PCR reaction. The effect of these salt cations on predicting the Tm of primers has been studied extensively using various thermodynamic algorithms (Mitsuhashi 1996; Owczarzy, Moreira et al. 2008; Owczarzy, Vallone et al. 1997; Peyret 2000; SantaLucia 1998; SantaLucia and Hicks 2004; Tan and Chen 2006; von Ahsen, Wittwer et al. 2001; von Ahsen, Wittwer et al. 2011). Most of these algorithms, however, have been developed for divalent cations (Mg+2), which have a higher stabilizing effect on dsDNA than monovalent cations.

Currently there are three widely accepted thermodynamic algorithms according to von Ahsen et al.(2011) which are Owczarzy et al.(Owczarzy, Moreira et al. 2008; Owczarzy, Vallone et al. 1997) and SantaLucia et al. (SantaLucia and Hicks 2004) for predicting the Tm of primers. Selection of one of these three algorithms depends on concentration of the divalent cations used in the PCR reaction by the users.

Annealing Temperature (Ta) 364

Optimum Ta is one of the crucial factors for success of a PCR reaction, especially when long products have to be synthesized. If Ta is too low, it will result in amplification of non-specific DNA fragments and, if too high, it compromises the yield and purity of the PCR product due to poor annealing of the primers.

Ideally, annealing temperature is calculated as 5 ºC below the lowest Tm of the pair of primers to be used, but it is usually adjusted to improve the specificity and yield of the product by carrying out optimization experiments (Innis, Michael et al. 1990).

GC Content percentage

An important factor to consider while designing a primer is the percentage of GC content, which must be between ranges of 30 % to 60 % to ensure the stable annealing of primer with template. Melting temperature of a primer is directly proportional to the GC content (G ≡ C; A = T) (Alberts, Johnson et al. 2002; Dieffenbach and Dveksler 2003; Rychlik, Spencer et al. 1990). Another factor that has to be taken into account while designing or choosing a primer is to avoid any stretches and repeats of Polypyrimidine (T, C) or Polypurine (A, G) as this will promote non-specific annealing (Mitsuhashi 1996).

3′ End Sequence and GC clamp

There are three factors that have to be considered in relation to the 3’ end sequences (i) Is a well established fact that polymerase requires the 3’ end of the primer to begin elongation for successful amplification of the product. To improve priming efficiency, it is important that at least the last three bases of the 3’end of the primer are homologous to the template (ii) It is preferable to include G / C or GC type residues like CC, GC, GG, and CG at the 3’ end referred as “GC clamp”. This increases priming efficiency due to stronger hydrogen bonding of GC residues, and (iii) the presence of T residue at the 3’ end reduces the priming specificity and hence has to be avoided. A run of 3 or more G or C bases , makes it a sticky end, which is the terminal portion that has a stretch of unpaired 365

nucleotides, and thus potentially annealing at multiple sites on the template DNA (Kwok, Kellogg et al. 1990; Sheffield, Cox et al. 1989b) thereby reducing efficiency of the reaction.

Secondary structure

A primer sequence with the presence of a secondary structure is detrimental for a PCR reaction. As the concentration of the primer is more than the template concentration in a PCR reaction, will result in the nonspecific amplification due to inter- or intra-primer annealing resulting in “noise” or background products. To avoid any self- and hetero-dimer formation, primer sequences have to be screened for intra-primer homology or self-homology, which causes “snapback” forming partially double stranded hair pin loop like structures. Further, they must be screened for inter-primer homology which results in the primer dimer formation, which is amplification of the complimentary bases in the primers and a potential by-product of the PCR reaction. A simple process to avoid formation of any secondary structure is to select primers with > = 50 % G+C content and deficient in one of the four bases (Kampke, Kieninger et al. 2001). Most of the commercial software does this for the users.

Amino acid Polarity

There are in total 20 amino acids, which have an alkyl group attached to the alpha amino acid unit, with the only exception of Glycine. Glycine does not have a side chain making it hydrophobic and hence constitutes as a parent skeleton for amino acids. Based on the polar nature of the side chains, amino acids are classified into three categories (a) Neutral amino acids, (b) Basic Amino acids and (c) Acidic amino acids. Neutral amino acids are further classified as (i) Neutral Nonpolar Amino acids and (ii) Neutral Polar amino acids. The polar amino acids are a group comprising neutral-polar, acidic and basic amino acids (Taylor 1986) (Fig. 1) .

366

Fig. 1 Derived from (Taylor 1986). The Venn diagram showing the relationship of the 20 naturally occurring amino acids to a selection of physico-chemical properties which are important in the determination of protein tertiary structure.

Domain specific Primer Design

Ten new forward primers were designed from 725 COI primer regions (Table 4). As the reverse primer (HCO 2198) exhibits high resemblance across the broadest array of species, it was not altered. The thermodynamic behaviour and stability (Hairpin loop, Primer dimer, Tm and GC %) of primer pairs were analysed for heterodimers formation by measuring Gibbs free energy (∆G) using Perl Primer® application that uses nearest neighbour approach and incorporating base mismatch data. Parameters like oligo concentration at 0.2 µm, monovalent cations at 50 mM and divalent cations concentration at 1.5 mM were kept constant. ∆G value less than -5 kcal / mole is acceptable for primer development (Yuryev 2007). The primer sequences were than BLASTED in Primer-BLAST tool provided by NCBI. Following search parameter were used for better specificity of primers to target templates, Reference Sequence (Ref Seq) database was selected as “nr”, Tm of primer between 50 ºC to 63 ºC at an interval of 3 ºC, PCR product size range between 500 to 1000 base pairs and rest of the parameters were kept constant.

367

Table 1 Variations in nucleotide base pairs across Phylum and 725 sequences when compared with Folmer HCO 2198 primers. The number in blue colour indicates number of variable nucleotides (1 to 4) and grey colour indicates total number of variable positions at the given position of nucleotide.

Ascidian Folmer HCO 2198 (N=5) t g a t t t t t t g g t c a c c c t g a a g t t t a

<- Variable 0 0 1 1 0 1 0 0 1 1 0 3 0 0 1 0 0 2 0 0 1 0 1 1 0 1 Nucleotides -> <-No of variable 0 0 4 1 0 1 0 0 1 4 0 5 0 0 3 0 0 2 0 0 3 0 0 4 0 1 positions ->

<- a -> 0 0 0 0 0 0 0 0 0 4 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0

<- t - > 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 0 0 0 0 0 0 0 0

<- g -> 0 0 4 0 0 0 0 0 0 0 0 3 0 0 0 0 0 1 0 0 3 0 0 3 0 0

<- c -> 0 0 0 1 0 1 0 0 1 0 0 1 0 0 0 0 0 1 0 0 0 0 1 1 0 1

Echinodermat 0 0 1 1 0 1 0 0 1 0 0 3 0 0 1 0 0 3 0 0 1 0 0 3 0 0 a 1 1 0 0 1 0 7 0 0 3 0 0 15 0 0 11 0 0 0 0 11 0 0 15 0 0 (N = 26) 2 5

<- a -> 0 0 0 0 0 0 0 0 0 0 0 6 0 0 0 0 0 9 0 0 0 0 0 8 0 0

<- t - > 0 0 0 0 0 0 0 0 0 0 0 0 0 0 11 0 0 0 0 0 0 0 0 0 0 0

1 <- g -> 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 2 0 0 11 0 0 4 0 0 2

<- c -> 0 0 0 1 0 7 0 0 3 0 0 8 0 0 0 0 0 4 0 0 0 0 0 3 0 0

Invertebrata 0 0 1 0 1 1 0 1 2 0 1 3 0 0 1 0 0 3 0 0 1 0 0 3 0 0 2 10 # (N =177) 0 0 0 1 50 0 1 32 0 1 0 0 89 0 0 0 0 45 0 0 91 0 0 9 1 # 8 <- a -> 0 0 0 0 0 0 0 0 1 0 0 45 0 0 0 0 0 0 0 0 0 0 49 0 0 5

<- t - > 0 0 0 0 0 0 0 0 0 0 0 0 0 0 89 0 0 0 0 0 0 0 0 0 0 0

2 1 <- g -> 0 0 0 0 0 0 1 0 0 0 38 0 0 0 0 0 0 0 45 0 0 23 0 0 9 4 1 <- c -> 0 0 0 0 1 50 0 0 31 0 1 18 0 0 0 0 0 0 0 0 0 0 19 0 0 5

Mold 0 0 1 0 0 1 0 0 1 0 0 3 0 0 1 0 0 3 0 0 1 0 0 2 0 0 1 2 (N= 28) 0 0 0 0 8 0 0 2 0 0 27 0 0 17 0 0 0 0 10 0 0 6 0 0 7 4 1 <- a -> 0 0 0 0 0 0 0 0 0 0 0 4 0 0 0 0 0 0 0 0 0 0 5 0 0 5

<- t - > 0 0 0 0 0 0 0 0 0 0 0 0 0 0 17 0 0 0 0 0 0 0 0 0 0 0

1 <- g -> 0 0 0 0 0 0 0 0 0 0 18 0 0 0 0 0 5 0 0 10 0 0 1 0 0 7

<- c -> 0 0 0 0 0 8 0 0 2 0 0 5 0 0 0 0 0 4 0 0 0 0 0 0 0 0

Vertebrata 0 0 1 0 0 1 0 0 1 0 0 3 0 0 1 0 0 3 0 0 1 0 0 3 0 0 3 34 19 35 # 36 (N= 489) 0 0 0 0 0 0 0 0 0 0 93 0 0 0 0 75 0 0 0 0 4 3 0 8 # 3 10 # 17 <- a -> 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 # 8

<- t - > 0 0 0 0 0 0 0 0 0 0 0 0 0 0 93 0 0 0 0 0 0 0 0 0 0 0

3 2 <- g -> 0 0 0 0 0 0 0 0 0 0 52 0 0 0 0 0 0 0 75 0 0 38 0 0 4 4 34 19 19 8 14 <- c -> 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 7 0 7

725 primer 0 0 1 1 1 1 0 1 3 1 1 3 0 0 1 0 0 3 0 0 1 0 1 3 0 0 9 40 22 50 21 # 14 47 sequences 0 0 2 1 0 1 4 1 0 0 0 0 0 0 0 1 0 0 6 9 9 6 3 # 4 9 16 # 24 <- a -> 0 0 0 0 0 0 0 0 1 4 0 0 0 0 0 0 0 0 0 0 0 0 0 5 # 0 21 <- t - > 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 9 11 4 14 <- g -> 0 0 0 0 0 0 1 1 0 0 0 0 0 0 0 0 0 0 0 69 0 0 6 2 6 4 40 22 22 # 17 <- c -> 0 0 0 2 1 0 0 0 1 0 0 0 0 0 0 0 0 0 1 0 0 9 7 9 # 0

368

Table 2 Variations in nucleotide base pairs across Phylum and 725 sequences when compared with Folmer LCO 1490 primers. The number in blue colour indicates number of variable nucleotides (1 to 4) and grey colour indicates total number of variable positions at the given position of nucleotide.

369

Ascidian Folmer LCO 1490 (N=5) g g t c a a c a a a t c a t a a a g a t a t t g g <- Variable Nucleotides 2 1 2 0 0 2 0 0 2 0 0 1 0 0 0 0 0 1 0 0 0 0 0 1 1 0 3 -> <-No of variable 5 5 3 0 0 3 0 0 3 0 0 1 0 0 0 0 0 1 0 0 0 0 0 1 3 0 5 positions -> <- a -> 3 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 3 0 3

<- t - > 2 5 2 0 0 2 0 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1

<- g -> 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1

<- c -> 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0

Echinoder 3 2 3 1 3 2 1 3 3 2 2 2 3 2 2 1 2 2 2 2 2 2 0 2 1 2 3 mata (N = 2 2 2 1 1 1 1 1 1 2 1 1 1 2 5 5 8 3 6 5 2 3 7 5 0 3 5 26) 6 6 2 7 0 5 0 6 0 6 0 4 2 6 1 1 3 1 3 5 2 0 0 2 0 0 0 3 0 2 0 0 0 0 0 3 0 0 8 0 2 <- a -> 1 1 2 2 1 1 1 0 2 8 5 8 4 2 0 2 0 0 2 1 4 3 1 0 2 0 0 3 3 <- t - > 2 5 8 3 2 2 1 0 0 0 1 0 0 3 4 6 1 0 1 3 0 0 0 0 9 0 3 0 0 0 0 3 <- g -> 2 1 0 0 1 0 0 4 0 0 3 0 0 5 0 2 8 0 2 0 4 0 0 0 4 0 0 0 <- c -> 1 Invertebrat 3 3 3 2 1 3 2 3 3 1 2 3 0 1 1 2 2 2 2 1 1 1 0 1 0 0 4 a 1 1 1 1 1 1 9 1 7 6 4 3 4 2 7 6 6 9 3 4 0 2 3 5 5 2 2 0 0 0 7 (N =177) 7 1 5 4 8 2 2 7 5 1 7 7 2 7 1 1 3 1 1 0 0 0 3 0 0 0 2 0 0 0 0 0 0 3 0 0 0 0 0 0 0 1 <- a -> 3 9 1 2 4 1 1 1 7 1 5 3 5 2 0 0 0 3 3 0 0 0 0 0 1 2 1 0 0 0 0 0 0 0 0 <- t - > 5 1 7 6 5 3 9 1 3 1 9 0 0 5 6 3 3 6 0 1 1 0 2 0 0 3 0 0 0 2 0 0 0 0 <- g -> 1 6 5 4 1 1 5 4 4 2 1 0 5 0 0 0 0 0 3 0 0 2 0 0 2 2 0 0 0 0 <- c -> 2 4 5 9 2 5 1 2

Mold (N= 1 2 2 0 0 3 0 0 3 0 0 1 0 0 1 0 0 1 0 0 1 0 0 2 0 0 4 2 2 2 1 1 1 2 28) 0 0 0 0 0 0 8 0 0 5 0 0 5 0 0 8 0 0 0 0 8 7 7 2 7 3 8 1 0 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9 0 0 <- a -> 0 2 2 2 1 0 0 7 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8 <- t - > 8 5 3 5 <- g -> 0 0 0 0 0 1 0 0 1 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 0 8

