DOCSLIB.ORG

Human Xc-N-Acetylgalactosaminidase Qx-NAGA)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Human Xc-N-Acetylgalactosaminidase Qx-NAGA) 4585 JMed Genet 1996;33:458-464 Human xc-N-acetylgalactosaminidase Qx-NAGA) deficiency: new mutations and the paradox J Med Genet: first published as 10.1136/jmg.33.6.458 on 1 June 1996. Downloaded from between genotype and phenotype J L M Keulemans, A J J Reuser, M A Kroos, R Willemsen, M M P Hermans, A M W van den Ouweland, J G N de Jong, R A Wevers, W 0 Renier, D Schindler, M J Coll, A Chabas, H Sakuraba, Y Suzuki, 0 P van Diggelen Abstract reported the second independent case of a- Up to now eight patients with a-NAGA NAGA deficiency with an entirely different deficiency have been described. This in- clinical phenotype. This patient had a late onset cludes the newly identified patient re- disease with slight facial coarseness, dis- ported here who died unexpectedly aged seminated angiokeratoma, and mild intellectual II years of hypoxia during convulsions; impairment (IQ= 70), but without neuro- necropsy was not performed. logical symptoms. Unlike the infantile cases, Three patients have been genotyped pre- this patient had prominent vacuolisation in all viously and here we report the mutations dermal cells, most prominently in vascular and in the other five patients, including two lymphatic endothelial cells and eccrine sweat new mutations (S160C and E193X). The gland cells, but also in dermal neural cells and newly identified patient is consanguineous fibroblasts.' The glomerular endothelial cells with the first patients reported with a- but not the epithelial kidney cells are involved NAGA deficiency and neuroaxonal dys- and also blood lymphocytes are vacuolised.6 trophy and they all had the a-NAGA geno- These three patients shared, however, the type E325KIE325K. abnormal urinary excretion of specific oli- Clinical heterogeneity among patients gosaccharides. The major compounds are si- with x-NAGA deficiency is extreme. Two alylglycopeptides of the 0-glycosidic type with Department of affected sibs, homozygotes for E325K, are serine or threonine linked to the a-N-acet- Clinical Genetics, severely affected and have the signs and ylgalactosamine (aGalNAc) moieties.78 Using Erasmus University, PO Box 1738, 3000 DR symptoms of infantile neuroaxonal dys- an axGalNAc specific lectin, intralysosomal Rotterdam, The trophy, but prominent vacuolisation is storage products were shown in lysosomes of Netherlands lacking. The mildly affected patients (two cultured fibroblasts from the infantile patients.9 http://jmg.bmj.com/ J L M Keulemans families, three patients) at the opposite The a-NAGA gene codes for 411 amino A J J Reuser M A Kroos end of the clinical spectrum have clear acids'1 and consists of nine exons." Mutation R Willemsen vacuolisation and angiokeratoma but no analysis of the ox-NAGA gene showed the M M P Hermans overt manifestations. Two of missense mutation E325K in the infantile A M W van den neurological Ouweland them are homozygous for the stop muta- cases13; both patients were homozygous for O P van Diggelen tion E193X, leading to complete loss of this mutation. The adult patient was found a-NAGA protein. These observations are to be homozygous for the missense mutation Institute of Neurology 14 on September 30, 2021 by guest. Protected copyright. and Department of difficult to reconcile with a simple geno- R329W. Child Neurology, type-phenotype correlation and we sug- Recently, four additional patients with a- of University gest that factors or genes other than a- NAGA deficiency were reported in two in- Nijmegen, The Netherlands NAGA contribute to the clinical hetero- dependent families. The index case in the J G N de Jong geneity of the eight patients with a-NAGA Dutch family, reported by de Jong et al,'5 had R A Wevers deficiency. psychomotor retardation at the