US007569386B2
(12) United States Patent (10) Patent No.: US 7,569,386 B2 DeAngelis (45) Date of Patent: Aug. 4, 2009
(54) CHONDROITINSYNTHASE GENE AND Terminal Position of Chondroitin Sulfate’ Nakanishi et al. The Jour METHODS OF MAKING AND USING SAME nal of Biological Chemistry 1981, 256 (11) 5443-5449). “Differences in the Effects of pH on the Hydrolytic and (75) Inventor: Paul L. DeAngelis, Edmond, OK (US) Transgalactosylic Reactions of Beta-Galactosidase (Escherichia coli), Huber et al., Can. J. Biochem. Cell Biol. 61: 198-206 (1983). (73) Assignee: The Board of Regents of the University “Binding and Reactivity at the 'Glucose' Site of Galactosyl-Beta Galactosidase (Escherichia coli), Huber et al., Arch Biochem of Oklahoma, Norman, OK (US) Biophys. 234: 151-160 (1984). (*) Notice: Subject to any disclaimer, the term of this “Effect of Replacing Uridine 33 in Yeast tRNAPhe on the Reaction patent is extended or adjusted under 35 With Ribosomes”. Dix et al., J. Biol. Chem., 261(22): 101 12-8 (1986). U.S.C. 154(b) by 656 days. "Structure and Serological Characteristics of the Capsular K4 Anti gen of Escherichia coli O5:K4:H4, A Fructose-Containing Polysac (21) Appl. No.: 11/042,530 charide With a Chondroitin Backbone', Rodriguez et al., Eur, J. Biochem., 177:117-124 (1988). (22) Filed: Jan. 24, 2005 “The Carboxy-Terminal Domain of the LexA Repressor Oligomerises Essentially as the Entire Protein'. Schnarret al., FEBS (65) Prior Publication Data Lett. 234:56-60 (1988). US 2005/O164984 A1 Jul. 28, 2005 "A Cryptic Fimbrial Gene in Serratia Marcescens”. Moriya et al., J. Bacteriol. 171 (12): 6629-36 (1989). Related U.S. Application Data "Monoclonal Antibodies Specific for K88ab, K88ac and K88ad Anti gens of Escherichia coli, Liet al., Wei Sheng Wu Xue Bao, 29:348 (63) Continuation of application No. 09/842,484, filed on 353 (1989) (Full Article Unavailable; Abstract Only). Apr. 25, 2001, now abandoned, application No. “Kinetic Characterization of the Unisite Catalytic Pathway of Seven 11/042,530, filed on Jan. 24, 2005, and a continuation Beta-Subunit Mutant F1-ATPases From Escherichia coli'', al-Shawi in-part of application No. 09/283.402, filed on Apr. 1, et al., J. Biol. Chem., 264(26): 15376-83 (1989). 1999, now abandoned, and a continuation-in-part of "Slow-Binding Inhibition of the Escherichia coli Pyruvate application No. 09/437.277, filed on Nov. 10, 1999, Dehydrogenase Multienzyme Complex by Acetylphosphinate”. now Pat. No. 6,444,447. Schonbrunn-Hanebeck et al., Biochemistry, 29(20): 4880-5 (1990). "Molecular Cloning and Expression of the Genes Encoding the (60) Provisional application No. 60/199,538, filed on Apr. Escherichia coli K4 Capsular Polysaccharide, A Fructose-Substi 25, 2000. tuted Chondroitin', Drake et al., FEMS Microbiol. Lett., 54(1- 3):227-30 (1990) (Full Article Unavailable; Abstract Only). (51) Int. Cl. “Electron Microscopic Study of Coexpression of Adhesive Protein CI2N 5/10 (2006.01) Capsules and Polysaccharide Capsules in Escherichia coli. Kronke CI2N I/2 (2006.01) et al., Infect. Immunity, 58:2710-4 (1991). CI2N 9/10 (2006.01) “Transport and Utilization of Ferrioxamine-E-Bound Iron in Erwinia C7H 2L/04 (2006.01) Herbicola (Pantoea agglomerans). Matzanke et al., Biol. Met., 181 (52) U.S. Cl...... 435/325; 435/252.3:435/254.11: 185 (1991). “Modulation of the Tight Binding of Carboxyarabinitol 1, 435/320.1; 536/23.2 5-Biphosphate to the Large Subunit of Ribulose 1.5-Bisphosphate (58) Field of Classification Search ...... None Carboxylase/Oxygenase'. Smrcka et al., Arch. Biochem. BiophyS., See application file for complete search history. 286: 14-9 (1991). (56) References Cited "Slow-Onset Inhibition of Ribosomal Peptidyltransferase by Lincomycin', Kallia-Raftopoulos et al., Arch. Biochem. BiophyS., U.S. PATENT DOCUMENTS 298: 332-339 (1992). 4,585,754 A 4, 1986 Meisner et al. (Continued) 4,990,601 A 2, 1991 Skjak-Braek et al. 5,008,253 A 4, 1991 Casu et al. Primary Examiner Nashaat T Nashed 2003.01.00534 A1 5/2003 Zoppetti et al. Assistant Examiner Md. Younus Meah (74) Attorney, Agent, or Firm—Dunlap Codding, P.C. FOREIGN PATENT DOCUMENTS EP OO300035 5, 1995 (57) ABSTRACT EP O1304338 4/2003 WO WOOOf 27437 5, 2000 WO WOO1/O2597 1, 2001 The present invention relates to a chondroitin synthase gene WO WOO1/80810 11, 2001 and methods of making and using same. In more particular, WO WOO3/O12099 2, 2003 but not by way of limitation, the present invention relates to a chondroitin synthase gene from Pasteurella multocida and OTHER PUBLICATIONS methods of isolating and using same. Additionally, the present invention relates to the use of unsulfated chondroitin "Genetic Mapping of the K1 and K4Antigens (L) of Escherichia coli. and its preparation, as well as conversion into modified ver Non-Allelism of K(L) Antigens With K Antigens of 08: K27(A), sions such as dermatan Sulfate and chondroitin Sulfate poly 08:K8 (L) and 09:K57 (B), Orskov et al., Acta Pathol Microbiol Scand B, 84:125-131 (1976). CS. "A Terminal 6-Sulfotransferase Catalyzing A Synthesis of N-Acetylgalactosamine 4,6-Bissulfate Residue. At The Nonreducing 16 Claims, 10 Drawing Sheets US 7,569,386 B2 Page 2
OTHER PUBLICATIONS “Kinetic Studies on the Interaction Between a Ribosomal Complex Active in Peptide Bond Formation and the Macrollide Antibiotics “Enhanced Catalysis by Active-Site Mutagenesis at Aspartic Acid Tylosin and Erythromycin', Dinos et al., Biochemistry, 39(38): 153 in Escherichia coli Alkaline Phosphatase'. Matlin et al., Bio 11621-11628 (2000). chemistry, 31(35): 8196-8200 (1992). "Structure-Function Relationships in Novel Peptide Dodecamers “A Study of Vitamin Inhibition on the Mutagenicity of the Antine With Broad-Spectrum Bactericidal and Endotoxin-Neutralizing oplastic Drugs'. Zhao and Huang, Zhonghua Yu Fang Yi Xue Za Zhi, Activities”. Mayo et al., Biochemical Journal, 349(3): 717-728 26:291-293 (1992) (Full Article Unavailable; Abstract Only). (2000). “Molecular Cloning of a Gene Coding for Beta-Glucanase From Identification and Molecular Cloning of a Chondroitin Synthase Bacillus Subtilis K4, Antagonist to Plant Pathogenic Fungi'. Kim et From Pasteurella Multocida TypeF, Paul DeAngelis, et al., Journal of al., RDA Journal of Agricultural Science Biotechnology, 35(1): 213 Biological Chemistry, vol. 275, No.31, pp. 24124-24129, Apr. 2000. 218 (1993). “Ring Opening is not Rate-Limiting in the GTP Cyclohydrolase I “Preliminary Study of Test Methods to Assess the Virucidal Activity Reaction”. Bacher et al., J. Biol. Chem., 276(4): 2622-2626 (2001). of Skin Disinfectants Using Poliovirus and Bacteriophages', Davies “Subunit Communication in Tetrameric Class 2 Human Liver et al., Journal of Hospital Infection, 25(2): 125-131 (1993). “The Escherichia coli serA-Linked Capsule Locus and its Flanking Aldehyde Dehydrogenase as the Basis for Half-Of-The-Site Reac Sequences are Polymorphic, Genetic Evidence for the Existence of tivity and the Dominance of the Oriental Subunit in a More Than Two Groups of Capsule Gene Clusters'. Drake et al., J. Heterotetramer'. Weiner et al., Chemico-Biological Interactions, Gen. Microbiol. 139 (Pt. 8): 1707-1714 (1993). 130-132(1-3):47-56 (2001). “Reaction of Modified and Unmodified tRNA (Tyr) Substrates With Molecular Cloning and Expression of a Human Chondroitin Tyrosyl-tRNA Synthetase (Bacillus stearothermophilus)'', Avis et Synthase, Hiroshi Kitagawa, et al., Journal of Biological Chemistry, al., Biochemistry, 32(20): 5312-5320 (1993). vol. 276, No. 42, pp. 38721-38726, August 2001. “Effect of pH on Solubility and Ionic State of Lipopolysaccharide Utility of Molecularly Dissected Synthases for Chemoenzymatic Obtained From the Deep Rough Mutant of Escherichia coli, Dinet Synthesis of Glycosaminoglycan Oligosaccharides, Paul DeAngelis, al., Biochemistry, 32(17): 4579-4586 (1993). Glycobiology, vol. 11, No. 10, pp. 934, Oct. 2001. “Amino Acid Residues of the Kringle-4 and Kringle-5 Domains of "Detection of Submicrogram Quantitites of Glycosaminoglycans on Human Plasminogen That Stabilize Their Interactions With Omega Agarose Gels by Sequential Staining With Toluidine Blue and Stains Amino Acid Ligands', McCance et al., J. Biol. Chem. All”, Volpi and Maccari, Electrophoresis, 23(24):4060-4066 (2002). 269(51):32405-32410 (1994). Keratan Sulfate Biosynthesis, James Funderburgh, IUBMB Life, vol. “Kinetic Mechanism of Kinesin Motor Domain'. Ma and Taylor, 54, pp. 187-194, 2002. Biochemistry, 34(40): 13233-13241 (1995). Mammalian Hyaluronan Synthases, Naoki Itano, et al., IUBMB Life, “Production and Purification of an Extracellularly Produced K4 vol. 54, pp. 195-199, 2002. Polysachharide From Escherichia coli'. Manzoni et al., Biotechnol. Molecular Cloning and Expression of Human Chondroitin Lett., 18(4): 383-386 (1996). N-Acetylgalactosaminyltransferase, Toru Uyama, et al., Journal of “A Novel Family of Phospholipase D Homologues That Includes Biological Chemistry, vol. 277, No. 11, pp. 8841-8846, Jan. 2002. Phospholipid Synthases and Putative Endonucleases: Identification Molecular Cloning and Characterization of Chondroitin Polymerase of Duplicated Repeats and Potential Active Site Residues'. Ponting From Escherichia coli Strain K4, Toshio Ninomiya, et al., Journal of and Kerr, Protein Science,914-922 (May 1996). Biological Chemistry, vol. 277, No. 24, pp. 21567-21575, Apr. 2002. “Biosynthesis of Dermatan Sulphate. Defructosylated Escherichia Molecular Cloning and Characterization of a Novel Chondroitin coli K4 Capsular Polysaccharide as a Substrate for the D-Glucuronyl Sulfate Glucuronyltransferase That Transfers Glucuronic Acid to C-5 Epimerase, and an Indication of a Two-Base Reaction Mecha N-Acetylgalactosamine, Masanori Gotoh, et al., Journal of Biologi nism”, Hannesson et al., Biochem. J., 313(Pt. 2): 589-596 (1996). cal Chemistry, vol. 277, No. 41, pp. 38179-38188, Jul. 2002. “Biosynthesis of the Escherichia coli K4 Capsule Polysaccharide: A Structure Function Analysis of Pasteurella Glycosaminoglycan Syn Parallel System for Studies of Glycosyltransferases in Chondroitin thesis, Wei Jing, et al., Glycobiology, vol. 12, No. 10, pp. 705, Oct. Formation', Lidholtet al., J. Biol. Chem., 272(5):2682-2687 (1997). 2002. “Kinetic Mechanism of Monomeric Non-Claret Disjunctional Pro tein (Ncd) ATPase'. Pechatnikova et al., J. Biol. Chem. 272(49): Biosynthesis of Chondroitin/Dermatan Sulfate, Jeremiah Silbert, et 30735-30740 (1997). al., IUBMB Life, vol. 54, pp. 177-186, Oct. 2002. "A Two-Site Mechanism for ATP Hydrolysis by the Asymmetric Rep Functional Characteristics and Catalytic Mechanisms of the Bacte Dimer P2S as Revealed by Site-Specific Inhibition With ADP rial Hyaluronan Synthases, Paul Weigel, IUBMB Life, vol. 54, pp. AlF4'. Wong and Lohman, Biochemistry, 36(11): 3115-3125 201-211, Oct. 2002. (1997). "Structural/Functional Characterization of the Alpha 2-Plasmin “The Capsule Biosynthetic Locus of Pasturella Multocida A:1”. Inhibitor C-Terminal Peptide', Frank et al., Biochemistry, 42:1078 Chung et al., FEMS Microbiology Letters, 186:289-296 (1998). 1085 (2003). “Role of Fimbriae-Mediated Adherence for Neutrophil Migration “Trp-999 of Beta-Galactosidase (Escherichia coli) is a Key Residue Across Escherichia coli-Infected Epithelial Cell Layers', Godaly et for Binding, Catalysis, and Synthesis of Allolactose, the Natural Lac al., Molecular Microbiology, 30(4): 725-735 (1998). Operon Inducer', Huber et al., Biochemistry, 42(6): 1796-1803 “Complete Kinetic Mechanism of Elongation Factor Tu-Dependent (2003). Binding of Aminoacyl-tRNA to the a Site of the E. coli Ribosome'. "Separation of Capsular Polysaccharide K4 and Defructosylated K4 Papeet al., EMBO J., 17(24): 7490-7497 (1998). Derived Disaccharides by High-Performance Capillary “Transfer RNA Identity Contributes to Transition State Stabilization Electrophoresis and High-Performance Liquid Chromatography'. During Aminoacyl-tRNA Synthesis', Ibba et al., Nucleic Acids Volpi, Electrophoresis, 24(6): 1063-1068 (2003). Research, 27(18):3631-3637 (1999). “Milligram-Scale Preparation and Purification of Oligosaccharides “Contractile Function and Myoplasmic Free Ca2+ (Cam) in Coro of Defined Length Possessing the Structure of Chondroitin From nary and Mesenteric Arteries of Endotoxemic Guinea Pigs”, Jones et Defructosylated Capsular Polysaccharide K4'', Volpi, Glycobiology, al., Shock, 11: 64-71 (1999). 13(9):635-640 (2003).