<- c -> 0 0 4 0 0 4 0 0 1 0 0 8 0 0 5 0 0 0 0 0 8 0 0 4 0 0 2

2 3 3 0 0 3 1 0 3 0 1 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 4 Vertebrata 4 4 4 2 3 2 3 2 2 4 1 (N= 489) 8 8 8 0 0 4 1 0 6 0 1 8 0 0 3 0 0 0 0 9 0 0 0 0 0 8 9 9 9 9 2 5 2 1 2 2 9 1 6 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 <- a -> 1 1 4 4 1 1 1 1 <- t - > 8 7 7 0 0 1 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 7 8 7 6 9 7 1 0 0 0 0 0 1 0 6 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 8 <- g -> 8 9 3 2 2 3 2 2 3 4 4 1 0 0 0 0 0 0 0 0 8 0 0 3 0 0 0 0 0 9 0 0 0 0 0 1 <- c -> 7 6 3 2 1 2 2 1

4 3 3 2 3 3 2 3 3 2 3 3 3 2 2 2 3 2 3 3 2 2 0 2 2 2 4 725 primer 7 7 7 3 4 3 3 3 2 7 2 1 2 1 1 8 1 1 sequences 2 1 0 6 7 8 6 6 7 8 5 8 5 7 0 4 6 5 2 2 6 3 9 3 8 2 2 5 4 3 9 8 9 8 9 9 5 2 1 1 5 2 1 1 1 2 0 0 5 3 0 0 3 0 2 0 0 0 3 0 3 0 0 3 2 9 <- a -> 9 3 0 7 3 7 8 9 6 6 3 2 1 1 9 5 3 0 2 1 8 0 7 2 0 2 0 0 3 3 5 3 1 0 2 0 0 3 3 6 <- t - > 9 2 5 0 4 6 1 1 8 1 8 3 0 0 5 4 6 6 3 1 1 5 0 0 3 0 9 0 5 0 0 0 0 <- g -> 0 2 5 8 3 5 3 2 3 3 3 2 3 7 5 6 5 0 0 0 0 2 0 3 5 0 2 8 2 2 0 6 2 5 0 0 3 0 0 2 <- c -> 0 3 2 5 6 6 2 5 370

Specificity of the Primers

Specificity of designed forward primers for COI region was validated against the NCBI’s nr database as mentioned above. Primers F1, F2 and F5 showed a wide range of COI specificity (theoretical amplification) across taxa, the sequences isolated by these search using the primers F1, F2 and F5 were cross referenced with the Universal LCO 1490 primer for specificity (Tables 3).

Forward primer F1 ( TA TCA ACA AAC CAT AAA GAT ATC GG) is 25 base pair long with Tm of 57.54 ºC , GC concentration of 32 % and amplifying 700- 736 base pair COI region. Primer F1 differs from LCO 1490 at base position 1 (t instead of g), 2 (a instead of g), 11 (c instead of t) and position 23 (c instead of t). This primer has been explicit 92.75 % for the same number of mtDNA sequences put to test which also showed specificity with Folmer LCO1490 primer. F1 primer (Table 6) identified the remaining 7 % of sequences.

Forward primer F2 (TA TCA ACT AAC CAT AAA GAA ATC GG) is 25 base pair long with Tm of 57.49 ºC , GC concentration of 32 % and amplifying 700 – 710 base pair COI region. Primer F2 differs from LCO 1490 at base position 1 (t instead of g), 2 (a instead of g), 8 (t instead of a), 11 (c instead of t), 20 (a instead of t) and position 23 (c instead of t) and is more specific for Phylum Chordata than to other taxa. The designed primer F2 is found to be more successful than LCO 1490 in respect to specificity with template and identifying more species, by 20.37% compared to LCO 1490 primer analysis.

Forward primer F5 (GA ACA AAT ATC TTA CAC GTT GGC) is 23 base pair long with Tm of 52 ºC, GC concentration of 39 % and amplifying 735 base pair COI region is specific for order: Alcynonacea from Phylum: Cnidaria. Mitochondrial genome sequences search-using Folmer primer failed to find any sequences, from this order. However, primer F5 did not show any success for sequences from other class in Phylum Cnidaria which was identified using Folmer primers.

371

New Forward primer

The new forward primers F1 to F7 were tested along with HCO 2198 for its specificity with template DNA. This specificity is only theoretically guaranteed in terms of sequence similarity checked against the NCBI’s databases. Even though various forward primers have been suggested in this study, primers F1, F2 and F5 are found to be very successful in theoretical amplification of the COI gene from various phyla and in certain cases specific to certain phyla and order when compared with LCO 1490.

372

Table 3 Summary of New F1, F2 and F5 primer when compared with Folmer LCO 1490, checked against the NCBI database. For more detail on sequences please see Tables 6 and 7.

Base pair similarity (Minimum similarity = 20 bp ; Maximum COI region

Primer. Number of similarity = 25 bp). No of New sequences Specificity sequences. picked. (theoretical 20 21 22 23 24 25 amplification).

Min = 700 bp; Max = 715 LCO 1490 6 8 7 6 5 58 bp Similarity in 96 6.25 8.33 7.29 6.25 5.2 60.41 Average specificty = 709 bp (%) Min = 703 bp; Max = 736 F1 14 70 10 2 0 0 bp Similarity in 96 6 14.58 72.91 10.41 2.08 Average specificty = 709 bp (%)

Min = 703 bp; Max = LCO 1490 15 17 5 3 1 0 709bp 54 Similarity in Average specificity = 709 27.77 31.48 9.26 5.55 1.85 (%) bp Min = 703 bp; Max = F2 6 13 27 8 0 0 709bp 54 13 Similarity in Average specificity = 709 11.11 24.07 50 14.81 (%) bp

LCO 1490 11 9 3 0 0 3 Average specificity = 709 Similarity in 43 25 25.5 20.9 6.97 6.97 bp (%)

F5 1 1 15 0 0 0 Average specificity = 735 Similarity in 43 17 2.32 2.32 34.88 bp (%)

373

Reverse primers (HCO 2198)

The original Folmer primer HCO 2198 showed 17 conserved regions from 26 base pairs, across 80 invertebrate species. Similar test performed on 177 invertebrate species sequences in current study, showed a decline in number of conserved sites by two base pairs. The 3’ end of Folmer HCO 2198 primers remains highly conserved for remaining taxa (Table 1) compared to LCO 1490 (Table 2). The overall analysis of 725 sequences in this study showed only nine variations, majority of which encountered in 5’ end of the primer.

The amino acid translation of primer base pairs across the 725 sequences is supported with four conserved and four variable amino acid regions. Three of the four conserved amino acid region are towards the 3’end of the primers.

374

Table 4 Forward primer design for amplifying and sequencing the COI gene region.

Amiono acid COI Leng GC Content Total deltaG value in Hetero Symbol Primer Sequence Tm Translation Amplification th (%) Kcal/mole dimer

LCO GG TCA ACA AAT CAT AAA 57.0 - 3.19 F S T N H K D I G 547 to 723 25 32 -42.45 1490 GAT ATT GG 4 kcal/mol TA TCA ACA AAC CAT AAA GAT 57.5 - 2.19 F1 L S T N H K D I G 709 25 32 - 22.09 kcal/mol ATC GG 4 kcal/mol TA TCA ACT AAC CAT AAA GAA 57.4 - 1.01 F2 L S T N H K E I G 709 25 32 - 22.06 kcal/mol ATC GG 9 kcal/mol TT TCT ACA AAT CAT AAA GAT 52.9 - 0.36 F3 F S T N H K D I G 709 to 736 25 24 - 19.37 kcal/mol ATA GG 6 kcal/mol TT TCT ACA AAT CAC AAG GAT 56.9 - 2.31 F4 F S T N H K D I G 709 25 32 - 21.63 kcal/mol ATA GG 3 kcal/mol GA ACA AAT ATC TTA CAC GTT 52.9 - 2.02 F5 R T N I L H V G 735 25 39 - 19.37 kcal/mol GGC 6 kcal/mol TG TTT CAT AAA CCG TTG ACT 58.8 - 0.89 F6 L F H K P L T K 731 23 39 - 22.19 kcal/mol AG 4 kcal/mol AT AAT TAT TTA ATC CGT TGG 51.7 - 0.07 F7 N N Y L I R W D 733 21 28 - 17.41 kcal/mol GAC 7 kcal/mol AT AGA AAC AAA TTT ACC GCG F8 ATH AT GAG NTT ATA TTT AAG TCG F9 Due to the presence of IUPAC notation, perl primer failed to analyse the various parameters. TTG AT GCA ACT AAG ACG ATH F10 ATT TG

375

Table 5 Taxonomiy of 725 sequences included in Primer analysis. The Bold letter indicates the Phylum, Class, Order and Family similarity with original Folmer paper (Folmer, Black et al. 1994b). The colour code of genus represents the amplified region of the COI fragment excluding primers.

376

Base pair length and Colour code 270bp 493bp 633bp 648bp 651bp 654bp 657bp 660bp 662bp 666bp 669bp 675bp

Phylum Class Order Family Genus Ascoschoengasti Voltziales Trombiculidae a Walchia Ammotrechida Nothopuga Solifugae e Eremobatidae Eremobates Mesobuthus Mesobuthus Buthidae Scorpiones Centruroides Buthus Chactidae Uroctonus Aphonopelma Theraphosidae Ornithoctonus Araneae Nephillidae Nephila Arachnida Tetranychidae Tetranychus Liphistiidae Heptathela Phytoseiidae Metaseiulus Parasitiformes Ixodes Ixodidae Ixodes Arthropod Leptotrombidiu a m Leptotrombidiu Prostigmata Trombiculidae m Leptotrombidiu m Opiliones Phalangiidae Phalangium Ricinulei Ricinoididae Pseudocellus Amblypygi Phrynidae Phrynus Branchiopod Anostraca Artemiidae Artemia a Notostraca Triopsidae Triops Poduromorpha Neanuridae Friesea Entomobryomorph Isotomidae Cryptopygus a Symphypleona Sminthuridae Sminthurus Collembola Onychiuridae Onychiurus Poduromorpha Poduridae Podura Entomobryomorph Entomobryida Orchesella a e Nemasomatida Diplopoda Julida Antrokoreana e Contd....

377

Ceratopogonidae Culicoides Ceratitis Bactrocera Bactrocera Tephritidae Bactrocera Bactrocera Bactrocera Syrphidae Simosyrphus Drosophila Diptera Drosophilidae Drosophila Drosophila Aedes Culicidae Anopheles Tabanidae Cydistomyia Calliphoridae Chrysomya Nemestrinidae Trichophthalma Muscidae Hematobia Oestridae Dermatobia Tetraleurodes Aleyrodidae Trialeurodes Bemisia Insecta Colobathristidae Phaenacantha Malcidae Malcus Hemiptera Alydidae Riptortus Berytidae Yemmalysus Aphrophoridae Philaenus Aradidae Neuroctenus Psyllidae Pachypsylla Plataspidae Coptosoma Reticulitermes Reticulitermes Isoptera Rhinotermitidae Reticulitermes Reticulitermes Tortricidae Adoxophyes Lycaenidae Coreana Sphingidae Manduca Ostrinia Crambidae

Lepidoptera Ostrinia Pieridae Artogeia Bombycidae Bombyx Geometridae Phthonandria Saturniidae Antheraea Contd....

378

Campanulotes Phthiraptera Philopteridae Bothriometopus Campodeoidae Campodea Diplura Japygidae Japyx Campodeoidae Campodea Acrididae Locusta Gryllotalpidae Gryllotalpa Orthoptera Acrididae Oxya Ruspolia Tettigoniidae Anabrus Machilidae Trigoniophthalmus Archaeognatha Meinertellidae Nesomachilis Elateridae Pyrophorus Coleoptera Cerambycidae Anoplophora Tenebrionidae Tribolium Plecoptera Pteronarcyidae Pteronarcys Thysanura Lepismatidae Thermobia Psocoptera Lepidopsocidae Lepidopsocid Thysanoptera Thripidae Thrips Mantodea Mantidae Tamolanica Mantophasmatodea Mantophasmatidae Sclerophasma Potamidae Geothelphusa Litopenaeus Litopenaeus Penaeidae Fenneropenaeus Marsupenaeus Decapoda Palaemonidae Macrobrachium Atyidae Halocaridina Parastacidae Cherax Malacostraca Varunidae Eriocheir Eriphiidae Pseudocarcinus Portunidae Callinectes Harpiosquilla Squillidae Squilla Stomatopoda Squilla Gonodactyloidae Gonodactylus Lysiosquillidae Lysiosquillina Isopoda Ligiidae Ligia Contd....

379

Siphonostomatoida Caligidae Lepeophtheirus Tigriopus Harpacticoida Harpacticidae Maxillopoda Tigriopus Sessilia Balanidae Megabalanus

Podoplea Cyclophettidae Paracyclopina Pycnogonida Pantopoda Ammotheidae Achelia Symphyla Symphyla Scutigerellidae Scutigerella Contd....

380

Base pair length and Colour code 270bp 493bp 633bp 648bp 651bp 654bp 657bp 660bp 662bp 666bp 669bp 675bp

Phylum Class Order Family Genus Anguilla Anguilla Anguilla Anguilla Anguilla Anguilla Anguilla Anguilla Anguillidae Anguilla Anguilla Anguilliformes Anguilla Anguilla Anguilla Anguilla Anguilla Anguilla Chordata Actinopterygii Anguilla Congridae Conger Eurpharyngida Eurypharynx e Saccopharyngi Saccopharynx dae Atheriniformes Atherinidae Hypoatherina Chlorophthalm Chlorophthalmus idae Aulopiformes Harpadon Synodontidae Saurida Batrachoidiformes Batrachoididae Porichthys Exocoetoidae Cypselurus Scomberesocid Cololabis ae Beloniformes Adrianichthyid Oryzias ae Exocoetidae Exocoetus Contd....