age of 4 years. W 0 Renier At the metabolic level, the patients with Screening her sibs showed that a healthy sib with Institute for Human a-NAGA deficiency are similar. The major a-NAGA deficiency has no overt clinical symp- Genetics, University of abnormal urinary oligosaccharides are si- toms at the age of3 years. Chabas etal'6 reported Germany Wurzburg, 0 with a mild D Schindler alylglycopeptides ofthe linked type. Our adult patients of Spanish origin enzymatic studies indicated that these phenotype consisting of angiokeratoma, slight Institute of Clinical compounds are not the primary lysosomal dysmorphism, lymphoedema, and prominent Biochemistry, storage products. vacuolisation in endothelial cells, resembling Barcelona, Spain Kanzaki et al.5 In this M J Coll ( Med Genet 1996;33:458-464) the case reported by paper A Chabas we report the mutations of these four patients and describe a new German case with infantile a- Department of Key words: ac-N-acetylgalactosaminidase; a-NAGA de- Clinical Genetics, The ficiency; processing. NAGAdeficiency. The genotype andphenotype Tokyo Metropolitan of the presently known eight cases of a-NAGA Institute of Medical deficiency are discussed. Science, Tokyo, Japan In 1987 two German infants were reported by H Sakuraba Van Diggelen et ail with a profound deficiency Y Suzuki of the lysosomal enzyme a-N-acetylgalactos- Patients and methods Correspondence to aminidase (ot-NAGA). Schindler et al2 reported CASE REPORTS Dr van Diggelen. that the patients had infantile neuroaxonal dys- The two German brothers, first reported by van Received 18 October 1995 visceral involvement or Diggelen et all and Schindler et aP with a severe Revised version accepted for trophy without dys- publication 9 January 1996 morphism. Two years later Kanzaki et al-5 infantile form of at-NAGA deficiency, are Human a-N-acetylgalactosaminidase (a-NAGA) deficiency: new mutations and the paradox between genotype and phenotype 459 Table 1 Oligonucleotide primers used to sequence and PCR amplify the coding regions of on visual examination, but neurological tests the a-NAGA gene have not been performed. Length offragment sequenced The Spanish patients reported by Chabas et Exon* Primer sequencest and (location in gene*) and (relative position to exont) al'6 are designated El.1 and E1.2. J Med Genet: first published as 10.1136/jmg.33.6.458 on 1 June 1996. Downloaded from 1 s: GCCTAAGGTTGAGGGCGG (1646-1663) 228 bp (-60§ to +31) as: GAAGGGCCAAAGCACTCCTT (1854-1873) 2 s: AGCTGTGGGGGCAACTGATA (3479-3498) 223 bp (-11 to + 2) CELL CULTURE AND ENZYME ASSAYS as: GGCAAGGCTCATCAGGTGA (3683-3701) 3 s: GAGGCAGGGTGTGGGTGA (4101-4118) 308 bp (-29 to +32) Skin fibroblasts were cultured according to as: GCCCTAAGCGAGGTAGGGTG (4389-4408) routine procedures in Ham's F10 medium sup- 4 s: GTCCTGCTTGAGCCCACTGT (4777-4796) 260 bp (-17 to + 23) as: CCCTCCCCGT' TGCCTAC (5019-5036) plemented with 10% fetal bovine serum and 5 s: CCAGACTGCCTCCTGCACTT (5244-5263) 204 bp (-22 to +29) antibiotics. The cells were harvested with tryp- as: AGGTAAGGAGGCCTGGGTGT (5428-5447) 6 s: CTGGTGCTGGACTCTGCCTT (6157-6176) 248 bp (-7 to + 18) sin seven days after the last subculture and as: GCAGGGTCGTCACAGATGG (6386-6404) were stored at - 70°C until use. 7 s: CCTCCTTGAGGAGATGAGAGC (8991-9011) 282 bp (-4 to + 13) as: CTCAGCCCTCCCCTTCCTT (9254-9272) a-N-acetylgalactosaminidase (xNAGA) ac- 8 s: AGATAAGCTGGGGTGCTGGA (10832-10851) 351 bp (-64 to +5) tivity was assayed in homogenates prepared as: CCCACAGAAATCTGAAGCCC (11163-11182) 9 s: CTGTGCCCCACTCTCATGG (11587-11605) 226 bp (-12 to + 9¶) by sonication of cultured fibroblasts in water. as: AGGCTCAGTGGTGCCACC (11795-11812) Reaction mixtures consisted of 10,ul homo- * Exon number and position of nucleotide in a-NAGA gene according to accession No M59199. genate (30 jug protein for patient materials or t s = sense strand; as = antisense. All primers shown in 5' to 3' direction. 