US 20030104601A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2003/0104601 A1 DeAngelis (43) Pub. Date: Jun. 5, 2003

(54) CHONDROITINSYNTHASE GENE AND Publication Classification METHODS OF MAKING AND USING SAME (51) Int. Cl." ...... C12P 21/02; C12N 1/21; (76) Inventor: Paul L. DeAngelis, Edmond, OK (US) C07H 21/04; CO8B 37/00; C12N 9/24; C12N 15/74; Correspondence Address: C12O 1/68 DUNLAP, CODDING & ROGERS PC. (52) U.S. Cl...... 435/200; 435/69.1; 435/320.1; PO BOX 16370 435/252.3; 536/23.2; 536/54; OKLAHOMA CITY, OK 73114 (US) 435/6 (21) Appl. No.: 09/842,484 (57) ABSTRACT (22) Filed: Apr. 25, 2001 Related U.S. Application Data The present invention relates to a chondroitin Synthase gene and methods of making and using Same. In more particular, (63) Continuation-in-part of application No. 09/283,402, but not by way of limitation, the present invention relates to filed on Apr. 1, 1999, now abandoned, and which is a a chondroitin Synthase gene from Pasteurella multocida and continuation-in-part of application No. 09/437.277, methods of isolating and using Same. Additionally, the filed on Nov. 10, 1999, now Pat. No. 6,444447. present invention relates to the use of unsulfated chondroitin and its preparation, as well as conversion into modified (60) Provisional application No. 60/199,538, filed on Apr. versions Such as dermatan Sulfate and chondroitin Sulfate 25, 2000. polymers.

Patent Application Publication Jun. 5, 2003. Sheet 5 of 10 US 2003/0104601 A1

Std CS V HAS

2. S .

w y - as Y 8 as is a s sis

s O A4 C

- - - 12 14 16 18 20 22 Time (min) Fig. 3 Patent Application Publication US 2003/0104601 A1

r bib a vil ?t Patent Application Publication Jun. 5, 2003. Sheet 7 of 10 US 2003/0104601 A1

DEANGELIS STD. SNMOL 10/15/00 Standard 1000

800

600

400

200

O 10.0 20.0 30.0 40.0 50.0 60.0

SAMPLEF REPEAT 5NMOL. 10/15 Pasteurella 1000 Chondroitin

800

600

400

200

O 0 200 300 40.0 50.0 60.0 Patent Application Publication Jun. 5, 2003 Sheet 8 of 10 US 2003/0104601 A1

100

75

É 50

25

9 10 11 12 13 14 5 6 Time (min) Fig. 6

200

150

É 100

50

Time (min) Fig. 7 Patent Application Publication Jun. 5, 2003 Sheet 9 of 10 US 2003/0104601 A1

NMR of Typc F Polymer

HOD

5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 ppm Fig. 8 Patent Application Publication Jun. 5, 2003. Sheet 10 of 10 US 2003/0104601 A1

ABCase Treatment 0.012 0.010 0.008 0.006 e 0.004 0.002 O.OOO ADiOS -0.002 -0.004

25 50 75 100 minutes Fig. 9

ACase Treatment

0.012

0.010

0.008 t (). OO6 0.004 ADiOS OOO2

0.000 5() 75 minutes Fig. 10 US 2003/0104601 A1 Jun. 5, 2003

CHONIDROITN SYNTHASE GENE AND a GAG intermediate. Also GAGS may sequester or bind METHODS OF MAKING AND USING SAME certain proteins (e.g. growth or coagulation factors) to cell Surfaces. CROSS-REFERENCE TO RELATED 0008 Certain pathogenic bacteria produce an extracellu APPLICATIONS lar polysaccharide coating, called a capsule, which Serves as 0001. This application is related to U.S. provisional a virulence factor. In a few cases, the capsule is composed application Serial No. 60/199,538 filed Apr. 25, 2000 and of GAG or GAG-like polymers. As the microbial polysac entitled “POLYMER FORMATION AND RECOGNITION charide is identical or very similar to the host GAG, the MECHANISMS AND METHODS OF MAKING AND antibody response is either very limited or non-existent. The USING SAME'; is a continuation-in-part of pending U.S. capsule is thought to assist in the evasion of host defenses patent application Ser. No. 09/283,402, filed Apr. 4, 1999 Such as phagocytosis and complement. Examples of this and entitled “DNA ENCODING HYALURONAN SYN clever Strategy of molecular camouflage are the production THASE FROM PASTEURELLA MULTOCIDA AND of an authentic HA polysaccharide by Gram-negative Type METHODS OF USE"; and is a continuation-in-part of A Pasteurella multocida and Gram-positive Group A and C pending U.S. patent application Ser. No. 09/437,277, filed StreptococcuS. The HA capsule of these microbes increases Nov. 10, 1999 and entitled “POLYMER GRAFTING BY virulence by 10° to 10-fold as measured by LDsovalues, the POLYSACCHARIDE SYNTHASES. number of colony forming units that will kill 50% of the test animals after bacterial challenge. STATEMENT REGARDING FEDERALLY 0009. The invasiveness and pathogenicity of certain E. FUNDED RESEARCH coli Strains has also been attributed to their polysaccharide 0002 The government owns certain rights in the present capsules. Two Escherichia coli capsular types, K4 and K5, invention pursuant to a grant from the National Institutes of make polymers composed of GAG-like polymers. The E. Health (GM56497) and a grant from the National Science coli K4 polymer is an unsulfated chondroitin backbone Foundation (MCB-9876193). decorated with fructose side-branches on the C3 position of the GlcUA residues. The K5 capsular material is a polysac BACKGROUND OF THE INVENTION charide, called heparosan, identical to mammalian heparin except that the bacterial polymer is unsulfated and there is 0003) 1. Field of the Invention no epimerization of GlcUA to iduronic acid. 0004. The present invention relates to a chondroitin syn 0010. The studies of GAG biosynthesis have been instru thase gene and methods of making and using Same. In more mental in understanding polysaccharide production in gen particular, but not by way of limitation, the present invention eral. The HA synthases were the first GAG glycosyltrans relates to a chondroitin Synthase gene from Pasteurella ferases to be identified at the molecular level. These multocida and methods of isolating and using Same. Addi enzymes utilize UDP-Sugar nucleotide Substrates to produce tionally, the present invention relates to the use of unsulfated large polymers containing thousands of disaccharide chondroitin and its preparation, as well as conversion into repeats. The genes encoding bacterial, Vertebrate, and viral modified versions Such as dermatan Sulfate and chondroitin HAS enzymes have been cloned. In all these cases, expres Sulfate polymers. Sion studies demonstrated that transformation with DNA 0005 2. Background Information Relating to the Inven encoding a single HAS polypeptide conferred the ability of tion foreign hosts to Synthesize HA. Except for the most recent HAS to be identified, P. multocida pmHAS, these proteins 0006 Glycosaminoglycans GAGs are long linear have similar amino acid Sequences and predicted topology in polysaccharides consisting of disaccharide repeats that con the membrane. Two classes of HASs have been proposed to tain an amino Sugar and are found in most animals. Chon exist based on these structural differences as well as poten droitin B(1, 4)GlcUA-B(1, 3)GalNAc), heparin/heparan tial differences in reaction mechanism C.1 4)GlcUA-B(1, 4)GlcNAc, and hyaluronan IB(1, 4)GlcUA-B(1, 3)GlcNAc) are the three most prevalent 0011. The biochemical study of chondroitin biosynthesis GAGS found in humans. Chondroitin and heparin typically in vertebrates was initiated in the 1960s. Only recently have have n=20 to 100, while hyaluronan typically has n=10. the mammalian enzymes for elongation of the polysaccha Chondroitin and heparin are Synthesized as glycoproteins ride backbone of chondroitin been tentatively identified by and are Sulfated at various positions in vertebrates. Hyalu biochemical means. An 80-kDa GlcUA transferase found in roman is not Sulfated in Vertebrates. A Substantial fraction of vertebrate cartilage and liver was implicated in the biosyn the GlcUA residues of heparin and chondroitin are epimer thesis of the chondroitin backbone by photoaffinity labeling ized to form iduronic acid. with an azidoUDP-GlcUA probe. A preparation from bovine 0007 Many lower animals possess these same GAGs or serum with the appropriate GalNAc- and GlcUA-transferase very Similar molecules. GAGS play both Structural and activities in vitro was obtained by conventional chromatog recognition roles on the cell Surface and in the extracellular raphy, but Several bands on SDS polyacrylamide gels matrix. By virtue of their physical characteristics, namely a (including a few migrating ~80 kDa) were observed. high negative charge density and a multitude of polar 0012 Chondroitin polysaccharide (beta-1,3-GalNAc hydroxyl groups, GAGS help hydrate and expand tissues. beta-1,4-GlcUA); n=~10-2000) has use as a hyaluronan Numerous proteins bind selectively to one or more of the (HA) polysaccharide Substitute in medical or cosmetic appli GAGs. Thus the proteins found on cell surfaces or the cations. Both chondroitin and hyaluronan form Viscoelastic associated extracellular matrices (e.g. CD44, collagen, gels (Suitable for eye or joint applications) or hydrophilic, fibronectin) of different cell types may adhere or interact via hygroscopic materials (Suitable for moisturizer or wound US 2003/0104601 A1 Jun. 5, 2003 dressings). Unmodified or underivatized chondroitin is not multocida and methods of isolating and using Same. Addi known to exist or, if present, in Very Small quantities in the tionally, the present invention relates to the use of unsulfated human body. The main advantage is that byproducts of chondroitin and its preparation, as well as conversion into natural HA degradation (by shear, enzyme, radical or oxi modified versions Such as dermatan Sulfate and chondroitin dation processes) have certain biological activities with Sulfate polymers. respect to Vascularization, angiogenesis, cancer, tissue modulation, but similar byproducts of chondroitin (in the BRIEF DESCRIPTION OF THE SEVERAL proposed unsulfated, unmodified State) may not have the VIEWS OF THE DRAWINGS Same biological activity. The chondroitin polymers are more inert, loosely speaking, than the analogous HA molecule. 0017 FIG. 1. Sequence Alignment of pmCS and Chondroitin from either P. multocida Type F or a recombi pmHAS. The two Pasteurella GAG synthases are highly nant host containing the Pasteurella-derived or Pasteurella homologous. Identical residues are denoted with the hyphen. like Synthase gene will Serve as an alternative biomaterial The numbering Scheme corresponds to the slightly longer with unique properties. pmHAS sequence. The putative A1 (residues 161-267) and A2 (residues 443-547) domains correspond to regions 0013 With respect to related microbial GAG syntheses important for hexosamine transferase or for glucuronic acid other than the HASs, only the E. coli K5 glycosyltrans transferase activity, respectively. Most Sequence differences ferases, that Synthesizes heparosan have been identified by are found in the amino-terminal half of the polypeptides. genetic and biochemical means. In contrast to the HASS, it The “consensus sequence” between pm CS and pm HAS appears that two proteins, KfiA and KfiC, are required to depicts identical residues and Similar residues (Consensus transfer the Sugars of the disaccharide repeat to the growing symbols denoted as: is anyone of IV; S is anyone of LM; polymer chain. The chondroitin-backbone Synthesizing % is anyone of FY; # is anyone of NDQEBZ). Multalin enzymes of E. coli K4 have been enzymatically character version 5.4.1 Multiple Sequence alignment with hierarchical ized, but the genes encoding the relevant glycosyltrans clustering F. CORPET, 1988, Nucl. Acids Res., 16 (22), ferases have not yet been identified. 10881-10890 Symbol comparison table: blosum62 Gap 0.014. Many P multocida isolates produce GAG or GAG weight: 12 Gap length weight: 2 Consensus levels: high= like molecules as assessed by enzymatic degradation and 90% low-50% removal of the capsule of living bacterial cells. Type AP 0018 FIG. 2. Western Blot Analysis of Truncated multocida, the major fowl cholera pathogen, makes a cap Recombinant PASTEURELLAGAGSynthases. Immunore Sule that is sensitive to hyaluronidase. Subsequent NMR active bands at the predicted size of 80 kDa correspond to Structural Studies of capsular extracts confirmed that HA was pMCS-7'(CS) or pmHAS-7 (HAS). No similar band is the major polysaccharide present. A specific HA-binding seen for the vector control (V). Prestained standards (Stds) protein, aggrecan, also interacts with HA from Type AP are shown for Size comparison. multocida. Two other distinct P. multocida types, a Swine pathogen, Type D, and a minor fowl cholera pathogen, Type 0019 FIG. 3. Gel Filtration Analysis of Radiolabeled F, produce polymers that are chondroitin or chondroitin-like Polymer Synthesized in vitro. The pmCS''' extract (1 mg based on the observation that their capsules are degraded by total protein) was incubated with chondroitin acceptor oli Flavobacterium chondroitin AC lyase. After enzymatic gosaccharide (5ug), UDP-'CGlcUA and UDP-HIGal removal of the capsule, both types were more readily NAc (580 uM, 0.16 uCi each) in a reaction volume of 200 phagocytosed by neutrophils in Vitro. The capsule of Type D all for 30 min. The reaction product was split into five cells, but not Type F cells, is also reported to be degraded by aliquots and treated with various GAG glycosidases as heparinase III, Suggesting a heparin-type molecule is described in Experimental Procedures. Portions (60%) of the present, too. Samples were then analyzed on the PolySep column (cali bration elution times in minutes: void volume, 12.7. 580 0.015. In the present invention, we have analyzed the kDa dextran, 15.4 kDa dextran, 16.0, totally included vol monosaccharide composition of the P. multocida Type F ume, 19.3 min). Radioactivity (''C, solid line; H, dotted polysaccharide and used the DNA sequence information of line) measured by the in-line detector is presented as disin the Type AHA biosynthesis locus to obtain the homologous tegrations per Second (dps). The double-headed arrow cor region from the Type F chromosome. From this research we responds to a response of 20 dpS.A, untreated polymer, peak have identified a chondroitin synthase, named pmCS (P 15.9 min; B, Flavobacterium chondroitinase AC lyase multocida Chondroitin Synthase), the first chondroitin syn treated polymer, peak, 19.2 min; C, HA lyase-treated poly thase to be identified and molecularly cloned from any mer, peak 15.9 min. The polymer peak with a size of ~100 Source. Interestingly, a single polypeptide is responsible for to 400 kDa contained both radiolabeled sugars at a 1:1 ratio the copolymerization of the GlcUA and GalNAc sugars. We and was degraded only by the appropriate enzyme, chon also identified the Type F capsular polymer as an unsulfated droitin AC lyase. chondroitin polymer. We also identify organisms with the chondroitin Synthase gene (Type F P multocida) as new 0020 FIG. 4. Gel Electrophoresis Analysis of Polysac Sources of unsulfated chondroitin polymer. charides. Various polymers were Separated by their mass/ charge ratio on 0.8% agarose gels in a 1xTAE (tris acetate SUMMARY OF THE INVENTION EDTA) buffersytem. About 9 ug of polymer were loaded per lane and Separated using a field of 0.8 VoltS/cm. Lanes: Type 0016. The present invention relates to a chondroitin syn F, native polymer from Pasteurella multocida Type F, HA, thase gene and methods of making and using Same. In more hyaluronic acid; Type III, StreptococcuS pneumoniae type 3 particular, but not by way of limitation, the present invention capsular polymer; Chon SO4, Chondroitin sulfate C.B.A- relates to a chondroitin Synthase gene from Pasteurella from left to right note: marked in white dotted circle); US 2003/0104601 A1 Jun. 5, 2003 heparin, porcine heparin; kb ladder, kilobase DNA ladder ABC was added Separately. The digestions were kept in a standard; Lambda H, HindIII digest of lambda virus DNA 37 C. water bath overnight. The enzymes were deactivated standard. Sizes of select DNA standards are marked in by boiling for 2 min. The experiments were performed with kilobases (kb). After electrophoresis, the gel was stained a capillary electrophoresis P/ACE 5500 System (Beckman with the dye Stains-All (Sigma; 0.05% in 50% ethanol, w/v) Instruments, Fullerton, Calif.) at a constant capillary tem for 2 hours, then destained in water. Type F polymer runs perature of 18 C. with a potential of -22 kV by UV slower than chondroitin Sulfate polymers because it is larger absorbance at 232 nm. The electropherograms were and not as highly charged (missing the extra charges of acquired using the System Gold Software package (Beckman sulfates). The staining color for HA, Type III and Type F Instruments, Fullerton, Calif.). Separation and analysis were polymers is blue, but chondroitin Sulfate Stains purple. The carried out in a reversed polarity mode using a fused Silica Type F polysaccharide is a novel large unsulfated chon (externally coated except where the tube passed through the droitin chain, the first report of this polymer. detector) capillary tube (50 um inner diameter, 360 um outer 0021 FIG. 5. Monosaccharide Analysis of Type F Poly diameter, 57 cm long, and 49 cm effective length). Prior to mer. The examples of the actual chromatogram used to every run, the capillary was conditioned with 0.5M NaOH (1 generate the Sugar composition data in Table 2 are shown min, 20 psi) and rinsed (1 min, 20 psi) with separation buffer here. The profiles graph the amperometric response (y-axis (20 mM HPO, adjusted to pH 3.5 with saturated dibasic Signifying the relative amount of Sugar eluting from column; Sodium phosphate). Samples were applied by pressure injec units na=nanoamperes) versus elution time (X-axis signify tion 25 S at 0.5 psi. Standards of all potential chondroitin ing the distinct monosaccharides; units=minutes). All oligosaccharides were used to calibrate the capillary. The injected Samples (containing about 5 nanomoles of each unsulfated disaccharide, ADiOS, was observed in digests of Sugar component) were spiked with an internal Standards Type F polymer. Thus, the native polymer of Type F is an rhamnose (Rha), to assess recovery and the column perfor unSulfated chondroitin. mance. The “DeAngelis Standard” contains a mixture of 0026 FIG. 10. Disaccharide Composition Analysis GalNAc, GlcNAc, and GlcUA that were subjected to Samples were dissolved in 10 ul of 50 mM Tris-HCl and 60 hydrolysis. The “Sample F is a hydrolysate of Type F mM sodium acetate buffer, pH 8, and 20 m U Chondroitinase polymer. The analysis shows that the Type F polymer is AC was added separately. The digestions were kept in a 37 composed of only GalN (hydrolysis removes the acetyl C. water bath overnight. The enzymes were deactivated by group converting GalNAc into GalN) and GlcUA monosac boiling for 2 min. -The experiments were performed with a charides. capillary electrophoresis P/ACE 5500 System (Beckman Instruments, Fullerton, Calif.) at a constant capillary tem 0022 FIG. 6. HA Product Size Analysis of xlHAS1 perature of 18 C. with a potential of -22 kV by UV Ser77 Mutants. The various enzymes were assayed for 5 absorbance at 232 nm. The electropherograms were minutes and the HA polymer products were separated by acquired using the System Gold Software package (Beckman high performance gel filtration. Depending on the nature of Instruments, Fullerton, Calif.). Separation and analysis were the Substituting amino acid residue at position 77, either carried out in a reversed polarity mode using a fused Silica larger or Smaller HA products were formed in comparison to (externally coated except where the tube passed through the HA products polymerized by the wild-type enzyme. Only detector) capillary tube (50 um inner diameter, 360 um outer two mutants, Ser77Ile (larger HA) and Ser77Thr (smaller diameter, 57 cm long, and 49 cm effective length). Prior to HA), and the wild-type Synthase are shown. 5 min products every run, the capillary was conditioned with 0.5M NaOH (1 separated on a PolySep-4000 column. For comparison, min, 20 psi) and rinsed (1 min, 20 psi) with separation buffer the-580-kDa dextranstandard eluted at 12.5 min or 16.8 min (20 mM HPO, adjusted to pH 3.5 with saturated dibasic on the 4000 or 6000 column, respectively. Sodium phosphate). Samples were applied by pressure injec 0023 FIG. 7. HA Product Size Analysis of xlHAS1 tion 25 S at 0.5 psi. Standards of all potential chondroitin Ser77 Mutants. The various enzymes were assayed for 30 oligosaccharides were used to calibrate the capillary. The minutes and the HA polymer products were separated by unsulfated disaccharide, ADiOS, was observed in digests of high performance gel filtration. Depending on the nature of Type F polymer. Thus, the native polymer of Type F is an the Substituting amino acid residue at position 77, either unSulfated chondroitin. larger or Smaller HA products were formed in comparison to HA products polymerized by the wild-type enzyme. Only DETAILED DESCRIPTION OF THE two mutants, Ser77Ile (larger HA) and Ser77Thr (smaller INVENTION HA), and the wild-type synthase are shown. 30 min products separated on a PolySep-6000 column. For comparison, the 0027. Before explaining at least one embodiment of the 580-kDa dextranstandard eluted at 12.5 min or 16.8 min on invention in detail, it is to be understood that the invention is not limited in its application to the details of construction the 4000 or 6000 column, respectively. and the arrangement of the components Set forth in the 0024 FIG. 8. NMR Analysis-Type F polysaccharide following description or illustrated in the drawings. The (170 ug uronic acid based on carbazole reaction) was invention is capable of other embodiments or of being exchanged into deuterated water (DO) and the proton practiced or carried out in various ways. Also, it is to be spectrum (H-NMR) was acquired at 45° C. at 500 MHz. The understood that the phraseology and terminology employed chemical shifts (ppm) of the peaks are consistent with an herein is for purpose of description and should not be unsulfated chondroitin polymer. regarded as limiting. 0.025 FIG. 9. Disaccharide Composition Analysis 0028. As used herein, the term “nucleic acid segment” Samples were dissolved in 10 ul of 50 mM Tris-HCl and 60 and “DNA segment” are used interchangeably and refer to a mM sodium acetate buffer, pH 8, and 20 m U Chondroitinase DNA molecule which has been isolated free of total genomic US 2003/0104601 A1 Jun. 5, 2003