381

Anomalopidae Anomalops Anoplogastrida Anoplogaster e Beryx Berycidae Beryx Monocentridae Monocentris Beryciformes Holocentridae Ostichthys Trachichthyida Hoplostethus e Diretmoides Diretmidae Diretmus Holocentridae Myripristis Characidae Chalceus Characiformes Phenacogrammu Alestiidae s Clupeiformes Clupeidae Dorosoma Campostoma Ctenopharyngod on Cyprinella Cyprinus Biwia Carassius Carassius Carassius Carpiodes Gila Chondrostoma Coreoleucisus Cyprinidae Hemibarbus Hemibarbus Cypriniformes Hemibarbus Danio Hypophthalmicht hys Puntius Hypophthalmicht hys Notropis Sarcocheilichthy s Phenacobius Megalobrama Opsariichthys Balitoridae Lefua Catostomidae Minytrema

382

Cobitidae Cobitis Catostomidae Xyrauchen Contd....

383

Cyprinodontiform Poeciliidae Gambusia es Aplocheilidae Kryptolebias Macrouridae Caelorinchus Arctogadus Boreogadus Gadus Gadidae Melanogrammus Merlangius Theragra Gadiformes Squalogadus Macrouridae Ventrifossa Trachyrincus Bregmacerotid Bregmaceros ae Lotidae Lota Moridae Physiculus Gasterosteidae Gasterosteus Gasterosteiformes Hypoptychidae Hypoptychus Indostomidae Indostomus

Gonorynchiforme Gonorynchidae Gonorynchus s Apteronotidae Apteronotus Gymnotiformes Sternopygidae Eligenmannia Trachipteridae Zu Lamprididae Lampris Lampridiformes Stylephoridae Stylephorus Trachipteridae Trachipterus Caulophrynida Caulophryne e Chaunax Chaunacidae Chaunax Lophiiformes Lophius Lophiidae Lophius Melanotaenida Melanocetus e Myctophidae Myctophum Myctophiformes Neoscopelidae Neoscopelus Contd....

384

Ophidiidae Bassozetus Carapidae Carapus Cataetyx Ophidiiformes Bythitidae Diplacanthopom a Lamprogrammus Ophidiidae Sirembo Osmeriformes Osmeridae Plecoglossus Arapaima Osteoglossiformes Osteoglossidae Scleropages Acanthurus Acanthurus Acanthuridae Naso Zebrasoma Acropomatidae Doederleinia Anarhichadida Anarhichas e Salarias Blenniidae Petroscirtes Caesionidae Pterocaesio Caproidae Antigonia Carangoides Perciformes Carangidae Caranx Trachurus Centracanthida Spicara e Centrarchidae Micropterus Centropomidae Lates

Chaetodontida Heniochus e Chaetodon Channichthyid Chionodraco ae Elassomatidae Elassoma Eleotridae Eleotris Emmelichthyid Emmelichthys ae Contd....

385

Gobiesocidae Arcos Gobiesocoidae Aspasma Gymnogobius Gobiidae Acanthogobius Diagramma Haemulidae Parapristipoma Parajulis Labridae Pteragogus Lethrinus Lethrinidae Lutjanus Luvaridae Luvarus Monodactylida Monodactylus e Crenimugil Mugilidae Mugil

Odontobutidae Odontobutis Percichthyidae Coreoperca Etheostoma Percidae Percina Pholidae Pholis Pomacanthidae Centropyge Pomacanthidae Chaetodontoplus Rhyacicthyidae Rhyacichthys Euthynnus Scomberomorus Scombridae Thunnus Scomber Thunnus Serranidae Plectropomus Siganidae Siganus Contd....

386

Pagrus Sparidae Paragyropus Pagellus

Zanclidae Zanclus Zoarcidae Lycodes Aphredoderida Aphredoderus Percopsiformes e Percopsidae Percopsis Hippoglossus Reinhardtius Pleuronectidae Platichthys Pleuronectiformes Verasper Verasper Soleidae Solea Paralichthyidae Paralichthys Polymixiiformes Polymixiidae Polymixia Oncorhynchus Oncorhynchus Salmoniformes Salmonidae Oncorhynchus Oncorhynchus Salmo

Cyclopteridae Aptocyclus Cottidae Cottus Dactylopterida Dactyloptena Scorpaeniformes e Dactyloptena Peristediidae Satyrichthys Sebastes Sebastidae Helicolenus Semionotiformes Lepisosteidae Lepisosteus Cranoglanidida Cranoglanis e Siluriformes Amblycipitidae Liobagrus Pangasiidae Pangasianodon Bagridae Pseudobagrus Cetostoma Cetomimidae Danacetichthys Eutaeniophorina Mirapinnidae Stephanoberycifor e mes Rondeletiidae Rondeletia Scopelogadus Melamphaidae Poromitra Synbranchidae Monopterus Synbranchiformes Mastacembelidae Mastacembelus Contd.... 387

Mola Molidae Masturus Diodontidae Diodon Ostraciidae Ostracion Aracanidae Kentrocapros Monacanthidae Stephanolepis Tetraodontiformes Balistidae Sufflamen Triacanthus Triacanthidae Trixiphichthys Tetraodontidae Tetraodon Triacanthodida Macrorhamphos e odes Triacanthodes Triodontidae Triodon Allocyttus Oreosomatidae Neocyttus Parazenidae Parazen Zeiformes Macurocyttida Zenion e

Zeus Zeidae Zenopsis Amolops Rana Ranidae Rana Fejervarya Pelobatidae Pelobates Bombinatorida Bombina e Bombina Alytes Amphibia Anura Discoglossidae obstetricans Discoglossus Bufo Bufonidae Bufo Hylidae Hyla Microhylidae Microhyla Polypedates Rhacophoridae Rhacophorus Contd....

388

Ambystoma Ambystomatid Ambystoma ae Ambystoma Ambystoma Gyrinophilus Hemidactylium Hydromantes Batrachoseps Batrachoseps Desmognathus Bolitoglossa Ensatina Plethodontidae Plethodon Caudata Desmognathus Plethodon Eurycea Plethodon Pseudotriton Oedipina Phaeognathus Thorius Cryptobranchi Andrias dae

Hynobiidae Hynobius Plethodontidae Aneides Rhyacotritonid Rhyacotriton ae Ichthyophiidae Ichthyophis Uraeotyphlidae Uraeotyphlus Caeciliidae Siphonops Gymnophiona Scolecomorphi Scolecomorphus dae Rhinatrematida Rhinatrema e Cionidae Ciona Enterogona Phallusia Ascidiacea Ascidiidae Phallusia Stolidobranchia Pyuridae Halocynthia Anas Anseriformes Anatidae Cygnus Branta Aves Apodiformes Trochilidae Archilochus Scolopacidae Arenaria Charadriiformes Synthliboramphu Alcidae s Contd.... 389

Egretta Ardeidae Ardea Threskiornithid Ciconiiformes Nipponia ae Phoenicopterid Phoenicopterus ae Dinornithiformes Emeidae Anomalopteryx Falco Falconidae Falconiformes Micrastur Pandionidae Pandion Arborophila Coturnix Lophura Syrmaticus Phasianidae Gallus Galliformes Syrmaticus Syrmaticus Phasianus Syrmaticus

Meleagrididae Meleagris Numididae Numida Gaviiformes Gaviidae Gavia Rhynochetidae Rhynochetos Gruiformes Rallidae Porphyrio Acrocephalus Sylviidae Sylvia Passeriformes Sylvia Estrildidae Taeniopygia Pelecaniformes Phaethontidae Phaethon Picidae Dryocopus Piciformes Ramphastidae Pteroglossus Podicipediformes Podicipedidae Tachybaptus Diomedeidae Diomedea Procellariformes Procellariidae Pterodroma Psittaciformes Psittacidae Melopsittacus Struthioniformes Rheidae Rhea Cephalaspido Petromyzontiform Petromyzontid Petromyzon morphi es ae Branchiostoma Branchiostomi Branchiostoma dae Branchiostoma Cephalochorda Amphioxiformes Assymetron ta Epigonichthyid Epigonichthys ae Asymmetron Epigonichthys

390

Contd.... Rajiformes Rajidae Okamejei Elasmobranchi Carcharhiniforme i Scyliorhinidae Scyliorhinus s Bubalus Bos Bos Capra Bovidae Naemorhedus Pantholops Capricornis Antilope Tayassuidae Pecari Camelus Camelus Camelidae Camelus Artiodactyla Lama Cervus nippon Cervus nippon Cervus Cervidae Muntiacus Mammalia Cervus Rangifer Sus scrofa Phacochoerus Suidae Sus Sus Giraffidae Giraffa Canis Canis Canidae Canis Canis Otariidae Arctocephalus Carnivora Phocidae Phoca Neofelis Panthera Felidae Uncia Panthera Felis Contd....

391

Ailuropoda Helarctos Melursus Ursidae Ursus

Tremarctos Ursus Ursus Balaenoptera Balaenoptera Balaenopterida Balaenoptera e Balaenoptera Balaenoptera Cetacea Iniidae Lipotes Eubalaena Balaenidae Eubalaena Tursiops Delphinidae Stenella Sousa Vespertilionida Pipistrellus e Chiroptera Rhinolophidae Rhinolophus Pteropodidae Pteropus Cingulata Dasypodidae Dasypus Myrmecobiida Myrmecobius e Dasyurus Dasyuromorphia Dasyuridae Sminthopsis Thylacinidae Thylacinus Didelphis Didelphimorphia Didelphidae Thylamys Monodelphis Acrobatidae Distoechurus Lagorchestes Macropodidae Lagostrophus Macropus Diprotodontia Petaurus Petauridae Dactylopsila Phalangeridae Phalanger Phascolarctida Phascolarctos e Erinaceomorpha Erinaceidae Erinaceus Lagomorpha Leporidae Oryctolagus Ornithorhynchi Ornithorhynchus Monotremata dae Tachyglossidae Tachyglossus

392

Contd....

Caenolestes Paucituberculata Caenolestidae Rhyncholestes Peramelemorphia Peramelidae Echymipera Equus Equidae Equus Perissodactyla Ceratotherium Rhinocerotidae Rhinoceros Colobus Chlorocebus Chlorocebus Nasalis Cercopithecida Semnopithecus e Presbytis Pygathrix Procolobus Primates Pygathrix Trachypithecus Hylobatidae Hylobates Pan Pongo Hominidae Pongo Homo Homo Elephas Proboscidea Elephantidae Loxodonta Mammuthus Anomaluridae Anomalurus Microtus Cricetidae Cricetulus Microtus Spalacidae Nannospalax Rodentia Myoxidae Myoxus Rattus Rattus Muridae Mus Mus Rattus Crocidura Soricidae Soricomorpha Sorex Talpidae Urotrichus Contd....

393

Alligator Paleosuchus Crocodilia Crocodylidae Paleosuchus Caiman Mecistops Coleonyx Heteronotia Gekkota Gekkonidae Gekko Gekko Teratoscincus Acrochordidae Acrochordus Agkistrodon Viperidae Ovophis Deinagkistrodon Amphisbaena Amphisbaenid Geocalamus ae Rhineura Chlamydosaurus Calotes Agamidae Pogona Xenagama Reptilia Bipes Bipedidae Bipes Bipes Boidae Boa Trogonophidae Diplometopon Squamata Dinodon Colubridae Enhydris Iquania Chamaeleo Elapidae Naja Takydromus Lacertidae Lacerta Scincidae Eumeces Chamaeleonida Kinyongia e Furcifer Xenopeltidae Xenopeltis Typhlopidae Ramphotyphlops Shinisauridae Shinisaurus Xantusiidae lepidophyma Colubridae Pantherophis Pythonidae Python Varanidae Varanus Contd....

394

Trionychidae Dogania Cheloniidae Chelonia Cuora Geoemydidae Cuora Chelydridae Platysternon Bataguridae Mauremys Psammobates Testudines Indotestudo Manouria Testudo Testudinidae Testudo Testudo Malacochersus Testudo Coelacanthiforme Latimeria Coelacanthidae s Latimeria Ceratodontiforme Ceratodontiida Sarcopterygii Neoceratodus s e Lepidosireniforme Lepidosirenida Lepidosiren s e Thaliacea Doliolida Doliolidae Doliolum

Contd....

395

Base pair length and Colour code 270bp 493bp 633bp 648bp 651bp 654bp 657bp 660bp 662bp 666bp 669bp 675bp

Phylum Class Order Family Genus Acropora Acroporidae Anacropora Montipora Montastraea Scleractinia Faviidae Montastraea Anthozoa Cnidaria Pocillopora Pocilloporidae Pocillopora Seriatopora Antipatharia Cladopathidae Chrysopathes Gorgonacea Isididae Keratoisidinae Scyphozoa Semaeostomeae Ulmaridae Aurelia

Contd....

396

Base pair length and Colour code 270bp 493bp 633bp 648bp 651bp 654bp 657bp 660bp 662bp 666bp 669bp 675bp

Phylum Class Order Family Genus Forcipulatid Asteriidae Pisaster a Asterinidae Patiria Valvatida Acanthaster Acanthasteridae Asteroidea Acanthaster Luidiidae Luidia Paxillosida Astropectinidae Astropecten Forcipulatid Asteriidae Asterias a Strongylocentrot Echinoderma us ta Strongylocentrotid Strongylocentrot Echinoida Echinoidea ae us Strongylocentrot us Arbacioida Arbaciidae Arbacia Cyrtocrinid Hemicrinidae Gymnocrinus a Crinoidea Comasteridae Phanogenia Comatulida Antedonidae Antedon Ophiuroide Ophiuridae Ophiura Ophiurida a Ophiactidae Ophiopholis

Contd....