U.S. Patent Aug. 4, 2009 Sheet 5 of 10 US 7,569,386 B2
Std CS Y AS
the f y we
w w s a 8 8 s
12 14, 16 18 20 22 Time (min) Fig. 3 U.S. Patent Aug. 4, 2009 Sheet 6 of 10 US 7,569,386 B2
S CASE Pr- E a E S D C) s O d O S. > > CO O CS
H H O M - o M
er CN NO
er
CN U.S. Patent Aug. 4, 2009 Sheet 7 of 10 US 7,569,386 B2
DEANGELIS STD. 5NMOL 10/15/00 Standard 1000
800 SY S. s O s O s 600 200 O 10.0 20.0 30.0 40.0 50.0 60.0 SAMPLE F REPEAT 5NMOL. 10/15 Pasteurella 1000 Chondroitin 800 600 400 200 O 10.0 20.0 30.0 40.0 50.0 60.0 U.S. Patent Aug. 4, 2009 Sheet 8 of 10 US 7,569,386 B2 100 75 350A 25 O 12 13 Time (min) Fig. 6 200 150 2A 100 50 12 13 14 15 16 17 18 Time (min) Fig. 7 U.S. Patent Aug. 4, 2009 Sheet 9 of 10 US 7,569,386 B2 NMR of Type F Polymer HOD 5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 ppm Fig. 8 U.S. Patent Aug. 4, 2009 Sheet 10 of 10 US 7,569,386 B2 ABCase Treatment 0.012 0.010 0.008 0.006 0.004 0.002 0.000 ADiOS -0.002 -0.004 25 50 75 100 minutes Fig. 9 ACase Treatment 0.012 0.010 0.008 e 0.006 0.004 ADiOS 0.002 0.000 50 75 minutes Fig. 10 US 7,569,386 B2 1. 2 CHONIDROITN SYNTHASE GENE AND GAGS may sequester or bind certain proteins (e.g. growth or METHODS OF MAKING AND USING SAME coagulation factors) to cell Surfaces. Certain pathogenic bacteria produce an extracellular CROSS-REFERENCE TO RELATED polysaccharide coating, called a capsule, which serves as a APPLICATIONS virulence factor. In a few cases, the capsule is composed of GAG or GAG-like polymers. As the microbial polysaccha This application is a continuation of U.S. patent applica ride is identical or very similar to the host GAG, the antibody tion Ser. No. 09/842,484 filed Apr. 25, 2001 now abandoned response is either very limited or non-existent. The capsule is and entitled CHONDROITIN SYNTHASE GENE AND thought to assist in the evasion of host defenses such as METHODS OF MAKING AND USING SAME: is related to 10 phagocytosis and complement. Examples of this clever strat U.S. provisional application Ser. No. 60/199,538 filed Apr. egy of molecular camouflage are the production of an authen 25, 2000 and entitled “POLYMER FORMATION AND tic HA polysaccharide by Gram-negative Type A Pasteurella RECOGNITION MECHANISMS AND METHODS OF multocida and Gram-positive Group A and C Streptococcus. MAKING AND USING SAME'. is a continuation-in-part of The HA capsule of these microbes increases virulence by 10° U.S. patent application Ser. No. 09/283.402, filed Apr. 1, 15 to 10-fold as measured by LDso values, the numberofcolony 1999 now abandoned and entitled “DNA ENCODING forming units that will kill 50% of the test animals after HYALURONAN SYNTHASE FROM PASTEURELLA bacterial challenge. MULTOCIDA AND METHODS OF USE; and is a continu The invasiveness and pathogenicity of certain E. coli ation-in-part of U.S. patent application Ser. No. 09/437.277. strains has also been attributed to their polysaccharide cap filed Nov. 10, 1999 now U.S. Pat. No. 6,444,447 and entitled Sules. Two Escherichia coli capsular types, K4 and K5, make POLYMER GRAFTING BY POLYSACCHARIDE SYN polymers composed of GAG-like polymers. The E. coli K4 THASES. polymer is an unsulfated chondroitin backbone decorated with fructose side-branches on the C3 position of the GlcUA STATEMENT REGARDING FEDERALLY residues. The K5 capsular material is a polysaccharide, called FUNDED RESEARCH 25 heparosan, identical to mammalian heparin except that the bacterial polymer is unsulfated and there is no epimerization The government owns certain rights in the present inven of GlcUA to iduronic acid. tion pursuant to a grant from the National Institutes of Health The studies of GAG biosynthesis have been instrumental in (GM56497) and a grant from the National Science Founda understanding polysaccharide production in general. The HA tion (MCB-9876.193). 30 synthases were the first GAG glycosyltransferases to be iden tified at the molecular level. These enzymes utilize UDP BACKGROUND OF THE INVENTION sugar nucleotide substrates to produce large polymers con taining thousands of disaccharide repeats. The genes 1. Field of the Invention encoding bacterial, vertebrate, and viral HAS enzymes have 35 been cloned. In all these cases, expression studies demon The present invention relates to a chondroitin synthase strated that transformation with DNA encoding a single HAS gene and methods of making and using same. In more par polypeptide conferred the ability of foreign hosts to synthe ticular, but not by way of limitation, the present invention size HA. Except for the most recent HAS to be identified, P relates to a chondroitin synthase gene from Pasteurella mul multocida pmHAS, these proteins have similar amino acid tocida and methods of isolating and using same. Additionally, 40 sequences and predicted topology in the membrane. Two the present invention relates to the use of unsulfated chon classes of HASs have been proposed to exist based on these droitin and its preparation, as well as conversion into modi structural differences as well as potential differences in reac fied versions such as dermatan Sulfate and chondroitin Sulfate tion mechanism. polymers. The biochemical study of chondroitin biosynthesis inver 2. Background Information Relating to the Invention 45 tebrates was initiated in the 1960s. Only recently have the Glycosaminoglycans GAGs are long linear polysaccha mammalian enzymes for elongation of the polysaccharide rides consisting of disaccharide repeats that contain an amino backbone of chondroitin been tentatively identified by bio Sugar and are found in most animals. Chondroitin B(1.4) chemical means. An 80-kDa GlcUA transferase found in GlcUA-B(1,3)GalNAc, heparin/heparan C.14)GlcUA-B vertebrate cartilage and liver was implicated in the biosyn (1,4)GlcNAc, and hyaluronan IB(1,4)GlcUA-B(1.3) 50 thesis of the chondroitin backbone by photoaffinity labeling GlcNAc, are the three most prevalent GAGs found in with an azidoUDP-GlcUA probe. A preparation from bovine humans. Chondroitin and heparin typically have n=20 to 100, serum with the appropriate GalNAc- and GlcUA-transferase while hyaluronan typically has n=10. Chondroitin and hep activities in vitro was obtained by conventional chromatog arin are synthesized as glycoproteins and are Sulfated at vari raphy, but several bands on SDS-polyacrylamide gels (in ous positions in vertebrates. Hyaluronan is not sulfated in 55 cluding a few migrating ~80 kDa) were observed. vertebrates. A substantial fraction of the GlcUA residues of Chondroitin polysaccharide (beta-1,3-GalNAc-beta-1,4- heparin and chondroitin are epimerized to form iduronic acid. GlcUA); n=-10-2000) has use as a hyaluronan (HA) Many lower animals possess these same GAGS or very polysaccharide Substitute in medical or cosmetic applica similar molecules. GAGS play both structural and recognition tions. Both chondroitin and hyaluronan form viscoelastic gels roles on the cell surface and in the extracellular matrix. By 60 (suitable for eye or joint applications) or hydrophilic, hygro virtue of their physical characteristics, namely a high negative scopic materials (Suitable for moisturizer or wound dress charge density and a multitude of polar hydroxyl groups, ings). Unmodified or underivatized chondroitin is not known GAGS help hydrate and expand tissues. Numerous proteins to exist or, if present, in very Small quantities in the human bind selectively to one or more of the GAGs. Thus the pro body. The main advantage is that byproducts of natural HA teins found on cell Surfaces or the associated extracellular 65 degradation (by shear, enzyme, radical or oxidation pro matrices (e.g. CD44, collagen, fibronectin) of different cell cesses) have certain biological activities with respect to vas types may adhere or interact via a GAG intermediate. Also cularization, angiogenesis, cancer, tissue modulation, but US 7,569,386 B2 3 4 similar byproducts of chondroitin (in the proposed unsul ing scheme corresponds to the slightly longer pmHAS fated, unmodified State) may not have the same biological sequence. The putative A1 (residues 161-267) and A2 (resi activity. The chondroitin polymers are more inert, loosely dues 443-547) domains correspond to regions important for speaking, than the analogous HA molecule. Chondroitin from hexosamine transferase or for glucuronic acid transferase either P. multocida Type F or a recombinant host containing activity, respectively. Most sequence differences are found in the Pasteurella-derived or Pasteurella-like synthase gene will the amino-terminal half of the polypeptides. The “consensus serve as an alternative biomaterial with unique properties. sequence' betweenpmCS and pmHAS depicts identical resi With respect to related microbial GAG synthases other dues and similar residues (Consensus symbols denoted as: is than the HASs, only the E. coli K5 glycosyltransferases, that anyone of IV: S is anyone of LM; % is anyone of FY: it is synthesizes heparosan have been identified by genetic and 10 anyone of NDQEBZ). Multalin version 5.4.1 Multiple biochemical means. In contrast to the HASs, it appears that sequence alignment with hierarchical clustering F. CORPET, two proteins, KfiA and KfiC, are required to transfer the 1988, Nucl. Acids Res., 16 (22), 10881-10890 Symbol com Sugars of the disaccharide repeat to the growing polymer parison table: blosumó2 Gap weight: 12 Gap length weight: 2 chain. The chondroitin-backbone synthesizing enzymes of E. Consensus levels: high-90% low-50% coli K4 have been enzymatically characterized, but the genes 15 FIG. 2. Western Blot Analysis of Truncated Recombinant encoding the relevant glycosyltransferases have not yet been PASTEURELLA GAG Synthases. Immunoreactive bands at identified. the predicted size of 80 kDa correspond to pmCS''(CS) or Many P. multocida isolates produce GAG or GAG-like pmHAS''' (HAS). No similar band is seen for the vector molecules as assessed by enzymatic degradation and removal control (V). Prestained standards (Stds) are shown for size of the capsule of living bacterial cells. Type A P. multocida, comparison. the major fowl cholera pathogen, makes a capsule that is FIG. 3. Gel Filtration Analysis of Radiolabeled Polymer sensitive to hyaluronidase. Subsequent NMR structural stud Synthesized in vitro. The pmCS''' extract (1 mg total pro ies of capsular extracts confirmed that HA was the major tein) was incubated with chondroitin acceptor oligosaccha polysaccharide present. A specific HA-binding protein, ride (5 pig), UDP-CIGlcUA and UDP-HIGalNAc (580 aggrecan, also interacts with HA from Type AP multocida. 25 uM, 0.16 uCi each) in a reaction volume of 200 ul for 30 min. Two other distinct P. multocida types, a Swine pathogen, Type The reaction product was split into five aliquots and treated D, and a minor fowl cholera pathogen, Type F, produce poly with various GAG glycosidases as described in Experimental mers that are chondroitin or chondroitin-like based on the Procedures. Portions (60%) of the samples were then ana observation that their capsules are degraded by Flavobacte lyzed on the PolySep column (calibration elution times in rium chondroitin AC lyase. After enzymatic removal of the 30 minutes: Void volume, 12.7. 580 kDa dextran, 15.4 kDa dex capsule, both types were more readily phagocytosed by neu tran, 16.0, totally included volume, 19.3 min). Radioactivity trophils in vitro. The capsule of Type D cells, but not Type F (''C, solid line; H, dotted line) measured by the in-line cells, is also reported to be degraded by heparinase III, Sug detector is presented as disintegrations per second (dps). The gesting a heparin-type molecule is present, too. double-headed arrow corresponds to a response of 20 dps. A. In the present invention, we have analyzed the monosac 35 untreated polymer, peak 15.9 min; B, Flavobacterium chon charide composition of the P. multocida Type F polysaccha droitinase AC lyase-treated polymer, peak, 19.2 min: C, HA ride and used the DNA sequence information of the Type A lyase-treated polymer, peak 15.9 min. The polymer peak with HA biosynthesis locus to obtain the homologous region from a size of ~100 to 400 kDa contained both radiolabeled sugars the Type F chromosome. From this research we have identi at a 1:1 ratio and was degraded only by the appropriate fied a chondroitin synthase, named pmCS (P. multocida 40 enzyme, chondroitin AC lyase. Chondroitin Synthase), the first chondroitin synthase to be FIG. 4. Gel Electrophoresis Analysis of Polysaccharides. identified and molecularly cloned from any source. Interest Various polymers were separated by their mass/charge ratio ingly, a single polypeptide is responsible for the copolymer on 0.8% agarose gels in a 1xTAE (tris acetate EDTA) buffer ization of the GlcUA and GalNAc sugars. We also identified system. About 9 ug of polymer were loaded per lane and the Type F capsular polymer as an unsulfated chondroitin 45 separated using a field of 0.8 volts/cm. Lanes: Type F, native polymer. We also identify organisms with the chondroitin polymer from Pasteurella multocida Type F: HA, hyaluronic synthase gene (Type FP multocida) as new Sources of unsul acid; Type III, Streptococcus pneumoniae type 3 capsular fated chondroitin polymer. polymer: Chon SO4, Chondroitin sulfate C.B.A from left to right note: marked in white dotted circle; heparin, porcine SUMMARY OF THE INVENTION 50 heparin; kb ladder, kilobase DNA ladder standard; Lambda H, HindIII digest of lambda virus DNA standard. Sizes of The present invention relates to a chondroitin synthase select DNA standards are marked in kilobases (kb). After gene and methods of making and using same. In more par electrophoresis, the gel was stained with the dye Stains-All ticular, but not by way of limitation, the present invention (Sigma; 0.05% in 50% ethanol, w/v) for 2 hours, then relates to a chondroitin synthase gene from Pasteurella mul 55 destained in water. Type F polymer runs slower than chon tocida and methods of isolating and using same. Additionally, droitin Sulfate polymers because it is larger and not as highly the present invention relates to the use of unsulfated chon charged (missing the extra charges of Sulfates). The staining droitin and its preparation, as well as conversion into modi color for HA, Type III and Type F polymers is blue, but fied versions such as dermatan Sulfate and chondroitin Sulfate chondroitin sulfate stains purple. The Type F polysaccharide polymers. 60 is a novel large unsulfated chondroitin chain, the first report of this polymer. BRIEF DESCRIPTION OF THE SEVERAL FIG. 5. Monosaccharide Analysis of Type F Polymer. The VIEWS OF THE DRAWINGS examples of the actual chromatogram used to generate the Sugar composition data in Table 2 are shown here. The pro FIG. 1. Sequence Alignment of pmCS and pmHAS. The 65 files graph the amperometric response (y-axis signifying the two Pasteurella GAG synthases are highly homologous. relative amount of Sugar eluting from column; units Identical residues are denoted with the hyphen. The number nA nanoamperes) versus elution time (X-axis signifying the US 7,569,386 B2 5 6 distinct monosaccharides; units minutes). All injected was added separately. The digestions were kept in a 37° C. samples (containing about 5 nanomoles of each Sugar com water bath overnight. The enzymes were deactivated by boil ponent) were spiked with an internal standard, rhamnose ing for 2 min. The experiments were performed with a capil (Rha), to assess recovery and the column performance. The lary electrophoresis P/ACE 5500 System (Beckman Instru “DeAngelis Standard’ contains a mixture of GalNAc, ments, Fullerton, Calif.) at a constant capillary temperature of GlcNAc, and GlcUA that were subjected to hydrolysis. The 18°C. with a potential of -22 kV by UV absorbance at 232 “Sample F is a hydrolysate of Type F polymer. The analysis nm. The electropherograms were acquired using the system shows that the Type F polymer is composed of only GalN Gold software package (Beckman Instruments, Fullerton, (hydrolysis removes the acetyl group converting GalNAc into Calif.). Separation and analysis were carried out in a reversed GalN) and GlcUA monosaccharides. 