A Novel Function of Galactomyces Candidum in Highly Efficient Ammonia Nitrogen

bioRxiv preprint doi: https://doi.org/10.1101/397687; this version posted August 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.

1 A novel function of Galactomyces candidum in highly efficient ammonia nitrogen

2 removal from low C:N wastewater

4 Li Xiaochao1†, Liu Hui2†, Zeng Guihua, Li Hualin2†,Chen Zhinan, Liu Wenbin1*†,

5 Yang Liping2*†

7 1College of Life Sciences, Hunan Normal University, Changsha, Hunan 410004,

8 China.

9 2Department of Environmental Science, Changsha Environmental Protection College,

10 Changsha, Hunan 410004, China.

12 *For correspondence: Liu Wenbin; Yang Liping

13 †Contributed equally

22 bioRxiv preprint doi: https://doi.org/10.1101/397687; this version posted August 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.

24 Abstract

26 A strain of bacteria that demonstrated efficient nitrogen removal potential under low

27 C:N conditions was screened from landfill leachate. The strain was identified as

28 Galactomyces candidum by ITS sequencing, and growth density and removal of

29 ammonia nitrogen were assessed after 24 h of incubation. The results showed that the

30 optimum ammonia nitrogen reduction conditions for G. candidum was at pH 8.0 and

31 30 °C, with a C:N ratio of 1.5:1; the highest rate of ammonia nitrogen removal was

32 93.1%. This novel function of G. candidum offers great potential in the removal of

33 ammonia nitrogen from sewage, especially in low C:N wastewater. Our study

34 provides a new theoretical basis for the industrial application of bacteria in the

35 biochemical treatment of wastewater and reduces environmental pollution.

37 A novel function and potential of Galamyces candidum in the removal of ammonia

38 nitrogen from wastewater treatment was found,which provides a theoretical basis for

39 the treatment of ammonia in wastewater.

41 Keywords

42 Galactomyces candidum; low C:N; nitrogen removal; wastewater; pollution

43 mitigation

45 bioRxiv preprint doi: https://doi.org/10.1101/397687; this version posted August 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.

48 Introduction

50 Removal of ammonia nitrogen from wastewater, especially that with low carbon

51 (C)-nitrogen (N) ratio, is of key interest (You et al., 2009; Liang et al., 2014). In

52 China, there are high levels of industrial and agricultural pollution in rivers and

53 groundwater deriving from discharge of landfill leachate, petrochemicals, fertilizers,

54 and monosodium glutamate to wastewater that is characterized by low C:N (Jia ,2014).

55 Since traditional biological treatment of wastewater requires large amounts of energy

56 and sources of carbon to complete the denitrification process ( Zhao et al.,2001), a

57 more sustainable to approach to wastewater treatment could be the identification of

58 microbes that remain effective under low carbon conditions. Fungi have different

59 carbon-nitrogen ratio requirements, where it is generally >10 (Gao et al., 2007).

60 Anammox and denitrifying bacteria have been reported to be two types of autotrophic

61 bacteria effective in low-N:N ratio of sewage (Deng et al., 2015; Persson et al., 2017),

62 while Li et al. (2017) and Yang et al. (2018) reported bacterial strains that showed

63 high ammonia nitrogen removal efficiency under low C and N conditions.

65 Galactomyces candidum is a eukaryotic microorganism that is widely present in the

66 environment, has morphological characteristics that are intermediate between yeast

67 and fungus, and is often used in the food and drink industry, including for cheese bioRxiv preprint doi: https://doi.org/10.1101/397687; this version posted August 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.

68 ripening (Sacristan et al., 2012) and production of beer (Sun.2009), white wine, and

69 fermented bean curd, due to the production of pectinase (S.F. Cavalitto, et al., 2006),

70 coenzyme Q, lipase, increase medium chain fatty acid content and antimicrobial

71 activity (Khoramnia, et al., 2013). Although G. candidum has been reported to reduce

72 the harmful effects of chemical oxygen demand (COD) in sewage treatment of

73 wastewater( He, et al.,2007 ; Yan, et al.,2002; Xiong, et al.,2008), its impact on the

74 toxic pollutant, ammoniacal nitrogen in landfill leachate is unclear. Here, we screened

75 for strains of G. candidum that thrive under low C:N conditions and demonstrated

76 significant effects on ammonia removal from landfill leachate.

78 Results and discussion

80 Colony morphology

82 We cultured ammonia nitrogen-reducing strains of G. candidum (GC) from landfill

83 leachate in selective medium with NH4+-N as the source of N source. The colony

84 cultured on solid YPD medium at 30 °C was gray-white in color, with a diameter of c.