5 jug for controls) and 20 p1 1 mmol/l MU- t Relative position to exon; - = upstream and + = downstream of exon. § Position upstream of start codon in exon 1. xGalNAc, Moscerdam Substrates, Rotterdam) ¶ Position downstream of stop codon in exon 9. in McIlvain's phosphate/citrate buffer, pH 4.7. After incubation for one hour at 37°C, the reactions were terminated by the addition of Table 2 The mutations in all patients with a-NAGA deficiency 200,ul 0.5 mol/I Na2CO3/NaHCO3, pH 10.7, Patient Nucleotide change* (exonlexon) Protein change* Reference and the fluorescence of 4-methylumbelliferone (MU) was measured with a Fluoroskan (Titer- D1.1 G11005A (8/8) E325K/E325K 13 D1.2 G11005A (8/8) E325K/E325K 13 tek) fluorimeter. ,B-galactosidase activity, using D2.1 G11005A (8/8) E325K/E325K Present paper an MU substrate, and protein content of cell NLl.I C4969G/G11005A (4/8) S160C/E325K Present paper NL1.2 C4969G/G11005A (4/8) S160C/E325K Present paper homogenates was determined as described pre- Jl.1 C11017T (8/8) R329W/R329W 14 viously.'7 ,B-galactosidase was also determined El.I G5371T (5/5) E193X/E193X Present paper - E1.2 G5371T (5/5) E193X/E193X Present paper with the disaccharide Gal/Il 3GalNAc (Oxford GlycoSystems) in a galactose de- * Nucleotide and amino acid numbering is according to Yamauchi et al'0 and accession No M59199. hydrogenase based assay.'8 Reaction mixtures The exons in which the mutation was found are shown in brackets. (30 pl) contained 20 pg protein from sonicated fibroblast homogenates, 2-7 mmol/l of the dis- accharide, 67 mmol/l NaCl in 67 mmol/l so- designated Dl. 1 and D1.2. The patients have dium acetate buffer, pH 4 3, and were remained in a vegetative state for the last few incubated for three hours at 37°C, after which http://jmg.bmj.com/ years and are at present 12 and 1 1 years of age. 200 pl 0 1 mol/I Tris/HCl, pH 8-6 containing The newly diagnosed German patient D2. 1 0-6 mmol/1 NAD+ and 0-13 U galactose de- lived in the same village as the Dl family and hydrogenase (Boehringer) was added.
Load more

Recommended publications
  • (12) United States Patent (10) Patent No.: US 8,323,640 B2 Sakuraba Et Al
    USOO8323640B2 (12) United States Patent (10) Patent No.: US 8,323,640 B2 Sakuraba et al. (45) Date of Patent: *Dec. 4, 2012 (54) HIGHLY FUNCTIONAL ENZYME HAVING OTHER PUBLICATIONS O-GALACTOSIDASE ACTIVITY Broun et al., Catalytic plasticity of fatty acid modification enzymes (75) Inventors: Hitoshi Sakuraba, Abiko (JP); Youichi underlying chemical diversity of plant lipids. Science, 1998, vol. 282: Tajima, Tokyo (JP); Mai Ito, Tokyo 1315-1317. (JP); Seiichi Aikawa, Tokyo (JP); Cameron ER. Recent advances in transgenic technology. 1997, vol. T: 253-265. Fumiko Aikawa, Tokyo (JP) Chica et al., Semi-rational approaches to engineering enzyme activ (73) Assignees: Tokyo Metropolitan Organization For ity: combining the benefits of directed evolution and rational design. Curr, opi. Biotechnol., 2005, vol. 16:378-384. Medical Research, Tokyo (JP); Altif Couzin et al. As Gelsinger case ends, Gene therapy Suffers another Laboratories, Tokyo (JP) blow. Science, 2005, vol. 307: 1028. Devos et al., Practical Limits of Function prediction. Proteins: Struc (*) Notice: Subject to any disclaimer, the term of this ture, Function, and Genetics. 2000, vol. 41: 98-107. patent is extended or adjusted under 35 Donsante et al., AAV vector integration sites in mouse hapatocellular U.S.C. 154(b) by 0 days. carcinoma. Science, 2007. vol. 317: 477. Juengst ET., What next for human gene therapy? BMJ., 2003, vol. This patent is Subject to a terminal dis 326: 1410-1411. claimer. Kappel et al., Regulating gene expression in transgenic animals. Current Opinion in Biotechnology 1992, vol. 3: 548-553. (21) Appl. No.: 13/052,632 Kimmelman J. Recent developments in gene transfer: risk and eth ics.