10 polarity mode using a fused silica (externally coated except FIG. 6. HA Product Size Analysis of XIHAS1-Ser77 where the tube passed through the detector) capillary tube (50 Mutants. The various enzymes were assayed for 5 minutes um inner diameter, 360 um outer diameter, 57 cm long, and 49 and the HA polymer products were separated by high perfor cm effective length). Prior to every run, the capillary was mance gel filtration. Depending on the nature of the Substi conditioned with 0.5M NaOH (1 min, 20 psi) and rinsed (1 tuting amino acid residue at position 77, either larger or 15 min, 20 psi) with separation buffer (20 mMHPO adjusted to smaller HA products were formed in comparison to HA prod pH 3.5 with saturated dibasic sodium phosphate). Samples ucts polymerized by the wild-type enzyme. Only two were applied by pressure injection 25s at 0.5 psi. Standards of mutants, Ser77Ile (larger HA) and Ser77Thr (smaller HA), all potential chondroitin oligosaccharides were used to cali and the wild-type synthase are shown. 5 min products sepa brate the capillary. The unsulfated disaccharide, ADiOS, was rated on a PolySep-4000 column. For comparison, the 580 observed in digests of Type F polymer. Thus, the native poly kDa dextran standard eluted at 12.5 min or 16.8 min on the mer of Type F is an unsulfated chondroitin. 4000 or 6000 column, respectively. FIG. 7. HA Product Size Analysis of XIHAS1-Ser77 DETAILED DESCRIPTION OF THE INVENTION Mutants. The various enzymes were assayed for 30 minutes and the HA polymer products were separated by high perfor 25 Before explaining at least one embodiment of the invention mance gel filtration. Depending on the nature of the Substi in detail, it is to be understood that the invention is not limited tuting amino acid residue at position 77, either larger or in its application to the details of construction and the smaller HA products were formed in comparison to HA prod arrangement of the components set forth in the following ucts polymerized by the wild-type enzyme. Only two description or illustrated in the drawings. The invention is mutants, Ser77Ile (larger HA) and Ser77Thr (smaller HA), 30 capable of other embodiments or of being practiced or carried and the wild-type synthase are shown. 30 min products sepa out in various ways. Also, it is to be understood that the rated on a PolySep-6000 column. For comparison, the 580 phraseology and terminology employed herein is for purpose kDa dextran standard eluted at 12.5 min or 16.8 min on the of description and should not be regarded as limiting. 4000 or 6000 column, respectively. As used herein, the term “nucleic acid segment” and “DNA FIG. 8. NMR Analysis Type F polysaccharide (170 ug 35 segment are used interchangeably and refer to a DNA mol uronic acid based on carbazole reaction) was exchanged into ecule which has been isolated free of total genomic DNA of a deuterated water (DO) and the proton spectrum (H-NMR) particular species. Therefore, a “purified DNA or nucleic was acquired at 45° C. at 500 MHz. The chemical shifts (ppm) acid segment as used herein, refers to a DNA segment which of the peaks are consistent with an unsulfated chondroitin contains a Chondroitin Synthase (“CS) coding sequence yet polymer. 40 is isolated away from, or purified free from, unrelated FIG. 9. Disaccharide Composition Analysis—Samples genomic DNA, for example, total Pasteurella multocida or, were dissolved in 10 ul of 50 mM Tris-HCl and 60 mM for example, mammalian host genomic DNA. Included sodium acetate buffer, pH 8, and 20 mU Chondroitinase ABC within the term “DNA segment', are DNA segments and was added separately. The digestions were kept in a 37° C. Smaller fragments of Such segments, and also recombinant water bath overnight. The enzymes were deactivated by boil 45 vectors, including, for example, plasmids, cosmids, phage, ing for 2 min. The experiments were performed with a capil viruses, and the like. lary electrophoresis P/ACE 5500 System (Beckman Instru Similarly, a DNA segment comprising an isolated or puri ments, Fullerton, Calif.) at a constant capillary temperature of fied pmCS (Pasteurella multocida Chondroitin Synthase) 18°C. with a potential of -22 kV by UV absorbance at 232 gene refers to a DNA segment including Chondroitin Syn nm. The electropherograms were acquired using the system 50 thase coding sequences isolated Substantially away from Gold software package (Beckman Instruments, Fullerton, other naturally occurring genes or protein encoding Calif.). Separation and analysis were carried out in a reversed sequences. In this respect, the term 'gene' is used for sim polarity mode using a fused silica (externally coated except plicity to refer to a functional protein, polypeptide or peptide where the tube passed through the detector) capillary tube (50 encoding unit. As will be understood by those in the art, this um inner diameter, 360 um outer diameter, 57 cm long, and 49 55 functional term includes genomic sequences, cDNA cm effective length). Prior to every run, the capillary was sequences or combinations thereof. “Isolated Substantially conditioned with 0.5M NaOH (1 min, 20 psi) and rinsed (1 away from other coding sequences' means that the gene of min, 20 psi) with separation buffer (20 mMHPO adjusted to interest, in this case pm CS, forms the significant part of the pH 3.5 with saturated dibasic sodium phosphate). Samples coding region of the DNA segment, and that the DNA seg were applied by pressure injection 25s at 0.5 psi. Standards of 60 ment does not contain large portions of naturally-occurring all potential chondroitin oligosaccharides were used to cali coding DNA. Such as large chromosomal fragments or other brate the capillary. The unsulfated disaccharide, ADiOS, was functional genes or DNA coding regions. Of course, this observed indigests of Type F polymer. Thus, the native poly refers to the DNA segment as originally isolated, and does not mer of Type F is an unsulfated chondroitin. exclude genes or coding regions later added to, or intention FIG. 10. Disaccharide Composition Analysis—Samples 65 ally left in the segment by the hand of man. were dissolved in 10 ul of 50 mM Tris-HCl and 60 mM Due to certain advantages associated with the use of sodium acetate buffer, pH 8, and 20 mU Chondroitinase AC prokaryotic sources, one will likely realize the most advan US 7,569,386 B2 7 8 tages upon isolation of the CS gene from Pasteurella multo Nucleic acid segments having chondroitin synthase activ cida. One Such advantage is that, typically, eukaryotic ity may be isolated by the methods described herein. The term enzymes may require significant post-translational modifica “a sequence essentially as set forth in SEQ ID NO:2 or 4 tions that can only be achieved in a eukaryotic host. This will means that the sequence Substantially corresponds to a por tend to limit the applicability of any eukaryotic CS gene that tion of SEQID NO:2 or 4 and has relatively few amino acids is obtained. Moreover, those of ordinary skill in the art will which are not identical to, or a biologically functional equiva likely realize additional advantages in terms of time and ease lent of, the amino acids of SEQ ID NO: 2 or 4. The term of genetic manipulation where a prokaryotic enzyme gene is “biologically functional equivalent” is well understood in the sought to be employed. These additional advantages include art and is further defined in detail herein, as a gene having a (a) the ease of isolation of a prokaryotic gene because of the 10 sequence essentially as set forth in SEQID NO:2 or 4, and relatively small size of the genome and, therefore, the reduced that is associated with the ability of prokaryotes to produce amount of Screening of the corresponding genomic library chondroitin or a “chondroitin like” polymer or a chondroitin and (b) the ease of manipulation because the overall size of synthase polypeptide. the coding region of a prokaryotic gene is significantly One of ordinary skill in the art would appreciate that a smaller due to the absence of introns. Furthermore, if the 15 nucleic acid segment encoding enzymatically active chon product of the Chondroitin Synthase gene (i.e., the enzyme) droitin synthase may contain conserved or semi-conserved requires posttranslational modifications or cofactors, these substitutions to the sequences set forth in SEQID NOS: 1, 2, would best be achieved in a similar prokaryotic cellular envi 3 or 4 and yet still be within the scope of the invention. ronment (host) from which the gene was derived. In particular, the art is replete with examples of practitio Preferably, DNA sequences in accordance with the present ners ability to make structural changes to a nucleic acid seg invention will further include genetic control regions which ment (i.e. encoding conserved or semi-conserved amino acid allow the expression of the sequence in a selected recombi Substitutions) and still preserve its enzymatic or functional nant host. Of course, the nature of the control region activity. See for example: (1) Risler et al. “Amino Acid Sub employed will generally vary depending on the particular use stitutions in Structurally Related Proteins. A Pattern Recog (e.g., cloning host) envisioned. 25 nition Approach.” J. Mol. Biol. 204:1019-1029 (1988) “... In particular embodiments, the invention concerns isolated according to the observed exchangeability of amino acid side DNA segments and recombinant vectors incorporating DNA chains, only four groups could be delineated; (ii) IIe and Val; sequences which encode a Chondroitin Synthase gene Such as (ii) Leu and Met, (iii) Lys, Arg, and Gln, and (iv) Tyr and pmCS. In the case of pmCS, the isolated DNA segments and Phe.”; (2) Niefind et al. “Amino Acid Similarity Coefficients recombinant vectors incorporating DNA sequences which 30 for Protein Modeling and Sequence Alignment Derived from include within their amino acid sequences an amino acid Main-Chain Folding Anoles.” J. Mol. Biol. 219:481-497 sequence in accordance with SEQID NO: 2 or 4. Moreover, (1991) similarity parameters allow amino acid substitutions in other particular embodiments, the invention concerns iso to be designed; and (3) Overington et al. “Environment lated DNA segments and recombinant vectors incorporating Specific Amino Acid Substitution Tables: Tertiary Templates DNA sequences which encode a gene that includes within its 35 and Prediction of Protein Folds. Protein Science 1:216-226 amino acid sequence the amino acid sequence of an Chon (1992) Analysis of the pattern of observed substitutions as droitin Synthase gene or DNA, and in particular to an Chon a function of local environment shows that there are distinct droitin Synthase gene or cDNA, corresponding to Pasteurella patterns . . . . Compatible changes can be made. multocida Chondroitin Synthase pmCS. For example, These references and countless others available to one of where the DNA segment or vector encodes a full length 40 ordinary skill in the art, indicate that given a nucleic acid Chondroitin Synthase protein, or is intended for use in sequence, one of ordinary skill in the art could make Substi expressing the Chondroitin Synthase protein, preferred tutions and changes to the nucleic acid sequence without sequences are those which are essentially as set forth in SEQ changing its functionality. Also, a Substituted nucleic acid ID NO:2 or 4. segment may be highly identical and retain its enzymatic 45 The original sequences (SEQID NOS: 1 and 2) differ from activity with regard to its unadulterated parent, and yet still the corrected sequences (SEQ ID NOS: 2 and 4) because, fail to hybridize thereto. after more extensive sequencing of the plasmid template One of ordinary skill in the art would also appreciate that encoding the original functional pmCS gene, we found a few Substitutions can be made to the pmCS nucleic acid segment mistakes made by the sequencing technician in the original 50 listed in SEQ ID NO: 1 or 3 without deviating outside the DNA sequence. Basically, certain regions of the pmCS gene Scope and claims of the present invention. Standardized and are very difficult to sequence accurately. Typically, one can accepted functionally equivalent amino acid substitutions are obtain a sequence read length of 200-700 bases with a non presented in Table I. problematic sequence. However, in the case of pmCS gene, there were certain places where no more than 20 to 50 bases 55 TABLE I could be read, and even those were difficult. The two reasons Conservative and Semi for sequencing problems are usually due to: (1) the template, Amino Acid Group Conservative Substitutions which should remain single-stranded during the reaction, forming double-stranded regions or loops in the problematic NonPolar R Groups Alanine, Valine, Leucine, Isoleucine, Proline, Methionine, Phenylalanine, template that cause the sequencing polymerase to fall off the 60 Tryptophan template prematurely, and (2) the sequencing product forms Polar, but uncharged, R Groups Glycine, Serine, Threonine, Cysteine, loops structures or twisted forms while running on the elec Asparagine, Glutamine trophoresis gel that do not run in the desired single-stranded Negatively Charged R Groups Aspartic Acid, Glutamic Acid conformation. We have now corrected the sequence to reflect Positively Chared R Groups Lysine, Arginine, Histidine the actual DNA and protein sequences of pmCS. 65 SEQID NO: 1 and 2 have been assigned GenBank Acces Another preferred embodiment of the present invention is Sion No. AF 195517. a purified nucleic acid segment that encodes a protein in US 7,569,386 B2 9 10 accordance with SEQ ID NO:2 or 4, further defined as a may be employed for the generation of DNA fragments in recombinant vector. As used herein, the term “recombinant accordance with the present invention. Thus, the only limita vector” refers to a vector that has been modified to contain a tion generally on the particular method employed for DNA nucleic acid segment that encodes a Chondroitin Synthase isolation is that the isolated nucleic acids should encode a protein, or fragment thereof. The recombinant vector may be biologically functional equivalent chondroitin synthase. further defined as an expression vector comprising a promoter Once the DNA has been isolated it is ligated together with operatively linked to said Chondroitin Synthase encoding a selected vector. Virtually any cloning vector can be nucleic acid segment. employed to realize advantages in accordance with the inven A further preferred embodiment of the present invention is tion. Typical useful vectors include plasmids and phages for a host cell, made recombinant with a recombinant vector 10 use in prokaryotic organisms and even viral vectors for use in comprising a Chondroitin Synthase gene. The preferred eukaryotic organisms. Examples include pKK223-3, pSA3, recombinant host cell may be a prokaryotic cell. In another recombinant lambda, SV40, polyoma, adenovirus, bovine embodiment, the recombinant host cell is a eukaryotic cell. papilloma virus and retroviruses. However, it is believed that As used herein, the term “engineered’ or “recombinant cell particular advantages will ultimately be realized where vec is intended to refer to a cell into which a recombinant gene, 15 tors capable of replication in both Lactococcus or Bacillus Such as