85 2 mm, and rough, moist surface, unraised center, and irregular edges (Fig. 1A).

87 Strain identification

89 The GC genome size was approximately 20 kb (Fig. 1B), and ITS sequence lengths of bioRxiv preprint doi: https://doi.org/10.1101/397687; this version posted August 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.

90 two strains were about 350 and 346 bp (Fig. 1C). BLAST alignment analysis showed

91 similarity between GC and GC strain WM 04.493 KP132255.1 was 99%, and 98%

92 similarity to GC strain LC317625.1. A phylogenetic tree (Kondo et al., 2012) of GC

93 strains (Fig. 2) showed differences between GC bacteria and GC strain WM 04.493

94 KP132255.1 occurred at bases 4, 42, 43, 319, 338, 339, and 340, while differences

95 with GC strain LC317625.1 occurred at bases 65, 91, 92, 319, 338, 339, and 340 (Fig.

96 3).

98 Fig. 1 here.

100 Fig. 2 here.

101

102 Fig. 3 here.

103

104 GC growth

105

106 Growth of G. candidum strains was assessed at OD600; the initial delay in growth

107 between 0 and 2 h was followed by logarithmic growth (Fig. 4). This growth pattern

108 showed that the nitrifying bacteria had the characteristics of a short generation cycle

109 with a fast growth rate[4]. After 24 h, growth rate was stable. Since turbidity of the

110 bacteria was measured using an ultraviolet spectrophotometer, dead bacteria cells

111 were also counted, and may explain the lack of decline after the stabilization period. bioRxiv preprint doi: https://doi.org/10.1101/397687; this version posted August 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.

112

113 Fig. 4 here.

114

+ 115 Effect of initial pH on NH 4 -N removal

116

117 The optimum pH for growth of G. candidum was about 9.0 (Fig. 5A), but ammonia

118 removal efficiency was at pH. 8.0 (Fig. 5B), possibly because the ammonia reducing

119 enzymes in G. candidum are inhibited at high alkaline conditions.

120

121 Fig. 5 here.

122

+ 123 Effect of temperature on NH 4 -N removal

124

125 While G. candidum grew at temperatures in the range 10-42 °C, growth was slow at

126 10 °C and more rapid at temperatures >10 °C (Fig. 6A). We found that the optimum

127 temperature for growth of the bacteria was 30 °C, and growth efficiency decreased

128 when the temperature exceeded 30 °C. Ammonia nitrogen removal rate was highest at

129 30 °C (76.3%), however this rate reduced to 7% at 42 °C (Fig. 6B). It can be seen that,

130 under different temperature conditions, the optimal growth temperature and ammonia

131 nitrogen removal rate of this strain is 30 °C.

132

133 Fig. 6 here. bioRxiv preprint doi: https://doi.org/10.1101/397687; this version posted August 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.

134

+ 135 Effect of C:N ratio on NH 4 -N removal

136

137 selection mediumWhen the C:N ratio was low, growth of G. candidum was similarly

138 low, but increased as the C increased relative to N (Fig. 7A). Ammonia nitrogen

139 removal rate was similarly low at low C:N ratios (Fig. 7B), possibly as a result of the

140 production of ammonia oxidase by the bacteria that were shown to be a strain of

141 ammoxidation heterotrophs. When the C:N ratio was between 1 and 4, there was an

142 increase in growth of G. candidum, with a peak in growth and removal rate of

143 ammonia nitrogen (93.1%) at a C:N ratio of 1.5, and further increases in carbon

144 decreased efficiency of removal of ammonia nitrogen (Fig 7A and 7B).

145

146 Fig. 7 here.

147

148 Conclusions

149

150 Industrial wastewater tends to contain high ammonia nitrogen and low C:N ratio,

151 however, insufficient sources of carbons to support traditional biological nitrogen

152 removal results in poor levels of denitrification and the need to increase

153 carbon(Zhu,2015) not only increases economic costs of pollution mitigation, but also

154 increases CO2 production and atmospheric pollution. Therefore, a more sustainable

155 approach to wastewater treatment is to maintain the level of carbon use, and explore bioRxiv preprint doi: https://doi.org/10.1101/397687; this version posted August 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.