397

Base pair length and Colour code 270bp 493bp 633bp 648bp 651bp 654bp 657bp 660bp 662bp 666bp 669bp 675bp

Phylum Class Order Family Genus Clausiliidae Albinaria Pulmonata Planorbidae Biomphalaria Aplysiidae Aplysia Polyceridae Roboastra Opisthobranchia Acteonidae Pupa Placobranchidae Elysia Patellogastropoda Lottiidae Lottia Gastropoda Conidae Conus Neogastropoda Turridae Lophiotoma Sorbeoconcha Nassariidae Ilyanassa Vetigastropoda Haliotididae Haliotis Archaeogastropod Mollusc a a Stylommatophora Vampyroteuthida Vampyroteuthi Vampyromorpha e s Sepiidae Sepia Sepioteuthis Loliginidae Decapodiformes Loligo Cephalopod Sepiidae Sepia a Enoploteuthidae Watasenia Octopus Octopoda Octopodidae Octopus Nautilida Nautilidae Nautilus Teuthida Ommastrephidae Todarodes Contd....

398

Mytilus Mytiloida Mytilidae Mytilus Mytilus Crassostrea Ostreidae Crassostrea Ostreoida Placopecten Pectinidae Mizuhopecten Argopecten Bivalvia Hiatellidae Hiatella Euheterodontaincertae sedis Cardiidae Acanthocardia Solemyoida

Nuculoida Eulamellobrachia Unionoida Myoida Veneroida Pholadomyoida

Scaphopoda

Aplacophora

Contd....

399

Base pair length and Colour code 270bp 493bp 633bp 648bp 651bp 654bp 657bp 660bp 662bp 666bp 669bp 675bp

Phylum Class Order Family Genus Toxocara Toxocaridae Toxocara Ascaridida Secernentea Toxocara Anisakidae Anisakis Spirurida Onchocercidae Dirofilaria Nematoda Agamermis Enoplea Mermithida Mermithidae Thaumamermis Steinernematidae Steinernema Secernentea Rhabditida Rhabditidae Caenorhabditis Haemonchidae Haemonchus Contd....

400

Base pair length and Colour code 270bp 493bp 633bp 648bp 651bp 654bp 657bp 660bp 662bp 666bp 669bp 675bp

Phylum Class Order Family Genus Diphyllobothriu Pseudophyllid Diphyllobothriid m ea ae Diphyllobothriu m Cestoda Echinococcus Cyclophyllide Echinococcus Taeniidae a Echinococcus Platyhelmenth Echinococcus is Monogene Gyrodactylida Gyrodactylus Gyrodactylus a e Gyrodactylus Trichobilharzia Trematod Schistosomatida Strigeidida Schistosoma a e Schistosoma Turbellari a Contd....

401

Base pair length and Colour code 270bp 493bp 633bp 648bp 651bp 654bp 657bp 660bp 662bp 666bp 669bp 675bp

Phylum Class Order Family Genus Petrosiidae Xestospongia Niphatidae Amphimedon Haplosclerida Callyspongiidae Callyspongia Haliconidae Haliclona Astrophorida Geodiidae Geodia Dictyoceratida Spongiidae Hippospongia Azinellidae Axinella Halichondrida Halichondriidae Topsentia Demospongiae Porifera Verongida Aplysinidae Aplysina Latruncullidae Negombata Tethyidae Tethya Hadromerida Suberitidae Suberites Chondrillidae Chondrillia Poecilosclerida Iotrochotidae Iotrochota Halisarcidae Halisarca Dendroceratida Dictyodendrillidae Igernella Hexactinellida Lyssacinosida Rossellidae Aphrocallistes

402

Table 6 Forward primer F1 vs Folmer LCO 1490. Highlighted rows have been picked up by the new designed primer only.

Base Pair Base pair Template Taxonomy Template Sequence position position Sequence H No of No of C matching matching Genban LC O T Kin Cl F1 = TA TCA ACA HC T Forwar k F Phy Orde Famil Rever bases for O Rever bases for LCO Species 2 ot gdo as AAC CAT AAA O2 ot d LCO Accessi 1 lum r y se F1 149 se 1490 1 al m s GAT ATC GG 198 al 1490 on 0 9 8 1 5 7 Met Arth In Hym ...... 7 TA...... Phaneroto GU0976 2 Braco 129 1 8 0 azo ropo se enopt ...... T...... T...... 23/25 589 0 ...... 22/25 ma flava 54.1 9 nidae 7 9 9 a da cta era ...... 9 ...... 7 7 7 Met Arth In Hym ...... 7 AT...... Hyles AJ7494 1 Sphin 2 2 0 azo ropo se enopt AN..C...... T...... 21/25 14 722 0 C...... 23/25

annei 30.1 4 gidae 2 9 a da cta era ...... 9 ...... 7 7 Met Arth In Hym ...... 7 AN..C...... Hyles AJ7494 1 Sphin 3 2 0 azo ropo se enopt AT...... T...... 22/25 14 722 0 ..C...... 21/25

annei 29.1 4 gidae 2 9 a da cta era ...... 9 ...... Amblyjopp 7 7 Met Arth In Hym Ichne ...... 7 ...... EU5416 ...... 4 a spp. 1 0 0 azo ropo se enopt umoni GG...... T...... T...... 21/25 1 709 0 ...... 25/25

65.1 ......

JKC-2008 9 9 a da cta era dae ...... 9 ...... 1 2 7 Met Arth In Kerop ...... 7 TT..T...... Arachnoca JN8617 6 3 Dipte 163 234 5 0 azo ropo se latida .T..T...... T...... 22/25 0 .C...... 21/25

mpa flava 48.1 9 4 ra 9 7

9 a da cta e ...... 9 ...... 3 7 1 8 7 Met Arth In Droso ...... 7 ...... Drosophila EU4936 Dipte TT...... 6 0 0 0 azo ropo se philid .T...... T...... T...... 22/25 100 808 0 ...... 23/25 haleakalae 56.1 ra ...... 0 8 9 a da cta ae ...... 9 ...... Sabethes AF4258 5 7 7 Met Arth In Dipte Culici ...... 7 TT..T..T ...... 7 .T..T..T..T...... T.. 20/25 50 758 21/25

cyaneus 40.1 0 5 0 azo ropo se ra dae ...... 0 ......

403

8 9 a da cta ...... 9 ...... 7 7 Met Arth In ...... 7 ...... Aedes JF43039 Dipte Culici ...... 8 1 0 0 azo ropo se GG...... T...... T...... 21/25 1 709 0 ...... 25/25

koreicus 3.1 ra dae ...... 9 9 a da cta ...... 9 ...... 7 7 Met Arth In Cecid ...... 7 ...... Mayetiola JN6382 Dipte ...... 9 1 1 1 azo ropo se omyii GG...... T...... T...... 21/25 1 712 1 ...... 25/25

hordei 48.1 ra ......

2 2 a da cta dae ...... 2 ...... 7 7 Met Arth In Callip ...... 7 TC.....T...... 1 Cynomya FR7191 3 Dipte 4 0 azo ropo se horida .C.....T..T...... T...... 21/25 39 747 0 ...... 22/25

0 mortuorum 59.1 9 ra

7 9 a da cta e ...... 9 ...... 7 7 Met Arth In Callip ...... 7 TT.....T...... 1 Lucilia DQ4534 2 Dipte 3 0 azo ropo se horida .T.....T..T...... T...... 21/25 23 731 0 ...... 22/25

1 mexicana 92.1 3 ra

1 9 a da cta e ...... 9 ...... 7 7 Met Arth In ...... 7 TT.....T...... 1 Ceratitis AY7884 2 Dipte Tephr 3 0 azo ropo se .T.....T..T...... T...... 21/25 17 725 0 ...... 22/25

2 divaricata 25.1 3 ra itidae 1 9 a da cta ...... 9 ......

404

Base Pair Base pair Template Taxonomy Template Sequence position position Sequence H No of No of C matching matching Genba LC O T Kin F1 = TA TCA ACA HC T Forwar nk F Phy Clas Ord Fami Rever bases for O Rever bases for LCO Species 2 ot gdo AAC CAT AAA O2 ot d LCO Accessi 1 lum s er ly se F1 149 se 1490 1 al m GAT ATC GG 198 al 1490 on 0 9 8 7 7 Met Arth Sarco ...... 7 TC..T...... 1 Sarcophaga JQ5820 1 Insec Dipt 2 0 azo ropo phagi .C..T..T..T...... T...... 20/25 17 725 0 T...... 21/25

3 argyrostoma 86.1 7 ta era 5 9 a da dae ...... 9 ...... 1 1 Limnichidae 7 Met Arth Cole Limn ...... 7 TT..G...... 1 JQ0344 2 9 Insec 129 199 sp. MJTNT- 0 azo ropo opter ichid .T..G...... G.....T...... 21/25 0 ..C.....G...... 20/25

4 16.1 9 9 ta 2 9 2012 8 a da a ae ...... 8 ...... 2 9 7 7 Met Arth Cole Scara ...... 7 ...... 1 Costelytra JN7934 Insec ...... 1 0 0 azo ropo opter baeid GG...... T...... T...... 21/25 1 709 0 ...... 25/25

5 zealandica 87.1 ta ......

9 9 a da a ae ...... 9 ...... 7 7 Met Arth Cole Chrys ...... 7 TC..T...... 1 Mimosestes AB499 2 Insec 3 0 azo ropo opter omeli .C..T..C...... T...... 21/25 23 731 0 C..C...... 20/25

6 humeralis 955.1 3 ta 1 9 a da a dae ...... 9 ...... 7 7 Met Arth Cole Curc ...... 7 ...... 1 Sitophilus GU196 Insec ...... 1 0 0 azo ropo opter ulioni GG...... T...... T...... 21/25 1 708 0 ...... 25/25

7 oryzae 318.1 ta ...... 8 8 a da a dae ...... 8 ...... Henosepilac 7 7 Met Arth Cole Cocci ...... 7 TT..T...... 1 AB002 Insec hna 2 1 0 azo ropo opter nellid .T..T...... G.....T...... 21/25 2 710 1 .C.....G...... 20/25

8 213.1 ta pustulosa 0 9 a da a ae ...... 0 ...... Taeniothrips 7 7 Met Arth Thys ...... 7 ...... 1 HM246 Insec thripi ...... major 1 0 0 azo ropo anop GG...... T...... T...... 21/25 1 706 0 ...... 25/25

9 177.1 ta dae ...... isolate 6 6 a da tera ...... 6 ...... 2 Aleurodicus EU5818 7 7 Met Arth Insec Hem Aleyr ...... 7 ...... 1 GG...... T...... T.. 21/25 1 709 25/25

0 dispersus 38.1 0 0 azo ropo ta ipter odida ...... 0 ......

405

9 9 a da a e ...... 9 ...... 7 7 Met Arth Hem ...... 7 TT..T...... 2 Platypleura FJ1691 1 Insec Cicad 2 0 azo ropo ipter .T..T.....T..C...... T...... 20/25 17 725 0 ....C...... 21/25

1 plumosa 78.1 7 ta inae 5 9 a da a ...... 9 ...... 7 7 Met Arth Lepi Nym ...... 7 TT..T...... 2 Altinote EU2755 Insec 9 1 0 azo ropo dopt phali .T..T..T..T...... T...... 20/25 9 717 0 T...... 21/25

2 tenebrosa 65.1 ta

7 9 a da era dae ...... 9 ...... 7 7 Met Arth Lepi Papili ...... 7 AT...... 2 Parides AY804 1 Insec 2 0 azo ropo dopt onida AT...... T...... T...... 21/25 14 722 0 ...... 23/25

3 vertumnus 383.1 4 ta 2 9 a da era e ...... 9 ...... Cyamus 7 7 Met Arth Mala Amp ...... 2 ovalis DQ095 2 Cyam 2 0 azo ropo costr hipo ....C..G.....C...... 22/25 ...... 0/25

4 isolate 047.1 0 idae 8 9 a da aca da ...... osSA5b01 7 7 Met Arth Mala Camb ...... 7 TT..T...... 2 Cambaroide JN9911 1 Deca 2 0 azo ropo costr arida .T..T.....T...... T...... 21/25 17 725 0 ...... 22/25

5 s similis 96.1 7 poda 5 9 a da aca e ...... 9 ...... Portunus 7 7 Met Arth Mala ...... 7 ...... 2 EU2841 Deca Portu ...... sanguinolent 1 0 0 azo ropo costr GG...... T...... T...... 21/25 1 709 0 ...... 25/25 6 44.1 poda nidae ...... us 9 9 a da aca ...... 9 ...... 7 7 Met Arth Mala ...... 7 ...... 2 Hemigrapsu EU2841 Deca Varu ...... 1 0 0 azo ropo costr GG...... T...... T...... 21/25 1 709 0 ...... 25/25 7 s sinensis 39.1 poda nidae ...... 9 9 a da aca ...... 9 ...... 7 7 Met Arth Mala Paras ...... 7 ...... 2 Engaeus EU9211 Deca ...... 1 0 0 azo ropo costr tacida GG...... T...... T...... 21/25 1 709 0 ...... 25/25 8 fossor 44.1 poda ...... 9 9 a da aca e ...... 9 ...... Fenneropen 7 7 Met Arth Mala ...... 7 ...... 2 AY789 Deca Penae ...... aeus 1 0 0 azo ropo costr GG...... T...... T...... 21/25 1 709 0 ...... 25/25 9 233.1 poda idae ...... penicillatus 9 9 a da aca ...... 9 ......