DNA of a particular species. Therefore, a “purified' DNA or Sequences which include within their amino acid Sequences nucleic acid Segment as used herein, refers to a DNA an amino acid sequence in accordance with SEQID NO:2 or segment which contains a Chondroitin Synthase (“CS”) 4. Moreover, in other particular embodiments, the invention coding Sequence yet is isolated away from, or purified free concerns isolated DNA segments and recombinant vectors from, unrelated genomic DNA, for example, total Pas incorporating DNA sequences which encode a gene that teurella multocida or, for example, mammalian host includes within its amino acid Sequence the amino acid genomic DNA. Included within the term “DNA segment', Sequence of an Chondroitin Synthase gene or DNA, and in are DNA segments and Smaller fragments of Such Segments, particular to an Chondroitin Synthase gene or cDNA, cor and also recombinant vectors, including, for example, plas responding to Pasteurella multocida Chondroitin Syn mids, cosmids, phage, Viruses, and the like. thase-pmCS. For example, where the DNA segment or vector encodes a full length Chondroitin Synthase protein, 0029. Similarly, a DNA segment comprising an isolated or is intended for use in expressing the Chondroitin Synthase or purified pm CS (Pasteurella multocida Chondroitin Syn protein, preferred Sequences are those which are essentially thase) gene refers to a DNA segment including Chondroitin Synthase coding Sequences isolated Substantially away from as set forth in SEO ID NO:2 or 4. other naturally occurring genes or protein encoding 0033) The original sequences (SEQ ID NOS: 1 and 2) Sequences. In this respect, the term “gene' is used for differ from the corrected sequences (SEQID NOS: 2 and 4) Simplicity to refer to a functional protein, polypeptide or because, after more extensive Sequencing of the plasmid peptide encoding unit. AS will be understood by those in the template encoding the original functional pm CS gene, we art, this functional term includes genomic Sequences, cDNA found a few mistakes made by the Sequencing technician in Sequences or combinations thereof. “Isolated Substantially the original DNA sequence. Basically, certain regions of the away from other coding Sequences' means that the gene of pm CS gene are very difficult to Sequence accurately. Typi interest, in this case pm CS, forms the Significant part of the cally, one can obtain a sequence read length of 200-700 coding region of the DNA segment, and that the DNA bases with a non-problematic Sequence. However, in the Segment does not contain large portions of naturally-occur case of pm CS gene, there were certain places where no more ring coding DNA, Such as large chromosomal fragments or than 20 to 50 bases could be read, and even those were other functional genes or DNA coding regions. Of course, difficult. The two reasons for Sequencing problems are this refers to the DNA segment as originally isolated, and usually due to: (1) the template, which should remain does not exclude genes or coding regions later added to, or Single-Stranded during the reaction, forming double intentionally left in the Segment by the hand of man. Stranded regions or loops in the problematic template that cause the Sequencing polymerase to fall off the template 0.030. Due to certain advantages associated with the use, prematurely, and (2)the Sequencing product forms loops of prokaryotic Sources, one will likely realize the most Structures or twisted forms while running on the electro advantages upon isolation of the CS gene from Pasteurella phoresis gel that do not run in the desired Single-Stranded multocida. One Such advantage is that, typically, eukaryotic conformation. We have now corrected the Sequence to enzymes may require Significant post-translational modifi reflect the actual DNA and protein sequences of pm CS. cations that can only be achieved in a eukaryotic host. This will tend to limit the applicability of any eukaryotic CS gene 0034 SEQID NO: 1 and 2 have been assigned GenBank that is obtained. Moreover, those of ordinary skill in the art Accession No. AF195517. will likely realize additional advantages in terms of time and 0035 Nucleic acid segments having chondroitin synthase ease of genetic manipulation where a prokaryotic enzyme activity may be isolated by the methods described herein. gene is Sought to be employed. These additional advantages The term “a sequence essentially as set forth in SEQ ID include (a) the ease of isolation of a prokaryotic gene NO:2 or 4” means that the sequence substantially corre because of the relatively Small size of the genome and, sponds to a portion of SEQ ID NO:2 or 4 and has relatively therefore, the reduced amount of Screening of the corre few amino acids which are not identical to, or a biologically sponding genomic library and (b) the ease of manipulation functional equivalent of, the amino acids of SEQ ID NO:2 because the Overall size of the coding region of a prokaryotic or 4. The term “biologically functional equivalent” is well gene is significantly Smaller due to the absence of introns. understood in the art and is further defined in detail herein, Furthermore, if the product of the Chondroitin Synthase as a gene having a Sequence essentially as Set forth in SEQ gene (i.e., the enzyme) requires posttranslational modifica ID NO:2 or 4, and that is associated with the ability of tions or cofactors, these would best be achieved in a similar prokaryotes to produce chondroitin or a “chondroitin like” prokaryotic cellular environment (host) from which the gene polymer or a chondroitin Synthase polypeptide. was derived. 0036) One of ordinary skill in the art would appreciate 0.031 Preferably, DNA sequences in accordance with the that a nucleic acid Segment encoding enzymatically active present invention will further include genetic control regions chondroitin Synthase may contain conserved or Semi-con which allow the expression of the Sequence in a Selected served substitutions to the sequences set forth in SEQ ID recombinant host. Of course, the nature of the control region NOS: 1, 2, 3 or 4 and yet still be within the scope of the employed will generally vary depending on the particular invention. use (e.g., cloning host) envisioned. 0037. In particular, the art is replete with examples of 0032. In particular embodiments, the invention concerns practitioners ability to make Structural changes to a nucleic isolated DNA segments and recombinant vectors incorpo acid segment (i.e. encoding conserved or semi-conserved rating DNA sequences which encode a Chondroitin Syn amino acid Substitutions) and still preserve its enzymatic or thase gene Such as pm CS. In the case of pm CS, the isolated functional activity. See for example: (1) Risler et al. “Amino DNA segments and recombinant vectors incorporating DNA Acid Substitutions in Structurally Related Proteins. A Pat US 2003/0104601 A1 Jun. 5, 2003 tern Recognition Approach.” J. Mol. Biol. 204:1019-1029 cells are thus cells having a gene or genes introduced (1988) ". . . according to the observed exchangeability of through the hand of man. Recombinantly introduced genes amino acid Side chains, only four groups could be delin will either be in the form of a cDNA gene, a copy of a eated; (ii) Ile and Val; (ii) Leu and Met, (iii) LyS, Arg, and genomic gene, or will include genes positioned adjacent to Gln, and (iv) Tyr and Phe.”; (2) Niefind et al. “Amino Acid a promoter not naturally associated with the particular Similarity Coefficients for Protein Modeling and Sequence introduced gene. Alignment Derived from Main-Chain Folding Anoles.” J. 0042. Where one desires to use a host other than Pas Mol. Biol. 219:481-497 (1991) similarity parameters allow teurella, as may be used to produce recombinant chondroitin amino acid Substitutions to be designed; and (3) Overington Synthase, it may be advantageous to employ a prokaryotic et al. “Environment-Specific Amino Acid Substitution System Such as E. coli, B. Subtilis, Lactococcus sp., or even Tables: Tertiary Templates and Prediction of Protein Folds,” eukaryotic Systems. Such as yeast or Chinese hamster ovary, Protein Science 1:216-226 (1992) “Analysis of the pattern African green monkey kidney cells, VERO cells, or the like. of observed Substitutions as a function of local environment Of course, where this is undertaken it will generally be shows that there are distinct patterns . . . . Compatible desirable to bring the chondroitin Synthase gene under the changes can be made. control of Sequences which are functional in the Selected 0.038. These references and countless others available to alternative host. The appropriate DNA control Sequences, as one of ordinary skill in the art, indicate that given a nucleic well as their construction and use, are generally well known acid Sequence, one of ordinary skill in the art could make in the art as discussed in more detail hereinbelow. Substitutions and changes to the nucleic acid Sequence 0043. In preferred embodiments, the chondroitin syn without changing its functionality. Also, a Substituted thase-encoding DNA segments further include DNA nucleic acid Segment may be highly identical and retain its Sequences, known in the art functionally as origins of enzymatic activity with regard to its unadulterated parent, replication or “replicons', which allow replication of con and yet still fail to hybridize thereto. tiguous Sequences by the particular host. Such origins allow 0039. One of ordinary skill in the art would also appre the preparation of extrachromosomally localized and repli ciate that Substitutions can be made to the pm CS nucleic acid cating chimeric Segments or plasmids, to which chondroitin segment listed in SEQ ID NO: 1 or 3 without deviating Synthase DNA sequences are ligated. In more preferred outside the Scope and claims of the present invention. instances, the employed origin is one capable of replication Standardized and accepted functionally equivalent amino in bacterial hosts Suitable for biotechnology applications. acid Substitutions are presented in Table I. However, for more versatility of cloned DNA segments, it may be desirable to alternatively or even additionally TABLE I employ origins recognized by other host Systems whose use is contemplated (Such as in a shuttle vector). Conservative and Semi Amino Acid Group Conservative Substitutions 0044) The isolation and use of other replication origins such as the SV40, polyoma or bovine papilloma virus NonPolar R Groups Alanine, Valine, Leucine, Isoleucine, origins, which may be employed for cloning or expression Proline, Methionine, Phenylalanine, Tryptophan in a number of higher organisms, are well known to those of Polar, but uncharged, R Groups Glycine, Serine, Threonine, Cysteine, ordinary skill in the art. In certain embodiments, the inven Asparagine, Glutamine tion may thus be defined in terms of a recombinant trans Negatively Charged R Groups Aspartic Acid, Glutamic Acid formation vector which includes the chondroitin Synthase Positively Charged R Groups Lysine, Arginine, Histidine coding gene Sequence together with an appropriate replica tion origin and under the control of Selected control regions. 0040 Another preferred embodiment of the present 004.5 Thus, it will be appreciated by those of skill in the invention is a purified nucleic acid Segment that encodes a art that other means may be used to obtain the Chondroitin protein in accordance with SEQ ID NO:2 or 4, further Synthase gene or cDNA, in light of the present disclosure. defined as a recombinant vector. AS used herein, the term For example, polymerase chain reaction or RT-PCR pro “recombinant vector” refers to a vector that has been modi duced DNA fragments may be obtained which contain full fied to contain a nucleic acid Segment that encodes a complements of genes or cDNAS from a number of Sources, Chondroitin Synthase protein, or fragment thereof. The including other Strains of Pasteurella or from eukaryotic recombinant vector may be further defined as an expression Sources, such as cDNA libraries. Virtually any molecular vector comprising a promoter operatively linked to Said cloning approach may be employed for the generation of Chondroitin Synthase encoding nucleic acid Segment. DNA fragments in accordance with the present invention. 0041. A further preferred embodiment of the present Thus, the only limitation generally on the particular method invention is a host cell, made recombinant with a recombi employed for DNA isolation is that the isolated nucleic acids nant vector comprising a Chondroitin Synthase gene. The should encode a biologically functional equivalent chon preferred recombinant host cell may be a prokaryotic cell. In droitin Synthase. another embodiment, the recombinant host cell is a eukary 0046) Once the DNA has been isolated it is ligated otic cell. AS used herein, the term “engineered” or “recom together with a Selected vector. Virtually any cloning vector binant cell is intended to refer to a cell into which a can be employed to realize advantages in accordance with recombinant gene, Such as a gene encoding Chondroitin the invention. Typical useful vectors include plasmids and Synthase, has been introduced. Therefore, engineered cells phages for use in prokaryotic organisms and even viral are distinguishable from naturally occurring cells which do vectors for use in eukaryotic organisms. Examples include not contain a recombinantly introduced gene. Engineered pKK223-3, pSA3, recombinant lambda, SV40, polyoma, US 2003/0104601 A1 Jun. 5, 2003