a gene encoding Chondroitin Synthase, has been strains and E. coli or P. multocida are employed. introduced. Therefore, engineered cells are distinguishable Vectors such as these, exemplified by the pSA3 vector of from naturally occurring cells which do not contain a recom Dao and Ferretti or the pAT19 vector of Trieu-Cuot, et al., binantly introduced gene. Engineered cells are thus cells hav allow one to perform clonal colony selection in an easily ing a gene or genes introduced through the hand of man. manipulated host Such as E. coli, followed by Subsequent Recombinantly introduced genes will either be in the form of transfer back into a food grade Lactococcus or Bacillus strain a cDNA gene, a copy of agenomic gene, or will include genes for production of chondroitin. These are benign and well positioned adjacent to a promoter not naturally associated studied organisms used in the production of certain foods and with the particular introduced gene. biotechnology products—otherwise known in the art as Where one desires to use a host other than Pasteurella, as 25 GRAS (Generally Regarded As Safe). GRAS organisms are may be used to produce recombinant chondroitin synthase, it advantageous in that one can augment the Lactococcus or may be advantageous to employ a prokaryotic system such as Bacillus strain’s ability to synthesize chondroitin through E. coli, B. subtilis, Lactococcus sp., or even eukaryotic sys gene dosaging (i.e., providing extra copies of the HA syn tems such as yeast or Chinese hamster ovary, African green thase gene by amplification) and/or the inclusion of addi monkey kidney cells, VERO cells, or the like. Of course, 30 tional genes to increase the availability of the chondroitin where this is undertaken it will generally be desirable to bring precursors UDP-GlcUA and UDP-GalNAc. These precursors the chondroitin synthase gene under the control of sequences are made by the action of UDP-glucose dehydrogenase and which are functional in the selected alternative host. The UDP-GlcNAc/UDP-GalNAc epimerase, respectively. The appropriate DNA control sequences, as well as their construc inherent ability of a bacterium to synthesize chondroitin can tion and use, are generally well known in the art as discussed 35 also be augmented through the formation of extra copies, or in more detail hereinbelow. amplification, of the plasmid that carries the chondroitin Syn In preferred embodiments, the chondroitin Synthase-en thase gene. This amplification can account for up to a 10-fold coding DNA segments further include DNA sequences, increase in plasmid copy number and, therefore, the Chon known in the art functionally as origins of replication or droitin Synthase gene copy number. “replicons', which allow replication of contiguous sequences 40 Another procedure that would further augment Chon by the particular host. Such origins allow the preparation of droitin Synthase gene copy number is the insertion of mul extrachromosomally localized and replicating chimeric seg tiple copies of the gene into the plasmid. Another technique ments or plasmids, to which chondroitin synthase DNA would include integrating the Chondroitin Synthase gene into sequences are ligated. In more preferred instances, the chromosomal DNA. This extra amplification would be espe employed origin is one capable of replication in bacterial 45 cially feasible, since the Chondroitin Synthase gene size is hosts suitable for biotechnology applications. However, for Small. In some scenarios, the chromosomal DNA-ligated vec more versatility of cloned DNA segments, it may be desirable tor is employed to transfect the host that is selected for clonal to alternatively or even additionally employ origins recog screening purposes such as E. coli or Bacillus, through the use nized by other host systems whose use is contemplated (such of a vector that is capable of expressing the inserted DNA in as in a shuttle vector). 50 the chosen host. In certain instances, especially to confer The isolation and use of other replication origins such as stability, genes such as the chondroitin synthase gene, may be the SV40, polyoma or bovine papilloma virus origins, which integrated into the chromosome in various positions in an may be employed for cloning or expression in a number of operative fashion. Unlike plasmids, integrated genes do not higher organisms, are well known to those of ordinary skill in need selection pressure for maintenance of the recombinant the art. In certain embodiments, the invention may thus be 55 gene. defined in terms of a recombinant transformation vector Where a eukaryotic source such as dermal or synovial which includes the chondroitin synthase coding gene fibroblasts or rooster comb cells is employed, one will desire sequence together with an appropriate replication origin and to proceed initially by preparing a cDNA library. This is under the control of selected control regions. carried out first by isolation of mRNA from the above cells, Thus, it will be appreciated by those of skill in the art that 60 followed by preparation of double stranded cDNA using an other means may be used to obtain the Chondroitin Synthase enzyme with reverse transcriptase activity and ligation with gene or cDNA, in light of the present disclosure. For example, the selected vector. Numerous possibilities are available and polymerase chain reaction or RT-PCR produced DNA frag known in the art for the preparation of the double stranded ments may be obtained which contain full complements of cDNA, and all such techniques are believed to be applicable. genes or cDNAS from a number of Sources, including other 65 A preferred technique involves reverse transcription. Once a strains of Pasteurella or from eukaryotic sources. Such as population of double stranded cDNAs is obtained, a cDNA cDNA libraries. Virtually any molecular cloning approach library is prepared in the selected host by accepted tech US 7,569,386 B2 11 12 niques, such as by ligation into the appropriate vector and for the specific desired catalysis are usually a series of Small amplification in the appropriate host. Due to the high number domains or motifs. Thus a pair of enzymes that possess the of clones that are obtained, and the relative ease of screening same or similar motifs would be expected to possess the same large numbers of clones by the techniques set forth herein, or similar catalytic activity, thus be functionally equivalent. one may desire to employ phage expression vectors, such as Utility for this hypothetical pair of enzymes may be consid wgt11, agt 12, Gem11, and/or ZAP for the cloning and ered interchangeable unless one member of the pair has a expression screening of cDNA clones. Subset of distinct, useful properties. In a similar vein, certain In certain other embodiments, the invention concerns iso non-critical motifs or domains may be dissected from the lated DNA segments and recombinant vectors that include original, naturally occurring protein and function will not be within their sequence a nucleic acid sequence essentially as 10 affected; removal of non-critical residues does not perturb the set forth in SEQID NO:1. The term “essentially as set forth in important action of the remaining critical motifs or domains. SEQID NO:1 is used in the same sense as described above By analogy, with Sufficient planning and knowledge, it should and means that the nucleic acid sequence Substantially corre be possible to translocate motifs or domains from one enzyme sponds to a portion of SEQID NO: 1, and has relatively few to another polypeptide to confer the new enzyme with desir codons which are not identical, or functionally equivalent, to 15 able characteristics intrinsic to the domain or motif. the codons of SEQID NO: 1. The term “functionally equiva The term “standard hybridization conditions” as used lent codon’ is used herein to refer to codons that encode the herein, is used to describe those conditions under which sub same amino acid, such as the six codons for arginine or serine, stantially complementary nucleic acid segments will form as set forth in Table I, and also refers to codons that encode standard Watson-Crick base-pairing. A number of factors are biologically equivalent amino acids. known that determine the specificity of binding or hybridiza It will also be understood that amino acid and nucleic acid tion, such as pH, temperature, salt concentration, the presence sequences may include additional residues, such as additional of agents, such as formamide and dimethyl sulfoxide, the N- or C-terminal amino acids or 5' or 3' nucleic acid length of the segments that are hybridizing, and the like. sequences, and yet still be essentially as set forth in one of the When it is contemplated that shorter nucleic acid segments sequences disclosed herein, so long as the sequence meets the 25 will be used for hybridization, for example fragments criteria set forth above, including the maintenance of biologi between about 14 and about 100 nucleotides, salt and tem cal protein activity where protein expression and enzyme perature preferred conditions for overnight hybridization will activity is concerned. The addition of terminal sequences include 1.2-1.8xHPB at 40-50° C. or 5XSSC at 50° C. Washes particularly applies to nucleic acid sequences which may, for in low salt (10 mM salt or 0.1xSSC) are used for stringency example, include various non-coding sequences flanking 30 and room temperature incubations of 10-60 minutes. either of the 5' or 3' portions of the coding region or may Naturally, the present invention also encompasses DNA include various internal sequences, which are known to occur segments which are complementary, or essentially comple within genes. mentary, to the sequence set forth in SEQID NOS:1, 2, 3 or Likewise, deletion of certain portions of the polypeptide 4. Nucleic acid sequences which are “complementary are can be desirable. For example, functional truncated versions 35 those which are capable of base-pairing according to the ofpmHAS or pmCS missing the carboxyl terminus enhances standard Watson-Crick complementarity rules. As used the utility for in vitro use. (FIG. 2, Table 3) The pmHAS''' herein, the term "complementary sequences' means nucleic and pmCS''' are soluble proteins that are easy to purify in acid sequences which are substantially complementary, as contrast to the full-length proteins (972 and 965 residues, may be assessed by the same nucleotide comparison set forth respectively). Also, expression level increases greatly as the 40 above, or as defined as being capable of hybridizing to the membrane is not overloaded. It is also contemplated that the nucleic acid segment of SEQID NO:1. truncated version of pmCS encompasses residues 45-704 and The nucleic acid segments of the present invention, regard 75-704. These truncated versions are also highly soluble and less of the length of the coding sequence itself, may be com increases expression; the native membrane proteins are found bined with other DNA sequences, such as promoters, poly in low levels and is not soluble without special treatment with 45 adenylation signals, additional restriction enzyme sites, detergents. multiple cloning sites, epitope tags, poly histidine regions, Allowing for the degeneracy of the genetic code as well as other coding segments, and the like, such that their overall conserved and semi-conserved Substitutions, sequences length may vary considerably. It is therefore contemplated which have between about 40% and about 80%; or more that a nucleic acid fragment of almost any length may be preferably, between about 80% and about 90%; or even more 50 employed, with the total length preferably being limited by preferably, between about 90% and about 99%; of nucle the ease of preparation and use in the intended recombinant otides which are identical to the nucleotides of SEQID NO:1 DNA protocol. will be sequences which are “essentially as set forth in SEQ Naturally, it will also be understood that this invention is ID NO:1. Sequences which are essentially the same as those not limited to the particular nucleic acid and amino acid set forth in SEQID NO:1 may also be functionally defined as 55 sequences of SEQID NOS:1, 2, 3 or 4. Recombinant vectors sequences which are capable of hybridizing to a nucleic acid and isolated DNA segments may therefore variously include segment containing the complement of SEQID NO:1 under the Chondroitin Synthase coding regions themselves, coding standard or less stringent hybridizing conditions. Suitable regions bearing selected alterations or modifications in the standard hybridization conditions will be well known to those basic coding region, or they may encode larger polypeptides of skill in the art and are clearly set forth herein. As certain 60 which nevertheless include Chondroitin Synthase coding domains and active sites are formed from a relatively small regions or may encode biologically functional equivalent pro portion of the total polypeptide, these regions of sequence teins or peptides which have variant amino acids sequences. identity or similarity may be present only in portions of the The DNA segments of the present invention encompass gene. biologically functional equivalent Chondroitin Synthase pro As well known in the art, most of the amino acids in a 65 teins and peptides. Such sequences may arise as a conse protein are present to form the “scaffolding or general envi quence of codon redundancy and functional equivalency ronment of the protein. The actual working parts responsible which are known to occur naturally within nucleic acid US 7,569,386 B2 13 14 sequences and the proteins thus encoded. Alternatively, func biological half life. One present solution to this problem is to tionally equivalent proteins or peptides may be created via the couple a small molecule shield that prevents the protein from application of recombinant DNA technology, in which being cleared from the circulation too rapidly. Very small changes in the protein structure may be engineered, based on molecular weight chondroitin is well suited for this role and considerations of the properties of the amino acids being would be nonimmunogenic and biocompatible. Larger exchanged. Changes designed by man may be introduced molecular chondroitin attached to a drug or protein may be through the application of site-directed mutagenesis tech used to target the reticuloendothelial cell system which has niques, e.g., to introduce improvements to the enzyme activ endocytic receptors for chondroitin. Large polymers may be ity or to antigenicity of the Chondroitin Synthase protein or to used in high concentrations to make gels or viscous solutions test Chondroitin Synthase mutants in order to examine chon 10 droitin synthase activity at the molecular level. with potential for joint lubrications opthaltmic procedures, Also, specific changes to the Chondroitin Synthase coding and cosmetics. sequence can result in the production of chondroitin having a One of ordinary skill in the art given this disclosure would modified size distribution or structural configuration. One of appreciate that there are several ways in which the size dis ordinary skill in the art would appreciate that the Chondroitin 15 tribution of the chondroitin polymer made by the chondroitin Synthase coding sequence can be manipulated in a manner to synthase could be regulated to give different sizes. First, the produce an altered chondroitin synthase which in turn is kinetic control of product size can be altered by decreasing capable of producing chondroitin having differing polymer temperature, decreasing time of enzyme action and by sizes and/or functional capabilities. For example, the Chon decreasing