406

Base Pair Base pair Template Taxonomy Template Sequence position position Sequence H No of No of C matching matching Genba Ki LC O T F1 = TA TCA ACA HC T Forwar nk F ng Phy Famil Rever bases for O Rever bases for LCO Species 2 ot Class Order AAC CAT AAA O2 ot d LCO Accessi 1 do lum y se F1 149 se 1490 1 al GAT ATC GG 198 al 1490 on m 0 9 8 7 7 Me Arth Mala ...... 7 ...... 3 Cydia JF7077 Lepid Tortri ...... 1 0 0 taz ropo costr GG...... T...... T...... 21/25 1 709 0 ...... 25/25

0 pomonella 73.1 optera cidae ...... 9 9 oa da aca ...... 9 ...... 7 7 Me Arth Mala Nymp ...... 7 TT..T...... 3 Ideopsis GU365 Lepid 1 0 0 taz ropo costr halida .T..T.....T...... T...... 21/25 27 735 0 ...... 22/25

1 gaura 916.1 optera 9 9 oa da aca e ...... 9 ...... 7 7 Me Arth Cheyl ...... 7 ...... 3 Cheyletus HQ404 Arac Actine ...... 1 0 0 taz ropo etoide GG...... T...... T...... 21/25 1 709 0 ...... 25/25

2 carnifex 359.1 hnida dida ...... 9 9 oa da a ...... 9 ...... Cybaeus 7 7 Me Arth ...... 7 ...... 3 FJ2637 Arac Arane Cyba ...... chauliodou 1 0 0 taz ropo GG...... T...... T...... 21/25 1 709 0 ...... 25/25

3 99.1 hnida ae eidae ...... s 9 9 oa da ...... 9 ...... 7 7 Me Arth Cerat ...... 7 ...... 3 Ceratozete EF9897 Arac Oribat ...... 1 0 0 taz ropo ozetid GG...... T...... T...... 21/25 1 709 0 ...... 25/25

4 s pacificus 23.1 hnida ida ...... 9 9 oa da ae ...... 9 ...... Hyalomma 7 7 Me Arth ...... 7 AT...... 3 EU8277 4 Arac Ixodid Ixodi lusitanicu 5 0 taz ropo AT...... T...... C..T...... 20/25 47 755 0 ...... C...... 22/25

5 31.1 7 hnida a dae m 5 9 oa da ...... 9 ...... Raoiella 7 7 Me Arth Trom Tenui ...... 7 -- ...... 3 spp. 3 JF9284 Arac 1 0 0 taz ropo bidifo palpid .--...... T...... T...... 21/25 7 706 0 ...... 23/25

6 APGD- 27.1 hnida 6 5 oa da rmes ae ...... 9 ...... 2011 3 Moina HM236 7 7 Me Arth Bran Diplos Moini ...... 7 ...... 1 GG...... T...... T.. 21/25 7 709 25/25

7 macrocopa 481.1 0 0 taz ropo chiop traca dae ...... 0 ......

407

9 9 oa da oda ...... 9 ...... 1 2 Triops 7 Me Arth Bran ...... 7 AC...... 3 AY639 3 1 Notost Triop 139 210 longicauda 0 taz ropo chiop AC...... T...... T...... 21/25 0 ...... 23/25

8 934.1 9 0 raca sidae 6 4 tus 9 oa da oda ...... 9 ...... 6 4 7 7 Me Arth Maxi Pyrgo ...... 7 .- ...... 3 Megatrem FJ7131 Sessili 1 0 0 taz ropo llopo matid G-...... T...... T...... 21/25 1 708 0 ...... 24/25

9 a anglicum 01.1 a 9 9 oa da da ae ...... 8 ...... 7 7 Me Arth Maxi ...... 7 ...... 4 Calanus AY665 Calan Calan ...... 1 0 0 taz ropo llopo GG...... T...... T...... 21/25 1 709 0 ...... 25/25

0 sinicus 663.1 oida idae ...... 9 9 oa da da ...... 9 ...... 4 5 7 Me Cho Pleth ...... 7 TT...... 4 Hydroman AY728 9 6 Amp Cauda 498 596 0 taz rdat odont .T...... T...... 23/25 0 C...... 23/25

1 tes italicus 215.1 8 9 hibia ta 3 1 9 oa a idae ...... 9 ...... 3 1 4 5 7 Me Cho Pleth ...... 7 TC...... 4 Karsenia JF4493 7 4 Amp Cauda 477 548 0 taz rdat odont .C...... C...... T...... 22/25 0 C..C...... 21/25

2 koreana 67.1 7 8 hibia ta 9 7 9 oa a idae ...... 9 ...... 9 7 5 6 Ichthyophi 7 Me Cho Gymn Ichth ...... 4 AY456 3 0 Amp s 0 taz rdat ophio yophi .T...... C.....C...... 22/25 ...... 0/25 3 251.1 0 1 hibia glutinosus 9 oa a na idae ...... 6 4 7 7 Me Cho Actin Scorp Platyc ...... 7 ...... 4 Platycepha HM180 ...... 3 1 0 taz rdat opter aenifo ephali GG...... T...... T...... 21/25 3 711 0 ...... 25/25 4 lus indicus 794.1 ...... 1 9 oa a ygii rmes dae ...... 9 ...... 7 7 Me Cho Actin Loric ...... 7 ...... 4 Kronichthy EU3710 Silurif ...... 1 0 0 taz rdat opter ariida GG...... T...... T...... 21/25 1 709 0 ...... 25/25 5 s subteres 21.1 ormes ...... 9 9 oa a ygii e ...... 9 ...... 5 6 7 Me Cho Actin Elass ...... 4 Elassoma AP0029 4 1 Percif 0 taz rdat opter omati .C..G..T..T...... C...... 20/25 ...... 0/25 6 evergladei 50.1 4 5 ormes 9 oa a ygii dae ...... 8 6

408

Base Pair Base pair Template Taxonomy Template Sequence position position Sequence H No of No of C T matching T matching Genb Ki LC O o Ph F1 = TA TCA ACA HC o Forwar ank F ng Cla Fami Rever bases for O Rever bases for LCO Species 2 t ylu Order AAC CAT AAA O2 t d LCO Acces 1 do ss ly se F1 149 se 1490 1 a m GAT ATC GG 198 a 1490 sion m 0 9 l l 8 EU17 7 7 Me Ch Asci Stolid ...... 7 ...... 4 Halocynthia Pyuri ...... 8861. 1 0 0 taz ord diac obran GG...... T...... T...... 21/25 1 709 0 ...... 25/25

7 pyriformis dae ......

1 9 9 oa ata ea chia .... 9 .... 5 6 FN66 7 Me Ch Ma Dasyu Dasy ...... 4 Sarcophilus 4 1 6604. 0 taz ord mm romor urida .C..T..T..T...... C...... 20/25 ...... 0/25 8 harrisii 1 1

1 9 oa ata alia phia e ...... 0 8 Heteromys EF15 7 7 Me Ch Ma Heter ...... 4 2 Roden .C..G..T..T..C...... anomalus TCWC 6848. 3 0 taz ord mm omyi ...... 20/25 ...... 0/25 9 3 tia .

39720 1 1 9 oa ata alia dae ...... 5 6 7 Me Ch Ma ...... 7 TC..T...... 5 JN214 9 6 Primat Homi 592 663 Homo sapiens 0 taz ord mm .C..T...... C.....C..T...... G.. 20/25 0 ..C..C...... G.. 20/25

0 475.1 2 3 es nidae 7 5 9 oa ata alia ...... 9 ...... 7 5 7 7 Me Mo Gast Sorbe ...... 7 ...... 5 JF496 Coni Conus memiae 1 0 0 taz llu ropo oconc GG...... T...... 22/25 1 709 0 ...... C...... 24/25

1 236.1 dae 9 9 oa sca da ha .... 9 . .... 7 7 Me Mo Gast Sorbe ...... 7 ...... 5 Clavus JF823 Drilli 1 0 0 taz llu ropo oconc GG...... T...... 22/25 1 709 0 ...... C...... 24/25

2 canalicularis 616.1 idae 9 9 oa sca da ha .... 9 . .... GU29 7 7 Me Mo Gast Sorbe ...... 7 ...... 5 Lophiotoma spp. Turri 9989. 1 0 0 taz llu ropo oconc GG...... T...... 22/25 1 709 0 ...... C...... 24/25 3 1 MW-2010 dae

1 9 9 oa sca da ha .... 9 . .... 5 Scolodonta spp. JF414 1 7 7 Me Mo Gast - Scolo GG...... T...... T...... 21/25 1 706 7 ...... 25/25

409

4 1 RR-201 816.1 0 0 taz llu ropo donti ...... 0 ......

6 6 oa sca da dae .... 6 .... HQ17 7 7 Me Mo Gast Eupul ...... 7 .- ...... 5 Carychium Ellob 1570. 1 0 0 taz llu ropo monat G-...... T...... T...... 21/25 1 705 0 ...... 24/25

5 tridentatum iidae

1 6 6 oa sca da a .... 5 ...... EU12 7 7 Me Mo Gast Neoga Nass ...... 7 ...... 5 Zeuxis ...... 4793. 1 0 0 taz llu ropo stropo ariida GG...... T...... T...... 21/25 1 709 0 ...... 25/25 6 siquijorensis ......

1 9 9 oa sca da da e .... 9 .... 7 7 Me Mo Biv ...... 7 ...... 5 JN898 Vener Vene ...... Cyclina sinensis 1 0 0 taz llu alvi .--...... T...... T...... 21/25 1 709 0 ...... 25/25

7 952.1 oida ridae ...... 7 9 oa sca a .... 9 .... AB47 7 7 Me Mo Biv Vesic ...... 7 ...... 5 Calyptogena Vener ...... 9089. 1 1 1 taz llu alvi omyi GG...... T...... T...... 21/25 1 712 1 ...... 25/25 8 kawamurai oida ......

1 2 2 oa sca a dae .... 2 .... GU39 7 7 Me Mo Biv Neoga Bucc ...... 7 ...... 5 Antillophos spp...... 3391. 1 0 0 taz llu alvi stropo inida GG...... T...... T...... 21/25 1 709 0 ...... 25/25 9 HL-2010a ......

1 9 9 oa sca a da e .... 9 .... Nassarius GU39 7 7 Me Mo Biv Neoga Nass ...... 7 ...... 6 ...... (Zeuxis) spp. 3390. 1 0 0 taz llu alvi stropo ariida GG...... T...... T...... 21/25 1 709 0 ...... 25/25 0 ...... HL-2010a 1 9 9 oa sca a da e .... 9 .... GQ43 7 7 Me Mo Biv Vetiga ...... 7 ...... 6 Osilinus Troc ...... 4019. 1 0 0 taz llu alvi stropo GG...... T...... T...... 21/25 2 710 0 ...... 25/25 1 turbinatus hidae ...... 1 9 9 oa sca a da .... 9 .... GU23 7 7 Me Mo Biv ...... 7 ...... 6 Union Unio ...... Unio tumidus 0750. 1 0 0 taz llu alvi GG...... T...... T...... 21/25 2 710 0 ...... 25/25 2 ida nidae ...... 1 9 9 oa sca a .... 9 .... DQ43 7 7 Me Mo Biv ...... 7 ...... 6 Scapharca Arcoi Arcid GG...T....T...... T...... 5140. 1 0 0 taz llu alvi ...... 20/25 1 703 0 ...... 25/25 3 broughtonii da ae ...... 1 3 3 oa sca a .... 3 ....

410

Base Pair Base pair Template Taxonomy Template Sequence position position Sequence H No of No of C matching matching Genba Ki LC O T F1 = TA TCA ACA HC T Forwar nk F ng Phyl Fami Rever bases for O Rever bases for Species 2 ot Class Order AAC CAT AAA O2 ot d LCO Accessi 1 do um ly se F1 149 se LCO 1490 1 al GAT ATC GG 198 al 1490 on m 0 9 8 7 7 Me ...... 7 ...... 6 Scapharca DQ435 Moll Bival Arcoid Arcid ...... 1 0 0 taz GG.G...... T...... T...... 20/25 1 703 0 ...... 25/25

4 broughtonii 135.1 usca via a ae ...... 3 3 oa ...... 3 ...... 7 7 Me ...... 7 ...... 6 Scapharca DQ435 Moll Bival Arcoid Arcid ...... 1 0 0 taz GC...... TA...... T...... 20/25 1 703 0 ...... 25/25

5 broughtonii 135.1 usca via a ae ...... 3 3 oa ...... 3 ...... 7 7 Me ...... 7 ...... 6 Scapharca DQ435 Moll Bival Arcoid Arcid ...... 1 0 0 taz GG...T....T...... T...... 20/25 1 703 0 ...... 25/25

6 broughtonii 135.1 usca via a ae ...... 3 3 oa ...... 3 ...... 7 7 Me Gast Macro Turb ...... 7 ...... 6 Turbanella JN0999 ...... 1 3 3 taz rotri - dasyid anelli GG...... T...... T...... 21/25 1 736 3 ...... 25/25

7 cornuta 46.1 ...... 6 6 oa cha a dae ...... 6 ...... 7 7 Me Gast Macro Turb ...... 7 ...... 6 Turbanella JN0999 ...... 1 3 3 taz rotri - dasyid anelli GG...... T...... T...... 21/25 1 733 3 ...... 25/25

8 hyalina 81.1 ...... 3 3 oa cha a dae ...... 3 ...... 7 7 Me Gast Macro Turb ...... 7 ...... 6 Turbanella JN0869 ...... 1 3 3 taz rotri - dasyid anelli GG...... T...... T...... 21/25 1 733 3 ...... 25/25

9 bocqueti 88.1 ...... 3 3 oa cha a dae ...... 3 ...... Turbanella 7 7 Me Gast Macro Turb ...... 7 ...... 7 JN0869 ...... ambronensi 1 2 2 taz rotri - dasyid anelli GG...... T...... T...... 21/25 1 727 2 ...... 25/25

0 85.1 ...... s 7 7 oa cha a dae ...... 7 ...... 7 7 Me Gast Macro Turb ...... 7 ...... 7 Turbanella JN0869 ...... 1 3 3 taz rotri - dasyid anelli GG...... T...... T...... 21/25 1 730 3 ...... 25/25

1 mustela 74.1 ...... 0 0 oa cha a dae ...... 0 ......