adenovirus, bovine papilloma virus and retroviruses. How expression vectors, Such as 2gt11, 2gt12, 2Cem11, and/or ever, it is believed that particular advantages will ultimately 2ZAP for the cloning and expression screening of cDNA be realized where vectors capable of replication in both clones. Lactococcus or Bacillus Strains and E. coli or P. multocida 0050. In certain other embodiments, the invention con are employed. cerns isolated DNA segments and recombinant vectors that include within their Sequence a nucleic acid Sequence essen 0047 Vectors such as these, exemplified by the pSA3 tially as set forth in SEQ ID NO:1. The term “essentially as vector of Dao and Ferretti or the paT19 vector of Trieu set forth in SEQ ID NO:1' is used in the same sense as Cuot, et al., allow one to perform clonal colony Selection in described above and means that the nucleic acid Sequence an easily manipulated host Such as E. coli, followed by substantially corresponds to a portion of SEQ ID NO:1, and Subsequent transfer back into a food grade Lactococcus or has relatively few codons which are not identical, or func Bacillus strain for production of chondroitin. These are tionally equivalent, to the codons of SEQID NO:1. The term benign and well Studied organisms used in the production of “functionally equivalent codon” is used herein to refer to certain foods and biotechnology products-otherwise codons that encode the same amino acid, Such as the Six known in the art as GRAS (Generally Regarded AS Safe). codons for arginine or Serine, as Set forth in Table I, and also GRAS organisms are advantageous in that one can augment refers to codons that encode biologically equivalent amino the LactococcuS or Bacillus Strain's ability to Synthesize acids. chondroitin through gene dosaging (i.e., providing extra 0051. It will also be understood that amino acid and copies of the HA Synthase gene by amplification) and/or the nucleic acid Sequences may include additional residues, inclusion of additional genes to increase the availability of Such as additional N- or C-terminal amino acids or 5' or 3' the chondroitin precursors UDP-GlcUA and UDP-GalNAc. nucleic acid Sequences, and yet still be essentially as Set These precursors are made by the action of UDP-glucose forth in one of the Sequences disclosed herein, So long as the dehydrogenase and UDP-GlcNAc/UDP-GalNAc epimerase, Sequence meets the criteria Set forth above, including the respectively. The inherent ability of a bacterium to synthe maintenance of biological protein activity where protein Size chondroitin can also be augmented through the forma expression and enzyme activity is concerned. The addition tion of extra copies, or amplification, of the plasmid that of terminal Sequences particularly applies to nucleic acid carries the chondroitin Synthase gene. This amplification can Sequences which may, for example, include various non account for up to a 10-fold increase in plasmid copy number coding Sequences flanking either of the 5' or 3' portions of and, therefore, the Chondroitin Synthase gene copy number. the coding region or may include various internal Sequences, which are known to occur within genes. 0.048 Another procedure that would further augment 0052 Likewise, deletion of certain portions of the Chondroitin Synthase gene copy number is the insertion of polypeptide can be desirable. For example, functional trun multiple copies of the gene into the plasmid. Another cated versions of pm HAS or pm CS missing the carboxyl technique would include integrating the Chondroitin Syn terminus enhances the utility for in vitro use. (FIG. 2, Table thase gene into chromosomal DNA. This extra amplification 3) The pm HAS''' and pm CS''' are soluble proteins that would be especially feasible, since the Chondroitin Synthase are easy to purify in contrast to the full-length proteins (972 gene Size is Small. In Some Scenarios, the chromosomal and 965 residues, respectively). Also, expression level DNA-ligated vector is employed to transfect the host that is increases greatly as the membrane is not overloaded. It is Selected for clonal Screening purposes Such as E. coli or also contemplated that the truncated version of pm CS Bacillus, through the use of a vector that is capable of encompasses residues 45-704 and 75-704. These truncated expressing the inserted DNA in the chosen host. In certain versions are also highly Soluble and increases expression; instances, especially to confer Stability, genes Such as the the native membrane proteins are found in low levels and is chondroitin Synthase gene, may be integrated into the chro not Soluble without Special treatment with detergents. moSome in various positions in an operative fashion. Unlike 0053 Allowing for the degeneracy of the genetic code as plasmids, integrated genes do not need Selection pressure for well as conserved and Semi-conserved Substitutions, maintenance of the recombinant gene. sequences which have between about 40% and about 80%; 0049. Where a eukaryotic source such as dermal or or more preferably, between about 80% and about 90%; or Synovial fibroblasts or rooster comb cells is employed, one even more preferably, between about 90% and about 99%; will desire to proceed initially by preparing a cDNA library. of nucleotides which are identical to the nucleotides of SEQ This is carried out first by isolation of mRNA from the above ID NO:1 will be sequences which are “essentially as set cells, followed by preparation of double stranded cDNA forth in SEQID NO:1. Sequences which are essentially the using an enzyme with reverse transcriptase activity and same as those set forth in SEQ ID NO:1 may also be ligation with the Selected vector. Numerous possibilities are functionally defined as Sequences which are capable of available and known in the art for the preparation of the hybridizing to a nucleic acid Segment containing the double stranded cDNA, and all such techniques are believed complement of SEQ ID NO:1 under standard or less strin to be applicable. A preferred technique involves reverse gent hybridizing conditions. Suitable Standard hybridization transcription. Once a population of double stranded cDNAS conditions will be well known to those of skill in the art and is obtained, a cDNA library is prepared in the selected host are clearly Set forth herein. AS certain domains and active by accepted techniques, Such as by ligation into the appro sites are formed from a relatively small portion of the total priate vector and amplification in the appropriate host. Due polypeptide, these regions of Sequence identity or Similarity to the high number of clones that are obtained, and the may be present only in portions of the gene. relative ease of Screening large numbers of clones by the 0054 As well known in the art, most of the amino acids techniques Set forth herein, one may desire to employ phage in a protein are present to form the “scaffolding or general US 2003/0104601 A1 Jun. 5, 2003 environment of the protein. The actual working parts respon larger polypeptides which nevertheless include Chondroitin Sible for the Specific desired catalysis are usually a Series of Synthase coding regions or may encode biologically func Small domains or motifs. Thus a pair of enzymes that possess tional equivalent proteins or peptides which have variant the same or Similar motifs would be expected to possess the amino acids Sequences. Same or Similar catalytic activity, thus be functionally 0059) The DNA segments of the present invention equivalent. Utility for this hypothetical pair of enzymes may encompass biologically functional equivalent Chondroitin be considered interchangeable unless one member of the Synthase proteins and peptides. Such Sequences may arise as pair has a Subset of distinct, useful properties. In a similar a consequence of codon redundancy and functional equiva vein, certain non-critical motifs or domains may be dis lency which are known to occur naturally within nucleic Sected from the original, naturally occurring protein and acid Sequences and the proteins thus encoded. Alternatively, function will not be affected; removal of non-critical resi functionally equivalent proteins or peptides may be created dues does not perturb the important action of the remaining via the application of recombinant DNA technology, in critical motifs or domains. By analogy, with Sufficient plan which changes in the protein Structure may be engineered, ning and knowledge, it should be possible to translocate based on considerations of the properties of the amino acids motifs or domains from one enzyme to another polypeptide being eXchanged. Changes designed by man may be intro to confer the new enzyme with desirable characteristics duced through the application of Site-directed mutagenesis intrinsic to the domain or motif. techniques, e.g., to introduce improvements to the enzyme 0055. The term “standard hybridization conditions” as activity or to antigenicity of the Chondroitin Synthase used herein, is used to describe those conditions under which protein or to test Chondroitin Synthase mutants in order to Substantially complementary nucleic acid Segments will examine chondroitin Synthase activity at the molecular level. form standard Watson-Crick base-pairing. A number of 0060 Also, specific changes to the Chondroitin Synthase factors are known that determine the Specificity of binding coding Sequence can result in the production of chondroitin or hybridization, Such as pH, temperature, Salt concentra having a modified Size distribution or Structural configura tion, the presence of agents, Such as formamide and dim tion. One of ordinary skill in the art would appreciate that the ethyl Sulfoxide, the length of the Segments that are hybrid Chondroitin Synthase coding Sequence can be manipulated izing, and the like. When it is contemplated that shorter in a manner to produce an altered chondroitin Synthase nucleic acid Segments will be used for hybridization, for which in turn is capable of producing chondroitin having example fragments between about 14 and about 100 nucle differing polymer sizes and/or functional capabilities. For otides, Salt and temperature preferred conditions for over example, the Chondroitin Synthase coding Sequence may be night hybridization will include 1.2-1.8xHPB at 40-50° C. altered in Such a manner that the chondroitin Synthase has an or 5xSSC at 50° C. Washes in low salt (10 mM salt or altered Sugar Substrate specificity So that the chondroitin 0.1xSSC) are used for Stringency and room temperature Synthase creates a new chondroitin-like polymer incorpo incubations of 10-60 minutes. rating a different Structure via the inclusion of a previously 0056 Naturally, the present invention also encompasses unincorporated Sugar or Sugar derivative. This newly incor DNA segments which are complementary, or essentially porated Sugar could result in a modified chondroitin having complementary, to the sequence set forth in SEQID NOS:1, different functional properties. AS will be appreciated by one 2, 3 or 4. Nucleic acid Sequences which are “complemen of ordinary skill in the art given the Chondroitin Synthase tary are those which are capable of base-pairing according coding Sequences, changes and/or Substitutions can be made to the standard Watson-Crick complementarity rules. As to the Chondroitin Synthase coding Sequence Such that these used herein, the term “complementary Sequences' means desired property and/or size modifications can be accom nucleic acid Sequences which are Substantially complemen plished. tary, as may be assessed by the same nucleotide comparison 0061 Basic knowledge on the substrate binding sites Set forth above, or as defined as being capable of hybridizing (e.g. the UDP-GlcUA site or UDP-GalNAc site or oligosac to the nucleic acid segment of SEQ ID NO:1. charide acceptor site) of pm CS allows the targeting of residues for mutation to change the catalytic properties of 0057 The nucleic acid segments of the present invention, the Site. The identity of important catalytic residues of regardless of the length of the coding Sequence itself, may pmHAS, a close homolog of pm CS, have recently been be combined with other DNA sequences, Such as promoters, elucidated (ling & DeAngelis, 2000, Glycobiology Vol 10; polyadenylation signals, additional restriction enzyme sites, pp. 883-889). Appropriate changes at or near these residues multiple cloning Sites, epitope tags, poly histidine regions, would allow other UDP-Sugars to bind instead of the authen other coding Segments, and the like, Such that their overall tic chondroitin Sugar precursors, thus a new, modified poly length may vary considerably. It is therefore contemplated mer is Synthesized. Polymer Size changes will be caused by that a nucleic acid fragment of almost any length may be differences in the Synthase's catalytic efficiency or changes employed, with the total length preferably being limited by in the acceptor Site affinity. Polymer Size changes have been the ease of preparation and use in the intended recombinant made in seHAS and spHAS (Weigel et al, Designer HA) as DNA protocol. well as the vertebrate HAS, xlHAS1 (DG42) (Pummill & 0.058 Naturally, it will also be understood that this inven DeAngelis, unpublished data) by mutating various residues tion is not limited to the particular nucleic acid and amino (FIGS. 6 and 7). As pmCS is a more malleable, robust acid sequences of SEQ ID NOS:1, 2, 3 or 4. Recombinant enzyme than these other enzymes, Similar or Superior Ver vectors and isolated DNA segments may therefore variously sions of mutant pmCS which synthesize modified polymers include the Chondroitin Synthase coding regions them are also possible. Selves, coding regions bearing Selected alterations or modi 0062) The term “modified structure” as used herein fications in the basic coding region, or they may encode denotes a chondroitin polymer containing a Sugar or deriva US 2003/0104601 A1 Jun. 5, 2003 tive not normally found in the naturally occurring chon residue at position 77, either larger or Smaller HA products droitin polypeptide. The term “modified size distribution” were formed in comparison to HA products polymerized by refers to the Synthesis of chondroitin molecules of a size the wild-type enzyme. Only two mutants, Ser77Ile (larger distribution not normally found with the native enzyme; the HA) and Ser77Thr (smaller HA), and the wild-type synthase engineered size could be much Smaller or larger than nor are shown. Panel A: 5 min products separated on a PolySep mal. 4000 column. Panel B: 30 min products separated on a PolySep-6000 column. For comparison, the 580-kDa dext 0.063 Various chondroitin products of differing size have ran standard eluted at 12.5 min or 16.8 min on the 4000 or application in the areas of drug delivery and the generation 6000 column, respectively. of an enzyme of altered Structure can be combined with a chondroitin of differing size. Applications in angiogenesis 0067 Specific changes in any of these residues can and wound healing are potentially large if chondroitin poly produce a modified hyaluronan or chondroitin that produces mers of about 10-20 monosaccharides can be made in good a hyaluronan or chondroitin product having a modified size quantities. Another particular application for Small chon distribution. Engineered changes to SeHAS, SpHAS, droitin oligosaccharides is in the Stabilization of recombi pmHAS, cvHAS, pm CS that decrease the intrinsic size of nant human proteins used for medical purposes. A major the hyaluronan or chondroitin polymer that the enzyme can problem with such proteins is their clearance from the blood make before the hyaluronan or chondroitin is released, will and a short biological half life. One present solution to this provide powerful means to produce either a hyaluronan or problem is to couple a Small molecule Shield that prevents chondroitin polymer product of Smaller or potentially larger the protein from being cleared from the circulation too Size than the native enzyme. rapidly. Very small molecular weight chondroitin is well 0068 Finally, larger molecular weight chondroitin made Suited for this role and would be nonimmunogenic and be degraded with Specific chondroitinidases to make lower biocompatible. Larger molecular chondroitin attached to a molecular weight chondroitin. This practice, however, is drug or protein may be used to target the reticuloendothelial very difficult to achieve reproducibility and one must cell System which has endocytic receptors for chondroitin. meticulously repurify the chondroitin to remove the chon Large polymerS may be used in high concentrations to make droitinidases and unwanted digestion products. gels or Viscous Solutions with potential for joint lubrications opthaltmic procedures, and cosmetics. 0069 Structurally modified chondroitin is no different conceptually than altering the size distribution of the chon 0.064 One of ordinary skill in the art given this disclosure droitin product by changing particular amino acids in the would appreciate that there are Several ways in which the desired Chondroitin Synthase and/or more particularly, but size distribution of the chondroitin polymer made by the not limiting thereto pmCS. Derivatives of UDP-GalNAc, in chondroitin Synthase could be regulated to give different which the acetyl group is missing from the amide (UDP sizes. First, the kinetic control of product size can be altered GalN) or replaced with another chemically useful group (for by decreasing temperature, decreasing time of enzyme example, phenyl to produce UDP-GalNPhe), are expected to action and by decreasing the concentration of one or both be particularly useful. The free amino group would be Sugar nucleotide Substrates. Decreasing any or all of these available for chemical reactions to derivatize chondroitin in variables will give lower amounts and Smaller Sizes of the former case with GalN incorporation. In the latter case, chondroitin product. The disadvantages of these approaches GalNPhe, would make the polymer more hydrophobic or are that the yield of product will also be decreased and it may prone to making emulsions. The Strong Substrate Specificity be difficult to achieve reproducibility from day to day or may rely on a particular Subset of amino acids among the batch to batch. 10-20% that are conserved. Specific changes to one or more 0065. Secondly, the alteration of the intrinsic ability of of these residues creates a functional chondroitin Synthase the enzyme to Synthesize a large chondroitin product. that interacts leSS Specifically with one or more of the Changes to the protein can be engineered by recombinant Substrates than the native enzyme. This altered enzyme DNA technology, including Substitution, deletion and addi could then utilize alternate natural or Special Sugar nucle tion of Specific amino acids (or even the introduction of otides to incorporate Sugar derivatives designed to allow prosthetic groups through metabolic processing). Such different chemistries to be employed for the following changes that result in an intrinsically slower enzyme could purposes: (i) covalently coupling specific drugs, proteins, or then allow more reproducible control of chondroitin size by toxins to the Structurally modified chondroitin for general or kinetic means. The final chondroitin size distribution is targeted drug delivery, radiological procedures, etc. (ii) determined by certain characteristics of the enzyme that rely covalently croSS linking the hyaluronic acid itself or to other on particular amino acids in the Sequence. Among the Supports to achieve a gel, or other three dimensional bio 10-20% of residues absolutely conserved between strepto material with Stronger physical properties, and (iii) coccal hyaluronate Synthase enzymes, eukaryotic hyalur covalently linking hyaluronic acid to a Surface to create a onate Synthase enzymes, and the pm CS, there is a set of biocompatible film or monolayer. amino acids at unique positions that may control or greatly 0070) Experimental Procedures influence the size of the polymer (either hyaluronan or chondroitin) that the enzyme can make. 0071 Materials and Pasteurella Strains-Unless other wise noted, all chemicals were from Sigma or Fisher, and all 0066. As shown in FIGS. 6 and 7, HA Product Size molecular biology reagents were from Promega. The wild Analysis of XlHAS1-Ser77 Mutants. The various enzymes type encapsulated Type FP multocida strains, P-4679 and were assayed for 5 or 30 minutes and the HA polymer P-3695, were obtained from Dr. Richard Rimler (USDA, products were separated by high performance gel filtration. Ames, Iowa). These strains were isolated from turkeys with Depending on the nature of the Substituting amino acid fowl cholera. P-4679 had a slightly larger capsule than US 2003/0104601 A1 Jun. 5, 2003