156 novel, complementary techniques, but such improvements to the denitrification

157 process may be hampered by various environmental factors (Zhang ,2010). In

158 addition to simultaneous nitrification and denitrification, anaerobic ammonia

159 oxidation and other processes, (Shen ,2013; Zhu ,2016;Peng et al., 2018), and new

160 theories and processes have been proposed to reduce the need for carbon in biological

161 denitrification. However, current ammonia nitrogen wastewater treatment that uses

162 strains of microbes to directly reduce the ammonia nitrogen is deemed the most

163 economical and effective. Galactomyces screened in this paper grew more rapidly in a

164 neutral to alkaline environment at 20-37 °C, and when the C:N ratio of the medium

165 was 1.5, ammonia nitrogen removal rate was 93.1% after 24 h. Since we found that

166 culturing the bacteria was simple and there was no need to increase carbon, our study

167 provides a theoretical basis for the treatment of ammonia in wastewater.

168

169 Gal. candidum has effective decolorization and decontamination effects in wastewater

170 treatment (Aouidi et al., 2010; Yin.2009) and it has been shown to purify wastewater

171 from the potato, tofu, and corn starch industries(Ren , et al., 2010;Qu, et al., 2005;Li,

172 et al., 2008), however, little is known about the impact of Gal. candidum on the

173 removal of ammonia nitrogen from wastewater. We found that the Galamyces

174 candidum screened in this paper had a significant effect in the removal of ammonia

175 nitrogen from wastewater after 24 h, especially under high ammonia nitrogen and low

176 carbon conditions, and there have been reports on the use of wastewater to ferment

177 Galactomyces. However, it is unclear whether Galactomyces removes ammonia bioRxiv preprint doi: https://doi.org/10.1101/397687; this version posted August 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.

178 nitrogen via nitrification or denitrification. If used in wastewater treatment,

179 Galactomyces could reduce the need for investment in equipment and therefore

180 treatment costs, while efficiently removing ammonia nitrogen.

181

182 We found a novel function and potential of Gal. candidum in the removal of ammonia

183 nitrogen from wastewater treatment, and it is likely that this bacteria would also elicit

184 positive effects on other pollution factors, such as COD, total nitrogen, and total

185 phosphorus. The effect and safety of use of Galactomyces in sewage treatment should

186 be assessed in future research, as should the mechanisms by which ammonia nitrogen

187 is removed by the bacteria.

188

189 Experimental procedures

190

191 Growth conditions

192

-1 -1 193 Selection medium (Daum et al., 1998) comprised 0.246 g l of NH4Cl; 0.039g l of

-1 -1 5 -1 194 MgSO4·7H2O, 0.055g l of CaCl2, 0.010g l of FeSO4·7H2O, 2.4 x10 g l of

-1 - 195 CuSO4·5H2O, 0.348g l of K2HPO4, and 3.603g l 1 of glucose. Growth medium (LB)

196 comprised 10.0g l-1 of tryptone, 5.0g l-1of yeast extract, 10.0g l-1 of NaCl, and 20.0g

197 l-1 of agar. YPD culture medium comprised 10 g l-1 of peptone, 20 g l-1of glucose; 5 g

198 l-1 of yeast powder, and 20 g l-1 of agar powder. MRS isolation medium comprised

199 10.0 g l-1 of peptone, 5.0 g l-1 of beef dipping, 4.0 g l-1 of yeast dipping powder, 20.0 g bioRxiv preprint doi: https://doi.org/10.1101/397687; this version posted August 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.

-1 -1 -1 -1 200 l of glucose, 2.0 g l of K2HPO4, 2.0 g l of C6H17N3O7, 5.0 g l of CH3COONa,

-1 -1 -1 201 0.2 g l of MgSO47H2O, 0.05g l of MnSO4, 20.0g l of agar, and 1.0 mL of Tween

202 80. Media were sterilized at 121 °C for 15 min.

203

204 Strain isolation

205

206 We used sterile saline to dilute the landfill leachate that had been collected from a

207 landfill site by 10 times. Glass beads were added to the dilute leachate, which was

208 then placed on a shaker for 20-30 mins to ensure a uniform suspension of microbes.

209 The suspension was strained and transferred to the LB, YPD, and MRS solid media

210 under aseptic conditions using dilution plating, and cultured at 37, 30, and 30 °C,

211 respectively, in an incubator for 24-48 h. Single bacterial strains that formed were

212 selected and further purified by streaking until pure strains were obtained, and then

213 stored at -80 °C. Single colonies of the isolated and purified strains were placed in

214 5-mL sterile LB, YPD, and MRS liquid media and cultured for 24 h, before 1% of the

215 liquid was removed and centrifuged at 12,000 rpm for 10 min. The liquid was

216 discarded, and then three repeat dilutions using saline were made. Bacteria were

217 added to 100 ml ammoxidation selective medium and placed on a 150 rmp constant

218 shaker in an incubator set at 30 °C for 24 h, and then bacteria were quantified using

219 the turbidity method (OD600). Nessler's reagent spectrophotometry(HJ 535-2009) was

220 used to measure ammonia nitrogen concentration in the culture medium.

