4585 JMed Genet 1996;33:458-464 Human xc-N-acetylgalactosaminidase Qx-NAGA) deficiency: new mutations and the paradox J Med Genet: first published as 10.1136/jmg.33.6.458 on 1 June 1996. Downloaded from between genotype and phenotype J L M Keulemans, A J J Reuser, M A Kroos, R Willemsen, M M P Hermans, A M W van den Ouweland, J G N de Jong, R A Wevers, W 0 Renier, D Schindler, M J Coll, A Chabas, H Sakuraba, Y Suzuki, 0 P van Diggelen Abstract reported the second independent case of a- Up to now eight patients with a-NAGA NAGA deficiency with an entirely different deficiency have been described. This in- clinical phenotype. This patient had a late onset cludes the newly identified patient re- disease with slight facial coarseness, dis- ported here who died unexpectedly aged seminated angiokeratoma, and mild intellectual II years of hypoxia during convulsions; impairment (IQ= 70), but without neuro- necropsy was not performed. logical symptoms. Unlike the infantile cases, Three patients have been genotyped pre- this patient had prominent vacuolisation in all viously and here we report the mutations dermal cells, most prominently in vascular and in the other five patients, including two lymphatic endothelial cells and eccrine sweat new mutations (S160C and E193X). The gland cells, but also in dermal neural cells and newly identified patient is consanguineous fibroblasts.' The glomerular endothelial cells with the first patients reported with a- but not the epithelial kidney cells are involved NAGA deficiency and neuroaxonal dys- and also blood lymphocytes are vacuolised.6 trophy and they all had the a-NAGA geno- These three patients shared, however, the type E325KIE325K. abnormal urinary excretion of specific oli- Clinical heterogeneity among patients gosaccharides. The major compounds are si- with x-NAGA deficiency is extreme. Two alylglycopeptides of the 0-glycosidic type with Department of affected sibs, homozygotes for E325K, are serine or threonine linked to the a-N-acet- Clinical Genetics, severely affected and have the signs and ylgalactosamine (aGalNAc) moieties.78 Using Erasmus University, PO Box 1738, 3000 DR symptoms of infantile neuroaxonal dys- an axGalNAc specific lectin, intralysosomal Rotterdam, The trophy, but prominent vacuolisation is storage products were shown in lysosomes of Netherlands lacking. The mildly affected patients (two cultured fibroblasts from the infantile patients.9 http://jmg.bmj.com/ J L M Keulemans families, three patients) at the opposite The a-NAGA gene codes for 411 amino A J J Reuser M A Kroos end of the clinical spectrum have clear acids'1 and consists of nine exons." Mutation R Willemsen vacuolisation and angiokeratoma but no analysis of the ox-NAGA gene showed the M M P Hermans overt manifestations. Two of missense mutation E325K in the infantile A M W van den neurological Ouweland them are homozygous for the stop muta- cases13; both patients were homozygous for O P van Diggelen tion E193X, leading to complete loss of this mutation. The adult patient was found a-NAGA protein. These observations are to be homozygous for the missense mutation Institute of Neurology 14 on September 30, 2021 by guest. Protected copyright. and Department of difficult to reconcile with a simple geno- R329W. Child Neurology, type-phenotype correlation and we sug- Recently, four additional patients with a- of University gest that factors or genes other than a- NAGA deficiency were reported in two in- Nijmegen, The Netherlands NAGA contribute to the clinical hetero- dependent families. The index case in the J G N de Jong geneity of the eight patients with a-NAGA Dutch family, reported by de Jong et al,'5 had R A Wevers deficiency. psychomotor retardation at the age of 4 years. W 0 Renier At the metabolic level, the patients with Screening her sibs showed that a healthy sib with Institute for Human a-NAGA deficiency are similar. The major a-NAGA deficiency has no overt clinical symp- Genetics, University of abnormal urinary oligosaccharides are si- toms at the age of3 years. Chabas etal'6 reported Germany Wurzburg, 0 with a mild D Schindler alylglycopeptides ofthe linked type. Our adult patients of Spanish origin enzymatic studies indicated that these phenotype consisting of angiokeratoma, slight Institute of Clinical compounds are not the primary lysosomal dysmorphism, lymphoedema, and prominent Biochemistry, storage products. vacuolisation in endothelial cells, resembling Barcelona, Spain Kanzaki et al.5 In this M J Coll ( Med Genet 1996;33:458-464) the case reported by paper A Chabas we report the mutations of these four patients and describe a new German case with infantile a- Department of Key words: ac-N-acetylgalactosaminidase; a-NAGA de- Clinical Genetics, The ficiency; processing. NAGAdeficiency. The genotype andphenotype Tokyo Metropolitan of the presently