P-3695 as judged by light microscopy and India Inkstaining. GAATAGGCTGTC-3' SEQ ID NO: 6) were chosen to The latter Strain also possessed an endogenous uncharacter amplify a 3.6 kb portion of the Type F locus predicted to ized plasmid. contain the DNA encoding carboxyl-terminal half of the 0.072 Carbohydrate Analysis of Type F Capsular Mate KfaA homolog and the amino-terminal portion of the puta rial-The anionic polymer in the capsule of Type F bacteria tive polysaccharide synthase. The product from a PCR was purified by urea extraction and cetylpyridinium chloride reaction (26 cycles) was cloned into a TA vector (Invitrogen) precipitation. P-4679 was grown in complete defined media according to the manufacturer guidelines. The plasmid was (150 ml) with mild shaking overnight at 37° C. Cells were analyzed by cycle Sequencing (ThermoSequenase(R) System harvested by centrifugation (3,000xg, 10 min) and washed with P-terminators, Amersham) with the Pm10 or the twice with 0.1 M NaCl by repeated centrifugation and Pm21 primer. The preliminary sequence data from the PCR resuspension. The capsule was removed by extraction with product derived from Type F DNA was highly (about 80%) 3 ml of 8 Murea for 8 min at 98 C. The cells were removed homologous to the Sequence of the Type A locus. Therefore, by high-speed centrifugation (15,000xg, 10 min) and the the 3.6-kb insert was excised from the plasmid, gel-purified, urea Solution was extracted with one volume of chloroform and labeled with digoxigenin (High Prime system, Boe thrice at 22 C. GAGS in the aqueous extract were precipi hiringer Mannheim) to serve as a hybridization probe. tated by the addition of cetylpyridinium chloride (1% w/v. final concentration). Substantial polysaccharide may also be 0075 Isolation of Capsule Biosynthesis Locus DNA-A precipitated from the spent culture media in a similar lambda library of Sau3A partially digested P-4679 DNA fashion. After Standing for 10 min, the precipitate was (4-9 kb average length insert) was made using the BamHI collected by high-speed centrifugation and redissolved in cleaved)Zap ExpressTM vector system (Stratagene). The 2.5 M NaCl. The mixture was clarified by high-speed plaque lifts were screened by hybridization (5xSSC, 50° C.; centrifugation and the Supernatant was precipitated with 3 16 hrs) with the digoxigenin-labeled probe using the manu vol of ethanol. The precipitate was washed with 70% facturer guidelines for colorimetric development. E. coli ethanol, dried slightly, and resuspended in 2.5 M NaCl. The XLI-Blue MRF" was co-infected with the purified, indi ethanol precipitation procedure was repeated and the pellet vidual positive lambda clones and EXASSist helper-phage to was redissolved in water. Another round of ethanol precipi yield phagemids. The resulting phagemids were transfected tation (2 vol) was performed. The final GAG pellet was into E. coli XLOLR cells to recover the plasmids. Sequence dissolved in water. The yield (0.6 mg uronic acid from all analysis of the plasmids revealed a novel open reading extract) was determined with the carbazole assay for uronic frame, i.e. pm CS, with high homology to pmHAS (87%). acid using a glucuronolactone standard. 0076 Expression of Recombinant P multocida Chon 0073. The monosaccharide composition of the GAG droitin Synthase-In previous studies with pmHAS, a func extract was determined by acid hydrolysis (2 M HCl, 4 hrs, tional, Soluble enzyme was created if a portion of the 100 C.) and high pH anion exchange chromatography. The carboxyl terminus was truncated by molecular genetic hydrolyzate was repeatedly diluted in water and dried under means. Therefore, a portion of the pm CS ORF (residues Vacuum to remove HCl, then mixed with a rhamnose Stan 1-704) in the insert of one of the excised lambda clones, dard, and clarified using a 0.2 um Spin filter. Portions of the pPmF4A, was amplified by 20 cycles of PCR with Taq hydrolyzate (about 5 nmoles of uronic acid) were injected polymerase. The Sense primer corresponded to the Sequence onto a PA-I column (Dionex) equilibrated with 12 mM at the deduced amino terminus of the ORF and the antisense NaOH. After isocratic elution (25 min) to separate the primer encoded the new carboxyl terminus followed by an neutral Sugars, a gradient of Sodium acetate (0 to 0.18 M in artificial stop codon. The resulting PCR product was purified 30 min) was utilized to separate the acidic Sugars. Eluted and concentrated using GeneClean. This insert was cloned compounds were detected by pulsed amperometric detec using the peTBlue-1. Acceptor System (Novagen) according tion. In parallel runs, the Type F Sample was Spiked with to the manufacturer's instructions. The Taq-generated Single known monosaccharide Standards of authentic chondroitin A overhang is used to facilitate the cloning of the open sulfate C (derived from shark cartilage) hydrolyzate. HA and reading frame downstream of the T7 promoter and the heparin hydrolyzate Standards were also run. Retention ribosome binding site of the vector. The ligated products times relative to the rhamnose internal Standard were cal were transformed into E. coli NovaBlue and plated on LB culated. carbenicillin (50 ug/ml) and tetracycline (15 ug/ml) under conditions for blue/white Screening. 0074 PCR Analysis of Type F Genomic DNA-Prelimi nary data from Southern blot analysis using pmHAS hybrid 0077. White or light blue colonies were analyzed by ization probes Suggested that the Type A and the Type F restriction digestion. Aclone containing a plasmid with the microbes were very homologous at the capsule locus. PCR desired truncated ORF, pPm-CS'', was transformed into was utilized to verify these findings. Type F chromosomal E. coli Tuner, the T7 RNA polymerase-containing expres DNA (0.1 lug) served as a template in PCR reactions (20 ug) Sion host, and maintained on LB media with carbenicillin utilizing oligonucleotide primers corresponding to various and chloramphenicol (34 ug/ml) at 30° C. Log phase cul regions of the Type A capsule locus genes. After 40 cycles tures were induced with 13-isopropylthiogalactoside (0.2 of PCR (94° C. 305; 42° C. 305; 72° C. 4 min) with Taq mM final) for 5 hrs. The cells were harvested by centrifu DNA polymerase in the supplied buffer (Fisher), the samples gation, frozen, and extracted for 20 mm with a mild deter were Separated by agarose gel electrophoresis. Many primer gent (bPer II reagent, Pierce) at 7 C. in the presence of a pairs, but not all, amplified Type F DNA to yield products of broad-range protease inhibitor cocktail. The cells were the predicted size assuming that Type A and Type Floci were removed by centrifugation and the Soluble extract was used homologous. Two primers (Pm10, 5'-CACTGTCTAACTT. as the source of Chondroitin Synthase enzyme for in vitro TATTGTTAGCC-3 SEQ ID NO: 5; Pm21,5'-TTTTTAAC asSayS. US 2003/0104601 A1 Jun. 5, 2003

0078 Western Blot Analysis of Recombinant P multo tions are used, the preferred method of transfection is cida Chondroitin Synthase-A monospecific polyclonal calcium treatment using calcium chloride to induce compe antibody was generated against a synthetic peptide (acetyl tence or electroporation. LDSDDYLEPDAVELCLKEF-amide SEQ ID NO: 7) cor 0082 Construction of suitable vectors containing the responding to residues 526 to 544 of the pmHAS protein. desired coding and control Sequences employ Standard liga The bPer extracts of various recombinant E. coli strains were tion techniques. Isolated plasmids or DNA fragments are heated at 42 C. for 10 mm in sample buffer before loading. cleaved, tailored, and religated in the form desired to con After electrophoresis, Semi-dry transfer to a nitrocellulose Struct the plasmids required. Cleavage is performed by membrane was performed. The Western blots were blocked treating with restriction enzyme (or enzymes) in Suitable with bovine serum albumin and incubated with the affinity buffer. In general, about 1 lug plasmid or DNA fragments are purified antibody before detection with a Protein A-alkaline used with about 1 unit of enzyme in about 20 tug of buffer phosphatase conjugate and calorimetric development with Solution. Appropriate buffers and Substrate amounts for bromochloroindolyl phosphate and nitro blue tetrazolium. particular restriction enzymes are specified by the manufac turer. Incubation times of about 1 hour at 37 C. are 0079 Assays for Chondroitin Synthase Activity-Incor workable. poration of radiolabeled monosaccharides from UDP-"C) 0083. After incubations, protein is removed by extraction GlcUA and/or UDP-HIGalNAc precursors (NEN) was with phenol and chloroform, and the nucleic acid is recov used to monitor chondroitin Synthase activity. Samples were ered from the aqueous fraction by precipitation with ethanol. usually assayed in a buffer containing 50 mM Tris, pH 7.2, If blunt ends are required, the preparation is treated for 15 20 mM MnCl, 0.1 M (NHA)SO, 1 M ethylene glycol, minutes at 15° C. with 10 units of Polymerase I (Klenow), 0-0.6 mMUDP-GlcUA, and 0-0.6 mM UDP-GalNAc in the phenol-chloroform extracted, and ethanol precipitated. For presence of a chondroitin-6-sulfate acceptor oligosaccha ligation approximately equimolar amounts of the desired ride, GalNAc-6-SOGlcUA-GalNAc-6-SOn (n=1 or 2; components, Suitably end tailored to provide correct match gift of Dr. Geetha Sugumaran), at 30° C. The reaction ing are treated with about 10 units T4DNA ligase per 0.5 lug products were separated from Substrates by descending DNA. When cleaved vectors are used as components, it may paper (Whatman 3M) chromatography with ethanol/IM be useful to prevent religation of the cleaved vector by ammonium acetate, pH 5.5, development solvent (65:35). pretreatment with bacterial alkaline phosphatase. The origin of the paper Strip was cut out, eluted with water, 0084. For analysis to confirm functional sequences in and the incorporation of radioactive Sugars into HA polymer plasmids constructed, the first step was to amplify the was detected by liquid Scintillation counting with BioSafe II plasmid DNA by cloning into Specifically competent E. coli cocktail (RPI). To test the transfer specificity of pmCS''' SURE cells (Stratagene) by doing transformation at 30-32 various UDP-sugars (UDP-GlcNAc, UDP-GalUA, UDP C. Second, the recombinant plasmid is used to transform E. Glc) were substituted for the authentic chondroitin precur coli K5 strain Bi8337-41, which can produce the UDP-GlcA SOS. precursor, and Successful transformants Selected by antibi 0080 Size Analysis and Enzymatic Degradation of otic resistance as appropriate. Plasmids from the library of Labeled Polymers-Gel filtration chromatography was used transformants are then Screened for bacterial colonies that to analyze the size distribution of the labeled polymers. exhibit HA production. These colonies are picked, amplified Separations were performed with a Polysep-GFC-P 5000 and the plasmids purified and analyzed by restriction map column (300x7.8 mm; Phenomenex) eluted with 0.2 M ping. The plasmids showing indications of a functional Sodium nitrate at 0.6 ml/min. Radioactivity was monitored Chondroitin Synthase gene are then further characterized by with an in-line Radioflow LB508 detector (EG & G Ber any number of Sequence analysis techniques which are thold) using Unisafe I cocktail (1.8 ml/min; Zinsser). The known by those of ordinary skill in the art. column was Standardized with fluorescein-labeled dextrans 0085. In general, prokaryotes are used for the initial of various sizes. To identify the-radiolabeled polymers, cloning of DNA sequences and construction of the vectors portions of Some reactions were dialyzed into water (3 kDa useful in the invention. It is believed that a Suitable Source cutoff) and the high molecular weight product was digested may be bacterial cells, particularly those derived from with various glycolytic enzymes for 7 hours at 37 C. The Strains that can exist on a simple minimal media for ease of enzyme concentrations and digestion buffers were: Fla purification. Bacteria with a single membrane, but a thick vobacterium chondroitin AC lyase, 1 milliunit/ul, 50 mM cell wall Such as Staphylococci and Streptococci are Gram Tris-acetate, pH 7.5; Proteus chondroitin AC lyase, 1 mil positive. Gram-negative bacteria Such as E. coli contain two liunit/ul, 50 mM Tris-acetate, pH 8; Streptomyces HA lyase, discrete membranes rather than one Surrounding the cell. 266 milliunits/ul, 50 mM sodium acetate, pH 5.4. Gram-negative organisms tend to have thinner cell walls. The Single membrane of the Gram-positive organisms is 0081. If cells without formidable cell membrane barriers analogous to the inner plasma membrane of Gram-negative are used as host cells, transfection is carried out by the calcium phosphate precipitation method, well known to bacteria. Additionally, many bacteria possess transport Sys those of skill in the art. However, other methods may also be tems that help capsular polymers be Secreted from the cell. used for introducing DNA into cells such as by nuclear 0086 For the expression of Chondroitin Synthase in a injection, cationic lipids, electroporation, protoplast fusion form most likely to accommodate Chondroitin Synthase or by the Biolistic(tm) Bioparticle delivery system devel Synthesis, one may desire to employ StreptococcuS Species oped by DuPont (1989). The advantage of using the DuPont Such as S. equisimilis or S. ZOOepidemicus and/or P. multo System is a high transformation efficiency. If prokaryotic cida and/or Bacillus Strains. The aforementioned Strains, as cells or cells which contain Substantial cell wall construc well as E. coli W3110 (F-, lambda-, prototrophic, ATCC No. US 2003/0104601 A1 Jun. 5, 2003

273325), bacilli such as Bacillus subtilis, or other entero hosts. In principle, any Such cell culture is workable, bacteriaceae Such as Serratia marceScens, could be utilized whether from vertebrate or invertebrate culture. However, to generate a “Super Chondroitin Synthase containing host. interest has been greatest in Vertebrate cells, and propagation 0087. In general, plasmid vectors containing origins of of Vertebrate cells in culture has become a routine procedure replication and control Sequences which are derived from in recent years. Examples of Such useful host cell lines are Species compatible with the host cell are used in connection VERO and HeLa cells, Chinese hamster ovary (CHO) cell with these hosts. The vector ordinarily carries an origin of lines, and WI38, BHK, COS, and MDCK cell lines. replication, as well as marking Sequences which are capable 0092 For use in mammalian cells, the control functions of providing phenotypic Selection in transformed cells. For on the expression vectors are often provided by Viral mate example, E. coli is typically transformed using pBR322, a rial. For example, commonly used promoters are derived plasmid derived from an E. coli species. pBR322 contains from polyoma, Adenovirus 2, bovine papilloma virus and genes for amplicillin and tetracycline resistance and thus most frequently Simian Virus 40 (SV40). The early and late provides easy means for identifying transformed cells. A promoters of SV40 virus are particularly useful because both pBR plasmid or a puC plasmid, or other microbial plasmid are obtained easily from the virus as a fragment which also or phage must also contain, or be modified to contain, contains the SV40 viral origin of replication. Smaller or promoters which can be used by the microbial organism for larger SV40 fragments may also be used, provided there is expression of its own proteins. included the approximately 250 bp Sequence extending from 0088 Those promoters most commonly used in recom the Hind III site toward the Bg1 I site located in the viral binant DNA construction include the lacZ promoter, tac origin of replication. promoter, the T7 bacteriophage promoter, and tryptophan 0093. Further, it is also possible, and often desirable, to (trp) promoter System. While these are the most commonly utilize promoter or control Sequences normally associated used, other microbial promoters have been discovered and with the desired gene Sequence, provided Such control utilized, and details concerning their nucleotide Sequences Sequences are compatible with the host cell Systems. An have been published, enabling a skilled worker to ligate origin of replication may be provided either by construction them functionally with plasmid vectors. Also for use with of the vector to include an exogenous origin, Such as may be the present invention one may utilize integration vectors. derived from SV40 or other viral (e.g., Polyoma, Adeno, 0089. In addition to prokaryotes, eukaryotic microbes, BPV) source, or may be provided by the host cell chromo Such as yeast cultures may also be used. Saccharomyces Somal replication mechanism. If the vector is integrated into cerevisiae, or common baker's yeast is the most commonly the host cell chromosome, the latter mechanism is often used among eukaryotic microorganisms, although a number Sufficient. of other Strains are commonly available. For expression in 0094) Chondroitin Sulfate and dermatan sulfate are both Saccharomyces, the plasmid YRp7, for example, is com derived from the Same polymer, i.e. D-glucuronic acid beta monly used. This plasmid already contains the trp1 gene (1-3)D-N-acetylgalactosamine beta (1-4). Both chondroitin which provides a Selection marker for a mutant Strain of Sulfate and dermatan Sulfate can be Sulfated at positions 4 or yeast lacking the ability to grow without tryptophan, for 6 of N-acetylgalactosamine and position 2 of the uronic example, ATCC No. 44076 or PEP4-1. The presence of the acid. Neither has been observed to be N-sulfated in nature. trp 1 lesion as a characteristic of the yeast host cell genome The difference between chondroitin Sulfate and dermatan then provides an effective environment for detecting trans Sulfate is the epimerisation of glucuronic acid to iduronic formation by growth in the absence of tryptophan. Suitable acid. There are problems however with the nomenclature promoting Sequences in yeast vectors include the promoters and designation of a polysaccharide as either chondroitin for the galactose utilization genes, the 3-phosphoglycerate Sulfate or dermatan Sulfate. In particular, the frequency with kinase or other glycolytic enzymes, Such as enolase, glyc which iduronic acid must occur rather than glucuronic acid, eraldehyde-3-phosphate dehydrogenase, hexokinase, pyru for the chain to be called a dermatan Sulfate chain, is open Vate decarboxylase, phosphofructokinase, glucose-6-phos to interpretation. Thus a chondroitin Sulfate chain may have phate isomerase, 3-phosphoglycerate mutase, pyruvate Sequences of dermatan Sulfate interspersed therein and Visa kinase, triosephosphate isomerase, phosphoglucose Versa. One of ordinary skill in the art would appreciate, isomerase, and glucokinase. however, that a polymer having between 10% and 50% 0090. In constructing suitable expression plasmids, the epimerisation of glucuronic acid to iduronic acid would be termination Sequences associated with these genes are also Suitably designated a dermatan Sulfate polysaccharide. ligated into the expression vector 3' of the Sequence desired to be expressed to provide polyadenylation of the mRNA 0095. A chondroitin polymer is produced by a chon and termination. Other promoters, which have the additional droitin Synthase and in particular, but not limited thereto, the advantage of transcription controlled by growth conditions pm CS of the present invention. For example, the chondroitin are the promoter region for alcohol dehydrogenase 2, cyto polymer can be converted into a dermatan molecule that chrome C, acid phosphatase, degradative enzymes associ may be an even more valuable product than chondroitin ated with nitrogen metabolism, and the aforementioned itself. The chondroitin polymer can be converted into der glyceraldehyde-3-phosphate dehydrogenase, and enzymes matan either in the purified form or in vivo (i.e. in the host itself). For example, Chang et al. have identified and detailed responsible for maltose and galactose utilization. Any plas a reaction of Azotobacter vinelandii poly-beta-D-mannu mid vector containing a yeast-compatible promoter, origin ronic acid C-5-epimerase on Synthetic D-glucuronans. A of replication and termination Sequences is Suitable. dermatan molecule can be made using the Azotobacter 0.091 In addition to microorganisms, cultures of cells vinelandii poly-beta-(1->4)-D-mannuronic acid C-5-epime derived from multicellular organisms may also be used as rase to react with a chondroitin polymer made via a chon US 2003/0104601 A1 Jun. 5, 2003