the concentration of one or both Sugar nucleotide droitin Synthase coding sequence may be altered in Such a substrates. Decreasing any or all of these variables will give manner that the chondroitin synthase has an altered Sugar lower amounts and Smaller sizes of chondroitin product. The Substrate specificity so that the chondroitin synthase creates a disadvantages of these approaches are that the yield of prod new chondroitin-like polymer incorporating a different struc uct will also be decreased and it may be difficult to achieve ture via the inclusion of a previously unincorporated Sugar or reproducibility from day to day or batch to batch. Sugar derivative. This newly incorporated Sugar could result 25 Secondly, the alteration of the intrinsic ability of the in a modified chondroitin having different functional proper enzyme to synthesize a large chondroitin product. Changes to ties. As will be appreciated by one of ordinary skill in the art the protein can be engineered by recombinant DNA technol given the Chondroitin Synthase coding sequences, changes ogy, including Substitution, deletion and addition of specific and/or substitutions can be made to the Chondroitin Synthase amino acids (or even the introduction of prosthetic groups coding sequence such that these desired property and/or size 30 through metabolic processing). Such changes that result in an modifications can be accomplished. intrinsically slower enzyme could then allow more reproduc Basic knowledge on the substrate binding sites (e.g. the ible control of chondroitin size by kinetic means. The final UDP-GlcUA site or UDP-GalNAc site or oligosaccharide chondroitin size distribution is determined by certain charac acceptor site) of pmCS allows the targeting of residues for teristics of the enzyme that rely on particular amino acids in mutation to change the catalytic properties of the site. The 35 the sequence. Among the 10-20% of residues absolutely con identity of important catalytic residues of pmHAS, a close served between Streptococcal hyaluronate synthase enzymes, homolog of pmCS, have recently been elucidated (Jing & eukaryotic hyaluronate synthase enzymes, and the pmCS, DeAngelis, 2000, Glycobiology Vol 10; pp. 883-889). Appro there is a set of amino acids at unique positions that may priate changes at or near these residues would allow other control or greatly influence the size of the polymer (either UDP-sugars to bind instead of the authentic chondroitin sugar 40 precursors; thus a new, modified polymer is synthesized. hyaluronan or chondroitin) that the enzyme can make. Polymer size changes will be caused by differences in the As shown in FIGS. 6 and 7. HA Product Size Analysis of synthase's catalytic efficiency or changes in the acceptor site XIHAS 1-Ser77 Mutants. The various enzymes were assayed affinity. Polymer size changes have been made in seHAS and for 5 or 30 minutes and the HA polymer products were sepa spHAS (Weigel et al. Designer HA) as well as the vertebrate 45 rated by high performance gel filtration. Depending on the HAS, XIHAS1 (DG42) (Pummill & DeAngelis, unpublished nature of the Substituting amino acid residue at position 77. data) by mutating various residues (FIGS. 6 and 7). As pm CS either larger or smaller HA products were formed in compari is a more malleable, robust enzyme than these other enzymes, son to HA products polymerized by the wild-type enzyme. similar or superior versions of mutant pmCS which synthe Only two mutants, Ser77Ile (larger HA) and Ser77Thr size modified polymers are also possible. 50 (smaller HA), and the wild-type synthase are shown. Panel A: The term “modified structure' as used herein denotes a 5 min products separated on a PolySep-4000 column. Panel chondroitin polymer containing a Sugar or derivative not nor B: 30 min products separated on a PolySep-6000 column. For mally found in the naturally occurring chondroitin polypep comparison, the 580-kDa dextranstandard eluted at 12.5 min tide. The term “modified size distribution” refers to the syn or 16.8 min on the 4000 or 6000 column, respectively. thesis of chondroitin molecules of a size distribution not 55 Specific changes in any of these residues can produce a normally found with the native enzyme; the engineered size modified hyaluronan or chondroitin that produces a hyaluro could be much smaller or larger than normal. nan or chondroitin product having a modified size distribu Various chondroitin products of differing size have appli tion. Engineered changes to seHAS, spHAS. pmHAS, cation in the areas of drug delivery and the generation of an cvHAS, pmCS that decrease the intrinsic size of the hyaluro enzyme of altered structure can be combined with a chon 60 nanor chondroitin polymer that the enzyme can make before droitin of differing size. Applications in angiogenesis and the hyaluronan or chondroitin is released, will provide pow wound healing are potentially large if chondroitin polymers erful means to produce either a hyaluronan or chondroitin of about 10-20 monosaccharides can be made in good quan polymer product of smaller or potentially larger size than the tities. Another particular application for Small chondroitin native enzyme. oligosaccharides is in the stabilization of recombinant human 65 Finally, larger molecular weight chondroitin made be proteins used for medical purposes. A major problem with degraded with specific chondroitinidases to make lower such proteins is their clearance from the blood and a short molecular weight chondroitin. This practice, however, is very US 7,569,386 B2 15 16 difficult to achieve reproducibility and one must meticulously final GAG pellet was dissolved in water. The yield (0.6 mg repurify the chondroitin to remove the chondroitinidases and uronic acid from all extract) was determined with the carba unwanted digestion products. Zole assay for uronic acid using a glucuronolactone standard. Structurally modified chondroitin is no different concep The monosaccharide composition of the GAG extract was tually than altering the size distribution of the chondroitin 5 determined by acid hydrolysis (2 M HCl, 4 hrs, 100°C.) and product by changing particular amino acids in the desired high pH anion exchange chromatography. The hydrolyzate Chondroitin Synthase and/or more particularly, but not lim was repeatedly diluted in water and dried under vacuum to iting thereto pmCS. Derivatives of UDP-GalNAc, in which remove HCl, then mixed with a rhamnose standard, and clari the acetyl group is missing from the amide (UDP-GalN) or fied using a 0.2 um spin filter. Portions of the hydrolyzate replaced with another chemically useful group (for example, 10 (about 5 nmoles of uronic acid) were injected onto a PA-I phenyl to produce UDP-GalNPhe), are expected to be par column (Dionex) equilibrated with 12 mM NaOH. After iso ticularly useful. The free amino group would be available for cratic elution (25 min) to separate the neutral Sugars, a gra chemical reactions to derivatize chondroitin in the former dient of sodium acetate (0 to 0.18 M in 30 min) was utilized case with GalN incorporation. In the latter case, GalNPhe, to separate the acidic Sugars. Eluted compounds were would make the polymer more hydrophobic or prone to mak 15 detected by pulsed amperometric detection. In parallel runs, ing emulsions. The strong Substrate specificity may rely on a the Type F sample was spiked with known monosaccharide particular subset of amino acids among the 10-20% that are standards of authentic chondroitin sulfate C (derived from conserved. Specific changes to one or more of these residues shark cartilage) hydrolyzate. HA and heparin hydrolyzate creates a functional chondroitin synthase that interacts less standards were also run. Retention times relative to the rham specifically with one or more of the substrates than the native nose internal standard were calculated. enzyme. This altered enzyme could then utilize alternate PCRAnalysis of Type F Genomic DNA Preliminary data natural or special Sugar nucleotides to incorporate Sugar from Southern blot analysis using pmHAS hybridization derivatives designed to allow different chemistries to be probes suggested that the Type A and the Type F microbes employed for the following purposes: (i) covalently coupling were very homologous at the capsule locus. PCR was utilized specific drugs, proteins, or toxins to the structurally modified 25 to verify these findings. Type F chromosomal DNA (0.1 ug) chondroitin for general or targeted drug delivery, radiological served as a template in PCR reactions (20 ul) utilizing oligo procedures, etc. (ii) covalently cross linking the hyaluronic nucleotide primers corresponding to various regions of the acid itself or to other supports to achieve a gel, or other three Type A capsule locus genes. After 40 cycles of PCR (94°C. 30 dimensional biomaterial with stronger physical properties, 5:42°C. 305: 72° C.4 min) with Taq DNA polymerase in the and (iii) covalently linking hyaluronic acid to a Surface to 30 Supplied buffer (Fisher), the samples were separated by aga create a biocompatible film or monolayer. rose gel electrophoresis. Many primer pairs, but not all, amplified Type F DNA to yield products of the predicted size EXPERIMENTAL PROCEDURES assuming that Type A and Type Floci were homologous. Two primers (Pm10, 5'-CACTGTCTAACTTTATTGTTAGCC-3' Materials and Pasteurella Strains—Unless otherwise 35 SEQID NO:5; Pn21,5'-TTTTTAACGAATAGGCTGTC-3' noted, all chemicals were from Sigma or Fisher, and all SEQID NO: 6) were chosen to amplify a 3.6 kb portion of the molecular biology reagents were from Promega. The wild Type F locus predicted to contain the DNA encoding car type encapsulated Type F P multocida strains, P-4679 and boxyl-terminal half of the KfaA homolog and the amino P-3695, were obtained from Dr. Richard Rimler (USDA, terminal portion of the putative polysaccharide synthase. The Ames, Iowa). These strains were isolated from turkeys with 40 product from a PCR reaction (26 cycles) was cloned into a TA fowl cholera. P-4679 had a slightly larger capsule than vector (Invitrogen) according to the manufacturer guidelines. P-3695 as judged by light microscopy and India Ink staining. The plasmid was analyzed by cycle sequencing (ThermoSe The latter Strain also possessed an endogenous uncharacter quenase R system with P-terminators, Amersham) with the ized plasmid. Pm.10 or the Pm21 primer. The preliminary sequence data Carbohydrate Analysis of Type F Capsular Material The 45 from the PCR product derived from Type F DNA was highly anionic polymer in the capsule of Type F bacteria was purified (about 80%) homologous to the sequence of the Type A locus. by urea extraction and cetylpyridinium chloride precipita Therefore, the 3.6-kb insert was excised from the plasmid, tion. P-4679 was grown in complete defined media (150 ml) gel-purified, and labeled with digoxigenin (High Prime sys with mild shaking overnight at 37°C. Cells were harvested by tem, Boehringer Mannheim) to serve as a hybridization centrifugation (3,000xg, 10 min) and washed twice with 0.1 50 probe. M NaCl by repeated centrifugation and resuspension. The Isolation of Capsule Biosynthesis Locus DNA A lambda capsule was removed by extraction with 3 ml of 8 Murea for library of Sau3A partially digested P-4679 DNA (4-9 kb 8 min at 98°C. The cells were removed by high-speed cen average length insert) was made using the BamHI-cleaved) trifugation (15,000xg, 10 min) and the urea solution was Zap ExpressTM vector system (Stratagene). The plaque lifts extracted with one volume of chloroform thrice at 22° C. 55 were screened by hybridization (5xSSC, 50° C.; 16 hrs) with GAGs in the aqueous extract were precipitated by the addi the digoxigenin-labeled probe using the manufacturer guide tion of cetylpyridinium chloride (1% w/v final concentra lines for colorimetric development. E. coli XLI-Blue MRF tion). Substantial polysaccharide may also be precipitated was co-infected with the purified, individual positive lambda from the spent culture media in a similar fashion. After stand clones and EXAssist helper phage to yield phagemids. The ing for 10 min, the precipitate was collected by high-speed 60 resulting phagemids were transfected into E. coli XLOLR centrifugation and redissolved in 2.5 M NaCl. The mixture cells to recover the plasmids. Sequence analysis of the plas was clarified by high-speed centrifugation and the Superna mids revealed a novel open reading frame, i.e. pmCS, with tant was precipitated with 3 vol of ethanol. The precipitate high homology to pmHAS (87%). was washed with 70% ethanol, dried slightly, and resus Expression of Recombinant P. multocida Chondroitin Syn pended in 2.5 M NaCl. The ethanol precipitation procedure 65 thase-In previous studies with pmHAS, a functional, was repeated and the pellet was redissolved in water. Another soluble enzyme was created if a portion of the carboxyl ter round of ethanol precipitation (2 vol) was performed. The minus was truncated by molecular genetic means. Therefore, US 7,569,386 B2 17 18 a portion of the pmCS ORF (residues 1-704) in the insert of flow LB508 detector (EG & G Berthold) using Unisafe I one of the excised lambda clones, pPmF4A, was amplified by cocktail (1.8 ml/min: Zinsser). The column was standardized 20 cycles of PCR with Taq polymerase. The sense primer with fluorescein-labeled dextrans of various sizes. To identify corresponded to the sequence at the deduced amino terminus the radiolabeled polymers, portions of some reactions were of the ORF and the antisense primer encoded the new car dialyzed into water (3 kDa cutoff) and the high molecular boxyl terminus followed by an artificial stop codon. The weight product was digested with various glycolytic enzymes resulting PCR product was purified and concentrated using for 7 hours at 37°C. The enzyme concentrations and diges GeneClean. This insert was cloned using the pETBlue-1 tion buffers were: Flavobacterium chondroitin AC lyase, 1 Acceptor system (Novagen) according to the manufacturers milliunit/ul, 50 mM Tris-acetate, pH 7.5: Proteus chondroitin instructions. The Taq-generated single A overhang is used to 10 AC lyase, 1 milliunit/ul, 50 mM Tris-acetate, pH 8: Strepto facilitate the cloning of the open reading frame downstream myces HA lyase, 266 milliunits/ul, 50 mM sodium acetate, of the T7 promoter and the ribosome binding site of the pH 5.4. vector. The ligated products were transformed into E. coli If cells without formidable cell membrane barriers are used NovaBlue and plated on LB carbenicillin (50 g/ml) and as host cells, transfection is carried out by the calcium phos tetracycline (15 ug/ml) under conditions for blue/white 15 phate precipitation method, well known to those of skill in the Screening. art. However, other methods may also be used for introducing White or light blue colonies were analyzed by restriction DNA into cells Such as by nuclear injection, cationic lipids, digestion. A clone containing a plasmid with the desired electroporation, protoplast fusion or by the Biolistic(tm) Bio truncated ORF, pPm-CS'', was transformed into E. coli particle delivery system developed by DuPont (1989). The Tuner, the T7 RNA polymerase-containing expression host, advantage of using the DuPont system is a high transforma and maintained on LB media with carbenicillin and chloram tion efficiency. If prokaryotic cells or cells which contain phenicol (34 ug/ml) at 30° C. Log phase cultures were substantial cell wall constructions are used, the preferred induced with 13-isopropylthiogalactoside (0.2 mM final) for method of transfection is calcium treatment using calcium 5hrs. The cells were harvested by centrifugation, frozen, and chloride to induce competence or electroporation. extracted for 20 mm with a mild detergent (bPer II reagent, 25 Construction of Suitable vectors containing the desired Pierce) at 7° C. in the presence of a broad-range protease coding and control sequences employ standard ligation tech inhibitor cocktail. The cells were removed by centrifugation niques. Isolated plasmids or DNA fragments are cleaved, and the soluble extract was used as the source of Chondroitin tailored, and religated in the form desired to construct the Synthase enzyme for in vitro assays. plasmids required. Cleavage is performed by treating with Western Blot Analysis of Recombinant P. multocida Chon 30 restriction enzyme (orenzymes) in Suitable buffer. In general, droitin Synthase—A monospecific polyclonal antibody was about 1 lug plasmid or DNA fragments are used with about 1 generated against a synthetic peptide (acetyl-LDSDDYLEP unit of enzyme in about 20 Jul of buffer solution. Appropriate DAVELCLKEF-amide SEQIDNO: 7) corresponding to resi buffers and substrate amounts for particular restriction dues 526 to 544 of the pmHAS protein. The bPer extracts of enzymes are specified by the manufacturer. Incubation times various recombinant E. coli strains were heated at 42°C. for 35 of about 1 hour at 37° C. are workable. 