known eight cases of a-NAGA Institute of Medical deficiency are discussed. Science, Tokyo, Japan In 1987 two German infants were reported by H Sakuraba Van Diggelen et ail with a profound deficiency Y Suzuki of the lysosomal enzyme a-N-acetylgalactos- Patients and methods Correspondence to aminidase (ot-NAGA). Schindler et al2 reported CASE REPORTS Dr van Diggelen. that the patients had infantile neuroaxonal dys- The two German brothers, first reported by van Received 18 October 1995 visceral involvement or Diggelen et all and Schindler et aP with a severe Revised version accepted for trophy without dys- publication 9 January 1996 morphism. Two years later Kanzaki et al-5 infantile form of at-NAGA deficiency, are Human a-N-acetylgalactosaminidase (a-NAGA) deficiency: new mutations and the paradox between genotype and phenotype 459 Table 1 Oligonucleotide primers used to sequence and PCR amplify the coding regions of on visual examination, but neurological tests the a-NAGA gene have not been performed. Length offragment sequenced The Spanish patients reported by Chabas et Exon* Primer sequencest and (location in gene*) and (relative position to exont) al'6 are designated El.1 and E1.2. J Med Genet: first published as 10.1136/jmg.33.6.458 on 1 June 1996. Downloaded from 1 s: GCCTAAGGTTGAGGGCGG (1646-1663) 228 bp (-60§ to +31) as: GAAGGGCCAAAGCACTCCTT (1854-1873) 2 s: AGCTGTGGGGGCAACTGATA (3479-3498) 223 bp (-11 to + 2) CELL CULTURE AND ENZYME ASSAYS as: GGCAAGGCTCATCAGGTGA (3683-3701) 3 s: GAGGCAGGGTGTGGGTGA (4101-4118) 308 bp (-29 to +32) Skin fibroblasts were cultured according to as: GCCCTAAGCGAGGTAGGGTG (4389-4408) routine procedures in Ham's F10 medium sup- 4 s: GTCCTGCTTGAGCCCACTGT (4777-4796) 260 bp (-17 to + 23) as: CCCTCCCCGT' TGCCTAC (5019-5036) plemented with 10% fetal bovine serum and 5 s: CCAGACTGCCTCCTGCACTT (5244-5263) 204 bp (-22 to +29) antibiotics. The cells were harvested with tryp- as: AGGTAAGGAGGCCTGGGTGT (5428-5447) 6 s: CTGGTGCTGGACTCTGCCTT (6157-6176) 248 bp (-7 to + 18) sin seven days after the last subculture and as: GCAGGGTCGTCACAGATGG (6386-6404) were stored at - 70°C until use. 7 s: CCTCCTTGAGGAGATGAGAGC (8991-9011) 282 bp (-4 to + 13) as: CTCAGCCCTCCCCTTCCTT (9254-9272) a-N-acetylgalactosaminidase (xNAGA) ac- 8 s: AGATAAGCTGGGGTGCTGGA (10832-10851) 351 bp (-64 to +5) tivity was assayed in homogenates prepared as: CCCACAGAAATCTGAAGCCC (11163-11182) 9 s: CTGTGCCCCACTCTCATGG (11587-11605) 226 bp (-12 to + 9¶) by sonication of cultured fibroblasts in water. as: AGGCTCAGTGGTGCCACC (11795-11812) Reaction mixtures consisted of 10,ul homo- * Exon number and position of nucleotide in a-NAGA gene according to accession No M59199. genate (30 jug protein for patient materials or t s = sense strand; as = antisense. All primers shown in 5' to 3' direction. 5 jug for controls) and 20 p1 1 mmol/l MU- t Relative position to exon; - = upstream and + = downstream of exon. § Position upstream of start codon in exon 1. xGalNAc, Moscerdam Substrates, Rotterdam) ¶ Position downstream of stop codon in exon 9. in McIlvain's phosphate/citrate buffer, pH 4.7. After incubation for one hour at 37°C, the reactions were terminated by the addition of Table 2 The mutations in all patients with a-NAGA deficiency 200,ul 0.5 mol/I Na2CO3/NaHCO3, pH 10.7, Patient Nucleotide change* (exonlexon) Protein change* Reference and the fluorescence of 4-methylumbelliferone (MU) was measured with a Fluoroskan (Titer- D1.1 G11005A (8/8) E325K/E325K 13 D1.2 G11005A (8/8) E325K/E325K 13 tek) fluorimeter. ,B-galactosidase activity, using D2.1 G11005A (8/8) E325K/E325K Present paper an MU substrate, and protein content of cell NLl.I C4969G/G11005A (4/8) S160C/E325K Present paper NL1.2 C4969G/G11005A (4/8) S160C/E325K Present paper homogenates was determined as described pre- Jl.1 C11017T (8/8) R329W/R329W 14 viously.'7 ,B-galactosidase was also determined El.I G5371T (5/5) E193X/E193X Present paper - E1.2 G5371T (5/5) E193X/E193X Present paper with the disaccharide Gal/Il 3GalNAc (Oxford GlycoSystems) in a galactose de- * Nucleotide and amino acid numbering is according to Yamauchi et al'0 and accession No M59199. hydrogenase based assay.'8 Reaction mixtures The exons in which the mutation was found are shown in brackets. (30 pl) contained 20 pg protein from sonicated fibroblast homogenates, 2-7 mmol/l of the dis- accharide, 67 mmol/l NaCl in 67 mmol/l so- designated Dl. 1 and D1.2. The patients have dium acetate buffer, pH 4 3, and were remained in a vegetative state for the last few incubated for three hours at 37°C, after which http://jmg.bmj.com/ years and are at present 12 and 1 1 years of age. 200 pl 0 1 mol/I Tris/HCl, pH 8-6 containing The newly diagnosed German patient D2. 1 0-6 mmol/1 NAD+ and 0-13 U galactose de- lived in the same village as the Dl family and hydrogenase (Boehringer) was added.