droitin Synthase Such as pm CS. (Chang et al. Action of pm CS, one of ordinary skill in the art is capable of producing Azotobacter vinelandii poly-beta-D-mannuronic Acid C-5- an unsulfated chondroitin molecule which is an ideal Starting epimerase On Synthetic D-Glucuronans, Carbohydrate material for epimerization by a mammalian epimerase. For Research, Dec. 1, 2000; 329(4):913-22, which is expressly one Such mammalian epimerase and methods of using Same, incorporated herein in its entirety by reference). U.S. Pat. see e.g. Malmstrom A., BioSynthesis of Dermatan Sulfate No. 5,939,289 issued to Ertesvaget al., which is expressly Substrate Specificity of the C-5 Uronosyl Epimerase, J. Biol. incorporated herein by reference, also discloses a C-5 epi Chem., Jan. 10, 1984; 259(1): 161-5, which is expressly merase which may be used to convert the chondroitin incorporated herein by reference in its entirety. molecule produced by the P. multocida chondroitin synthase into a unSulfated dermatan molecule. The c-5 epimerase is 0099) Utilizing enzymatic sulfation, the chondroitin expected to work on the chondroitin polymer as the Chang polymer-turned-dermatan molecule can be Sulfated, et al. paper describes epimerization of a variety of polysac thereby creating an even more valuable and flexible polymer charides containing uronic acids including oxidized Starch for anticoagulation, device coatings, and/or other biomate and chitin. rial. AS pointed out in the Eklund et al. article entitled Dermatan is a Better Substrate for 4-O-sulfation than Chon 0.096 Alternatively, instead of step-wise chondroitin syn droitin: Implications in the Generation of 4-O-sulfated, thesis followed by epimerization reaction, an in Vivo com L-iduronic-rich Galactosaminoglycans, Arch. Biochem. bined method should be possible. This is very suitable in Biophys., Nov. 15, 2000; 383(2):171-7, which is expressly pm CS/AZotobacter epimerase case as the reactions are com incorporated in its entirety herein by reference, dermatan is patible and both genes are from Gram-negative bacteria. not only more easily enzymatically Sulfated than chon Both enzymes have been shown to function in E-coli. droitin, but Sulfated dermatan is a more valuable, flexible Placing both genes in one cell and allowing contact of and useful product than chondroitin. Thus, utilizing a chon chondroitin and the epimerase results in the desired product. droitin Synthase Such as pm CS, one or ordinary skill in the 0097. Further, an assay procedure for measuring the art, given the present disclosure, would be able to produce reactions catalyzed by polyuronic acid C-5 epimerases can natural and non-natural chondroitin as well as dermatan and be used. (See e.g., Chang et al. Measurement of the Activity dermatan Sulfate. Other articles, which are expressly incor of Polyuronic Acid C-5 Epimerases, Anal. Biochem., Apr. porated herein in their entirety by reference, outline other 10, 1998; 258(1):59-62, which is expressly incorporated methodologies for enzymatically Sulfating dermatan. Bhakta herein in its entirety by reference) Action of C-5 epimerases et al. Sulfation of N-acetylglucosamine by Chondroitin inverts the C-6 carboxyl group of polyuronic acids thus 6-Sulfotransferase 2 (GST-5), J.Biol. Chem., Dec. 22, 2000; converting beta-linked residues into alpha-linked residues or 275(51):40226-34; Ito et al. Purification and Characteriza Vice versa. The above-identified assay takes advantage of the tion of N-acetylgalactosamine 4-sulfate 6-O-Sulfotrans greater Susceptibility of the acid hydrolysis of alpha-glyco ferase from the Squid Cartilage, J. Biol. Chem., Nov. 3, Sidic linkages than beta-glycosidic linkages. Thus, acid 2000; 275(44):34728-36. treatment of experimental polymers (the product) results in 0100. In addition to enzymatic sulfation, the dermatan a color yield but the parent Starting material does not result polymer can be chemically sulfated. One method for chemi in a substantial color yield. The method of this particular cal Sulfation is outlined in the article by Garg et al. entitled assay involves the partial acid hydrolysis of the polyuronic Effect of Fully Sulfated Glycosaminoglycans on Pulmonary acid before and after reaction with the C-5 epimerase. The Artery Smooth Muscle Cell Proliferation, Arch. Biochem. greater or lesser amounts of uronic acid released (Solubi Biophys., Nov. 15, 1999; 371(2): 228-33, which is expressly lized) before and after reaction of the C-5 epimerase are a incorporated herein in its entirety by reference. Typically, measure of the amount of alpha- or beta-glycosidic linkages the polysaccharide in an anhydrous Solvent is treated with that are formed and a measure of the amount of catalysis by Sulfur trioxide or chloroSulfonic acid. In any event, one of the enzyme. In this manner, the conversion chondroitin ordinary skill in the art given the chondroitin Synthase polymer to dermatan can be catalyzed and monitored for (pmCS) of the present invention and the methodology for reaction and efficiency. producing a chondroitin polymer from the pm CS enzyme, 0098. The chondroitin molecule made by the pm CS would be capable of using the epimerization reaction to form enzyme is an ideal polymeric Starting material for the a dermatan molecule and then Sulfating this dermatan mol creation of a dermatan Sulfate molecule. Certain mammalian ecule by known enzymatic, or chemical Sulfation tech epimerases only epimerize unsulfated polymer molecules. niques. Alternatively, unepimerimized chondroitin could be For example, the C-5uronosyl epimerase, which is capable Sulfated by any means as well. of converting a chondroitin molecule into a dermatan mol 0101 Also, U.S. Pat. No. 4,990,601 issued to Skjak ecule, will only epimerize an unsulfated chondroitin mol Braek et al., which is expressly incorporated herein by ecule. UnSulfated chondroitin molecules are not found in reference in its entirety, discloses a chemical proceSS using nature, and chondroitin Sulfate must be either desulfated or Supercritical CO which epimerizes uronic acid in a com an unsulfated chondroitin molecule must be recombinantly pound. Utilizing a chondroitin polypeptide using the pm CS produced. Since no chondroitin Synthase has been known of the present invention and the CO epimerization method prior to or Since the discovery of the pm CS enzyme, one of of Skjak-Braek et al., one of ordinary skill in the art can ordinary skill in the art would have to expend additional easily make unsulfated dermatan molecules. time, money, and capital in order to convert Sulfated chon droitin into unsulfated or desulfated chondroitin. Once the 0102 Compositional Analysis of Type F P. multocida chondroitin is unsulfated, the mammalian epimerases can be Polymer-Previous work by others had shown that the Type used to convert the chondroitin molecule into a dermatan F capsule is removed from bacterial cells by treatment with molecule. By utilizing a chondroitin Synthase, Such as chondroitin AC lyase. We found that a fragment of the US 2003/0104601 A1 Jun. 5, 2003

Specific HA-binding protein, aggrecan, in the HA-TEST Type F chromosomal DNA as a template and various oli assay (Pharmacia) did not cross-react with extracts of the gonucleotide primers corresponding to the Type A capsule Type F polymer, but readily detected the HA in parallel locus. A 3.6 kb PCR product, which contained large portions extracts from Type A bacteria. Acid hydrolysis and of the Type F KfaA homolog (a putative polysaccharide monosaccharide analysis of the Type F polymer showed that transporter of E. coli) and the putative pm CS gene, was used it contained the Sugars galactosamine and GlcUA (Table 2 as a hybridization probe to obtain an intact P. multocida and FIG. 5). capsular locus from a lambda library. Two positively hybrid izing plaques were found after Screening about 10" plaques, Table 2 and these phage were converted into plasmids. We found that both plasmids contained a novel open reading frame of Monosaccharide Composition of Type F Polymer 965 residues, which we named pm CS, that was highly and Various GAGs homologous to the Type A HA synthase, pmHAS (FIG. 1). The level of identity was about 87% at both the DNA and 0103) Acid hydrolysis and high pH ion exchange chro protein levels. The differences in amino acid Sequence were matography were utilized to determine the Sugar compo mainly localized to Several regions of the polypeptide in the nents of the Type F polymer (F). The polysaccharides amino terminal half of the molecules. There is an excellent chondroitin Sulfate C (C), hyaluronan (HA), and heparin overall alignment of the enzymes except for a 7-residue (HEP), and pure monosaccharides were used as Standards. insertion in the pmHAS Sequence in the position corre Under these hydrolysis conditions, deacetylation and des sponding to residue 53 of the pm CS Sequence. ulfation as well as the desired fragmentation of glycosidic bonds occur. Retention times relative to the internal Standard 0106) The central portion of both the pm CS and the rhamnose elution time (10.7 min; set to 1) are presented for pmHAS polypeptides (residues 430-530) is most homolo the relevant hexosamines. Acidic Sugars were eluted with a gous to bacterial glycosyltransferases from a wide variety of Sodium acetate gradient; the retention time of the major genera, including Streptococcus, Vibric, Neisseria and Sta uronic acid peak from the Start of the gradiant is presented. phylococcus, that form exopolysaccharides or the carbohy Type F polysaccharide and chondroitin Sulfate possess the drate portions of lipopolysaccharides. The Some of the most identical monsaccharide composition, galactosamine and notable sequence similarities are the DGSTD and the DxDD glucuronic acid. motifs. Directly downstream of the pm CS gene a putative UDP-glucose dehydrogenase gene was identified. There fore, the relative gene order KfaA homolog polysaccha ride Synthase gene-UDP-glucose dehydrogenase gene in Polysaccharides this portion of the Pasteurella Type F capsule operon is the Sugar C C/F MIX F HA HEP Same as that found in Type A. 0107 Heterologous Expression of a Functional P mul Retention Time Relative to Rhamnose tocida Chondroitin Synthase-Western blot analysis using a glucosamine ND* ND ND 1.38 1.38 monospecific antipeptide antibody was used to detect the galactosamine 1.14 1.12 1.12 ND ND production of pmCS''' or pmHAS-7 polypeptide (FIG. Retention time (min) 2 ). Both enzymes contain a sequence that corresponds uronic acid 14.87 14.87 14.87 1485 14.58 exactly to the Synthetic peptide used to generate the anti body. Extracts derived from E. coli Tuner cells containing *ND, not detected the pmCS''plasmid contained an immunoreactive band of the appropriate size (i.e. predicted to be 80 kDa), but this 0104. The ion exchange profile of the chondroitin Sulfate band was not present in Samples from cells with the vector hydrolyzate was indistinguishable from the Type F hydro alone control. The use of soluble pmCS''' protein pro ly Zate, mixing experiments demonstrated that the compo Vided increased expression levels and facilitated preparation nent peaks migrated identically. No other Sugars were of enzyme in comparison to use of the native-length mem detected in the Type F polymer including glucosamine, brane protein. mannose, galactose, glucose, and fucose. HydrolyZates of the HA and heparin Standards clearly contained glucosamine 0.108 Extracts derived from E. coli Tuner cells contain but not galactosamine. Preliminary NMR studies are con ing the pm CS''' plasmid, but not samples from cells with Sistent with the hypothesis that the amino Sugar of the Type the vector alone, Synthesized polymer in Vitro when Supplied F polymer is present in an acetylated form (NAc CH with both UDP-GlcUA and UDP-GalNAc simultaneously chemical shift at 2.02 ppm in D.0; University of Georgia (Table 3). Complex Carbohydrate Research Center) (FIG. 8). Disac charide analysis of the chondroitin from Type F is of the Table 3 correct mass and bra charge expected to be derived from unsulfated chondroitin (FIGS. 9 and 10). This process Transferase Specificity of Recombinant pmCS''' involves cleaving the polymer with chondroitinase, Separat for Sugar Nucleotides ing products by capillary electrophoresis. The retention time 0109) Crude bPer extract (150 lug of total protein) was is compared to authentic Standards. Mass was measured by incubated in 50 lug of assay buffer containing 0.5 lug of mass spectrometry; in this size range, exact masses to within chondroitin oligosaccharide acceptor for 20 min either with 1 Da are measured. UDP-'CGlcUA or UDP-HGalNAc. The radiolabeled 0105 Molecular Cloning of the Type F P. multocida Sugar (300 uM, 0.04 uCi) was used in the presence of the Capsular Locus-PCR products were obtained utilizing indicated second unlabeled Sugar nucleotide (600 uM). The US 2003/0104601 A1 Jun. 5, 2003

incorporation into polymer was assessed by paper chroma Mixing the two different mutant proteins reconstituted the tography. The relative percentage of incorporation in com HA Synthase activity. It is likely that one domain, called Al, parison to the assay containing the authentic precursor (Set is responsible for GlcNAc transfer and the other domain, to 100%) is shown in parentheses. A representative experi called A2, is responsible for GlcUA transfer. Comparison of ment is shown. The recombinant pm CS''' incorporated the pm HAS and the pm CS sequences reveals that the only the authentic chondroitin precursors into polysaccha majority of the Sequence differences exist in the A1 domain. ride. The pm CS enzyme transfers a different hexosamine, Gal NAc, thus being consistent with the proposed two-domain structure for pm HAS. Second sugar Incorporation of first sugar 0114. The pmHAS protein was also hypothesized to nucleotide Present “CIGlcUA HIGalNAc interact with a putative polysaccharide transporter System or a membrane-bound partner via its carboxyl terminus dpm (%) because deletion of residues 704 to 972 from the native None 60 (0.9) 250 (7.5) length enzyme resulted in the formation of a Soluble UDP-GlcA ND* 3,310 (100) enzyme. However, no Substantial membrane-associated or UDP-GaA ND 315 (9.5) hydrophobic regions are predicted to reside in this Sequence. UDP-GalNAc 6,590 (100) ND UDP-GlcNAc 85 (1.5) ND AS pmHAS and pm CS are highly homologous in this region, UDP-Glc 60 (0.9) 370 (11) which is not essential for their glycosyltransferase activities, it is quite likely that the carboxyl terminus contains domains *ND, not determined. or motifs required for interacting with the polysaccharide transport machinery or a membrane-bound partner in Vivo. 0110 No incorporation of radiolabeled 'CGlcUA into The evolutionary relationship between Type A and Type FP polymer was observed if UDP-GalNAc was omitted, or if multocida Strains has not yet been delineated. Both organ UDP-GlcNAc was Substituted for UDP-GalNAc. Con isms are widespread causative agents of fowl cholera, but versely, in experiments using UDP-HGalNAc, substantial many more isolates from diseased birds in North America incorporation of radiolabel into polymer was only noted are Type A microbes with HA capsules. It is likely that the when UDP-GlcUA was also present. UDP-GalUA or UDP progenitor of the two distinct capsular types had either a Glc did not substitute for UDP-GlcUA. No polymerization chondroitin Synthase-like or a HAS-like gene. The Specific or transferase activity was detected if the divalent metal ions ity of this ancestral enzyme may have changed after a few were chelated with EDTA. The addition of the chondroitin mutations resulting in the appearance of another capsular oligosaccharide acceptor increased Sugar incorporation cata type. Apparently, the Sugar transfer Specificity is rather lyzed by pm CS''' at least 50- to 100-fold in comparison to selective since neither recombinant pm CS nor pm HAS parallel reactions without acceptor in analogy to observa misincorporate the inappropriate hexosamine into polymer tions of pm HAS. in vitro. Some Gram-negative bacteria (e.g. E. coli) possess 0111 Analysis by gel filtration chromatography indicated an UDP-GlcNAc/UDP-GalNAc epimerase, therefore the that recombinant pmCS produced polymer chains of 10= hexosamine precursor either for HA or for chondroitin could (1,000) monosaccharides long (100 to 400 kDa) in vitro. have been available for polysaccharide biosynthesis without Radioactivity from both labeled GlcUA and GalNAc sugars the need to gain an auxiliary metabolic enzyme Simulta co-migrated as a single peak (FIG. 3A). No radiolabel was neously. Typically the UDP-glucose dehydrogenase, the incorporated into high molecular weight polymer if both enzyme that forms the UDP-GlcUA precursor, is found in UDP-Sugars were not present during the assay. The identity Gram-negative bacteria only if the microbe possesses a of the polymer as chondroitin was verified by its sensitivity GlcUA-containing polymer or glycoconjugate. In both Type to Flavobacterium or Proteus chondroitin AC lyase (FIG. A and Type FP multocida, the UDP-glucose dehydrogenase 3B) and its resistance to the action of Streptomyces HAlyase gene is directly downstream of the GAG synthase. (FIG. 3C). 0115 The relationship between the bacterial chondroitin 0112 Analysis of the native Type F polymer by agarose Synthase and the putative mammalian counterpart is unclear. gel electrophoresis also shows that high molecular weight No Similar vertebrate proteins are deposited in the database polymer is made by bacteria in vivo (FIG. 4). The Type F as yet. Both bacterial pmCS and the vertebrate chondroitin polymer was visualized by Stains. All Staining an 0.8% Synthase utilize UDP-Sugars to extend acceptor carbohy agarose gel run in 1xTAE System. HA and Type F both drates in vitro. In most cases, the mammalian enzyme in stained blue while DNA and chondroitin Sulfate stained cell-free extracts, however, does not produce long chon purple and Heparin stained yellow. The Type F polymer is droitin chains and only the half-reaction (e.g. adding a single smaller than HA, but still forms very large chains of about GlcUA to a GalNAc-terminated oligosaccharide or vice 50 to about 150 KDa. versa) is readily observed in vitro. In vertebrate tissues, other enzymes modify chondroitin extensively by sulfation 0113 P. multocida Type F produces a chondroitin cap and/or epimerization. The discovery and the characterization Sule. The glycosyltransferase responsible for polymerizing of pm CS will assist the further study of the rather recalci the chondroitin backbone component of the capsular trant mammalian chondroitin Synthase enzymes. polysaccharide has also been cloned. The pm CS enzyme appears to be a close homolog of the pmHAS enzyme. 0116. Thus, it should be apparent that there has been Recently, it was determined that the pmHAS enzyme con provided in accordance with the present invention a purified tains two active sites in a single aid polypeptide by gener nucleic acid Segment having a coding region encoding ating mutants that transfer only GlcUA or only GlcNAc. enzymatically active chondroitin Synthase, methods of pro US 2003/0104601 A1 Jun. 5, 2003

ducing chondroitin from the pm CS gene, and the use of it is evident that many alternatives, modifications, and chondroitin produced from a chondroitin Synthase encoded variations will be apparent to those skilled in the art. by the pm CS gene, that fully satisfies the objectives and Accordingly, it is intended to embrace all Such alternatives, advantages Set forth above. Although the invention has been modifications, and variations that fall within the Spirit and described in conjunction with Specific embodiments thereof, broad Scope of the appended claims.