411

Dactylopod 7 7 Me Gast Macro Dact ...... 7 ...... 7 JN0036 ...... ola baltica 1 0 0 taz rotri - dasyid ylopo GG...... T...... T...... 21/25 1 706 0 ...... 25/25

2 39.1 ...... voucher 6 6 oa cha a dola ...... 6 ...... 7 7 Me Mon Brac ...... 7 ...... 7 Brachionus GU232 Roti Ploimi ...... 1 1 1 taz ogon hioni .--...... T...... 21/25 1 712 1 ...... 25/25

3 calyciflorus 730.1 fera da ...... 2 2 oa onta dae ...... 2 ...... 7 7 Me Dem Ianth ...... 7 ...... 7 Ianthella JF9155 1 Pori Veron ...... 1 0 taz ospo ellida GG...... T...... T...... 21/25 1 709 0 ...... 25/25

4 basta 43.1 1 fera gida ...... 9 9 oa ngiae e ...... 9 ...... 7 7 Me Dem ...... 7 ...... 7 Cliona HM999 Pori Hardro Clion ...... 1 1 0 taz ospo GG...... T...... T...... 21/25 2 710 0 ...... 25/25

5 celata 027.1 fera merida aidae ...... 0 9 oa ngiae ...... 9 ...... Leiobdella 7 7 Me Arhyn Hae ...... 7 ...... 7 HQ203 Ann Hirud ...... spp. EB- 1 1 0 taz chobd madi GG...... T...... T...... 21/25 2 710 0 ...... 25/25

6 192.1 elida inida ...... 2010 0 9 oa ellida sidae ...... 9 ......

412

Base Pair Base pair Template Taxonomy Template Sequence position position Sequence H No of No of C matching matching Genba Ki LC O T F1 = TA TCA ACA HC T Forwar nk F ng Phy Orde Fami Revers bases for O Revers bases for Species 2 ot Class AAC CAT AAA O2 ot d LCO Accessi 1 do lum r ly e F1 149 e LCO 1490 1 al GAT ATC GG 198 al 1490 on m 0 9 8 7 7 Me An Phyllo ...... 7 ...... 7 Hediste AB603 Polyc Nerei ...... 1 0 0 taz neli docid GG...... T...... T...... 21/25 1 709 0 ...... 25/25

7 atoka 887.1 haeta didae ...... 9 9 oa da a .. 9 .. 7 7 Me An Lumb ...... 7 ...... 7 Lumbriner EU352 Polyc Eunici ...... 1 0 0 taz neli rineri GG...... T...... T...... 21/25 1 709 0 ...... 25/25

8 is tetraura 318.1 haeta da ......

9 9 oa da dae .. 9 .. Diopatra 7 7 Me An ...... 7 ...... 7 GQ456 Polyc Eunici Onup ...... marocensi 1 0 0 taz neli GG...... T...... T...... 21/25 1 709 0 ...... 25/25

9 165.1 haeta da hidae ...... s 9 9 oa da .. 9 .. Amp 7 7 Me An ...... 7 ...... 8 Chloeia EU352 Polyc Eunici hino ...... 1 0 0 taz neli GG...... T...... T...... 21/25 1 700 0 ...... 25/25

0 parva 320.1 haeta da mida ...... 0 0 oa da .. 0 .. e 7 7 Me An ...... 7 ...... 8 Marphysa EU352 Polyc Eunici Eunic ...... 1 0 0 taz neli GG...... T...... T...... 21/25 1 709 0 ...... 25/25

1 sanguinea 317.1 haeta da idae ...... 9 9 oa da .. 9 .. 7 7 Me An Alvin ...... 7 ...... 8 Paralvinel DQ209 Polyc Tereb ...... 1 1 0 taz neli ellida GG...... T...... T...... 21/25 2 710 0 ...... 25/25

2 la grassle 259.1 haeta ellida ......

0 9 oa da e .. 9 .. Mesochaet 7 7 Me An Chaet ...... 7 ...... 8 DQ209 Polyc Spioni ...... opterus 1 1 0 taz neli opteri GG...... T...... T...... 21/25 2 710 0 ...... 25/25

3 251.1 haeta da ......

taylor 0 9 oa da dae .. 9 .. 8 Sabella AY436 7 7 Me An Polyc Sabell Sabel ...... 7 ...... 1 GG...... T...... T.. 21/25 1 709 25/25

4 spp.allanz 349.1 0 0 taz neli haeta ida lidae ...... 0 ......

413

anii 9 9 oa da .. 9 .. Echiniscus 7 7 Me Tar Heter Echini Echin ...... 7 ...... 8 FJ6169 ...... spp. ARD- 4 1 0 taz digr otardi scoide iscida GG...... T...... T...... 21/25 4 712 0 ...... 25/25

5 93.1 ...... 2009 2 9 oa ada grada a e .. 9 .. Macrobiot 7 7 Me Tar Heter Macr ...... 7 ...... 8 EU244 Parac ...... idae spp. 1 0 0 taz digr otardi obioti GG...... T...... T...... 21/25 1 709 0 ...... 25/25

6 611.1 hela ...... RS-2008 9 9 oa ada grada dae .. 9 .. 3 3 7 Me Tar Heter Arthr Batill ...... 7 TT..T...... 8 Batillipes DQ099 1 8 310 381 0 taz digr otardi otardi ipedi .T..T...... C...... T...... 21/25 0 ..C..C...... 20/25

7 pennaki 433.1 0 1 4 2 9 oa ada grada grada dae .. 9 ...... 4 2 7 7 Me Tar Eutar Macr ...... 7 ...... 8 Macrobiot EU244 Parac ...... 1 0 0 taz digr digrad obioti GG...... T...... T...... 21/25 1 710 1 ...... 25/25

8 us tonollii 609.1 hela ...... 9 9 oa ada a dae .. 0 .. Milnesium 7 7 Me Tar Eutar ...... 7 ...... 8 EU244 Apoc Milne ...... tardigradu 1 0 0 taz digr digrad GG...... T...... T...... 21/25 1 709 0 ...... 25/25

9 604.1 hela siidae ...... m 9 9 oa ada a .. 9 .. Craspp.ed 7 7 Me Cni ...... 7 ...... 9 FJ4236 Hydro Hydro Olind ...... acusta 2 1 0 taz dari GG...... T...... T...... 21/25 2 710 0 ...... 25/25 0 20.1 zoa ida iidae ...... sowerbyi 0 9 oa a .. 9 .. 1 1 4 5 7 Me Cni ...... 7 TT.....T ...... 9 Hydra EU237 Hydro Hydro Hydri 145 152 5 2 0 taz dari .T.....T..T...... A...... 21/25 0 ...... 21/25 1 oligactis 491.1 zoa ida dae 64 72 6 7 9 oa a .. 9 .A.. .. 4 2 7 7 Me Xeno ..T...... 7 AC...... T...... 9 AY619 1 Ech Urec AC...... C.....C..T. Urechis 2 0 taz - pneust ....C..... 20/25 14 722 0 .C..C...... C..... 20/25 2 711.1 4 iura hidae . 2 9 oa a G..... 9 .C..... G.....

414

Base Pair Base pair Template Taxonomy Template Sequence position position Sequence H No of No of C matching matching Genba Ki LC O T F1 = TA TCA ACA HC T Forwar nk F ng Phyl Ord Fami Reve bases for O Reve bases for Species 2 ot Class AAC CAT AAA O2 ot d LCO Accessi 1 do um er ly rse F1 149 rse LCO 1490 1 al GAT ATC GG 198 al 1490 on m 0 9 8 Invertebrate 7 7 ...... 9 GU070 environment 1 0 0 .T...... T...... T...... 22/25 ...... 0/25

3 929.1 al sample 9 9 ...... 7 7 Pro Amo Lobosa Thec ...... 7 ...... 9 Parvamoeba JN2024 ...... 1 1 1 toz ebozo incertae - amoe GG...... T...... T...... 21/25 1 715 1 ...... 25/25

4 rugata strain 35.1 ...... 5 5 oa a sedis bidae ...... 5 ...... 7 7 Me Hapl Lumb ...... 7 ...... 9 Eisenia spp. HQ224 Anne Clitellat ...... 1 0 0 taz otaxi ricida GG...... T...... T...... 21/25 1 709 0 ...... 25/25

5 FK-2010 516.1 lida a ...... 9 9 oa da e ...... 9 ...... 7 7 Chr Xant Vau Vauc ...... 7 ...... 9 Vaucheria EF6725 Xantho ...... 1 1 1 omi hoph cheri heria GG...... T...... T...... 21/25 1 715 1 ...... 25/25

6 litorea 15.1 phyceae ......

5 5 sta yceae ales ceae ...... 5 ......

415

Table 7 Forward primer F2 vs Folmer LCO 1490. Highlighted rows have been picked up by the new designed primer only.

Base Pair Base pair Template

location Taxonomy Template Sequence position Sequence

F2 = TA TCA ACT AAC

CAT AAA GAA ATC GG

No of matching Species Genbank Accession F2 LCO2198 Total Kingdom Phylum Class Order Family HCO 2198 No of matching bases for F2 LCO1490 HCO2198 Total Forward HCO2198 bases for LCO1490 Hylomys AM90 7 Met Cho Mam 23 53 604 Insectiv Erinac ...... T.... 1 suillus isolate 5042.1 0 azo rdat mali .C...... C..... /2 36 4 ora eida ......

T-0675 9 a a a 5 Hylomys 7 Met Cho Mam 22 7 21 AM90 53 609 Insectiv Erinac ...... G.... 53 60 TT.....T...... G.... 2 suillus isolate 0 azo rdat mali .T...... T...... T.... /2 0 /2

5041.1 86 4 ora eida ...... 86 94 ...... C...... T-1773 9 a a a 5 9 5 7 Met Cho Mam 21 Sarcophilus FN666 54 611 Dasyuro Dasyu ...... 0/ 3 0 azo rdat mali .C..T.....T...... C..... /2

harrisii 604.1 10 8 morphia ridae ...... 25 9 a a a 5 7 Met Cho Mam Thyla 22 Thylacinus FJ515 59 669 Dasyuro ..T.....C.. 0/ 4 0 azo rdat mali cinida .C..T...... C..... /2

cynocephalus 781.1 88 6 morphia ...... 25 9 a a a e 5 7 Met Cho Mam 22 JN632 53 606 Cetartio Cervi ..T...... 0/ 5 Rucervus eldi 0 azo rdat mali .T...... C.....C..... /2

697.1 55 3 dactyla dae ...... 25 9 a a a 5 7 Met Cho Mam 22 7 21 JN632 53 605 Certarti Cervi ..T...... 53 60 TT.....T...... T...... 6 Axis axis 0 azo rdat mali .T...... T...... T..... /2 0 /2

599.1 51 9 odactyla dae ...... 51 59 ...... C...... 9 a a a 5 9 5 7 Met Cho Mam 23 7 TT.....T.. 20 JN632 53 606 Certarti Cervi ..T...... 53 60 ..T...... 7 Rusa alfredi 0 azo rdat mali .T...... T..... /2 0 C...... C /2

698.1 58 6 odactyla dae ...... G..... 58 66 ...... G..... 9 a a a 5 9 .. 5 7 Met Cho Mam 22 7 TC.....T.. 20 Pseudoryx EF536 53 605 Certarti Bovid ...... 53 60 ...... 8 0 azo rdat mali .C...... C..T.. /2 0 C...... C... /2

nghetinhensis 352.1 43 1 odactyla ae T...... 43 51 T...... 9 a a a 5 9 .. 5 7 Met Cho Mam 23 7 TT.....T.. 20 JN632 53 605 Certarti Bovid ..T...... 53 60 ..T...... 9 Oryx leucoryx 0 azo rdat mali .T...... T..... /2 0 C...... C /2

679.1 44 2 odactyla ae ...... G..... 44 52 ...... G..... 9 a a a 5 9 .. 5 7 Met Cho Mam Didelph 22 7 21 1 Monodelphis AJ508 54 613 Didel ...... T.... 54 61 TC.....T...... T.... 0 azo rdat mali imorphi .C...... T..T.. /2 0 /2

0 domestica 398.1 28 6 phidae ...... 28 36 C......

9 a a a a 5 9 5 7 Met Cho Mam Didelph 22 1 Didelphis Z2957 54 612 Didel ...... T.... 0/ 0 azo rdat mali imorphi .T...... C.....C..... /2

1 virginiana 3.1 19 7 phidae ...... 25

9 a a a a 5 7 Met Cho Mam 22 7 21 1 Cebus AJ309 53 605 Primate Cebid ...... G.... 53 60 TT.....T...... G.... 0 azo rdat mali .T...... T..T.. /2 0 /2

2 albifrons 866.1 51 9 s ae ...... 51 59 C...... 9 a a a 5 9 5

416

Base Pair Base pair Template Taxonomy Template Sequence location position Sequence

F2 = TA TCA ACT AAC

CAT AAA GAA ATC GG

Species Genbank Accession F2 LCO2198 Total Kingdom Phylum Class Order Family HCO 2198 No of matching bases for F2 LCO1490 HCO2198 Total Forward HCO2198 No of matching bases for LCO1490 7 Met Cho 21 7 20 1 Cratogeomys AY50 Mamm Rode Geomy ...... T... 73 TT..T..T...... T... 23 731 0 azo rdat .T..T...... T..T.. /2 23 0 /2

3 tylorhinus 6564.1 alia ntia idae ...... 1 C...... 9 a a 5 9 5 EU10 7 Met Cho 20 7 23 1 Chaetodipus Mamm Rode Hetero ...... 73 TC...... 7500.1 23 731 0 azo rdat .C.....A..T...... T..T.. /2 23 0 /2

4 intermedius alia ntia myidae ...... G..... 1 ...... G.....