221 Non-inoculated medium was used as a control to calculate the removal rate of bioRxiv preprint doi: https://doi.org/10.1101/397687; this version posted August 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.

222 ammonia nitrogen, and the strain of G. candidum (GC) that had the best effect on

223 ammonia nitrogen removal was selected.

224

225 Bacterial strain identification

226

227 Bacteria DNA was extracted from the dilutions using a kit supplied by BIOMIGA

228 (Guangzhou FulenGen Co., Ltd. ). We used universal forward ITS1

229 (5’TCCGTAGGTGAACCTGCGG3’) and reverse ITS4

230 (5’TCCTCCGCTTATTGATATGC3’) primers to amplify genomic DNA of the

231 isolated strains at 94 °C for 5 min, followed by 30 cycles at 94°C for 0.5 min, 54 °C

232 for 0.75 min, 72 °C for 2 min, 72 °C for 10 min, and then 4 °C. PCR products were

233 sequenced by Tsingke Biological Technology Co., Ltd., Changsha, China. We

234 compared ITS rDNA sequences with those on the NCBI database

235 (https://www.ncbi.nlm.nih.gov/), and a phylogenetic tree was constructed using the

236 neighbor-joining method in MEGA6.0 software.

237

238 Effect of different environmental factors on nitrate reduction

239

240 G. candidum (GC) bacteria using YPD medium were cultured, and after

241 centrifugation, cells at the bottom of the centrifuge tube were inoculated into

242 ammonia oxidation media. The effect of different initial C:N ratios on ammonia

243 nitrogen removal by GC bacteria cultured at different pH, temperature, and on bioRxiv preprint doi: https://doi.org/10.1101/397687; this version posted August 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.

244 different media were assessed. Media pH was adjusted to 3.0, 4.0, 5.0, 6.0, 7.0, 8.0,

245 and 9.0, and GC bacteria were cultured in a 150 rmp shaker at 30 °C. Separately, GC

246 bacteria were incubated on a 150 rpm shaker for 24 h at 10, 20, 25, 30, 37, and 42 °C.

247 To assess effect of C:N ratio, we selected ratios equal to 0, 1, 1.5, 2, 3, and 4 and GC

248 bacteria were cultured on 0.246 g of medium fixed with NH4Cl, where glucose was

249 the C source at 30 °C on a 150 rmp shaker. All experiments were conducted using 1%

250 inoculum, with the original medium as a control. Following incubation for 24 h,

251 ammonia nitrogen concentration was assessed at 600 nm OD. All tests comprised

252 three replicates.

253

254 Analytical methods

255

256 Cell density was monitored at OD600, using a spectrophotometer, and ammonium

+ 257 nitrogen (NH4 -N) was measured using Nessler’s reagent spectrophotometry.

258

259 References

260

261 [1]You, J., et al. (2009). "Ammonia-oxidizing archaea involved in nitrogen removal."

262 Water Res 43(7): 1801-1809.

263 [2]Liang, Y., et al. (2014). "Microbial characteristics and nitrogen removal of

264 simultaneous partial nitrification, anammox and denitrification (SNAD) process

265 treating low C/N ratio sewage." Bioresour Technol 169: 103-109. bioRxiv preprint doi: https://doi.org/10.1101/397687; this version posted August 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.

266 [3] Jia Xiaoning. Study on Low Carbon-to-nitrogen Sewage Denitrification by

267 Combination Bed Based on Immobilized Microorganism [D]. Lanzhou University,

268 2014.

269 [4] Zhao Zongsheng, Liu Hongliang, Li Bingwei, Yuan Guangtao. High-efficiency

270 Biological Denitrification of Ammonia Nitrogen Wastewater [J].CHINA WATER

271 &WASTEWATER,2001(05):24-28.

272 [5] Gao, L., et al. (2007). "Effects of carbon concentration and carbon to nitrogen

273 ratio on the growth and sporulation of several biocontrol fungi." Mycol Res 111(Pt 1):

274 87-92.