    [Show full text]
  • Supplementary Information Biocementation of Soil by Calcite/Aragonite Precipitation Using Pseudomonas Azotoformans and Citrobact
    Electronic Supplementary Material (ESI) for RSC Advances. This journal is © The Royal Society of Chemistry 2019 Supplementary Information Biocementation of soil by calcite/aragonite precipitation using Pseudomonas azotoformans and Citrobacter freundii derived enzymes Heba Abdel-Aleem1, Tarek Dishisha1, Amal Saafan2, Abduallah A. AbouKhadra3 and Yasser Gaber1,4,* 1Department of Microbiology and Immunology, Faculty of Pharmacy, Beni-Suef University, 62511, Beni-Suef, Egypt 2Department of Pharmaceutical Microbiology, Faculty of Pharmacy, Menoufia university, Shebeen El-kom, Egypt 3Department of Civil Engineering, Facutly of Engineering, Beni-Suef University, 62511, Beni- Suef, Egypt 4Department of Pharmaceutics and Pharmaceutical Technology, Faculty of Pharmacy, Mutah University, Al-karak, 61710, Jordan *Corresponding author: E-mail: [email protected] Tel. int +20 82 216 2133 ; Fax. int +20 82 216 2133 1 Supplementary Table 1: strains identified using BCL card (Gram positive spore forming bacilli) Sample/test A1 B1 B2 Y1a Y2a BXYL - - - - - BXYL (betaxylosidase), LysA - - - - - LysA (L- lysine arylamidase), AspA - - - + - AspA (L aspartate arylamidase), LeuA + + + + + LeuA (leucine arylamidase), PheA - + - - - PheA (phenylalanine arylamidase), ProA - - - + - ProA (L-proline arylamidase), BGAL - - - - - BGAL (beta galactosidase), PyrA + + + + + PyrA (L-pyrrolydonyl arylamidase), AGAL - - - - - AGAL (alpha galactosidase), AlaA - - - + - AlaA (alanine arylamidase), TyrA - - - - - TyrA (tyrosine arylamidase), BNAG + + + + + BNAG (beta-N-acetyl
    [Show full text]
  • Base Excision Repair Deficient Mice Lacking the Aag Alkyladenine DNA Glycosylase
    Proc. Natl. Acad. Sci. USA Vol. 94, pp. 13087–13092, November 1997 Genetics Base excision repair deficient mice lacking the Aag alkyladenine DNA glycosylase BEVIN P. ENGELWARD*†,GEERT WEEDA*‡,MICHAEL D. WYATT†,JOSE´ L. M. BROEKHOF‡,JAN DE WIT‡, INGRID DONKER‡,JAMES M. ALLAN†,BARRY GOLD§,JAN H. J. HOEIJMAKERS‡, AND LEONA D. SAMSON†¶ †Department of Molecular and Cellular Toxicology, Harvard School of Public Health, 665 Huntington Avenue, Boston, MA 02115; ‡Department of Cell Biology and Genetics, Medical Genetics Centre, Erasmus University, P.O. Box 1738, 3000 DR, Rotterdam, The Netherlands; and §Eppley Institute for Research in Cancer and Allied Diseases and Department of Pharmaceutical Sciences, University of Nebraska Medical Center, Omaha, NE 68198-6805 Edited by Philip Hanawalt, Stanford University, Stanford, CA, and approved September 30, 1997 (received for review August 8, 1997) ABSTRACT 3-methyladenine (3MeA) DNA glycosylases 11). The precise biological effects of all of the DNA lesions remove 3MeAs from alkylated DNA to initiate the base repaired by mammalian 3MeA DNA glycosylases are not yet excision repair pathway. Here we report the generation of mice known for mammals, though there is strong evidence that deficient in the 3MeA DNA glycosylase encoded by the Aag 3MeA is cytotoxic (12), and other lesions may be mutagenic, (Mpg) gene. Alkyladenine DNA glycosylase turns out to be the namely Hx (13), 8oxoG (14), 1,N6-ethenoadenine («A), and major DNA glycosylase not only for the cytotoxic 3MeA DNA N2,3-ethenoguanine (15, 16). It is important to note that each lesion, but also for the mutagenic 1,N6-ethenoadenine («A) of these DNA lesions can arise spontaneously in the DNA of and hypoxanthine lesions.