9 a a 5 9 5 7 Met Cho 22 7 TT.....G.. 20 1 JN867 Amphi Anur Bufoni ...... 72 ...... Bufo leucomyos 20 728 0 azo rdat .T.....G...... T..... /2 20 0 C...... C /2

5 973.1 bia a dae ...... G..... 8 ...... G..... 9 a a 5 9 .. 5 7 Met Cho 22 7 21 1 JN867 Amphi Anur Bufoni ...... 72 TT.....T...... Bufo fastidiosus 20 728 0 azo rdat .T...... T...... T..... /2 20 0 /2

6 968.1 bia a dae ...... G..... 8 ...... C...... G..... 9 a a 5 9 5 7 Met Cho 21 1 Bufo JN867 Amphi Anur Bufoni ...... 0/ 20 728 0 azo rdat .T...... T.....G..C..... /2

7 marmoreus 979.1 bia a dae ...... G..... 25 9 a a 5 AB61 7 Met Cho 22 1 Gastrophryne Amphi Anur Microh ...... T... 0/ 1900.1 20 728 0 azo rdat .T.....C...... C..... /2

8 olivacea bia a ylidae ...... 25

9 a a 5 7 Met Cho 22 7 TT.....C.. 20 1 Plethodon AY72 52 592 Amphi Caud Plethod ..G...... 52 59 ..G...... 0 azo rdat .T.....C...... T..... /2 0 C...... C /2

9 petraeus 8222.1 14 2 bia ata ontidae ...... 14 22 ...... 9 a a 5 9 .. 5 7 Met Cho 20 7 20 2 Mertensiella EU88 53 603 Amphi Caud Salama ...... 53 60 TC..T..T...... 0 azo rdat .C..T.....T...... C..T.. /2 0 /2

0 caucasica 0319.1 22 0 bia ata ndridae ...... 22 30 ...... C...... 9 a a 5 9 5 7 Met Cho 21 7 22 2 Pseudohynobius FJ532 53 607 Amphi Caud Hynobi ..T...... 53 60 TT.....T...... T...... 0 azo rdat .T...... T...... T..T.. /2 0 /2

1 flavomaculatus 059.1 68 6 bia ata idae ...... 68 76 ...... 9 a a 5 9 5 7 Met Cho 20 7 20 2 Sternotherus HQ11 54 620 Chelon Testu Kinoste ...... 54 61 TT..T..T...... 0 azo rdat .C..G...... C.....C..T.. /2 0 /2

2 carinatus 4563.1 97 5 ia dines rnidae ...... 05 13 ...... C...... 9 a a 5 9 5 7 Met Cho Actino 23 7 TC.....T.. 20 2 Antigonia AP00 55 622 Percif Caproi ...... 55 62 ...... 0 azo rdat pterygi .C...... T..... /2 0 C...... C /2

3 capros 2943.1 12 0 ormes dae C...... 12 20 C...... 9 a a i 5 9 .. 5 Proterorhinus EU44 7 Met Cho Actino 21 7 21 2 Percif Gobiid ..T...... 72 TC...... C. ..T...... cf. 4675.1 20 728 0 azo rdat pterygi .C.....A...... C..T.. /2 20 0 /2 4 ormes ae ...... 8 ...... C......

semipellucidus 9 a a i 5 9 5 AF39 7 Met Cho Actino Microd 21 7 21 2 Microdesmus Percif ...... 72 TC...... C...... 1347.1 20 728 0 azo rdat pterygi esmida .C.....A...... C..T.. /2 20 0 /2 5 bahianus ormes ...... G..... 8 ...... C...... G.....

9 a a i e 5 9 5

417

Base Pair Base pair Template Taxonomy Template Sequence location position Sequence

F2 = TA TCA ACT AAC

CAT AAA GAA ATC

Species Genbank Accession F2 LCO2198 Total Kingdom Phylum Class Order Family HCO 2198 No of matching bases for F2 LCO1490 HCO2198 Total Forward HCO2198 No of matching bases for LCO1490 5 AB49 7 Met Cho Actino 22 7 21 2 Oryzias 4 618 Belonifor Adrianic ...... A 54 61 TT.....T...... A 8068. 0 azo rdat pterygi .T...... T...... T..... /2 0 /2 6 minutillus 8 9 mes hthyidae ...... 81 89 ...... C......

1 9 a a i 5 9 5 1 5 AP00 7 Met Cho Actino 22 7 21 2 Balistapus 4 620 Tetraodo Balistid ..G...... 54 62 TC.....T... ..G...... 9203. 0 azo rdat pterygi .C...... T...... T..... /2 0 /2 7 undulatus 9 7 ntiformes ae ...... 99 07 ...... C......

1 9 a a i 5 9 5 9 5 AP00 7 Met Cho Actino 20 2 Glossanodon 4 620 Osmerifo Argenti ...... 0/ 4105. 0 azo rdat pterygi .C..G...... C.....C..T.. /2 8 semifasciatus 9 5 rmes nidae ...... 25

1 9 a a i 5 7 5 EU65 7 Met Cho Actino Cyprinod Nothobr 21 2 Nothobranchi 5 624 ...... T.... 0/ 0204. 0 azo rdat pterygi ontiforme anchiida .C..C.....T...... T..... /2 9 us furzeri 3 6 ...... 25

1 9 a a i s e 5 8 5 7 Met Cho Actino Cyprinod ...... T.... 22 3 Fundulus FJ445 4 619 Funduli 0/ 0 azo rdat pterygi ontiforme .C...... C.....T...... G.... /2

0 heteroclitus 403.1 9 8 dae 25 9 a a i s . 5 0 5 AP01 7 Met Cho Actino .....C...... 22 3 Pantodon 4 613 Osteoglo Pantodo 0/ 1564. 0 azo rdat pterygi .T.....C...... C...... C...... /2 1 buchholzi 2 7 ssiformes ntidae 25

1 9 a a i .. 5 9 5 AP00 7 Met Cho Actino ..G.....C.. 22 7 TT.....T.. ..G.....C.. 21 3 Halieutaea 4 616 Lophiifor Ogcoce 54 61 5977. 0 azo rdat pterygi .T...... T..T...... /2 0 C...... /2

2 stellata 6 9 mes phalidae 61 69

1 9 a a i . 5 9 . . 5 1 7 Met Cho ...... T.... 23 3 Aburria JN801 2 Galliform Cracida 0/ 734 0 azo rdat Aves .C...... C...... G.... /2

3 aburri 479.1 6 es e 25 9 a a . 5 Apteryx rowi EU52 7 Met Cho ..G...... 23 7 TC.....T.. ..G...... 20 3 2 Apterygif Apteryg 73 voucher 5324. 734 0 azo rdat Aves .C...... T...... G... /2 26 0 C...... C ...... G... /2 4 6 ormes idae 4

R34155 1 9 a a .. 5 9 .. .. 5 6 7 Met Cho ..G...... 22 7 TC.....T.. ..G...... 20 3 FJ751 6 738 Gruiform 66 73 Otis tarda 0 azo rdat Aves Otididae .C...... C..T...... G...... /2 0 C...... C...... G...... /2

5 803.1 7 1 es 73 81 9 a a .. 5 9 .. .. 5 3

418

EU52 7 Met Cho ..G...... 23 3 Bubo 2 Strigifor Strigida 0/ 5335. 734 0 azo rdat Aves .C...... C.....C...... G...... /2

6 virginianus 6 mes e 25

1 9 a a .. 5 7 AB47 7 Met Cho ..T.....T.. 22 7 TA...... C ..T.....T.. 20 3 Kinyongia 2 799 Reptili Chamel 72 79 4917. 0 azo rdat Squamata ...... A...... C...... /2 0 ...... C..C...... /2 7 fischeri 8 0 a eonidae 82 90

1 9 a a . 5 9 . . 5 2 HM80 7 Met Cho 21 7 22 3 Gekko 2 Lepido Gekkoni ...... T.... 72 TC...... C ...... T.... 2953. 728 0 azo rdat Squamata .C.....A...... T..T.. /2 20 0 /2 8 chinensis 0 sauria dae ...... 8 ......

1 9 a a 5 9 5

419

Base Pair Template Base pair Template Taxonomy location Sequence position Sequence

Species Genbank Accession F2 LCO2198 Total Kingdom Phylum Class Order Family F2 = TA TCA ACT AAC CAT AAA GAA ATC GG HCO 2198 No of matching bases for F2 LCO1490 HCO2198 Total Forward HCO2198 No of matching bases for LCO1490 7 7 3 DQ453 Met Arthr Calliphor .T...... T...... 21/ TT.....T...... 22/ Lucilia cluvia 23 731 0 Insecta Diptera 23 731 0

9 490.1 azoa opoda idae T..T...... 25 ...... 25 9 9 7 7 4 Ocnaea spp. SLW- DQ631 Met Arthr Acroceri .T...... T ...... A.. 22/ TT.....T..C...... A.. 21/ 35 743 0 Insecta Diptera 35 743 0

0 2002c 972.1 azoa opoda dae ..T...... 25 ...... 25 9 9 7 7 4 Ptychoptera GQ465 Met Arthr Ptychopt .T.....A...... A.. 21/ TT...... C...... A.. 22/ 47 755 0 Insecta Diptera 47 755 0

1 quadrifasciata 782.1 azoa opoda eridae T..T...... 25 ...... 25 9 9 7 7 4 EU839 Met Arthr Neuropt Osmylid .T...... T ...... A.. 22/ TT.....T..C...... A.. 21/ Porismus strigatus 21 729 0 Insecta 21 729 0

2 761.1 azoa opoda era ae ..T...... 25 ...... 25 9 9 7 7 4 Mucroberotha EU839 Met Arthr Neuropt Berothid .C...... T ...... 22/ TC.....T..C...... 21/ 40 748 0 Insecta 40 748 0

3 vesicaria 740.1 azoa opoda era ae ..T...... C.... 25 ...... C.... 25 9 9 7 7 4 Polystoechotes FJ1713 15 230 Met Arthr Neuropt Polystoe .T...... T ...... A.. 22/ 159 230 TT.....T..C...... A.. 21/ 0 Insecta 0

4 punctatus 25.1 92 0 azoa opoda era chotidae ..T...... 25 2 0 ...... 25 9 9 7 7 4 Meligethes AM49 Met Arthr Coleopt Nitidulid .C...... T ..T...... 23/ TC.....T..C. ..T...... 20/ 29 737 0 Insecta 29 737 0

5 arankae 1707.1 azoa opoda era ae ...... G..... 25 ...... C...... G..... 25 9 9 7 7 4 Phyllium AB477 11 190 Met Arthr Phasmat Phylliida .G.....A...... T 21/ 119 190 T...... C...... T 23/ 0 Insecta 0

6 giganteum 461.1 96 4 azoa opoda odea e T..T...... 25 6 4 ...... 25 9 9 7 7 4 FJ1548 20 272 Met Arthr Hymeno Braconid ...... A..T...... A.. 21/ 202 272 TA...... A.. 23/ Cotesia vestalis 0 Insecta 0

7 97.1 21 9 azoa opoda ptera ae T..T...... 25 1 9 ...... 25 9 9 7 7 4 Campodea DQ529 14 212 Met Arthr Campode .C...... T ...... T...... 22/ 142 212 TC.....T..C...... T...... 21/ 0 Diplura 0

8 lubbocki 237.1 20 8 azoa opoda idae ..T...... 25 0 8 ...... 25 9 9 7 7 4 Gammarus JN704 Met Arthr Malacos Amphip Gammari .C.....A...... 22/ TC...... C...... 20/ 20 728 0 20 728 0

9 duebeni 067.1 azoa opoda traca oda dae C..... G...... 25 .....C..C.. G...... 25 9 9 15 7 7 5 Clava multicornis JN700 158 Met Cnida Hydroz Hydroid Hydracti .T...... T ...... T...... 22/ 151 158 TT.....T..C...... T...... 20/ 14 0 0

0 mitochondrion 935.1 55 azoa ria oa a niidae ..A...... 25 47 55 ...... A...... 25 7 9 9 7 7 5 Halisarca HQ606 92 163 Met Porife Demosp Dendroc Halisarci .T...... T...... C 21/ 161 TT.....T...... C 22/ 0 926 0

1 dujardini 143.1 6 4 azoa ra ongiae eratida dae T..T...... 25 4 ...... 25 9 9

420

Base Pair Base pair Template Taxonomy Template Sequence location position Sequence

F2 = TA TCA ACT AAC

CAT AAA GAA ATC GG

pecies

S Genbank Accession F2 LCO2198 Total Kingdom Phylum Class Order Family HCO 2198 No of matching bases for F2 LCO1490 HCO2198 Total Forward HCO2198 No of matching bases for LCO1490 7 Met Demos Hadro 20 7 24 5 Cliona HM99 71 Dendro ...... 71 ...... 3 0 azo Porifera pongia merid GG.....A..T...... T..... /2 3 0 /2

2 celata 9033.1 1 ceratida .....G..... 1 ...... C...... G..... 9 a e a 5 9 5 Decipisagit AP01 7 Met Aphrag .....C..... 22 7 .....C..... 21 5 88 96 Chaeto Saqitto Sagitti 88 96 TT...... C ta 1546.1 0 azo mophor .T.....A...... T..... A...... /2 0 A...... /2 3 99 04 gnatha idea dae 99 04 ...... C..

decipiens 6 a a .. 5 6 .. 5 AB61 7 Met Platyhe 20 7 21 5 Dugesia 38 45 turbell Tricladi Duges ...... A. 38 45 TT...... C ...... A. 8488.1 0 azo lmenthi .T.....A...... G..T..T.. /2 0 /2 4 ryukyuensis 39 41 aria da iidae .T...... 39 47 .....G...... T......

3 a s 5 3 5

421

Table 8 Forward primer F5 vs Folmer LCO 1490. Highlighted rows have been picked up by the new designed primer only.

Templa Base pair Base pair te Taxonomy Template Sequence location location Sequen ce

F5 = GA

ACA AAT

ATC TTA

CAC GTT

GGC Species Genbank Accession F5 LCO2198 Total Kingdom Phylum Class Order Family Reverse of No matching F5 for bases LCO1490 HCO2198 Total Forward Reverse for bases of matching No LCO1490

C A Al Chr 2 Iridogor FJ2 M ..G.... 2 9 7 ni nt cy yso 3 gia 686 et ...... 1 0 3 3 da ho on gorg / magnisp 39. az . C...... 5 9 5 ri zo ace iida 2

p.iralis 1 oa ..C.. a a a e 3 C A Al 2 Echinog HQ M Para ...... 7 7 ni nt cy 3 orgia 694 et mur ...... A..T 2 3 3 3 da ho on / complex 727 az icei ...... 7 5 ri zo ace 2

a .1 oa dae C.. a a a 3 C A Al 2 GU M ...... 1 9 7 ni nt cy Alc 3 Sinularia 355 et ...... A.. 3 7 0 3 da ho on yoni / loyai 979 az . C......