SEQUENCE LISTING

<160> NUMBER OF SEQ ID NOS : 7 <210> SEQ ID NO 1 &2 11s LENGTH 2979 &212> TYPE DNA <213> ORGANISM: Pasteurella multocida

<400 SEQUENCE: 1 ttataaact g attaaagaag gtaaacgatt caa.gcaaggit taatttittaa aggaaagaaa 60 atgaatacat tatcacaagc aataaaag.ca tata acagoa atgactatoa attagc actc 120 aaattatttg agaagttctgc toaaacctac ggg.cgaaaaa to gttgaatt coaaattatc 18O aaatgtaaag aaaaact citc gaccalattot tatgtaagtg aagataaaaa aaa.ca.gtgtt 240 tg.cgatagot cattagatat cqcaacacag citcttactitt coaacgtaaa aaaattaact 3OO citatc.cgaat cagaaaaaaa cagtttaaaa aataaatgga aatctatoac toggaaaaaa 360 toggagaacg cagaaatcag aaaggtggaa citagtaccca aagattittcc taaagatctt 420 gttcttgctic cattgccaga to atgttaat gattittacat ggtacaaaaa to gaaaaaaa 480 agcttaggta taaag.cctgit aaataagaat atcggtottt ctattattat toctacattt 540 aatcgtagcc gtattittaga tataacgtta gcctgtttgg to aatc agaa aacaaactac 600 ccatttgaag to gttgttgc agatgatggt agtaaggaala acttacttac cattgtgcaa 660 aaatacgaac aaaaacttga cataaagtat gtaagacaaa aagattatgg at atcaattg 720 tgtgcagtca gaaacttagg tttacgtaca gCaaagtatg attttgtct c gattictagac 78O tgc gatatgg caccacaa.ca attatgg gtt cattctitatic ttacagaact attagaagac 840 aatgatattg ttittaattgg accitagaaaa tatgtggata ct cataatat taccgcagaa 9 OO caatticcitta acgatccata tittaatagaa toactacct g aaaccqctac aaataacaat 96.O cctitcgatta catcaaaagg aaatatato g ttggattgga gattagaa.ca tttcaaaaaa O20 accgataatc tacgtctatg to attctocq tttcgittatt ttgttgcggg taatgttgca O8O ttittctaaag aatggctaaa taaagtaggit to gttcgatg aagaatttaa to attggggg 1 4 0 ggc galagatg tagaatttgg ttacagatta tttgccaaag gCtgttttitt cagagtaatt 200 gacgg.cggala togccatcca to aagaacca cotggtaaag aaaatgaaac agaacg.cgaa 260 gctggtaaaa gtattacgct taaaattgttgaaagaaaagg taccttacat citatagaaag 320 cittittaccaa tagaagattc acatattoat agaatacctt tagtttctat ttatatoccc 38O gcttata act gtgcaaatta tattoaaaga totgtagata gtgctcittaa toaaactgtt 4 40 gtogatctog aggtttgtat ttgtaac gat ggttcaa.cag ataatacctt agaagtgatc 5 OO aataagctitt atggtaataa toctagg gta cqcatcatgt citaaac caaa togcggaata 560 gcc to ag cat caaatgcago cqtttcttitt gctaaaggitt attacattgg gcagttagat 62O toagatgatt atcttgagcc to atgcagtt galactotgtt taaaagaatt tittaaaagat 680

aaaacgctag cittgttgttta taccactaat agaaacgtoa atcc.ggatgg tag cittaatc 740 US 2003/0104601 A1 Jun. 5, 2003 16

-continued gctaatggitt acaattggcc agaattittca cq agaaaaac to acaacggc tatgattgct 1800 caccatttta gaatgtttac gattagagct togcatttaa cqgatggatt taacgaaaat 1860 attgaaaacg cc.gtggatta to acatgttc cittaaactca gtgaagttgg aaaatttaaa 1920 catcttaata aaatctgcta taaccg.cgta ttacatggtg ataacacatc cattaagaaa 1980 citcggcattcaaaagaaaaa ccattttgtt gtagt caatc agt cattaaa tag acaaggc 20 40 atcaattatt ataattatga caaatttgat gatttagatgaaagtagaaa gtatatottc 2100 aataaaac cq citgaat atca agaagaaatg gatatgttaa aagat cittaa act cattcaa 216 O aataaagatg ccaaaatcgc agt cagtatt ttctatocca atacattaaa cqgcttagtg 2220 aaaaaactaa acaatatt at tdaatataat aaaaatatat tcgittattat tctacatgtt 228O gataagaatc atcttacacc agacatcaaa aaagaaatat togctttcta toataag cac 234. O caagtgaata ttt tactaaa taatgacatc. tcatattaca cqagtaatag actaataaaa 24 OO actgaggcac atttalagtaa tattaataaa ttalagtoagt taaatctaaa ttgttgaatac 2460 atcatttittg ataatcatga cagoctatto gttaaaaatg acagotatgc titatatgaaa 252O aaatatgatg togg catgaa tttcticagoa tta acacatg attggat.cga gaaaatcaat 258O gcqcatccac catttaaaaa gotgattaaa accitattitta atgacaatga cittaagaagt 264 O atgaatgtga aagggg catc acaagg tatgtttatgaagt atgcgctacc gcatgagctt 27 OO citgacgatta ttaaagaagt catca catcc toccaatcaa ttgatagtgt gcc agaatat 276 O. aacact gagg atatttggitt coaatttgca cittittaatct tagaaaagaa aaccq go cat 282O gtatttaata aaa.catcgac cct gacittat atgccittggg aac gaaaatt acaatggaca 2880 aatgaacaaa ttcaaagtgc aaaaaaaggc gaaaatatoc cc.gittaacaa gttcattatt 2.940 aatagtataa cqctataaaa catttgcatt ttattaaaa 2979

<210> SEQ ID NO 2 &2 11s LENGTH 965 &212> TYPE PRT <213> ORGANISM: Pasteurella multocida

<400 SEQUENCE: 2 Met Asn. Thir Lieu Ser Glin Ala Ile Lys Ala Tyr Asn. Ser Asn Asp Tyr 1 5 10 15 Glu Lieu Ala Lieu Lys Lieu Phe Glu Lys Ser Ala Glu Thir Tyr Gly Arg 2O 25 30 Lys Ile Val Glu Phe Glin Ile Ile Lys Cys Lys Glu Lys Lieu Ser Thr 35 40 45 Asn Ser Tyr Val Ser Glu Asp Llys Lys Asn. Ser Val Cys Asp Ser Ser 50 55 60

Leu Asp Ile Ala Thr Glin Leu Lleu Lleu Ser Asn. Wall Lys Lys Lieu. Thr 65 70 75 8O Leu Ser Glu Ser Glu Lys Asn. Ser Lieu Lys Asn Lys Trp Llys Ser Ile 85 90 95 Thr Gly Lys Lys Ser Glu Asn Ala Glu Ile Arg Lys Val Glu Lieu Val 100 105 110 Pro Lys Asp Phe Pro Lys Asp Leu Val Lieu Ala Pro Leu Pro Asp His 115 120 125 US 2003/0104601 A1 Jun. 5, 2003 17

-continued

Val Asn Asp Phe Thr Trp Tyr Lys Asn Arg Lys Lys Ser Lieu Gly Ile 130 135 1 4 0 Lys Pro Val Asn Lys Asn Ile Gly Leu Ser Ile Ile Ile Pro Thr Phe 145 15 O 155 160 Asn Arg Ser Arg Ile Lieu. Asp Ile Thr Lieu Ala Cys Lieu Val Asn Glin 1.65 170 175 Lys Thr Asn Tyr Pro Phe Glu Val Val Val Ala Asp Asp Gly Ser Lys 18O 185 190 Glu Asn Lieu Lieu. Thir Ile Val Glin Lys Tyr Glu Gln Lys Lieu. Asp Ile 195 200 2O5 Lys Tyr Val Arg Glin Lys Asp Tyr Gly Tyr Glin Lieu. Cys Ala Val Arg 210 215 220 Asn Lieu Gly Lieu Arg Thr Ala Lys Tyr Asp Phe Val Ser Tle Lieu. Asp 225 230 235 240 Cys Asp Met Ala Pro Glin Gln Leu Trp Val His Ser Tyr Leu Thr Glu 245 250 255 Leu Lieu Glu Asp Asn Asp Ile Val Lieu. Ile Gly Pro Arg Lys Tyr Val 260 265 27 O Asp Thr His Asn. Ile Thr Ala Glu Glin Phe Lieu. Asn Asp Pro Tyr Lieu 275 280 285

Ile Glu Ser Leu Pro Glu Thir Ala Thr Asn Asn Asn Pro Ser Ile Thr 29 O 295 3OO Ser Lys Gly Asn. Ile Ser Leu Asp Trp Arg Leu Glu His Phe Lys Lys 305 310 315 320 Thr Asp Asn Lieu Arg Lieu. Cys Asp Ser Pro Phe Arg Tyr Phe Val Ala 325 330 335 Gly Asn. Wall Ala Phe Ser Lys Glu Trp Lieu. Asn Lys Val Gly Trp Phe 340 345 350 Asp Glu Glu Phe Asn His Trp Gly Gly Glu Asp Val Glu Phe Gly Tyr 355 360 365 Arg Lieu Phe Ala Lys Gly Cys Phe Phe Arg Val Ile Asp Gly Gly Met 370 375 38O Ala Ile His Glin Glu Pro Pro Gly Lys Glu Asn. Glu Thr Glu Arg Glu 385 390 395 400 Ala Gly Lys Ser Ile Thr Lieu Lys Ile Val Lys Glu Lys Wall Pro Tyr 405 410 415 Ile Tyr Arg Lys Lieu Lleu Pro Ile Glu Asp Ser His Ile His Arg Ile 420 425 430 Pro Leu Val Ser Ile Tyr Ile Pro Ala Tyr Asn Cys Ala Asn Tyr Ile 435 4 40 4 45 Glin Arg Cys Val Asp Ser Ala Lieu. Asn Glin Thr Val Val Asp Leu Glu 450 455 460 Val Cys Ile Cys Asn Asp Gly Ser Thr Asp Asn. Thir Lieu Glu Val Ile 465 470 475 480 Asn Lys Lieu. Tyr Gly Asn. Asn. Pro Arg Val Arg Ile Met Ser Lys Pro 485 490 495 Asn Gly Gly Ile Ala Ser Ala Ser Asn Ala Ala Val Ser Phe Ala Lys 5 OO 505 510 Gly Tyr Tyr Ile Gly Glin Leu Asp Ser Asp Asp Tyr Lieu Glu Pro Asp 515 52O 525 US 2003/0104601 A1 Jun. 5, 2003 18

-continued Ala Val Glu Lieu. Cys Lieu Lys Glu Phe Lieu Lys Asp Lys Thr Lieu Ala 530 535 540 Cys Val Tyr Thr Thr Asn Arg Asn Val Asn Pro Asp Gly Ser Leu Ile 545 550 555 560 Ala Asn Gly Tyr Asn Trp Pro Glu Phe Ser Arg Glu Lys Leu Thir Thr 565 570 575 Ala Met Ile Ala His His Phe Arg Met Phe Thir Ile Arg Ala Trp His 58O 585 59 O Lieu. Thir Asp Gly Phe Asn. Glu Asn. Ile Glu Asn Ala Val Asp Tyr Asp 595 600 605 Met Phe Lieu Lys Lieu Ser Glu Val Gly Lys Phe Lys His Lieu. Asn Lys 610 615 62O Ile Cys Tyr Asn Arg Val Lieu. His Gly Asp Asn. Thir Ser Ile Lys Lys 625 630 635 640 Leu Gly Ile Glin Lys Lys Asn His Phe Val Val Val Asn Glin Ser Lieu 645 650 655 Asn Arg Glin Gly Ile Asn Tyr Tyr Asn Tyr Asp Llys Phe Asp Asp Lieu 660 665 670 Asp Glu Ser Arg Lys Tyr Ile Phe Asn Lys Thr Ala Glu Tyr Glin Glu 675 680 685 Glu Met Asp Met Leu Lys Asp Leu Lys Lieu. Ile Glin Asn Lys Asp Ala 69 O. 695 7 OO Lys Ile Ala Val Ser Ile Phe Tyr Pro Asn Thr Leu Asn Gly Leu Val 705 710 715 720 Lys Lys Lieu. Asn. Asn. Ile Ile Glu Tyr Asn Lys Asn. Ile Phe Val Ile 725 730 735 Ile Lieu. His Val Asp Lys Asn His Lieu. Thr Pro Asp Ile Lys Lys Glu 740 745 750 Ile Leu Ala Phe Tyr His Lys His Glin Val Asn. Ile Leu Lieu. Asn. Asn 755 760 765 Asp Ile Ser Tyr Tyr Thr Ser Asn Arg Lieu. Ile Lys Thr Glu Ala His 770 775 78O

Leu Ser Asn. Ile Asn Lys Lieu Ser Glin Lieu. Asn Lieu. Asn. Cys Glu Tyr 785 790 795 8OO Ile Ile Phe Asp Asn His Asp Ser Lieu Phe Wall Lys Asn Asp Ser Tyr 805 810 815 Ala Tyr Met Lys Lys Tyr Asp Val Gly Met Asn Phe Ser Ala Leu Thr 820 825 830 His Asp Trp Ile Glu Lys Ile Asn Ala His Pro Pro Phe Lys Lys Lieu 835 840 845 Ile Lys Thr Tyr Phe Asn Asp Asn Asp Leu Arg Ser Met Asn. Wall Lys 85 O 855 860 Gly Ala Ser Glin Gly Met Phe Met Lys Tyr Ala Leu Pro His Glu Leu 865 870 875 88O

Leu Thir Ile Ile Lys Glu Val Ile Thr Ser Cys Glin Ser Ile Asp Ser 885 890 895

Val Pro Glu Tyr Asn Thr Glu Asp Ile Trp Phe Glin Phe Ala Leu Leu 9 OO 905 910 Ile Leu Glu Lys Lys Thr Gly His Val Phe Asn Lys Thr Ser Thr Leu 915 920 925 US 2003/0104601 A1 Jun. 5, 2003 19

-continued

Thr Tyr Met Pro Trp Glu Arg Lys Leu Glin Trp Thr Asn Glu Glin Ile 930 935 940 Glin Ser Ala Lys Lys Gly Glu Asn. Ile Pro Val Asn Lys Phe Ile Ile 945 950 955 96.O

Asn Ser Ile Thr Lieu 965

<210> SEQ ID NO 3 &2 11s LENGTH 2.979 &212> TYPE DNA <213> ORGANISM: Pasteurella multocida