    [Show full text]
  • An in Vitro Model for Lysosomal Storage Diseases Using Aspartylglucosaminuria Patient Cells
    AN IN VITRO MODEL FOR LYSOSOMAL STORAGE DISEASES USING ASPARTYLGLUCOSAMINURIA PATIENT CELLS Master´s Thesis University of Turku MSc Degree Programme in Biomedical Sciences Drug Discovery and Development 4/2020 Maria Kjellman Supervisors Riikka Äänismaa, PhD Senior Scientist Therapy Area Rare Diseases Orion Corporation Orion Pharma Jarkko Venäläinen, PhD Principal Scientist Therapy Area Rare Diseases Orion Corporation Orion Pharma Ullamari Pesonen, PhD Professor of Pharmacology and Drug Development Institute of Biomedicine Faculty of Medicine University of Turku Pharmacology, Drug Development and Therapeutics The originality of this thesis has been verified in accordance with the University of Turku quality assurance system using the Turnitin OriginalityCheck service. ABSTRACT UNIVERSITY OF TURKU Institute of Biomedicine, Faculty of Medicine KJELLMAN, MARIA: An In Vitro Model for Lysosomal Storage Diseases Using Aspartylglucosaminuria Patient Cells Master‘s Thesis, 73 pages MSc Degree Programme in Biomedical Sciences Drug Discovery and Development April 2020 BACKGROUND Lysosomes are acidic organelles responsible for recycling of metabolic byproducts and cellular debris, and there are approximately 60 enzymes within lysosomes responsible for the recycling process. These enzymes can be malfunctional due to genetic mutations, which results in a lysosomal storage disease (LSD). One of these diseases is aspartylglucosaminuria (AGU) caused by an incorrectly folded aspartylglucosaminidase (AGA) enzyme, which results in a buildup of the substrate aspartylglucosamine. This enzymatic deficiency impairs the cellular function in both central nervous system (CNS) and periphery manifesting as an impaired physical and mental development. UNMET MEDICAL NEED Currently, there are no curative or even symptom alleviating treatments available. AIM The aim of this research was to establish a reliable in vitro model of LSD to enable repeatable experiments for drug development purposes.
    [Show full text]
  • Targeted Deletion of Alkylpurine-DNA-N-Glycosylase in Mice Eliminates Repair of 1,N6-Ethenoadenine and Hypoxanthine but Not of 3,N4-Ethenocytosine Or 8-Oxoguanine
    Proc. Natl. Acad. Sci. USA Vol. 94, pp. 12869–12874, November 1997 Biochemistry Targeted deletion of alkylpurine-DNA-N-glycosylase in mice eliminates repair of 1,N6-ethenoadenine and hypoxanthine but not of 3,N4-ethenocytosine or 8-oxoguanine B. HANG*, B. SINGER*†,G.P.MARGISON‡, AND R. H. ELDER‡ *Donner Laboratory, Lawrence Berkeley National Laboratory, University of California, Berkeley, CA 94720; and ‡Cancer Research Campaign Section of Genome Damage and Repair, Paterson Institute for Cancer Research, Christie Hospital (National Health Service) Trust, Manchester, M20 4BX, United Kingdom Communicated by H. Fraenkel-Conrat, University of California, Berkeley, CA, October 2, 1997 (received for review September 18, 1997) ABSTRACT It has previously been reported that 1,N6- A separate line of experimentation to assess the in vivo ethenoadenine («A), deaminated adenine (hypoxanthine, Hx), mutagenicity of various modified bases in differing repair and 7,8-dihydro-8-oxoguanine (8-oxoG), but not 3,N4- backgrounds used defined synthetic oligonucleotides or glo- ethenocytosine («C), are released from DNA in vitro by the bally modified vectors (12–15). Related to this are numerous DNA repair enzyme alkylpurine-DNA-N-glycosylase (APNG). in vitro experiments also using site-directed mutagenesis in To assess the potential contribution of APNG to the repair of which replication efficiency and changed base pairing could be each of these mutagenic lesions in vivo, we have used cell-free quantitated [reviewed by Singer and Essigmann, (15)]. These extracts of tissues from APNG-null mutant mice and wild-type data all yielded basic information on the potential biological controls. The ability of these extracts to cleave defined oli- role of modified bases in the absence of any repair capacity.