4 8 5 ri zo ace idae 2

.1 oa ..C.. a a a 3 C A Al 2 HQ M ..G.... Euplexa 7 7 ni nt cy Plex 3 694 et ...... A.. 4 ura 3 3 3 da ho on auri / 728 az . T......

crassa 7 5 ri zo ace dae 2

.1 oa .C.. a a a 3 C A Al 2 Alcyoniu GU M ..G.... 1 8 7 ni nt cy Alc 3 m 355 et ...... A.. 5 1 4 3 da ho on yoni / glomerat 947 az . G......

4 8 5 ri zo ace idae 2

um .1 oa ..C.. a a a 3 C A Al 2 Ellisella FJ6 M ..G.... 7 7 ni nt cy Ellis 3 spp. 429 et ...... G..... 6 3 3 3 da ho on ellid / DFH11- 32. az . C......

7 5 ri zo ace ae 2

8B 1 oa ..C.. a a a 3 C A Al 2 Keratoisi FJ2 M ..G.... 1 8 7 ni nt cy 3 s spp. 686 et Isidi ...... 7 6 8 3 da ho on /

SCF- 29. az dae . C...... 5 9 5 ri zo ace 2

2009a 1 oa ..C.. a a a 3 Chirone C A Al 2 GU M ...... phthya 1 9 7 ni nt cy Nid 3 356 et ...... A..T 8 spp. 3 7 1 3 da ho on aliid / 003 az ......

CSM- 6 0 5 ri zo ace ae 2

.1 oa C.. 2010 a a a 3 Pseudopt C A Al 2 DQ M ..G.... erogorgi 7 7 ni nt cy Gor 3 640 et ...... T 9 a 3 3 3 da ho on goni / 646 az ......

bipinnat 7 5 ri zo ace idae 2

.1 oa C.. a a a a 3 C A Al 2 HQ M ..G.... Dendron 7 7 ni nt cy Nep 3 1 694 et ...... A.. ephthya 3 3 3 da ho on hthe / 0 726 az . T......

putteri 7 5 ri zo ace idae 2

.1 oa .C.. a a a 3 C A Al 2 FJ2 M ..G.... 2 9 7 ni nt cy Pri 3 1 Primnoa 686 et ...... G..... 1 4 3 da ho on mno / 1 pacifica 38. az . C......

4 8 5 ri zo ace idae 2

1 oa ..C.. a a a 3 Briareu GU 2 9 7 M C A Al Bria ..G.... 2 1 ...... m 355 1 5 3 et ni nt cy reid .G..... 3 2 .

hamrum 975 7 1 5 az da ho on ae T...... / 422

.1 oa ri zo ace .C.. 2 a a a 3 C A Al 2 Titanide FJ2 M Ant ..G.... 2 9 7 ni nt cy 3 1 um 649 et hoth ...... G..... 4 8 3 da ho on / 3 frauenfel 16. az elid . C...... 9 3 5 ri zo ace 2

dii 1 oa ae ..C.. a a a 3

423

Base Template Base pair Template pair Taxonomy Sequence location Sequence location

F5 = GA

ACA AAT

ATC TTA

CAC GTT

GGC Species Genbank Accession F5 LCO2198 Total Kingdom Phylum Class Order Family Reverse of No matching F5 for bases LCO1490 HCO2198 Total Forward Reverse bases of matching No LCO1490 for M A C A Al ..G... 2 et Cor Coralliu B5 7 7 ni nt cy ..G... 2 1 a alli ...T...... m 95 3 3 3 d h on ..C... / 4 z ida ..... konojoi 19 7 5 ar oz ac .....C 2 o e

0.1 ia oa ea .. 3 a M JN C A Al ..G... 2 et Cor Cervera 62 1 8 7 ni nt cy .....A 3 1 a nul ...... atlantic 08 2 5 3 d h on ..C... / 5 z arii .... a 05. 2 6 5 ar oz ac .....C 2 o dae

1 ia oa ea .. 3 a G M C A Al 2 Ovabun U3 et ..T... 1 9 7 ni nt cy Xe 1 1 da 56 a ..G...... A...... 7 0 3 d h on nii / 6 faraune 00 z ...... T..... 2 6 5 ar oz ac dae 2 nesis 6.1 o ...C.. ia oa ea 3

a Telestul M FJ C A 2 a cf. et Te ..G... 26 2 9 7 ni nt Tel 3 1 spiculic a les ...... 49 3 7 3 d h esti / 7 ola z tac .... C.....

17. 6 0 5 ar oz dae 2

SCF- o ea ...C..

1 ia oa 3 2009 a M G C A An TT...... C 2 et Ant 1 Antipath U2 ni nt tip 4 7 C...... T.. 0 1 a ipat 1 es 96 d h ath 5 0 C..... A..... / 8 z hid 6 griggi 50 ar oz ari 7 9 ...... 2

o ae 5

4.1 ia oa a C.. C.. 5 a M C A TT...... 2 U3 et Ac Me Metridi ni nt 7 7 T..T. C..A. 0 1 67 a tin trid 3 um d h 4 0 ...... C..G / 9 83. z iar iida 2 senile ar oz 0 9 .....C .....C 2

1 o ia e ia oa .. .. 5 a A M C A Poc 2 Pocillop Y1 et Sc ...... ni nt illo 7 7 5 2 ora 39 a ler ...... d h por 1 1 0 / 0 damicor 81 z act ...... ar oz ida 0 9 2 nis 3.1 o ina . . ia oa e 5

a M AF C A 2 Montast et Sc ...... 01 ni nt Fav 7 7 5 2 rea a ler ...... 37 d h iida 1 1 0 / 1 faveolat z act ...... 38. ar oz e 0 9 2 a o ina . .

1 ia oa 5 a M Polycya JF C A Car 1 1 TT.. 2 et Sc ...... thus 82 ni nt yop 3 4 7 T..... 1 2 a ler ...... spp. 51 d h hyl 4 2 0 ...C.. / 2 z act C..... Mfl-, 40. ar oz lida 9 0 9 ...... 2 o ina ...C..

2011 1 ia oa e 7 5 . 5 a D M C A 1 1 2 Astrangi Q6 et Sc Rhi TT...... ni nt 1 2 7 2 2 a spp. 43 a ler zan T..... T..A. d h 3 0 0 / 3 JVK- 83 z act gii ...... ar oz 7 7 9 2 2006 2.1 o ina dae ...... C.. ia oa 0 8 5

a D M C A 1 1 TT.. 2 Q6 et Sc ...... Mussa ni nt Mu 2 3 7 T..... 0 2 43 a ler ...... angulos d h ssi 7 4 0 ...... / 4 83 z act C.....

a ar oz dae 5 5 9 .C.. 2 4.1 o ina ...C.. ia oa 1 9 A.. 5

424

Base pair Template Base pair Template Taxonomy location Sequence location Sequence

F5 = GA

ACA AAT

ATC TTA

CAC GTT

Species Genbank Accession F5 LCO2198 Total Kingdom Phylum Class Order Family GGC Reverse of No matching F5 for bases LCO1490 HCO2198 Total Forward Reverse of matching No LCO1490 for bases M C A 1 1 2 AY Scl TT...... C. Montip et ni nt Acr 6 6 7 2 2 903 era .T...... T..A. ora az d ho opor 1 8 0 / 5 296 ctin ...... C.....

cactus o ar zo idae 2 3 9 2

.2 a ...... C.. a ia a 3 1 5 M C A 1 1 ...... 2 Gonio JF8 Scl TT.... et ni nt Pori 6 6 7 ..A.. 0 2 pora 251 era .T..C az d ho tida 1 8 0 C..... / 6 column 41. ctin ......

o ar zo e 5 6 9 G..C. 2

a 1 a C..... a ia a 9 7 . 5 M C A 1 1 2 DQ Scl TT...... C. Agaric et ni nt Aga 3 4 7 1 2 643 era ....C.. .T..... ia az d ho ricii 7 4 0 / 7 831 ctin ...... C T......

humilis o ar zo dae 3 4 9 2

.1 a ...... C.. a ia a 3 1 5 M C A 2 Savali DQ Para 2 2 TT...... C. et ni nt Zoa 7 1 2 a 825 zoa 1 8 C..T. .C..A az d ho nthi 0 / 8 savagli 686 nthi 4 5 ...... G....

o ar zo dea 9 2

a .1 dae 3 1 ...... C.. a ia a 5 M C 2 JN Cu Car .T..T. ..C..C et ni Alat 7 7 0 2 Alatina 700 bo ybd 5 ....C...... az d inid 5 0 / 9 moseri 954 zo eid 1 C...... N..G.

o ar ae 9 9 2

.1 a a ..A...... C.. a ia 5 Craspe M C H 2 FJ4 dacust et ni yd Hy Olin 7 7 ...... 0 3 236 a az d ro droi diid 2 1 0 ...... / 0 20. sowerb o ar zo da ae 0 9 ...... 2

1 yi a ia a 5 M C H 1 1 2 EU TT.... Hydra et ni yd Hy Hyd 4 5 7 ...... 1 3 237 .T..... oligact az d ro droi rida 5 2 0 ...... / 1 491 ...... is o ar zo da e 6 7 9 ...... 2

.1 A.. a ia a 4 2 5 M C H 1 1 2 JN Hyd TT...... Clava et ni yd Hy 5 5 7 1 3 700 racti .T..C T...... multic az d ro droi 1 8 0 / 2 935 niid ...... ornis o ar zo da 4 5 9 2

.1 ae ..A.. . a ia a 7 5 5 M C H 1 1 2 JN TT...... Ectopl et ni yd Hy Tub 2 3 7 2 3 700 ...... T..A.. eura az d ro droi ulari 6 3 0 / 3 938 ....C.. T...... larynx o ar zo da idae 5 5 9 2

.1 ...... a ia a 1 9 5 M C H Ca 1 1 2 JN TT...... T..... Obelia et ni yd Hy mpa 4 5 7 1 3 700 .T..... T..A.. longiss az d ro droi nula 3 0 0 / 4 948 ...... C...... ima o ar zo da riida 7 8 9 2

.1 A......

a ia a e 6 4 5 M C H 1 1 2 Pennar JN TT.... et ni yd Hy Pen 2 3 7 1 3 ia 700 .T..... az d ro droi narii 9 6 0 / 5 distich 950 ......

o ar zo da dae 0 0 9 2

a .1 A.. a ia a 1 9 5 Varite H M C H 2 Hali ntacul M0 et ni yd Tra 7 7 ...... 5 3 crea a 535 az d ro chy 1 0 0 ...... / 6 tida yantaie 43. o ar zo lina 7 9 ...... 2 e

nsis 1 a ia a 5 Crater M C Sc Sta 2 JN 3 2 TT.... olophu et ni yp uro Dep 7 ...... 0 3 700 4 7 .G..... s az d ho me astri 0 ...... / 7 976 8 7 C...... convol o ar zo dus dae 9 ...... 2 .1 5 7 ..A.. vulus a ia a ae 5

425

M C Sc Sta TC... 2 Halicly JN Luc 4 4 ...... et ni yp uro 7 ..T.. 0 3 stus 700 erna 9 2 .....G. az d ho me 0 C..C. / 8 sanjua 944 riida 7 6 ...... o ar zo dus 9 ...... 2 nensis .1 e 3 5 C.. a ia a ae . 5

426

Base pair Template Base pair Template Taxonomy location Sequence location Sequence No of F5 = GA L K R L H matchi Ge P ACA No of C T i F e C C T ng nba h AAT matc O o n C Or a v O O o For Re bases Spec nk F y ATC hing 2 t g la de m e 1 2 t wa ver for ies Acc 5 l TTA bases 1 a d ss r il r 4 1 a rd se LCO1 essi u CAC for 9 l o y s 9 9 l 490 on m GTT F5 8 m e 0 8 GGC S C c Chry M Se TT...... n y Pe saor HQ et ma 4 4 ...... T.. i p la 7 3 a 694 a eo 9 2 .C...... d h gi 0 21/25 9 quin 730 z sto 3 2 ...... G a o id 9

quec .1 o me 3 5 ...A ..C.

ri z ae

irrha a ae .. . a o

a S C c M Se TC...... n y Ul Aure HQ et ma 5 4 ....T ..T.. i p m 7 4 lia 694 a eo 0 3 ..C. A.. d h ar 0 20/25 0 aurit 729 z sto 5 4 ...... G... a o id 9

a .1 o me 7 9 ......

ri z ae

a ae A.. C.. a o

a S C c M TT. Linu n y Li ..T.. JN7 et Co .T... che i p nu 9 1 7 ...T. 4 009 a ro ...... ungu d h ch 0 9 0 ...... 20/25 1 39. z nat ..... icula a o id 7 9 9 ......

1 o ae C..

ta ri z ae .C.. a A.. a o

a S C c M Sta TC. ..T.. n y C Cyan JN7 et ur 4 4 ....T ...... i p ya 7 4 ea 009 a om 7 0 ..C...... d h ne 0 20/25 2 capil 37. z ed 7 7 ...... G a o id 9

lata 1 o us 8 0 .C.. ..C.

ri z ae

a ae ... . a o

a S Ceri C c C M AC...... anth n y Ce er DQ et 1 2 ...... T.. eopsi i p ria ia 7 4 662 a 5 2 C...... s d h nth nt 0 21/25 3 399 z 4 5 C...... G amer a o ari hi 9

.1 o 5 3 ...... C.

ican ri z a da a ......

a a o e

427