10 mm in sample buffer before loading. After electrophoresis, After incubations, protein is removed by extraction with semi-dry transfer to a nitrocellulose membrane was per phenol and chloroform, and the nucleic acid is recovered formed. The Western blots were blocked with bovine serum from the aqueous fraction by precipitation with ethanol. If albumin and incubated with the affinity-purified antibody blunt ends are required, the preparation is treated for 15 before detection with a Protein A-alkaline phosphatase con 40 minutes at 15° C. with 10 units of Polymerase I (Klenow), jugate and calorimetric development with bromochloroin phenol-chloroform extracted, and ethanol precipitated. For dolyl phosphate and nitro blue tetrazolium. ligation approximately equimolar amounts of the desired Assays for Chondroitin Synthase Activity—Incorporation components, Suitably end tailored to provide correct match of radiolabeled monosaccharides from UDP-ICGlcUA ing are treated with about 10 units T4DNA ligase per 0.5ug and/or UDP-HIGalNAc precursors (NEN) was used to 45 DNA. When cleaved vectors are used as components, it may monitor chondroitin synthase activity. Samples were usually be useful to prevent religation of the cleaved vector by pre assayed in a buffer containing 50 mM Tris, pH 7.2, 20 mM treatment with bacterial alkaline phosphatase. MnCl, 0.1 M (NH4)2SO, 1 M ethylene glycol. 0-0.6 mM For analysis to confirm functional sequences in plasmids UDP-GlcUA, and 0-0.6 mMUDP-GalNAc in the presence of constructed, the first step was to amplify the plasmid DNA by a chondroitin-6-sulfate acceptor oligosaccharide, GalNAc 50 cloning into specifically competent E. coli SURE cells (Strat 6-SO-GlcUA-GalNAc-6-SOan (n=1 or 2: gift of Dr. Geetha agene) by doing transformation at 30-32° C. Second, the Sugumaran), at 30°C. The reaction products were separated recombinant plasmid is used to transform E. coli K5 strain from substrates by descending paper (Whatman 3M) chro Bi8337-41, which can produce the UDP-GlcA precursor, and matography with ethanol/1M ammonium acetate, pH 5.5, Successful transformants selected by antibiotic resistance as development solvent (65:35). The origin of the paper strip 55 appropriate. Plasmids from the library of transformants are was cut out, eluted with water, and the incorporation of radio then screened for bacterial colonies that exhibit HA produc active Sugars into HA polymer was detected by liquid Scin tion. These colonies are picked, amplified and the plasmids tillation counting with BioSafe II cocktail (RPI). To test the purified and analyzed by restriction mapping. The plasmids transfer specificity of pmCS''' various UDP-sugars (UDP showing indications of a functional Chondroitin Synthase GlcNAc, UDP-GalUA, UDP-Glc) were substituted for the 60 gene are then further characterized by any number of authentic chondroitin precursors. sequence analysis techniques which are known by those of Size Analysis and Enzymatic Degradation of Labeled ordinary skill in the art. Polymers—Gel filtration chromatography was used to ana In general, prokaryotes are used for the initial cloning of lyze the size distribution of the labeled polymers. Separations DNA sequences and construction of the vectors useful in the were performed with a Polysep-GFC-P 5000 column (300x 65 invention. It is believed that a suitable source may be bacterial 7.8 mm; Phenomenex) eluted with 0.2M sodium nitrate at 0.6 cells, particularly those derived from strains that can exist on ml/min. Radioactivity was monitored with an in-line Radio a simple minimal media for ease of purification. Bacteria with US 7,569,386 B2 19 20 a single membrane, butathick cell wall Such as Staphylococci promoter region for alcoholdehydrogenase 2, cytochrome C. and Streptococci are Gram-positive. Gram-negative bacteria acid phosphatase, degradative enzymes associated with nitro Such as E. coli contain two discrete membranes rather than gen metabolism, and the aforementioned glyceraldehyde-3- one surrounding the cell. Gram-negative organisms tend to phosphate dehydrogenase, and enzymes responsible formal have thinner cell walls. The single membrane of the Gram tose and galactose utilization. Any plasmid vector containing positive organisms is analogous to the inner plasma mem a yeast-compatible promoter, origin of replication and termi brane of Gram-negative bacteria. Additionally, many bacteria nation sequences is suitable. possess transport systems that help capsular polymers be In addition to microorganisms, cultures of cells derived secreted from the cell. from multicellular organisms may also be used as hosts. In For the expression of Chondroitin Synthase in a form most 10 principle, any such cell culture is workable, whether from likely to accommodate Chondroitin Synthase synthesis, one vertebrate or invertebrate culture. However, interest has been may desire to employ Streptococcus species such as S. equi greatest in vertebrate cells, and propagation of Vertebrate similis or S. Zooepidemicus and/or P. multocida and/or Bacil cells in culture has become a routine procedure in recent lus Strains. The aforementioned strains, as well as E. coli years. Examples of such useful host cell lines are VERO and W3110 (F-, lambda-, prototrophic, ATCC No. 273325), 15 HeLa cells, Chinese hamster ovary (CHO) cell lines, and bacilli such as Bacillus subtilis, or other enterobacteriaceae WI38, BHK, COS, and MDCK cell lines. Such as Serratia marcescens, could be utilized to generate a For use in mammalian cells, the control functions on the “super Chondroitin Synthase containing host. expression vectors are often provided by viral material. For In general, plasmid vectors containing origins of replica example, commonly used promoters are derived from tion and control sequences which are derived from species polyoma, Adenovirus 2, bovine papilloma virus and most compatible with the host cell are used in connection with frequently Simian Virus 40 (SV40). The early and late pro these hosts. The vector ordinarily carries an origin of repli moters of SV40 virus are particularly useful because both are cation, as well as marking sequences which are capable of obtained easily from the virus as a fragment which also con providing phenotypic selection in transformed cells. For tains the SV40 viral origin of replication. Smaller or larger example, E. coli is typically transformed using pBR322, a 25 SV40 fragments may also be used, provided there is included plasmid derived from an E. coli species. pl3R322 contains the approximately 250 bp sequence extending from the Hind genes for ampicillin and tetracycline resistance and thus pro III site toward the Bg 1 I site located in the viral origin of vides easy means for identifying transformed cells. A pBR replication. plasmid or a pUC plasmid, or other microbial plasmid or Further, it is also possible, and often desirable, to utilize phage must also contain, or be modified to contain, promoters 30 promoter or control sequences normally associated with the which can be used by the microbial organism for expression desired gene sequence, provided Such control sequences are of its own proteins. compatible with the host cell systems. An origin of replication Those promoters most commonly used in recombinant may be provided either by construction of the vector to DNA construction include the lacZ promoter, tac promoter, include an exogenous origin, such as may be derived from the T7 bacteriophage promoter, and tryptophan (trp) pro 35 SV40 or other viral (e.g., Polyoma, Adeno, BPV) source, or moter system. While these are the most commonly used, other may be provided by the host cell chromosomal replication microbial promoters have been discovered and utilized, and mechanism. If the vector is integrated into the host cell chro details concerning their nucleotide sequences have been pub mosome, the latter mechanism is often sufficient. lished, enabling a skilled worker to ligate them functionally Chondroitin sulfate and dermatan sulfate are both derived with plasmid vectors. Also for use with the present invention 40 from the same polymer, i.e. D-glucuronic acid beta (1-3)D- one may utilize integration vectors. N-acetylgalactosamine beta (1-4). Both chondroitin sulfate In addition to prokaryotes, eukaryotic microbes, such as and dermatan Sulfate can be sulfated at positions 4 or 6 of yeast cultures may also be used. Saccharomyces cerevisiae, N-acetyl galactosamine and position 2 of the uronic acid. or common baker's yeast is the most commonly used among Neither has been observed to be N-sulfated in nature. The eukaryotic microorganisms, although a number of other 45 difference between chondroitin sulfate and dermatan sulfate strains are commonly available. For expression in Saccharo is the epimerisation of glucuronic acid to iduronic acid. There myces, the plasmid YRp7, for example, is commonly used. are problems however with the nomenclature and designation This plasmid already contains the trp1 gene which provides a of a polysaccharide as either chondroitin Sulfate or dermatan selection marker for a mutant strain of yeast lacking the Sulfate. In particular, the frequency with which iduronic acid ability to grow without tryptophan, for example, ATCC No. 50 must occur rather than glucuronic acid, for the chain to be 44076 or PEP4-1. The presence of the trp 1 lesion as a char called a dermatan Sulfate chain, is open to interpretation. Thus acteristic of the yeast host cell genome then provides an a chondroitin Sulfate chain may have sequences of dermatan effective environment for detecting transformation by growth sulfate interspersed therein and visa versa. One of ordinary in the absence of tryptophan. Suitable promoting sequences skill in the art would appreciate, however, that a polymer in yeast vectors include the promoters for the galactose utili 55 having between 10% and 50% epimerisation of glucuronic Zation genes, the 3-phosphoglycerate kinase or other glyco acid to iduronic acid would be suitably designated a dermatan lytic enzymes, such as enolase, glyceraldehyde-3-phosphate Sulfate polysaccharide. dehydrogenase, hexokinase, pyruvate decarboxylase, phos A chondroitin polymer is produced by a chondroitin Syn phofructokinase, glucose-6-phosphate isomerase, 3-phos thase and in particular, but not limited thereto, the pmCS of phoglycerate mutase, pyruvate kinase, triosephosphate 60 the present invention. For example, the chondroitin polymer isomerase, phosphoglucose isomerase, and glucokinase. can be converted into a dermatan molecule that may be an In constructing Suitable expression plasmids, the termina even more valuable product than chondroitin itself. The chon tion sequences associated with these genes are also ligated droitin polymer can be converted into dermatan either in the into the expression vector 3' of the sequence desired to be purified form or in vivo (i.e. in the host itself). For example, expressed to provide polyadenylation of the mRNA and ter 65 Chang et al. have identified and detailed a reaction of Azoto mination. Other promoters, which have the additional advan bacter vinelandii poly-beta-D-mannuronic acid C-5-epime tage of transcription controlled by growth conditions are the rase on synthetic D-glucuronans. A dermatan molecule can be US 7,569,386 B2 21 22 made using the Azotobacter vinelandii poly-beta-(1->4)-D- merase and methods of using same, see e.g. Malmstrom A., mannuronic acid C-5-epimerase to react with a chondroitin Biosynthesis of Dermatan Sulfate Substrate Specificity of polymer made via a chondroitin Synthase such as pmCS. the C-5 Uronosyl Epimerase, J. Biol. Chem. Jan. 10, 1984; (Chang et al. Action of Azotobacter vinelandii poly-beta-D- 259(1): 161-5, which is expressly incorporated herein by mannuronic Acid C-5-epimerase on Synthetic D-Glucuro reference in its entirety. mans, Carbohydrate Research, Dec. 1, 2000; 329(4):913-22, which is expressly incorporated herein in its entirety by ref Utilizing enzymatic Sulfation, the chondroitin polymer— erence). U.S. Pat. No. 5,939,289 issued to Ertesvaget al., turned—dermatan molecule can be sulfated, thereby creating which is expressly incorporated herein by reference, also an even more valuable and flexible polymer for anticoagula discloses a C-5 epimerase which may be used to convert the 10 tion, device coatings, and/or other biomaterial. As pointed out chondroitin molecule produced by the P. multocida chon in the Eklund et al. article entitled Dermatan is a Better droitin synthase into a unsulfated dermatan molecule. The c-5 Substrate for 4-O-sulfation than Chondroitin: Implications in epimerase is expected to work on the chondroitin polymeras the Generation of 4-O-sulfated. L-iduronic-rich Galac the Chang et al. paper describes epimerization of a variety of tosaminoglycans, Arch. Biochem. Biophys. Nov. 15, 2000; polysaccharides containing uronic acids including oxidized 15 383 (2):171-7, which is expressly incorporated in its entirety starch and chitin. herein by reference, dermatan is not only more easily enzy Alternatively, instead of step-wise chondroitin synthesis matically sulfated than chondroitin, but sulfated dermatan is followed by epimerization reaction, an in vivo combined a more valuable, flexible and useful product than chondroitin. method should be possible. This is very suitable in pnCS/ Thus, utilizing a chondroitin synthase such as pmCS, one or Azotobacter epimerase case as the reactions are compatible ordinary skill in the art, given the present disclosure, would be and both genes are from Gram-negative bacteria. Both able to produce natural and non-natural chondroitinas well as enzymes have been shown to function in E. coli. Placing both dermatan and dermatan sulfate. Other articles, which are genes in one cell and allowing contact of chondroitin and the expressly incorporated herein in their entirety by reference, epimerase results in the desired product. outline other methodologies for enzymatically sulfating der Further, an assay procedure for measuring the reactions 25 catalyzed by polyuronic acid C-5 epimerases can be used. matan. Bhakta et al. Sulfation of N-acetylglucosamine by (See e.g., Chang et al. Measurement of the Activity of Polyu Chondroitin 6-Sulfotransferase 2 (GST-5), J. Biol. Chem. ronic Acid C-5 Epimerases, Anal. Biochem. Apr. 10, 1998: Dec. 22, 2000: 275(51):40226-34; Ito et al. Purification and 258(1):59-62, which is expressly incorporated herein in its Characterization of