    [Show full text]
  • Active Hydrogen Bond Network (AHBN) and Applications for Improvement of Thermal Stability and Ph-Sensitivity of Pullulanase from Bacillus Naganoensis
    RESEARCH ARTICLE Active Hydrogen Bond Network (AHBN) and Applications for Improvement of Thermal Stability and pH-Sensitivity of Pullulanase from Bacillus naganoensis Qing-Yan Wang1☯, Neng-Zhong Xie1☯, Qi-Shi Du1,2*, Yan Qin1, Jian-Xiu Li1,3, Jian- Zong Meng3, Ri-Bo Huang1,3 a1111111111 1 State Key Laboratory of Biomass Enzyme Technology, National Engineering Research Center for Non- Food Biorefinery, Guangxi Academy of Sciences, Nanning, Guangxi, China, 2 Gordon Life Science Institute, a1111111111 Belmont, MA, United States of America, 3 Life Science and Technology College, Guangxi University, a1111111111 Nanning, Guangxi, China a1111111111 a1111111111 ☯ These authors contributed equally to this work. * [email protected] Abstract OPEN ACCESS Citation: Wang Q-Y, Xie N-Z, Du Q-S, Qin Y, Li J-X, A method, so called ªactive hydrogen bond networkº (AHBN), is proposed for site-directed Meng J-Z, et al. (2017) Active Hydrogen Bond mutations of hydrolytic enzymes. In an enzyme the AHBN consists of the active residues, Network (AHBN) and Applications for functional residues, and conservative water molecules, which are connected by hydrogen Improvement of Thermal Stability and pH- bonds, forming a three dimensional network. In the catalysis hydrolytic reactions of hydro- Sensitivity of Pullulanase from Bacillus naganoensis. PLoS ONE 12(1): e0169080. lytic enzymes AHBN is responsible for the transportation of protons and water molecules, doi:10.1371/journal.pone.0169080 and maintaining the active and dynamic structures of enzymes. The AHBN of pullulanase Editor: Eugene A. Permyakov, Russian Academy of BNPulA324 from Bacillus naganoensis was constructed based on a homologous model Medical Sciences, RUSSIAN FEDERATION structure using Swiss Model Protein-modeling Server according to the template structure of Received: October 6, 2016 pullulanase BAPulA (2WAN).
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]
  • Letters to Nature
    letters to nature Received 7 July; accepted 21 September 1998. 26. Tronrud, D. E. Conjugate-direction minimization: an improved method for the re®nement of macromolecules. Acta Crystallogr. A 48, 912±916 (1992). 1. Dalbey, R. E., Lively, M. O., Bron, S. & van Dijl, J. M. The chemistry and enzymology of the type 1 27. Wolfe, P. B., Wickner, W. & Goodman, J. M. Sequence of the leader peptidase gene of Escherichia coli signal peptidases. Protein Sci. 6, 1129±1138 (1997). and the orientation of leader peptidase in the bacterial envelope. J. Biol. Chem. 258, 12073±12080 2. Kuo, D. W. et al. Escherichia coli leader peptidase: production of an active form lacking a requirement (1983). for detergent and development of peptide substrates. Arch. Biochem. Biophys. 303, 274±280 (1993). 28. Kraulis, P.G. Molscript: a program to produce both detailed and schematic plots of protein structures. 3. Tschantz, W. R. et al. Characterization of a soluble, catalytically active form of Escherichia coli leader J. Appl. Crystallogr. 24, 946±950 (1991). peptidase: requirement of detergent or phospholipid for optimal activity. Biochemistry 34, 3935±3941 29. Nicholls, A., Sharp, K. A. & Honig, B. Protein folding and association: insights from the interfacial and (1995). the thermodynamic properties of hydrocarbons. Proteins Struct. Funct. Genet. 11, 281±296 (1991). 4. Allsop, A. E. et al.inAnti-Infectives, Recent Advances in Chemistry and Structure-Activity Relationships 30. Meritt, E. A. & Bacon, D. J. Raster3D: photorealistic molecular graphics. Methods Enzymol. 277, 505± (eds Bently, P. H. & O'Hanlon, P. J.) 61±72 (R. Soc. Chem., Cambridge, 1997).