275 [6] Deng Weiwei,Wang Xiaochang. Research progress in the denitrification of sewage

276 at low C/N ratio [J]. Industrial Water Treatment,2015,35(02):15-19

277 [7] Persson, F., et al. (2017). "Community structure of partial nitritation-anammox

278 biofilms at decreasing substrate concentrations and low temperature." Microbial

279 Biotechnology 10(4): 761-772.

280 [8] Li, Y., et al. (2017). "Aerobic-heterotrophic nitrogen removal through nitrate

281 reduction and ammonium assimilation by marine bacterium Vibrio sp. Y1-5."

282 Bioresour Technol 230: 103-111.

283 [9] Yang, M., et al. (2018). "Highly efficient nitrogen removal of a coldness-resistant

284 and low nutrient needed bacterium, Janthinobacterium sp. M-11." Bioresour Technol

285 256: 366-373.

286 [10] Sacristan, N., et al. (2012). "Technological characterization of Geotrichum

287 candidum strains isolated from a traditional Spanish goats' milk cheese." Food bioRxiv preprint doi: https://doi.org/10.1101/397687; this version posted August 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.

288 Microbiol 30(1): 260-266.

289 [11] Sun Bingsheng. Study on Fermentation of Non-alcoholic Beverage Beverage

290 Similar to Beer with Aroma-Producing Strains of GeotrichumCandidum[D].Shandong

291 Institute of Light Industry,2009.

292 [12] S.F. Cavalitto,C.F. Mignone. Application of factorial and Doehlert designs for

293 optimization of protopectinase production by a Geotrichum klebahnii strain[J].

294 Process Biochemistry,2006,42(2).

295 [13] Khoramnia, A., et al. (2013). "Improvement of medium chain fatty acid content

296 and antimicrobial activity of coconut oil via solid-state fermentation using a

297 Malaysian Geotrichum candidum." Biomed Res Int 2013: 954542.

298 [14 He Xiaorong , Hu Shibin,Zheng Zhiwei. Geotrichum candidum for treatment of

299 corn alcohol wastewater and production of single cell protein [J]. Environmental

300 pollution & prevention,2007(10):721-724+730

301 [15] Yan Bin, Liu Mingdeng. Concentrated Molasses Alcohol Wastewater

302 Fermentation Production of Geotrichum [J]. BIOTECHNOLOGY,2002(03):38-39.

303 [16] Xiong Zheng, Liu You-xun, Yan Ke-liang, Chen Jing-bo, Zhang

304 Xiao-tong.Study on Fermentation of Geotrichum candidum in High-concentration

305 Inosine Wastewater[J].Food Science and Technology,2008(03):41-44

306 [17] Kondo, K., et al. (2012). "Expression, and Molecular and Enzymatic

307 Characterization of Cu-Containing Nitrite Reductase from a Marine

308 Ammonia-Oxidizing Gammaproteobacterium, Nitrosococcus oceani." Microbes and

309 Environments 27(4): 407-412. bioRxiv preprint doi: https://doi.org/10.1101/397687; this version posted August 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.

310 [18] Smith, M.T., Poot, G.A., De Cock, A.W.A.M., 2000. Re-examination of some

311 species of the genus Geotrichum Link:Fr. Antonie van Leeuwenhoek 77,71–8

312 [19] Oussama Ahrazem, A. P., Juan Antonio Leal (2002). "Fungal cell-wall

313 galactomannans isolated from Geotrichum spp.and their teleomorphs, Dipodascus and

314 Galactomyces."

315 [20]. Zhu Liang. Research progress on new biological treatment technology for

316 wastewater with high ammonia nitrogen and low C/N ratio[A]. Chinese Society for

317 Environmental Sciences. Proceedings of the 2015 Annual Conference of Chinese

318 Society of Environmental Sciences (Volume Two)[ C]. Chinese Society for

319 Environmental Sciences（Chinese Society for Environmental Sciences）:,2015:5.

320 [21] Zhang Shao-hui, Kang Shu-qin. Start-up and Influence Factors of Short cut

321 Nitrification Reactor at Low C/N Ratio [J]. CHINAWATER ＆

322 WASTEWATER,2010,26(11):96-99

323 [22]Shen Yanbing.Study on the Sewage Advanced Denitrification Treatment with the

324 low carbon-to-nitrogen ratio [D]. Beijing Jiaotong University,2013

325 [23] Zhu Tingting. Enhancement of low C/N wastewater treatment in a microbial

326 electrolysis cell[D]. Danlian University of Technology,2016.