N-acetylgalactosamine 4-sulfate 6-O- entirety by reference) Action of C-5 epimerases inverts the 30 Sulfotransferase from the Squid Cartilage, J. Biol. Chem. C-6 carboxyl group of polyuronic acids thus converting beta Nov. 3, 2000: 275(44):34728-36. linked residues into alpha-linked residues or vice versa. The In addition to enzymatic sulfation, the dermatan polymer above-identified assay takes advantage of the greater Suscep can be chemically sulfated. One method for chemical sulfa tibility of the acid hydrolysis of alpha-glycosidic linkages tion is outlined in the article by Garg et al. entitled Effect of than beta-glycosidic linkages. Thus, acid treatment of experi 35 Fully Sulfated Glycosaminoglycans on Pulmonary Artery mental polymers (the product) results in a color yield but the Smooth Muscle Cell Proliferation, Arch. Biochem. Biophys. parent starting material does not result in a Substantial color Nov. 15, 1999; 371(2): 228-33, which is expressly incorpo yield. The method of this particular assay involves the partial rated herein in its entirety by reference. Typically, the acid hydrolysis of the polyuronic acid before and after reac polysaccharide in an anhydrous solvent is treated with Sulfur tion with the C-5 epimerase. The greater or lesser amounts of 40 trioxide or chlorosulfonic acid. In any event, one of ordinary uronic acid released (solubilized) before and after reaction of skill in the art given the chondroitin synthase (pmCS) of the the C-5 epimerase are a measure of the amount of alpha- or present invention and the methodology for producing a chon beta-glycosidic linkages that are formed and a measure of the droitin polymer from the pmCS enzyme, would be capable of amount of catalysis by the enzyme. In this manner, the con using the epimerization reaction to form a dermatan molecule version chondroitin polymer to dermatan can be catalyzed 45 and monitored for reaction and efficiency. and then Sulfating this dermatan molecule by known enzy The chondroitin molecule made by the pmCS enzyme is an matic, or chemical Sulfation techniques. Alternatively, ideal polymeric starting material for the creation of a derma unepimerimized chondroitin could be sulfated by any means tan Sulfate molecule. Certain mammalian epimerases only as well. epimerize unsulfated polymer molecules. For example, the 50 Also, U.S. Pat. No. 4,990,601 issued to Skjak-Braek et al., C-5 uronosyl epimerase, which is capable of converting a which is expressly incorporated herein by reference in its chondroitin molecule into a dermatan molecule, will only entirety, discloses a chemical process using Supercritical epimerize an unsulfated chondroitin molecule. Unsulfated CO which epimerizes uronic acid in a compound. Utilizing chondroitin molecules are not found in nature, and chon a chondroitin polypeptide using the pmCS of the present droitin sulfate must be either desulfated or an unsulfated 55 invention and the CO epimerization method of Skjak-Braek chondroitin molecule must be recombinantly produced. et al., one of ordinary skill in the art can easily make unsul Since no chondroitin synthase has been known prior to or fated dermatan molecules. since the discovery of the pmCS enzyme, one of ordinary skill Compositional Analysis of Type FP multocida Polymer— in the art would have to expend additional time, money, and Previous work by others had shown that the Type F capsule is capital in order to convert sulfated chondroitin into unsulfated 60 removed from bacterial cells by treatment with chondroitin or desulfated chondroitin. Once the chondroitin is unsulfated, AC lyase. We found that a fragment of the specific HA the mammalian epimerases can be used to convert the chon binding protein, aggrecan, in the HA-TEST assay (Pharma droitin molecule into a dermatan molecule. By utilizing a cia) did not cross-react with extracts of the Type F polymer, chondroitin synthase, such as pmCS, one of ordinary skill in but readily detected the HA in parallel extracts from Type A the art is capable of producing an unsulfated chondroitin 65 bacteria. Acid hydrolysis and monosaccharide analysis of the molecule which is an ideal starting material for epimerization Type F polymer showed that it contained the Sugars galac by a mammalian epimerase. For one Such mammalian epi tosamine and GlcUA (Table 2 and FIG. 5). US 7,569,386 B2 23 24 The central portion of both the pmCS and the pmHAS TABLE 2 polypeptides (residues 430-530) is most homologous to bac terial glycosyltransferases from a wide variety of genera, Monosaccharide Composition of Type F Polymer and Various GAGs. Acid hydrolysis and high pH ion exchange chromatography were including Streptococcus, Vibric, Neisseria and Staphylococ utilized to determine the Sugar components of the Type F polymer (F). cus, that form exopolysaccharides or the carbohydrate por The polysaccharides chondroitin Sulfate C (C), hyaluronan (HA), tions of lipopolysaccharides. The some of the most notable and heparin (HEP), and pure monosaccharides were used as sequence similarities are the DGSTD and the DxDD motifs. standards. Under these hydrolysis conditions, deacetylation and desulfation as well as the desired fragmentation of glycosidic Directly downstream of the pmCS gene a putative UDP bonds occur. Retention times relative to the internal standard rhamnose glucose dehydrogenase gene was identified. Therefore, the elution time (10.7 min; set to 1) are presented for the relevant 10 relative gene order KfaA homolog polysaccharide Syn hexosamines. Acidic Sugars were eluted with a sodium acetate gradient; thase gene UDP-glucose dehydrogenase gene in this por the retention time of the major uronic acid peak from the start of the gradiant is presented. Type F polysaccharide and chondroitin Sulfate tion of the Pasteurella Type F capsule operon is the same as possess the identical monsaccharide composition, galactosamine that found in Type A. and glucuronic acid. Heterologous Expression of a Functional P. multocida 15 Chondroitin Synthase—Western blot analysis using a mono Polysaccharides specific antipeptide antibody was used to detect the produc Sugar C CFMIX F HA HEP tion of pmCS''' orpmHAS' polypeptide(FIG.2). Both enzymes contain a sequence that corresponds exactly to the Retention Time Relative to Rhamnose synthetic peptide used to generate the antibody. Extracts glucosamine ND: ND ND 1.38 1.38 derived from E. coli Tuner cells containing the pmCS' galactosamine 1.14 1.12 1.12 ND ND 704plasmid contained an immunoreactive band of the appro Retention time (min) priate size (i.e. predicted to be 80 kDa), but this band was not present in Samples from cells with the vector alone control. uronic acid 14.87 14.87 14.87 1485 14.58 The use of soluble pmCS''' protein provided increased *ND, not detected 25 expression levels and facilitated preparation of enzyme in comparison to use of the native-length membrane protein. The ion exchange profile of the chondroitin sulfate hydro Extracts derived from E. coli Tuner cells containing the lyzate was indistinguishable from the Type F hydrolyzate: pmCS''' plasmid, but not samples from cells with the vec mixing experiments demonstrated that the component peaks tor alone, synthesized polymer in vitro when supplied with migrated identically. No other sugars were detected in the 30 both UDP-GlcUA and UDP-GalNAc simultaneously (Table Type F polymer including glucosamine, mannose, galactose, 3). glucose, and fucose. HydrolyZates of the HA and heparin standards clearly contained glucosamine but not galac TABLE 3 tosamine. Preliminary NMR studies are consistent with the 35 Transferase Specificity of Recombinant pmCS''' for Sugar hypothesis that the amino Sugar of the Type F polymer is Nucleotides. Crude bPer extract (150 g of total protein) was incubated in present in an acetylated form (NAc CH chemical shift at 2.02 50 ul of assay buffer containing 0.5g of chondroitin oligosaccharide ppm in D.O; University of Georgia Complex Carbohydrate acceptor for 20 min either with UDP-'CGlcUA or UDP-HGalNAc. The radiolabeled Sugar (300 IM, 0.04 ICi) was used in the presence of Research Center) (FIG. 8). Disaccharide analysis of the chon the indicated second unlabeled sugar nucleotide (600 IM). The droitin from Type F is of the correct mass and charge expected 40 incorporation into polymer was assessed by paper chromatography. The to be derived from unsulfated chondroitin (FIGS. 9 and 10). relative percentage of incorporation in comparison to the assay containing the authentic precursor (set to 100%) is shown in parentheses. This process involves cleaving the polymer with chondroiti A representative experiment is shown. The recombinant pmCS''' nase, separating products by capillary electrophoresis. The incorporated only the authentic chondroitin precursors into polysaccharide. retention time is compared to authentic standards. Mass was measured by mass spectrometry; in this size range, exact 45 Incorporation of first Sugar masses to within 1 Da are measured. Second Sugar 'CGlcUA HGalNAc Molecular Cloning of the Type F P. multocida Capsular nucleotide Present dpm (%) Locus—PCR products were obtained utilizing Type F chro None 60 (0.9) 250 (7.5) mosomal DNA as a template and various oligonucleotide UDP-GlcA ND: 3,310 (100) primers corresponding to the Type A capsule locus. A 3.6 kb 50 UDP-GalUA ND 315 (9.5) PCR product, which contained large portions of the Type F UDP-GlcNAc 6,590 (100) ND KfaA homolog (a putative polysaccharide transporter of E. UDP-GlcNAc 85 (1.5) ND coli) and the putative pmCS gene, was used as a hybridization UDP-Glc 60 (0.9) 370 (11) probe to obtain an intact P. multocida capsular locus from a *ND, not determined. lambda library. Two positively hybridizing plaques were 55 found after screening about 10 plaques, and these phage No incorporation of radiolabeled 'CGlcuA into poly were converted into plasmids. We found that both plasmids mer was observed if UDP-GalNAc was omitted, or if UDP contained a novel open reading frame of 965 residues, which GlcNAc was substituted for UDP-GalNAc. Conversely, in we named pmCS, that was highly homologous to the Type A experiments using UDP-HIGalNAc, substantial incorpora HA synthase, pmHAS (FIG. 1). The level of identity was 60 tion of radiolabel into polymer was only noted when UDP about 87% at both the DNA and protein levels. The differ GlcUA was also present. UDP-GalUA or UDP-Glc did not ences in amino acid sequence were mainly localized to sev substitute for UDP-GlcUA. No polymerization or transferase eral regions of the polypeptide in the amino terminal half of activity was detected if the divalent metal ions were chelated the molecules. There is an excellent overall alignment of the with EDTA. The addition of the chondroitin oligosaccharide enzymes except for a 7-residue insertion in the pmHAS 65 acceptor increased sugar incorporation catalyzed by pmCS' sequence in the position corresponding to residue 53 of the 704 at least 50- to 100-fold in comparison to parallel reactions pmCS sequence. without acceptor in analogy to observations of pmHAS. US 7,569,386 B2 25 26 Analysis by gel filtration chromatography indicated that ative agents of fowl cholera, but many more isolates from recombinant pmCS produced polymer chains of 10=(1,000) diseased birds in North America are Type A microbes with monosaccharides long (100 to 400 kDa) in vitro. Radioactiv HA capsules. It is likely that the progenitor of the two distinct ity from both labeled GlcUA and GalNAc sugars co-migrated capsular types had either a chondroitin synthase like or a as a single peak (FIG. 3A). No radiolabel was incorporated 5 HAS-like gene. The specificity of this ancestral enzyme may into high molecular weight polymer if both UDP-sugars were have changed after a few mutations resulting in the appear not present during the assay. The identity of the polymer as ance of another capsular type. Apparently, the Sugar transfer chondroitin was verified by its sensitivity to Flavobacterium specificity is rather selective since neither recombinant pm CS or Proteus chondroitin AC lyase (FIG. 3B) and its resistance nor pmHAS misincorporate the inappropriate hexosamine to the action of Streptomyces HA lyase (FIG. 3C). 10 into polymer in vitro. Some Gram-negative bacteria (e.g. E. Analysis of the native Type F polymer by agarose gel coli) possess an UDP-GlcNAc/UDP-GalNAc epimerase, electrophoresis also shows that high molecular weight poly therefore the hexosamine precursor either for HA or for chon meris made by bacteria in vivo (FIG. 4). The Type F polymer droitin could have been available for polysaccharide biosyn was visualized by stains. All staining an 0.8% agarose gel run thesis without the need to gain an auxiliary metabolic enzyme in 1xTAE system. HA and Type F both stained blue while 15 simultaneously. Typically the UDP-glucose dehydrogenase, DNA and chondroitin sulfate stained purple and Heparin the enzyme that forms the UDP-GlcUA precursor, is found in stained yellow. The Type F polymer is smaller than HA, but Gram-negative bacteria only if the microbe possesses a still forms very large chains of about 50 to about 150 KDa. GlcUA-containing polymer or glycoconjugate. In both Type P multocida Type F produces a chondroitin capsule. The A and Type FP multocida, the UDP-glucose dehydrogenase glycosyltransferase responsible for polymerizing the chon gene is directly downstream of the GAG synthase. droitin backbone component of the capsular polysaccharide The relationship between the bacterial chondroitin syn has also been cloned. The pm CS enzyme appears to be a close thase and the putative mammalian counterpart is unclear. No homolog of the pmHAS enzyme. Recently, it was determined similar vertebrate proteins are deposited in the database as that the pmHAS enzyme contains two active sites in a single yet. Both bacterial pmCS and the vertebrate chondroitin syn polypeptide by generating mutants that transfer only GlcUA 25 thase utilize UDP-sugars to extend acceptor carbohydrates in or only GlcNAc. Mixing the two different mutant proteins vitro. In most cases, the mammalian enzyme in cell-free reconstituted the HA synthase activity. It is likely that one extracts, however, does not produce long chondroitin chains domain, called A1, is responsible for GlcNAc transfer and the and only the half-reaction (e.g. adding a single GlcUA to a other domain, called A2, is responsible for GlcUA transfer. GalNAc-terminated oligosaccharide or vice versa) is readily Comparison of the pmHAS and the pmCS sequences reveals 30 observed in vitro. Invertebrate tissues, other enzymes modify that the majority of the sequence differences exist in the A1 chondroitin extensively by Sulfation and/or epimerization. domain. The pmCS enzyme transfers a different hexosamine, The discovery and the characterization of pmCS will assist GalNAc, thus being consistent with the proposed two-domain the further study of the rather recalcitrant mammalian chon structure for pmHAS. droitin synthase enzymes. The pmHAS protein was also hypothesized to interact with 35 Thus, it should be apparent that there has been provided in a putative polysaccharide transporter system or a membrane accordance with the present invention a purified nucleic acid bound partner via its carboxyl terminus because deletion of segment having a coding region encoding enzymatically residues 704 to 972 from the native-length enzyme resulted in active chondroitin synthase, methods of producing chon the formation of a soluble enzyme. However, no substantial droitin from the pmCS gene, and the use of chondroitin pro membrane-associated or hydrophobic regions are predicted 40 duced from a chondroitin synthase encoded by the pmCS to reside in this sequence. As pmHAS and pmCS are highly gene, that fully satisfies the objectives and advantages set homologous in this region, which is not essential for their forth above. Although the invention has been described in glycosyltransferase activities, it is quite likely that the car conjunction with specific embodiments thereof, it is evident boxyl terminus contains domains or motifs required for inter that many alternatives, modifications, and variations will be acting with the polysaccharide transport machinery or a 45 apparent to those skilled in the art. membrane-bound partner in vivo. The evolutionary relation Accordingly, it is intended to embrace all such alternatives, ship between Type A and Type FP multocida strains has not modifications, and variations that fall within the spirit and yet been delineated. Both organisms are widespread caus broad scope of the appended claims. SEQUENCE LISTING <16 Oc NUMBER OF SEO ID NOS: 7 <21 Oc SEO ID NO 1 <211 LENGTH: 2979 <212 TYPE: DNA <213> ORGANISM: Pasteurella multocida <4 OO SEQUENCE: 1 ttataaact g attaaagaag gtaaacgatt caa.gcaaggit taatttittaa aggaaagaaa 60 atgaatacat tat cacaagc aataaaag.ca tata acagoa atgactatoga attagc actic 12O aaattatttg agaagtctgc tigaaacctac ggg.cgaaaaa togttgaatt coaaattatc 18O US 7,569,386 B2 29 30 - Continued gcqcatccac catttaaaaa. gctgattaaa acct attitta atgacaatga cittaagaagt 264 O atgaatgtga aaggggcatc acalagg tatg tittatgaagt atgcgct acc gcatgagctt 27 OO ctgacgatta ttaaagaagt Cat Cacat CC tgc caat caa ttgat agtgt gcc agaatat 276 O alacactgagg at atttggitt c caatttgca ct t t taatct tagaaaagaa alaccggc cat 282O gtatttaata aaa catcgac cctgactitat atgccttggg aacgaaaatt acaatggaca 288O aatgaacaaa ttcaaagtgc aaaaaaaggc gaaaatat co ccgittaacaa gttcattatt 294 O aatagtataa cgctataaaa catttgcatt ttattaaaa. 