<400 SEQUENCE: 3 ttataaactg attaaagaag gtaaacgatt caa.gcaaggit taatttittaa aggaaagaaa 60 atgaatacat tat cacaagc aataaaag.ca tataa.cagoa atgactatoa attagcactic 120 aaattatttg agaagttctgc tigaaacctac ggg.cgaaaaa togttgaatt coaaattatc 18O aaatgtaaag aaaaactcitc gacca attct tatgtaagtg aagataaaaa aaa.ca.gtgtt 240 tg.cgatagot cattagatat cqcaacacag citcttactitt coaacgtaaa aaaattaact citatico gaat cagaaaaaaa cagtttaaaa aataaatgga aatctatoac toggaaaaaa 360 toggagaacg cagaaatcag aaaggtggaa citagtaccca aagattittcc taaagat.ctt 420 gttcttgctc cattgccaga to atqttaat gattittacat ggtacaaaaa togaaaaaaa 480 agcttaggta taaag.cctgt aaataagaat atcggtottt citatt attat toctacattt 540 aatcgtagcc gtattittaga tataacgtta gcc tdtttgg toaatcagaa aacaaactac 600 ccatttgaag togttgttgc agatgatggit agtaaggaaa acttacittac cattgtgcaa. 660 aaatacgaac aaaaacttga cataaagtat gtaag acaaa aagattatgg atatocaattg 720 tgtgcagtica gaaact tagg tttacgtaca gcaaagtatg attttgttctic gattotagac tgcgatatgg caccacaa.ca attatgggitt cattcttatc ttacagaact attagaagac 840 aatgatattg ttittaattgg accitagaaaa tatgtggata citcataatat taccgcagaa 9 OO caatticcitta acg atccata tittaatagaa toactacctgaaaccgctac aaataacaat 96.O cctt.cgatta catcaaaagg aaatatat cq ttggattgga gattagaa.ca tttcaaaaaa O20 accgataatc tacgtotatg tdattctocq tttcgittatt ttagttgcgg taatgttgca ttittctaaag aatggctaaa taaagtaggit togttcgatg aagaatttaa to attggggg 14 O ggcgaagatg tagaatttgg ttacagatta tittgccaaag gotgttttitt cagagtaatt 200 gacggcggaa togg catacca toaagaacca cct ggtaaag aaaatgaaac aga.ccg.cgaa 260 gctggtaaaa gtattacgct taaaattgttgaaagaaaagg taccttacat citatagaaag 320 cittittaccaa tagaag attc acatattoat agaatacctt tagtttctat ttatatoccc gcttataact gtgcaaatta tattoaaaga tigtgtagata gtgct cittaa toaaactgtt 4 40 gtogatctog aggtttgtat ttgtaacgat ggttcaa.cag ataatacctt agaagtgatc 5 OO aataagctitt atggtaataa toctagggta cqcatcatgt citaalaccalaa togcggaata 560 gccticago at caaatgcago cqtttcttitt gctaaaggitt attacattgg gcagttagat toagatgatt atcttgagcc tdatgcagtt gaactgttgtt taaaagaatt tittaaaagat 680 aaaacgctag cittgttgttta taccactaat agaaacgtoa atc.cggatgg tag cittaatc 740 US 2003/0104601 A1 Jun. 5, 2003 20

-continued gctaatggitt acaattggcc agaattittca cq agaaaaac to acaacggc tatgattgct 1800 caccatttta gaatgtttac gattagagct togcatttaa cqgatggatt taacgaaaat 1860 attgaaaacg cc.gtggatta to acatgttc cittaaactca gtgaagttgg aaaatttaaa 1920 catcttaata aaatctgcta taaccg.cgta ttacatggtg ataacacatc cattaagaaa 1980 citcggcattcaaaagaaaaa ccattttgtt gtagt caatc agt cattaaa tag acaaggc 20 40 atcaattatt ataattatga caaatttgat gatttagatgaaagtagaaa gtatatottc 2100 aataaaac cq citgaat atca agaagaaatg gatattittaa aagat cittaa act cattcaa 216 O aataaagatg ccaaaatcgc agt cagtatt ttctatocca atacattaaa cqgcttagtg 2220 aaaaaactaa acaatatt at tdaatataat aaaaatatat tcgittattat tctacatgtt 228O gataagaatc atcttacacc agacatcaaa aaagaaatat togctttcta toataag cac 234. O caagtgaata ttt tactaaa taatgacatc. tcatattaca cqagtaatag actaataaaa 24 OO actgaggcac atttalagtaa tattaataaa ttalagtoagt taaatctaaa ttgttgaatac 2460 atcatttittg ataatcatga cagoctatto gttaaaaatg acagotatgc titatatgaaa 252O aaatatgatg togg catgaa tttcticagoa tta acacatg attggat.cga gaaaatcaat 258O gcqcatccac catttaaaaa gotgattaaa accitattitta atgacaatga cittaagaagt 264 O atgaatgtga aagggg catc acaagg tatgtttatgaagt atgcgctacc gcatgagctt 27 OO citgacgatta ttaaagaagt catca catcc toccaatcaa ttgatagtgt gcc agaatat 276 O. aacactgagg atatttggitt coaatttgca cittittaatct tagaaaagaa aaccggccat 2820 gtatttaata aaa.catcgac cct gacittat atgccittggg aac gaaaatt acaatggaca 2880 aatgaacaaa ttcaaagtgc aaaaaaaggc gaaaatatoc cc.gittaacaa gttcattatt 2.940 aatagtataa cqctataaaa catttgcatt ttattaaaa 2979

<210> SEQ ID NO 4 &2 11s LENGTH 965 &212> TYPE PRT <213> ORGANISM: Pasteurella multocida

<400 SEQUENCE: 4 Met Asn. Thir Lieu Ser Glin Ala Ile Lys Ala Tyr Asn. Ser Asn Asp Tyr 1 5 10 15 Glu Lieu Ala Lieu Lys Lieu Phe Glu Lys Ser Ala Glu Thir Tyr Gly Arg 2O 25 30 Lys Ile Val Glu Phe Glin Ile Ile Lys Cys Lys Glu Lys Lieu Ser Thr 35 40 45 Asn Ser Tyr Val Ser Glu Asp Llys Lys Asn. Ser Val Cys Asp Ser Ser 50 55 60 Leu Asp Ile Ala Thr Glin Leu Lleu Lleu Ser Asn. Wall Lys Lys Lieu. Thr 65 70 75 8O Leu Ser Glu Ser Glu Lys Asn. Ser Lieu Lys Asn Lys Trp Llys Ser Ile 85 90 95 Thr Gly Lys Lys Ser Glu Asn Ala Glu Ile Arg Lys Val Glu Lieu Val 100 105 110 Pro Lys Asp Phe Pro Lys Asp Leu Val Lieu Ala Pro Leu Pro Asp His 115 120 125 Val Asn Asp Phe Thr Trp Tyr Lys Asn Arg Lys Lys Ser Lieu Gly Ile 130 135 1 4 0 US 2003/0104601 A1 Jun. 5, 2003 21

-continued

Lys Pro Val Asn Lys Asn Ile Gly Leu Ser Ile Ile Ile Pro Thr Phe 145 15 O 155 160 Asn Arg Ser Arg Ile Lieu. Asp Ile Thr Lieu Ala Cys Lieu Val Asn Glin 1.65 170 175 Lys Thr Asn Tyr Pro Phe Glu Val Val Val Ala Asp Asp Gly Ser Lys 18O 185 190 Glu Asn Lieu Lieu. Thir Ile Val Glin Lys Tyr Glu Gln Lys Lieu. Asp Ile 195 200 2O5 Lys Tyr Val Arg Glin Lys Asp Tyr Gly Tyr Glin Lieu. Cys Ala Val Arg 210 215 220 Asn Lieu Gly Lieu Arg Thr Ala Lys Tyr Asp Phe Val Ser Tle Lieu. Asp 225 230 235 240 Cys Asp Met Ala Pro Glin Gln Leu Trp Val His Ser Tyr Leu Thr Glu 245 250 255 Leu Lieu Glu Asp Asn Asp Ile Val Lieu. Ile Gly Pro Arg Lys Tyr Val 260 265 27 O Asp Thr His Asn. Ile Thr Ala Glu Glin Phe Lieu. Asn Asp Pro Tyr Lieu 275 280 285

Ile Glu Ser Leu Pro Glu Thir Ala Thr Asn Asn Asn Pro Ser Ile Thr 29 O 295 3OO Ser Lys Gly Asn. Ile Ser Lieu. Asp Trp Arg Lieu Glu His Phe Lys Lys 305 310 315 320 Thr Asp Asn Leu Arg Leu Cys Asp Ser Pro Phe Arg Tyr Phe Ser Cys 325 330 335 Gly Asn. Wall Ala Phe Ser Lys Glu Trp Lieu. Asn Lys Val Gly Trp Phe 340 345 350 Asp Glu Glu Phe Asn His Trp Gly Gly Glu Asp Val Glu Phe Gly Tyr 355 360 365 Arg Lieu Phe Ala Lys Gly Cys Phe Phe Arg Val Ile Asp Gly Gly Met 370 375 38O Ala Tyr His Glin Glu Pro Pro Gly Lys Glu Asn. Glu Thir Asp Arg Glu 385 390 395 400 Ala Gly Lys Ser Ile Thr Lieu Lys Ile Val Lys Glu Lys Wall Pro Tyr 405 410 415 Ile Tyr Arg Lys Lieu Lleu Pro Ile Glu Asp Ser His Ile His Arg Ile 420 425 430 Pro Leu Val Ser Ile Tyr Ile Pro Ala Tyr Asn Cys Ala Asn Tyr Ile 435 4 40 4 45 Glin Arg Cys Val Asp Ser Ala Lieu. Asn Glin Thr Val Val Asp Leu Glu 450 455 460 Val Cys Ile Cys Asn Asp Gly Ser Thr Asp Asn. Thir Lieu Glu Val Ile 465 470 475 480 Asn Lys Lieu. Tyr Gly Asn. Asn. Pro Arg Val Arg Ile Met Ser Lys Pro 485 490 495 Asn Gly Gly Ile Ala Ser Ala Ser Asn Ala Ala Val Ser Phe Ala Lys 5 OO 505 510 Gly Tyr Tyr Ile Gly Glin Leu Asp Ser Asp Asp Tyr Lieu Glu Pro Asp 515 52O 525 Ala Val Glu Lieu. Cys Lieu Lys Glu Phe Lieu Lys Asp Lys Thr Lieu Ala 530 535 540 US 2003/0104601 A1 Jun. 5, 2003 22

-continued Cys Val Tyr Thr Thr Asn Arg Asn Val Asn Pro Asp Gly Ser Leu Ile 545 550 555 560 Ala Asn Gly Tyr Asn Trp Pro Glu Phe Ser Arg Glu Lys Leu Thir Thr 565 570 575 Ala Met Ile Ala His His Phe Arg Met Phe Thir Ile Arg Ala Trp His 58O 585 59 O Lieu. Thir Asp Gly Phe Asn. Glu Asn. Ile Glu Asn Ala Val Asp Tyr Asp 595 600 605 Met Phe Lieu Lys Lieu Ser Glu Val Gly Lys Phe Lys His Lieu. Asn Lys 610 615 62O Ile Cys Tyr Asn Arg Val Lieu. His Gly Asp Asn. Thir Ser Ile Lys Lys 625 630 635 640 Leu Gly Ile Glin Lys Lys Asn His Phe Val Val Val Asn Glin Ser Lieu 645 650 655 Asn Arg Glin Gly Ile Asn Tyr Tyr Asn Tyr Asp Llys Phe Asp Asp Lieu 660 665 670 Asp Glu Ser Arg Lys Tyr Ile Phe Asn Lys Thr Ala Glu Tyr Glin Glu 675 680 685 Glu Met Asp Ile Leu Lys Asp Leu Lys Lieu. Ile Glin Asn Lys Asp Ala 69 O. 695 7 OO Lys Ile Ala Val Ser Ile Phe Tyr Pro Asn Thr Leu Asn Gly Leu Val 705 710 715 720 Lys Lys Lieu. Asn. Asn. Ile Ile Glu Tyr Asn Lys Asn. Ile Phe Val Ile 725 730 735 Ile Lieu. His Val Asp Lys Asn His Lieu. Thr Pro Asp Ile Lys Lys Glu 740 745 750 Ile Leu Ala Phe Tyr His Lys His Glin Val Asn. Ile Leu Lieu. Asn. Asn 755 760 765 Asp Ile Ser Tyr Tyr Thr Ser Asn Arg Lieu. Ile Lys Thr Glu Ala His 770 775 78O

Leu Ser Asn. Ile Asn Lys Lieu Ser Glin Lieu. Asn Lieu. Asn. Cys Glu Tyr 785 790 795 8OO Ile Ile Phe Asp Asn His Asp Ser Lieu Phe Wall Lys Asn Asp Ser Tyr 805 810 815 Ala Tyr Met Lys Lys Tyr Asp Val Gly Met Asn Phe Ser Ala Leu Thr 820 825 830 His Asp Trp Ile Glu Lys Ile Asn Ala His Pro Pro Phe Lys Lys Lieu 835 840 845 Ile Lys Thr Tyr Phe Asn Asp Asn Asp Leu Arg Ser Met Asn. Wall Lys 85 O 855 860 Gly Ala Ser Glin Gly Met Phe Met Lys Tyr Ala Leu Pro His Glu Leu 865 870 875 88O

Leu Thir Ile Ile Lys Glu Val Ile Thr Ser Cys Glin Ser Ile Asp Ser 885 890 895

Val Pro Glu Tyr Asn Thr Glu Asp Ile Trp Phe Glin Phe Ala Leu Leu 9 OO 905 910 Ile Leu Glu Lys Lys Thr Gly His Val Phe Asn Lys Thr Ser Thr Leu 915 920 925 Thr Tyr Met Pro Trp Glu Arg Lys Leu Glin Trp Thr Asn Glu Glin Ile 930 935 940 US 2003/0104601 A1 Jun. 5, 2003 23

-continued

Glin Ser Ala Lys Lys Gly Glu Asn. Ile Pro Val Asn Lys Phe Ile Ile 945 950 955 96.O

Asn Ser Ile Thr Lieu 965

SEQ ID NO 5 LENGTH 24 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: primer <400 SEQUENCE: 5 cactgtctaa citttattgtt agcc 24

SEQ ID NO 6 LENGTH 2.0 TYPE DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: primer <400 SEQUENCE: 6 tttittaacga ataggctgtc 20

SEQ ID NO 7 LENGTH 19 TYPE PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: synthetic peptide corresponding to residues 526 to 544 of PrmHAS protein <400 SEQUENCE: 7 Leu Asp Ser Asp Asp Tyr Lieu Glu Pro Asp Ala Val Glu Lieu. Cys Lieu 1 5 10 15 Lys Glu Phe