327 [24] Peng, P., et al. (2018). "Effect of adding low-concentration of rhamnolipid on

328 reactor performances and microbial community evolution in MBBRs for low C/N

329 ratio and antibiotic wastewater treatment." Bioresour Technol 256: 557-561.

330 [25] Aouidi, F., et al. (2010). "Use of cheese whey to enhance Geotrichum candidum

331 biomass production in olive mill wastewater." J Ind Microbiol Biotechnol 37(8): bioRxiv preprint doi: https://doi.org/10.1101/397687; this version posted August 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.

332 877-882.

333 [26] Yin Liang. Study of Synergetic Degradation and Decolorization of Azo Dye by

334 Mixed Consortium [D].South China University of Technology,2009.

335 [27] Ren Yan , Mei Yun , Zeng Yan , Qin Li-kang. Purification of Wastewater from

336 Potato Starch Production of Ozone Treatment by Geotrichum Candidum [J]. Food

337 Research and Development,2010,31(07):35-38

338 [28] Qu Jing-ran,Liu Yu,Song Jun-mei.Study on Fermentation of Geotrichum

339 candidum with Waste Water[J].Food Research and Development,2005(03):99-102.

340 [29] Li Yu, Li Qi-jiu, Yin Yi-ting, LI Yi-ran,WEI Bo-feng, WANG Xiao-yu, LI Su-yu.

341 The Experimental Condition of Purificationand Being Resources Of Wastewater from

342 Maize Starch Processing by Geotrichum Candidum [J]. Journal of LIAONING

343 University,2008(01):81-84.

344 [30] Michael Daum, W. Z., 1 Hans Papen,1 Karin Kloos,2 Kerstin Nawrath,2

345 Hermann Bothe2 "Physiological and Molecular Biological Characterization of

346 Ammonia Oxidation of the Heterotrophic Nitrifier Pseudomonas putida."

347 Curr.Mierobiol.1998.37(4):281 一 288.

348 [31] HJ 535-2009. Water quality.Determination of ammonia nitrogen.Nessler's reagent

349 spectrophotometry[S].

350 351 352 353 354 355 356 357 bioRxiv preprint doi: https://doi.org/10.1101/397687; this version posted August 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.

358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 Figures 377

378 379

380 (A) (B) (C)

381

382 Fig. 1. Morphologies of Galactomyces candidum colonies cultivated using YPD

383 medium (A); isolation of G. candidum strain genome (B), where column 1 shows the

384 DL 23130 DNA markers and columns 2 and 3 show isolation of the G. candidum bioRxiv preprint doi: https://doi.org/10.1101/397687; this version posted August 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.

385 strain genome; identification of the PCR products of G. candidum (C), where columns

386 1 and 2 show PCR products of the ITS rRNA gene and column 3 shows the DL 1500

387 DNA markers.

388

389

390 Fig. 2. Phylogenetic tree constructed from GC and comparative strains by

391 neighbor-joining method. Bar indicating 0.002 is genetic distance.

392

393

394

395

396

397

398

399

400 bioRxiv preprint doi: https://doi.org/10.1101/397687; this version posted August 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.

401

402

403

404 Fig. 3. Differences in 16S rRNA gene sequences among Galactomyces candidum

405 strains WM 04.493 KP132255.1 (1) and LC317625.1 (2), and GC strains (3).

406

407

408

409

410

411

412

413

414

415

416

417

418 bioRxiv preprint doi: https://doi.org/10.1101/397687; this version posted August 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.

419

420

421 Fig. 4. Galactomyces candidum growth curve.

422

423

424

425

426

427

428

429

430

431

432

433

434

435 bioRxiv preprint doi: https://doi.org/10.1101/397687; this version posted August 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.

436

437 (A) (B)

438 Fig. 5. Effect of different pH conditions on Galactomyces candidum cell growth (A)

439 and ammonium removal efficiency (B) at 30 °C.

440

441

442

443

444

445

446

447

448

449

450

451

452

453 bioRxiv preprint doi: https://doi.org/10.1101/397687; this version posted August 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.

454

455 (A) (B)

456 Fig. 6. Effect of different temperature conditions on Galactomyces candidum cell

457 growth (A) and ammonium removal efficiency (B).

458

459

460

461

462

463

464

465

466

467

468

469

470

471 bioRxiv preprint doi: https://doi.org/10.1101/397687; this version posted August 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license.

472

473

474 Fig. 7. Effect of different C:N ratio conditions on Galactomyces candidum cell

475 growth (A) and ammonium removal efficiency (B).

476