    [Show full text]
  • Partial Purification of the Mammalian Alpha- Glucosidase Inhibitor from Melothria Sp. (Fam. Cucurbitaceae) Leaves and Stem Extract: in Vitro
    44 Partial Purification of the Mammalian Alpha- glucosidase Inhibitor from Melothria sp. (Fam. Cucurbitaceae) Leaves and Stem Extract: In Vitro Edmark C. Kamantigue1*, Noel S. Quiming2, Judylynn N. Solidum3, and Marilou G. Nicolas2 1 Pharmacy Department, College of Allied Health, National University, 2Department of Physical Science and Mathematics, College of Arts and Sciences, University of the Philippines Manila, and 3Pharmaceutical Chemistry Department, College of Pharmacy, University of the Philippines Manila *Corresponding Author: [email protected] Abstract: Diabetes Mellitus Type 2 (DM2) is a chronic disease characterized by insufficient insulin levels, pancreatic beta cells function loss and insulin resistance in peripheral tissue. Voglibose and acarbose are the clinically used alpha-glucosidase inhibitor; however, adverse effects such as nausea, diarrhea, and bloating hinder the utilization of these agents. Hence, there is a need to explore for an alternative drug that has fewer side effects, better activity, and more affordable than the current commercial drugs. In this study, Melothria sp. was purified using normal phase column chromatography. Seven fractions (fraction A-G) were separated and tested for mammalian alpha-glucosidase assay in vitro and phytochemical screening was conducted to determine the metabolites present in each fraction. Fraction F showed a promising activity against the enzyme and comparable to other natural products and commercial alpha- glucosidase agent, acarbose. Phenolic compounds such as tannins and flavonoids based on the phytochemical screening were detected present in the sample which can be responsible in the inhibition activity of the semi-purified extracts. Keywords: Diabetes Mellitus; Mammalian alpha-glucosidase; Piri-pipino; Cucurbitaceae; Melothria sp. 45 1.
    [Show full text]
  • Fast Urinary Screening of Oligosaccharidoses by MALDI-TOF/TOF Mass Spectrometry
    Fast urinary screening of oligosaccharidoses by MALDI-TOF/TOF mass spectrometry. Laurent Bonesso, Monique Piraud, Céline Caruba, Emmanuel van Obberghen, Raymond Mengual, Charlotte Hinault To cite this version: Laurent Bonesso, Monique Piraud, Céline Caruba, Emmanuel van Obberghen, Raymond Mengual, et al.. Fast urinary screening of oligosaccharidoses by MALDI-TOF/TOF mass spectrometry.. Orphanet Journal of Rare Diseases, BioMed Central, 2014, 9 (1), pp.19. 10.1186/1750-1172-9-19. inserm- 00945684 HAL Id: inserm-00945684 https://www.hal.inserm.fr/inserm-00945684 Submitted on 12 Feb 2014 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Bonesso et al. Orphanet Journal of Rare Diseases 2014, 9:19 http://www.ojrd.com/content/9/1/19 RESEARCH Open Access Fast urinary screening of oligosaccharidoses by MALDI-TOF/TOF mass spectrometry Laurent Bonesso1, Monique Piraud5, Céline Caruba1, Emmanuel Van Obberghen1,2,3,4, Raymond Mengual1† and Charlotte Hinault1,2,3,4*† Abstract Background: Oligosaccharidoses, which belong to the lysosomal storage diseases, are inherited metabolic disorders due to the absence or the loss of function of one of the enzymes involved in the catabolic pathway of glycoproteins and indirectly of glycosphingolipids.