What I claim is: Vative or conservative amino acid changes or is a truncated 1. A purified nucleic acid Segment comprising a coding Segment when compared to the nucleotide Sequence of SEQ region encoding enzymatically active chondroitin Synthase. ID NO:1 or 3. 7. A recombinant vector Selected from the group consist 2. The purified nucleic acid Segment of claim 1, wherein ing of a plasmid, coSmid, phage, integrated cassette or virus the purified nucleic acid Segment encodes a chondroitin vector and wherein the recombinant vector further com synthase isolated from Pasteurella multocida. prises a purified nucleic acid Segment having a coding 3. The purified nucleic acid Segment of claim 2, wherein region encoding enzymatically active chondroitin Synthase. the purified nucleic acid Segment encodes the Pasteurella 8. The recombinant vector of claim 7, wherein the purified multocida chondroitin synthase of SEQ ID NO:2 or 4. nucleic acid Segment encodes the Pasteurella multocida 4. The purified nucleic acid Segment of claim 2, wherein chondroitin synthase of SEQ ID NO:2 or 4. 9. The recombinant vector of claim 7, wherein the purified the purified nucleic acid Segment comprises a nucleotide nucleic acid Segment comprises a nucleotide Sequence in sequence in accordance with SEQ ID NO:1 or 3. accordance with SEO ID NO:1 or 3. 5. A purified nucleic acid Segment having a coding region 10. The recombinant vector of claim 7, wherein the encoding enzymatically active chondroitin Synthase, plasmid further comprises an expression vector. wherein the purified nucleic acid Segment is capable of 11. The recombinant vector of claim 10, wherein the hybridizing to the nucleotide sequence of SEQ ID NO:1 or expression vector comprises a promoter operatively linked 3. to the enzymatically active Pasteurella multocida chon 6. A purified nucleic acid Segment having a coding region droitin Synthase coding region. encoding enzymatically active chondroitin Synthase, 12. A recombinant host cell, wherein the recombinant host wherein the purified nucleic acid Segment has Semiconser cell is a prokaryotic cell transformed with a recombinant US 2003/0104601 A1 Jun. 5, 2003 24 vector comprising a purified nucleic acid Segment having a purified nucleic acid Segment having a coding region encod coding region encoding enzymatically active chondroitin ing enzymatically active Pasteurella multocida chondroitin Synthase. Synthase. 13. The recombinant host cell of claim 12, wherein the 31. The recombinant host cell of claim 30, wherein the purified nucleic acid Segment encodes the Pasteurella mul purified nucleic acid Segment encodes the Pasteurella mul tocida chondroitin synthase of SEQ ID NO:2 or 4. tocida chondroitin synthase of SEQ ID NO:2 or 4. 14. The recombinant host cell of claim 12, wherein the 32. The recombinant host cell of claim 30, wherein the purified nucleic acid Segment comprises a nucleotide purified nucleic acid Segment comprises a nucleotide sequence in accordance with SEQ ID NO:1 or 3. sequence in accordance with SEQ ID NO:1 or 3. 15. The recombinant host cell of claims 13 or 14, wherein 33. The recombinant host cell of claim 31 or 32, wherein the host cell produces chondroitin. the host cell produces chondroitin. 16. The recombinant host cell of claim 12, wherein the 34. The recombinant host cell of claim 30, wherein the enzymatically active chondroitin Synthase is capable of enzymatically active chondroitin Synthase is capable of producing a chondroitin polymer having a modified Struc producing a chondroitin polymer having a modified Struc ture. ture. 17. The recombinant host cell of claim 12, wherein the 35. The recombinant host cell of claim 30, wherein the enzymatically active chondroitin Synthase is capable of enzymatically active chondroitin Synthase is capable of producing a chondroitin polymer having a modified size producing a chondroitin polymer having a modified size distribution. distribution. 18. A recombinant host cell, wherein the recombinant host 36. A purified composition, wherein the purified compo cell is an eukaryotic cell transfected with a recombinant Sition comprises an enzymatically active chondroitin Syn vector comprising a purified nucleic acid Segment having a thase polypeptide. coding region encoding enzymatically active chondroitin 37. A purified composition, wherein the purified compo Synthase. Sition comprises a chondroitin polymer made by a recom 19. The recombinant host cell of claim 18, wherein the binant process. purified nucleic acid Segment encodes the Pasteurella mul 38. A purified composition, wherein the purified compo tocida chondroitin synthase of SEQ ID NO:2 or 4. Sition comprises a chondroitin polymer made by a chon 20. The recombinant host cell of claim 18, wherein the droitin Synthase. purified nucleic acid Segment comprises a nucleotide 39. A purified composition, wherein the purified compo sequence in accordance with SEQ ID NO:1 or 3. Sition comprises a chondroitin polymer made by a Pas 21. The recombinant host cell of claims 19 or 20, wherein teurella multocida chondroitin Synthase. the host cell produces chondroitin. 40. A purified composition, wherein the purified compo 22. The recombinant host cell of claim 18, wherein the Sition comprises a chondroitin polymer made by the Pas enzymatically active chondroitin Synthase is capable of teurella multocida chondroitin synthase of SEQ ID NO:2 or producing a chondroitin polymer having a modified Struc 4. ture. 41. A purified composition, wherein the purified compo 23. The recombinant host cell of claim 18, wherein the Sition comprises a chondroitin polymer made by the Pas enzymatically active chondroitin Synthase is capable of teurella multocida chondroitin Synthase comprising the producing a chondroitin polymer having a modified size nucleotide sequence in accordance with SEQ ID NO:1 or 3. distribution. 42. The purified composition of claims 36, 37,38, 39, 40, 24. A recombinant host cell, wherein the recombinant host 41, and 42, wherein the chondroitin polymer is represented cell is electroporated or transformed to introduce a recom by a structure, (Beta-1,4-GlcUA-beta-1,3-GalNAc), binant vector into the recombinant host cell, wherein the wherein n is a positive integer greater than or equal to 1. recombinant vector comprises a purified nucleic acid Seg 43. A purified composition, wherein the purified compo ment having a coding region encoding enzymatically active Sition comprises a chondroitin polymer having a modified chondroitin Synthase. size distribution. 25. The recombinant host cell of claim 24, wherein the 44. A purified composition, wherein the purified compo purified nucleic acid Segment encodes the Pasteurella mul Sition comprises a chondroitin polymer having a modified tocida chondroitin synthase of SEQ ID NO:2 or 4. Structure. 26. The recombinant host cell of claim 24, wherein the 45. The purified composition of claim 42, wherein the purified nucleic acid Segment comprises a nucleotide chondroitin polymer is unsulfated. sequence in accordance with SEQ ID NO:1 or 3. 46. A method for producing a chondroitin polymer in vitro 27. The recombinant host cell of claim 25 or 26, wherein comprising the Steps of: the host cell produces chondroitin. 28. The recombinant host cell of claim 24, wherein the providing a chondroitin Synthase; enzymatically active chondroitin Synthase is capable of placing the chondroitin Synthase in a medium Suitable for producing a chondroitin polymer having a modified Struc the expression of a chondroitin polymer; and ture. 29. The recombinant host cell of claim 24, wherein the extracting the chondroitin polymer Out of the medium. enzymatically active Pasteurella multocida chondroitin Syn 47. The method of claim 46, wherein in the step of thase is capable of producing a chondroitin polymer having providing a chondroitin Synthase, the chondroitin Synthase is a modified size distribution. from Pasteurella multocida. 30. A recombinant host cell, wherein the recombinant host 48. The method of claim 47, wherein in the step of cell is transduced with a recombinant vector comprising a providing a chondroitin Synthase, the chondroitin Synthase is US 2003/0104601 A1 Jun. 5, 2003

from Pasteurella multocida and has an amino acid Sequence 65. A method for detecting a bacterial cell that expresses in accordance with SEO ID NO:2 or 4. mRNA encoding Pasteurella multocida chondroitin syn 49. The method of claim 47, wherein in the step of thase, comprising the Steps of providing a chondroitin Synthase, the chondroitin Synthase obtaining a bacterial cell Sample; from Pasteurella multocida is a nucleotide Sequence in accordance with SEO ID NO:1 or 3. contacting at least one nucleic acid from the bacterial cell 50. A method for producing a chondroitin polymer in Sample with a purified nucleic acid Segment in accor Vivo, comprising the Steps of: dance with SEQ ID NO:1 or 3; providing a chondroitin Synthase, hybridizing the at least one nucleic and the purified nucleic acid Segment thereby forming a hybridized placing the chondroitin Synthase in a native or recombi complex; and nant organism, thereby providing a native or recombi nant organism having a chondroitin Synthase there; detecting the hybridized complex, wherein the presence of the hybridized complex is indicative of a bacterial placing the native or recombinant organism having a strain that expresses mRNA encoding Pasteurella mul chondroitin Synthase therein in a medium Suitable for tocida chondroitin Synthase. the expression of a chondroitin polymer; and 66. A method for producing a chondroitin polymer, com prising the Steps of extracting the chondroitin polymer. 51. The method of claim 50, wherein in the step of introducing a purified nucleic acid Segment having a providing a chondroitin Synthase, the chondroitin Synthase is coding region encoding enzymatically active chon from Pasteurella multocida. droitin Synthase into a host organism, wherein the host 52. The method of claim 51, wherein in the step of organism contains nucleic acid Segments encoding providing a chondroitin Synthase, the chondroitin Synthase is enzymes which produce UDP-GlcUA and UDP-Gal from Pasteurella multocida and has an amino acid Sequence NAc, in accordance with SEO ID NO:2 or 4. growing the host organism in a medium to Secrete chon 53. The method of claim 51, wherein in the step of droitin polymer; and providing a chondroitin Synthase, the chondroitin Synthase recovering the Secreted chondroitin polymer. from Pasteurella multocida is a nucleotide Sequence in 67. The method according to claim 66, wherein in the step accordance with SEO ID NO:1 or 3. of recovering the chondroitin polymer, the chondroitin poly 54. The purified composition of claim 42, wherein the mer is extracted from the medium or the cells or combina chondroitin polymer is Sulfated in vitro. tions thereof. 55. The purified composition of claim 42, wherein the 68. The method according to claim 67, further comprising chondroitin polymer is epimerized in vitro. the Steps of purifying the extracted chondroitin polymer. 56. A recombinant host cell containing a chondroitin 69. The method according to claim 66, further comprising Synthase and an epimerase. the Step of Sulfating the chondroitin polymer. 57. A recombinant host cell containing a chondroitin 70. The method according to claim 66, further comprising Synthase and a Sulfotransferase. the Step of epimerizing the chondroitin polymer. 58. A recombinant host cell containing a chondroitin 71. The method according to claim 66, wherein in the step Synthase, an epimerase, and a Sulfotransferase. of growing the host organism, the host organism Secretes a 59. The purified composition of claim 42, wherein the Structurally modified chondroitin polymer. chondroitin polymer is Sulfated in Vivo. 72. The method according to claim 66, wherein in the step 60. The purified composition of claim 42, wherein the of growing the host organism, the host organism Secretes a chondroitin polymer is epimerized in Vivo. chondroitin polymer having a modified size. 61. The recombinant host cell of claims 56, 57, or 58, 73. A pharmaceutical composition comprising a prese wherein the chondroitin synthase is a P. multocida chon lected pharmaceutical drug and an effective amount of a droitin Synthase. chondroitin polymer produced by a chondroitin Synthase 62. The recombinant host cell of claim 61, wherein the P directly or after modification of the polymer by Sulfation or multocida chondroitin Synthase is in accordance with SEQ. epimerization or combinations thereof. ID NO:2. 74. The pharmaceutical composition of claim 73, wherein 63. A purified composition, wherein the purified compo the chondroitin synthase is from Pasteurella multocida. Sition comprises an enzymatically active chondroitin Syn 75. The pharmaceutical composition of claim 74, wherein thase polypeptide. the chondroitin polymer is produced by the Pasteurella 64. A method for detecting a DNA species, comprising the multocida chondroitin synthase of SEQ ID NO:2 or 4. Steps of: 76. The pharmaceutical composition of claim 73, wherein the molecular weight of the chondroitin polymer is modified obtaining a DNA sample; thereby producing a modified molecular weight pharmaceu tical composition. contacting the DNA sample with a purified nucleic acid 77. The pharmaceutical composition of claim 73, wherein segment in accordance with SEQ ID NO:1 or 3; the molecular weight of the chondroitin polymer is modified hybridizing the DNA sample and the purified nucleic acid thereby producing a modified molecular weight pharmaceu Segment thereby forming a hybridized complex; and tical composition capable of targeting a Specific tissue or cell type within a patient having an affinity for the modified detecting the complex. molecular weight pharmaceutical composition. US 2003/0104601 A1 Jun. 5, 2003 26

78. A purified and isolated nucleic acid Sequence encod (3) sequences that flank the genetic elements and are ing enzymatically active chondroitin Synthase, the nucleic Sufficiently homologous to the chondroitin Synthase acid Sequence Selected from the group consisting of: gene to enable integration by homologous recombi the nucleic acid Sequence in accordance with SEQ ID nation, NO:1 or 3; whereby integration of the genetic elements into the complementary nucleic acid Sequences to the nucleic acid chondroitin Synthase gene results by means of sequence in accordance with SEQ ID NO:1 or 3; homologous recombination; nucleic acid Sequences which will hybridize to the nucleic iii. Selecting for host cells produced in Step (b) that acid sequence in accordance with SEQ ID NO:1 or 3; express Said Selectable marker polypeptide; and and iv. Screening and extracting the host cells obtained in Step nucleic acid Sequences which will hybridize to the (c) to obtain host cells that produce chondroitin Syn complementary nucleic acid Sequences of SEQ ID thase. NO:1 or 3. 86. The recombinant host cell of claim 85, wherein the 79. A purified and isolated nucleic acid Segment consist recombinant host cell is a vector. ing essentially of a nucleic acid Segment encoding enzy 87. The recombinant host cell of claim 85, wherein the matically active chondroitin Synthase. chondroitin Synthase gene is obtained from Pasteurella 80. A procaryotic or eucaryotic host cell transformed or multocida. transfected with an isolated nucleic acid Segment according 88. The recombinant host cell of claim 87, wherein the to claim 1, 2, or 3 in a manner allowing the host cell to chondroitin synthase gene obtained from Pasteurella mul express chondroitin polymer. tocida is in accordance with SEQ ID NO:1 or 3. 81. An isolated nucleic acid Segment consisting essen 89. The recombinant host cell of claim 85, wherein the tially of a nucleic acid Segment encoding chondroitin Syn recombinant host cell expresses chondroitin Synthase. thase having at least one nucleic acid Segment Sufficiently 90. The recombinant host cell of claim 89, wherein the duplicative of the nucleic acid Segment in accordance with recombinant host cell expresses a chondroitin Synthase in SEQ ID NO:1 or 3 to allow possession of the biological accordance with SEO ID NO:2 or 4. property of encoding for a Pasteurella multocida chon 91. The recombinant host cell of claim 85, further com droitin Synthase. prising the steps of: (e) exposing the host cells identified in 82. A cl)NA sequence according to claim 81. Step (d) to a mutagen under conditions Such that mutations 83. A prokaryotic or eukaryotic host cell transformed or are created in the chondroitin Synthase gene; and (f) testing transfected with a nucleic acid Segment according to claim the host cells produced in step (d) or (e) for host cells that 81 in a manner allowing the host cell to express chondroitin produce the marker polypeptide at a higher level than the polymer. initial level, to obtain a recombinant host cell having a mutation that causes increased expression of the upstream 84. A purified nucleic acid Segment having a coding genetic element resulting in an increase in production by the region encoding enzymatically active chondroitin Synthase, host cells of all polypeptides encoded by Said heterologous wherein the purified nucleic acid Segment is capable of DNA molecule compared to the production of all polypep hybridizing to the nucleotide Sequence in accordance with tides encoded by the heterologous DNA molecule by the SEO ID NO:1 or 3. host cells in the absence of the mutation, wherein the 85. A recombinant host cell that is the product of a process increased expression is retained in the absence of conditions comprising the Steps of: that Select for cells having the increased expression. i. providing a culture comprised of host cells comprising 92. A recombinant method for producing a heterologous a chondroitin Synthase promoter which is endogenous polypeptide in a host cell, comprising the Steps of: to the host cells and a chondroitin Synthase gene under (a) transforming the host cell with a vector comprising a transcriptional control of the chondroitin Synthase pro promoter and a nucleic acid construct comprising a moter, nucleic acid Sequence encoding a desired heterologous ii. transforming the host cells in the culture with a polypeptide, wherein Said promoter comprises a tran heterologous DNA molecule, comprising: Scriptional activating region of the nucleic acid sequence set forth in SEQ ID NO:1 or 3, and wherein (1) two genetic elements assembled Such that the the nucleic acid construct is positioned in operable coding regions of both elements are translated in the linkage with the promoter; Same direction, wherein the downstream genetic element comprises a Selectable marker gene, a pro (b) culturing the transformed host cell of step (a); and moter that controls the transcription of the Selectable (c) recovering the heterologous polypeptide from the marker gene, and a transcription termination transformed host cell of step (b). Sequence, and wherein the upstream genetic element 93. A process for producing a chondroitin polymer by comprises one or more promoterleSS coding regions fermentation of a cell expressing a chondroitin Synthase encoding at least one desired polypeptide followed enzyme having an amino acid Sequence in accordance with by a transcription termination Sequence, SEO ID NO:2 or 4. (2) sequences that flank the genetic elements and are 94. A process for the in vitro Sulfation of a chondroitin oriented Such that their direction of translation is the polymer, wherein the chondroitin polymer is produced by a Same as that of the two heterologous genetic ele chondroitin Synthase, wherein the chondroitin polymer is ments, and Sulfated by either chemical or enzymatic means. US 2003/0104601 A1 Jun. 5, 2003 27

95. The process of claim 94, wherein the chondroitin 104. The polysaccharide of claim 103, wherein the Synthase is a Pasteurella multocida chondroitin Synthase. polysaccharide is extracted and isolated from a culture 96. The process of claim 95, wherein the Pasteurella media in which a microorganism belonging to the class multocida chondroitin Synthase is in accordance with SEQ Pasteurella is cultured. ID NO:2 or 4. 97. A dermatan polymer obtained by the process of 105. The polysaccharide of claim 104, where the culture epimerizing a chondroitin polymer, wherein the chondroitin media is Selected from the group consisting of tissue, yeast polymer is produced by a chondroitin Synthase. or milk extracts or a chemically defined media composed of 98. The dermatan polymer of claim 97, wherein the Vitamins, amino acids and Salts, or combinations thereof. chondroitin synthase is a Pasteurella multocida chondroitin 106. The polysaccharide of claim 105, wherein the Synthase. polysaccharide is purified from the culture media by a 99. The dermatan polymer of claim 98, wherein the method Selected from the group consisting of Solvent pre PaSteurella multocida chondroitin Synthase is in accordance cipitation, aliphatic quaternary amine precipitation, ion with SEO ID NO:2 or 4. eXchange chromatography, Selective extraction, or Selective 100. A recombinantly produced unsulfated chondroitin ultrafiltration/dialysis, and combinations thereof. polysaccharide. 107. A purified nucleic acid Segment having a coding 101. The recombinantly produced unsulfated chondroitin polysaccharide of claim 100 produced by a chondroitin region encoding enzymatically active chondroitin Synthase, Synthase. the purified nucleic acid Segment corresponding to residues 102. The recombinantly produced unsulfated chondroitin 45 to 704 of SEO ID NOS:1 or 3. polysaccharide of claim 101, wherein the chondroitin syn 108. A purified nucleic acid Segment having a coding thase is in accordance with SEQ ID NO:2 or 4. region encoding enzymatically active chondroitin Synthase, 103. A polysaccharide comprising alternating Beta 1,4- the purified nucleic acid Segment corresponding to residues linked GalNAc and Beta 1.3-linked GlcUA in a 1:1 ratio of 75 to 704 of SEO ID NOS:1 or 3. the polysaccharide, the polysaccharide further having the 109. A purified nucleic acid Segment having a coding properties: (1) nature: a white amorphous powder; (2) Solu region encoding enzymatically active chondroitin Synthase, bility: insoluble in alcohol, acetone, chloroform, and Soluble the purified nucleic acid Segment corresponding to residues in water and dimethylsulfoxide; (3) component Sugars: glucuronic acid and N-acetyl-galactosamine only; (4) 1 to 704 of SEO ID NOS: 1 or 3. molecular weight: 1,000-250,000; (5) H-NMR spectrum: 110. The polysaccharide of claim 106, wherein the exhibiting signals characteristic of unsulfated chondroitin; polysaccharide is modified by a treatment Selected from the (6) enzymatic sensitivity: Susceptible to chondroitinase group consisting of Sulfation, epimerization, fragmentation, ABC, but not hyaluronate lyase; and (7) color reaction: or croSS-linking and combinations thereof. positive to phenol-Sulfuric acid reaction and carbazole reac tion.