    [Show full text]
  • International Conference
    5TH GLYCOPROTEINOSES INTERNATIONAL CONFERENCE Rome, Italy November 1-4 2017 EMBRACING INNOVATION ADVANCING THE CURE PROGRAM & ABSTRACTS 5TH GLYCOPROTEINOSES INTERNATIONAL CONFERENCE ROME, ITALY NOVEMBER 1-4 2017 EMBRACING INNOVATION ADVANCING THE CURE ISMRD would like to say a very special thank you to the following organizations and companies who have very generously given donations to support the 5th International Conference on Glycoproteinoses. ISMRD is an internationally focused not-for-profi t organization whose mission is to advocate for families and patients aff ected by one of the following disorders. Alpha-Mannosidosis THE WAGNER FOUNDATION Aspartylglucosaminuria Beta-Mannosidosis Fucosidosis Galactosialidosis ISMRD is very grateful for all the help and support that Symposia has given us Sialidosis (Mucolipidosis I) in the organization of our Conference on-the-ground support in Rome. Mucolipidosis II, II/III, III alpha/beta Mucolipidosis III Gamma Schindler Disease EMBRACING INNOVATION ADVANCING THE CURE SCIENTIFIC COMMITTEE: Alessandra d’Azzo CHAIR Contents Amelia Morrone Italy Richard Steet USA Welcome 2 Heather Flanagan-Steet USA ISMRD Mission & Governance 4 Dag Malm Norway ISMRD General Information 6 Thomas Braulke Dedicated to helping patients Germany in the rare disease community Stuart Kornfeld with unmet medical needs Scientifi c Program 10 USA Ultragenyx Pharmaceutical Inc. is a clinical-stage Family Program 14 ISMRD CONFERENCE biopharmaceutical company committed to creating new COMMITTEE: therapeutics to combat serious,
    [Show full text]
  • Oligosaccharide Screen, Urine
    Lab Dept: Urine/Stool Test Name: OLIGOSACCHARIDE SCREEN, URINE General Information Lab Order Codes: OLGO Synonyms: N/A CPT Codes: 84376 – Sugars (mono-, di-, oligosaccharides); single qualitative, each specimen Test Includes: This is a screening method for a subset of lysosomal storage disorders including: alpha-mannosidosis, aspartylglucosaminuria, fucosidosis, Schindler disease, GM1 gangliosidosis, Sandhoff disease, sialidosis, galactosialidosis, mucolipidoses types II and III, and Pompe disease. Logistics Test Indications: Investigation of possible oligosaccharidoses Lab Testing Sections: Chemistry - Sendouts Referred to: Mayo Medical Laboratories (MML Test: OLIGU) Phone Numbers: MIN Lab: 612-813-6280 STP Lab: 651-220-6550 Test Availability: Daily, 24 hours Turnaround Time: 4 – 8 days; performed Monday and Wednesday Special Instructions: Include family history, clinical condition (asymptomatic or acute episode), diet, and drug therapy information. Specimen Specimen Type: Urine, random collection Container: Plastic leakproof container (No preservatives) Draw Volume: 8 mL (Minimum: 2 mL) urine Processed Volume: Same as Draw Volume Collection: A random urine sample may be obtained by voiding into a urine cup and is often performed at the laboratory. Bring the refrigerated container to the lab. Make sure all specimens submitted to the laboratory are properly labeled with the patient’s name, medical record number and date of birth. Special Processing: Lab Staff: Aliquot specimen into a 13 mL urine tube, no preservative. Freeze immediately. Store and ship at frozen temperatures. Patient Preparation: None Sample Rejection: Mislabeled or unlabeled specimens Interpretive Reference Range: An interpretive report will be provided. This is a screening test; not all oligosachharidoses are detected. The resulting excretion profile may be characteristic of a specific disorder; however, abnormal results require confirmation by enzyme assay or molecular genetic testing.
    [Show full text]