2979 <210 SEQ ID NO 2 <211 LENGTH: 965 &212> TYPE : PRT <213> ORGANISM: Pasteurella multocida <4 OO SEQUENCE: 2 Met Asn. Thir Lieu. Ser Glin Ala Ile Lys Ala Tyr Asn Ser Asn Asp Tyr 1. 1O 15 Glu Luell Ala Lieu Lys Lieu. Phe Glu Llys Ser Ala Glu Thir Tyr Gly Arg 3O Ile Wall Glu Phe Glin Ile Ile Glu Lys Luell Ser Thr 35 4 O 45 Asn Ser Val Ser Glu Asp Llys Lys Asn. Ser Wall Asp Ser Ser SO 55 6 O Lell Asp Ile Ala Thr Glin Lieu. Lieu. Cell Ser Asn Wall Lieu. Thir 65 70 7s 8O Lell Ser Glu Ser Glu Lys Asn. Ser Lieu Lys Asn Trp Ser Ile 85 90 95 Thir Gly Llys Ser Glu Asn Ala Glu Ile Arg Wall Glu Lieu Wall 105 11 O Pro Asp Phe Pro Lys Asp Lieu Wall Lieu Ala Pro Lell Pro Asp His 115 12 O 125 Wall Asn Asp Phe Thir Trp Tyr Lys Asn Arg Llys Lys Ser Luell Gly Ile 13 O 135 14 O Lys Pro Wall Asn Lys Asn. Ile Gly Lieu. Ser Ile Ile Ile Pro Thir Phe 145 150 155 160 Asn Arg Ser Arg Ile Lieu. Asp Ile Thir Lieu Ala Lell Wall ASn Glin 1.65 17O 17s Thir Asn Tyr Pro Phe Glu Val Wal Wall Ala Asp Asp Gly Ser Lys 18O 185 19 O Glu Asn Luell Lieu. Thir Ile Wall Glin Llys Tyr Glu Glin Lys Luell Asp Ile 195 Tyr Wall Arg Gln Lys Asp Tyr Gly Tyr Glin Lell Ala Val Arg 21 O 215 Asn Luell Gly Lieu. Arg Thr Ala Lys Tyr Asp Phe Wall Ser Ile Lieu. Asp 225 23 O 235 24 O Asp Met Ala Pro Glin Glin Lieu. Trp Val His Ser Luell Thr Glu 245 250 255 Lell Luell Glu Asp Asn Asp Ile Val Lieu. Ile Gly Pro Arg Lys Tyr Val 26 O 265 27 O Asp Thir His ASn Ile Thir Ala Glu Glin Phe Lieu. Asn Asp Pro Tyr Lieu. 27s 28O 285 Ile Glu Ser Lieu Pro Glu. Thir Ala Thir Asn. Asn Asn Pro Ser Ile Thr 29 O 295 3 OO US 7,569,386 B2 31 32 - Continued Ser Gly ASn Ile Ser Lell Asp Trp Arg Luell Glu His Phe Lys Lys 3. OS 310 315 Thir Asp Asn Lieu. Arg Lell Asp Ser Pro Phe Arg Phe Wall Ala 3.25 330 335 Gly Asn Wall Ala Phe Ser Glu Trp Luell ASn Wall Gly Trp Phe 34 O 345 35. O Asp Glu Glu Phe Asn His Trp Gly Gly Glu Asp Wall Glu Phe Gly Tyr 355 360 365 Arg Luell Phe Ala Lys Gly Cys Phe Phe Arg Wall Ile Asp Gly Gly Met 37 O 375 Ala Ile His Glin Glu Pro Pro Gly Glu ASn Glu Thir Glu Arg Glu 385 390 395 4 OO Ala Gly Ser Ile Thir Lell Ile Wall Lys Glu Wall Pro Tyr 4 OS 415 Ile Arg Llys Lieu Lell Pro Ile Glu Asp Ser His Ile His Arg Ile 42O 425 43 O Pro Luell Wall Ser Ile Ile Pro Ala Tyr ASn Ala Asn Ile 435 44 O 445 Glin Arg Val Asp Ser Ala Luell Asn Glin Thir Wall Wall Asp Luell Glu 450 45.5 460 Wall Ile Cys Asn Asp Gly Ser Thir Asp ASn Thir Lell Glu Wall Ile 465 470 Asn Luell Tyr Gly Asn Asn Pro Arg Wall Arg Ile Met Ser Lys Pro 485 490 495 Asn Gly Gly Ile Ala Ser Ala Ser Asn Ala Ala Wall Ser Phe Ala SOO 505 Gly Tyr Tyr Ile Gly Glin Lell Asp Ser Asp Asp Lell Glu Pro Asp 515 525 Ala Wall Glu Lieu. Cys Lell Lys Glu Phe Luell Lys Asp Thir Luell Ala 53 O 535 54 O Cys Wall Th Thir Asn Arg Asn Wall Asn Pro Asp Ser Luell Ile 5.45 550 555 560 Ala Asn Gly Tyr Asn Trp Pro Glu Phe Ser Arg Glu Luell Thir Thir 565 st O sts Ala Met Ile Ala His His Phe Arg Met Phe Thir Ile Arg Ala Trp His 58O 585 59 O Lell Thir Asp Gly Phe Asn Glu Asn Ile Glu ASn Ala Wall Asp Asp 595 605 Met Phe Luell Llys Lieu Ser Glu Wall Gly Phe Lys His Luell Asn 610 615 Ile Asn Arg Wall Lell His Gly Asp ASn Thir Ser Ile Lys 625 630 635 64 O Lell Gly Ile Gln Lys Asn His Phe Wall Wall Wall Asn Glin Ser Luell 645 650 655 Asn Arg Glin Gly Ile Asn Tyr Asn Tyr Asp Phe Asp Asp Luell 660 665 67 O Asp Glu Ser Arg Llys Ile Phe Asn Thir Ala Glu Glin Glu 675 68O 685 Glu Met Asp Met Leu Asp Luell Luell Ile Glin Asn Asp Ala 69 O. 695 7 OO Lys Ile Ala Wall Ser Ile Phe Pro Asn Thir Lell Asn Gly Luell Wall 7 Os 71O 71s 72O US 7,569,386 B2 33 34 - Continued Luell Asn Asn. Ile Ile Glu Tyr Asn Lys Asn. Ile Phe Wall Ile 72 73 O 73 Ile Luell His Val Asp Lys Asn His Lieu. Thir Pro Asp Ile Lys Lys Glu 740 74. 7 O Ile Luell Ala Phe Tyr His Llys His Glin Wall Asn Ile Lell Luell Asn. Asn 760 765 Asp Ile Ser Tyr Tyr Thr Ser Asn Arg Lieu. Ile Lys Thir Glu Ala His 770 775 Lell Ser Asn Ile Asn Llys Lieu. Ser Gln Lieu. Asn Lell Asn Glu Tyr 79 O 79. 8OO Ile Ile Phe Asp Asn His Asp Ser Lieu. Phe Wall Asn Asp Ser Tyr 805 810 815 Ala Met Llys Llys Tyr Asp Wall Gly Met Asn Phe Ser Ala Lieu. Thir 825 83 O His Asp Trp Ile Glu Lys Ile Asn Ala His Pro Pro Phe Llys Lieu. 835 84 O 845 Ile Lys Thir Tyr Phe Asn Asp Asn Asp Lieu. Arg Ser Met Asn Val Lys 850 855 860 Gly Ala Ser Gln Gly Met Phe Met Llys Tyr Ala Lell Pro His Glu Lieu. 865 87O 88O Lell Thir Ile Ile Lys Glu Val Ile Thir Ser Cys Glin Ser Ile Asp Ser 885 890 895 Wall Pro Glu Tyr Asn Thr Glu Asp Ile Trp Phe Glin Phe Ala Lieu. Luell 9 OO 905 91 O Ile Luell Glu Llys Llys Thr Gly His Wall Phe Asn Thir Ser Thir Lieu. 915 92 O 925 Thir Tyr Met Pro Trp Glu Arg Llys Lieu. Glin Trp Thir Asn Glu Glin Ile 93 O 935 94 O Glin Ser Ala Llys Lys Gly Glu Asn Ile Pro Wall Asn Phe Ile Ile 945 950 955 96.O Asn Ser Ile Thir Lieu. 965 <210 SEQ ID NO 3 <211 LENGTH: 2979 &212> TYPE: DNA <213> ORGANISM: Pasteurella multocida <4 OO SEQUENCE: 3 ttataaactg attaaagaag gtaaacgatt caa.gcaaggt taatttittaa. aggaaagaaa 6 O atgaatacat tat cacaa.gc aataaaag.ca tataa.ca.gca atgactatoga attagcactic 12 O aaattatttg agalagt ctgc tgaaacctac gggcgaaaaa tcqttgaatt CCalaattat C 18O aaatgtaaag aaaaactic to gaccalatt ct tatgtaagtg aagataaaaa aaa.ca.gtgtt 24 O tgcgatagct cattagatat cgcaa.cacag citct tact tt c caacgtaaa aaaattalact 3OO citat cogaat cagaaaaaaa cagtttaaaa aataaatgga aat Ct at CaC tgggaaaaaa 360 tcggagaacg Cagaaatcag aaaggtggaa c tagtaccca aagattitt.cc taaagat citt gttcttgctic cattgccaga t catgttaat gattittacat ggtacaaaaa tcqaaaaaaa agct taggta taaag.cctgt aaataagaat atcggtctitt Ctatt attat t cotta cattt 54 O aatcgtagcc gtattittaga tataacgtta gcc titttgg t caat cagaa aacaaactac c catttgaag agatgatggit agtaaggaaa act tact tac cattgtgcaa 660 aaatacgaac aaaaacttga cataaagtat gtaagacaaa aagattatgg atat caattg 72 O US 7,569,386 B2 35 36 - Continued tgtgcagt ca gaaact tagg tttacgtaca gcaaagtatg attttgtctic gattictagac 78O tgcgatatgg caccacaa.ca attatgggitt cattctitatic ttacagaact attagaagac 84 O aatgat attgttittaattgg acctagaaaa tatgtggata ct cataatat taccgcagaa 9 OO caattic citta acgatc cata tittaatagaa toactacctgaaaccoctac aaataacaat 96.O c ctitcgatta catcaaaagg aaatatat cq ttggattgga gattagaaca tttcaaaaaa O2O accataatc tacgt.ctato tdatt citccg titt cqttatt ttagttgcgg taatgttgca O8O ttitt Ctaaag aatggctaaa taaagtaggit ttt catg aagaatttala t cattggggg 14 O ggcgaagatg tagaatttgg ttacagatta tittgccaaag gotgtttittt cagagtaatt 2OO gacggcggaa tigcatacca toaagaacca Cctggtaaag aaaatgaaac agaccgcgaa 26 O gctggtaaaa gtattacgct taaaattgttgaaagaaaagg tacct tacat citatagaaag 32O cittittaccaa tagaagattic acatatt cat agaatacctt tagtttctat ttatat cocc 38O gcttataact gtgcaaatta tattoaaaga tigtgtagata gtgct cittaa toaaactgtt 44 O gtcgat ct cq aggtttgt at ttgtaacgat gigttcaa.cag ataatacctt agaagtgat c SOO aataagctitt atggtaataa toctagggita cqcat catgt ctaaaccaaa tdgcggaata 560 gcct cagoat caaatgcago cqtttcttitt gctaaaggitt attacattgg gcagttagat 62O t cagatgatt atcttgagcc tdatgcagtt gaactgttgtt taaaagaatt tittaaaagat 68O aaaacgctag cittgttgttta taccactaat agaaacgt.ca atc.cggatgg tagcttaatc 74 O gctaatggitt acaattggcc agaattittca cqagaaaaac toacaacggc tatgattgct 8OO caccatttta gaatgtttac gattagagct tdgcatttaa cqgatggatt taacgaaaat 86 O attgaaaacg ccgtggatta toga catgttc cittaaactica gtgaagttgg aaaatttaaa 92 O catc.ttaata aaatctgcta taaccocqta ttacatggtgata acacat c cattaagaaa 98 O citcggcattcaaaagaaaaa ccattttgtt gtagt caatc agt cattaaa tag acaaggc 2O4. O atcaattatt ataattatga caaatttgat gatttagatgaaagtagaaa gtatat citt c 21OO aataaaac cq ctgaatatica agaagaaatg gat attittaa aagat cittaa act cattcaa 216 O aataaagatg ccaaaatcgc agt cagtatt ttctatocca atacattaaa cqgct tagtg 222 O aaaaaactaa acaatatt at tdaatataat aaaaatatat t cqtt attat t ctacatgtt 228O gataagaatc atc.ttacacic agacatcaaa aaagaaatat tdgctttcta t cataagcac 234 O caagtgaata ttt tactaaa taatgacatc. tcat attaca cqagtaatag actaataaaa 24 OO actgaggcac atttaagtaa tattaataaa ttaag to agit taaatctaaa ttgttgaatac 246 O at catttittgataatcatga cagcc tatt c gttaaaaatg acago tatgc titatatgaaa 252O aaatatgatgtcggcatgaa titt ct cagca tta acacatg attggat.cga gaaaatcaat 2580 gcqcatccac catttaaaaa gctgattaaa acct attitta atgacaatga cittaagaagt 264 O atgaatgtga aaggggcatc acaagg tatgttt atgaagt atgcgct acc gcatgagctt 27 OO ctgacgatta ttaaagaagt catca catcc tdccaat caa ttgatagtgt gcc agaatat 276 O aacactgagg at atttggitt coaatttgca cittittaatct tagaaaagaa aaccoggc cat 282O gtatttaata aaa catcqac cct gactitat atgcc ttggg aacgaaaatt acaatggaca 288O aatgaacaaa ttcaaagtgc aaaaaaaggc gaaaatat co ccdttaacaa gttcattatt 294 O aatagtataa cqctataaaa catttgcatt ttattaaaa 2979 <210 SEQ ID NO 4 US 7,569,386 B2 37 38 - Continued <211 LENGTH: 965 &212> TYPE: PRT <213> ORGANISM: Pasteurella multocida <4 OO SEQUENCE: 4 Met Asn. Thir Lieu. Ser Glin Ala Ile Lys Ala Tyr Asn. Ser Asn Asp Tyr 1. 5 1O 15 Glu Lieu Ala Lieu Lys Lieu. Phe Glu Lys Ser Ala Glu Thir Tyr Gly Arg 2O 25 3O Lys Ile Val Glu Phe Glin Ile Ile Lys Cys Lys Glu Lys Lieu. Ser Thr 35 4 O 45 Asn Ser Tyr Val Ser Glu Asp Llys Lys Asn. Ser Val Cys Asp Ser Ser SO 55 6 O Lieu. Asp Ile Ala Thr Glin Lieu. Lieu. Lieu. Ser Asn Val Llys Llys Lieu. Thir 65 70 7s 8O Lieu. Ser Glu Ser Glu Lys Asn. Ser Lieu Lys Asn Llys Trp Llys Ser Ile 85 90 95 Thr Gly Llys Llys Ser Glu Asn Ala Glu Ile Arg Llys Val Glu Lieu Val 1OO 105 11 O Pro Lys Asp Phe Pro Lys Asp Lieu Val Lieu Ala Pro Lieu Pro Asp His 115 12 O 125 Val Asn Asp Phe Thir Trp Tyr Lys Asn Arg Llys Llys Ser Lieu. Gly Ile 13 O 135 14 O Llys Pro Val Asn Lys Asn Ile Gly Lieu Ser Ile Ile Ile Pro Thr Phe 145 150 155 160 Asn Arg Ser Arg Ile Lieu. Asp Ile Thir Lieu Ala Cys Lieu Val Asn Glin 1.65 17O 17s Llys Thr Asn Tyr Pro Phe Glu Val Val Val Ala Asp Asp Gly Ser Lys 18O 185 19 O Glu Asn Lieu. Lieu. Thir Ile Val Glin Llys Tyr Glu Glin Llys Lieu. Asp Ile 195 2OO 2O5 Llys Tyr Val Arg Glin Lys Asp Tyr Gly Tyr Glin Lieu. Cys Ala Val Arg 21 O 215 22O Asn Lieu. Gly Lieu. Arg Thr Ala Lys Tyr Asp Phe Val Ser Ile Lieu. Asp 225 23 O 235 24 O Cys Asp Met Ala Pro Glin Gln Leu Trp Val His Ser Tyr Lieu. Thr Glu 245 250 255 Lieu. Lieu. Glu Asp Asn Asp Ile Val Lieu. Ile Gly Pro Arg Llys Tyr Val 26 O 265 27 O Asp Thr His Asn. Ile Thr Ala Glu Glin Phe Lieu. Asn Asp Pro Tyr Lieu 27s 28O 285 Ile Glu Ser Lieu. Pro Glu Thir Ala Thir Asn. Asn. Asn. Pro Ser Ile Thr 29 O 295 3 OO Ser Lys Gly Asn. Ile Ser Lieu. Asp Trp Arg Lieu. Glu. His Phe Llys Llys 3. OS 310 315 32O Thir Asp Asn Lieu. Arg Lieu. Cys Asp Ser Pro Phe Arg Tyr Phe Ser Cys 3.25 330 335 Gly Asn Val Ala Phe Ser Lys Glu Trp Lieu. Asn Llys Val Gly Trp Phe 34 O 345 35. O Asp Glu Glu Phe Asn His Trp Gly Gly Glu Asp Val Glu Phe Gly Tyr 355 360 365 Arg Lieu. Phe Ala Lys Gly Cys Phe Phe Arg Val Ile Asp Gly Gly Met 37 O 375 38O Ala Tyr His Glin Glu Pro Pro Gly Lys Glu Asn. Glu Thir Asp Arg Glu US 7,569,386 B2 39 40 - Continued 385 390 395 4 OO Ala Gly Ser Ile Thir Lell Ile Wall Lys Glu Wall Pro 4 OS 41O 415 Ile Arg Lys Lell Lell Pro Ile Glu Asp Ser His Ile His Arg Ile 42O 425 43 O Pro Luell Wall Ser Ile Ile Pro Ala ASn Ala Asn Ile 435 44 O 445 Glin Arg Wall Asp Ser Ala Luell Asn Glin Thir Wall Wall Asp Luell Glu 450 45.5 460 Wall Ile Asn Asp Gly Ser Thir Asp ASn Thir Lell Glu Wall Ile 465 470 47s 48O Asn Luell Gly Asn Asn Pro Arg Wall Arg Ile Met Ser Lys Pro 485 490 495 Asn Gly Ile Ala Ser Ala Ser Asn Ala Ala Wall Ser Phe Ala SOO 505 Gly Tyr Ile Gly Glin Lell Asp Ser Asp Asp Lell Glu Pro Asp 515 525 Ala Wall Glu Luell Cys Lell Lys Glu Phe Luell Asp Thir Luell Ala 53 O 535 54 O Cys Wall Thir Thir Asn Arg Asn Wall Asn Pro Asp Ser Luell Ile 5.45 550 555 560 Ala Asn Gly Asn Trp Pro Glu Phe Ser Arg Glu Luell Thir Thir 565 st O sts Ala Met Ile Ala His His Phe Arg Met Phe Thir Ile Arg Ala Trp His 58O 585 59 O Lell Thir Asp Gly Phe Asn Glu Asn Ile Glu ASn Ala Wall Asp Asp 595 605 Met Phe Luell Lell Ser Glu Wall Gly Phe Lys His Luell Asn 610 615 Ile Asn Arg Wall Lell His Gly Asp ASn Thir Ser Ile Lys 625 630 635 64 O Lell Gly Ile Glin Lys Asn His Phe Wall Wall Wall Asn Glin Ser Luell 645 650 655 Asn Arg Glin Gly Ile Asn Asn Asp Phe Asp Asp Luell 660 665 67 O Asp Glu Ser Arg Lys Ile Phe Asn Thir Ala Glu Glin Glu 675 68O 685 Glu Met Asp Ile Lell Asp Luell Luell Ile Glin Asn Asp Ala 69 O. 695 7 OO Lys Ile Ala Wall Ser Ile Phe Pro Asn Thir Lell Asn Gly Luell Wall 7 Os 71O Luell Asn Asn Ile Ile Glu Asn Asn Ile Phe Wall Ile 72 73 O 73 Ile Luell His Wall Asp Asn His Luell Thir Pro Asp Ile Lys Glu 740 74. 7 O Ile Luell Ala Phe Tyr His His Glin Wall ASn Ile Lell Luell Asn Asn 760 765 Asp Ile Ser Tyr Thir Ser Asn Arg Luell Ile Lys Thir Glu Ala His 770 775 Lell Ser Asn Ile Asn Lys Lell Ser Glin Luell ASn Lell Asn Glu 78s 79 O 79. US 7,569,386 B2 41 - Continued Ile Ile Phe Asp Asn His Asp Ser Lieu. Phe Wall Lys Asn Asp Ser Tyr 805 810 815 Ala Tyr Met Lys Llys Tyr Asp Val Gly Met Asn Phe Ser Ala Lieu. Thr 82O 825 83 O His Asp Trp Ile Glu Lys Ile Asn Ala His Pro Pro Phe Llys Llys Lieu. 835 84 O 845 Ile Llys Thr Tyr Phe Asn Asp Asn Asp Lieu. Arg Ser Met Asn. Wall Lys 850 855 860 Gly Ala Ser Glin Gly Met Phe Met Lys Tyr Ala Leu Pro His Glu Lieu. 865 87O 87s 88O Lieu. Thir Ile Ile Lys Glu Val Ile Thr Ser Cys Glin Ser Ile Asp Ser 885 890 895 Val Pro Glu Tyr Asn Thr Glu Asp Ile Trp Phe Glin Phe Ala Lieu. Leu 9 OO 905 91 O Ile Leu Glu Lys Lys Thr Gly His Val Phe Asn Lys Thr Ser Thr Lieu. 5 92 O 925 Thr Tyr Met Pro Trp Glu Arg Llys Lieu. Glin Trp Thr Asn Glu Glin Ile 93 O 935 94 O Glin Ser Ala Lys Lys Gly Glu Asn. Ile Pro Val Asn Llys Phe Ile Ile 945 950 955 96.O Asn. Ser Ile Thir Lieu. 965 <210 SEQ ID NO 5 <211 LENGTH: 24 &212> TYPE: DNA <213> ORGANISM: Artificial Sequence &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 5 cactgtctaa ctittattgtt agcc 24 <210 SEQ ID NO 6 <211 LENGTH: 2O &212> TYPE: DNA <213> ORGANISM: Artificial sequence &220s FEATURE: <223> OTHER INFORMATION: primer <4 OO SEQUENCE: 6 tttittaacga at aggctgtc 2O <210 SEQ ID NO 7 <211 LENGTH: 19 &212> TYPE: PRT <213> ORGANISM: Artificial Sequence &220s FEATURE: <223> OTHER INFORMATION: synthetic peptide corresponding to residues 526 to 544 of PmHAS protein <4 OO SEQUENCE: 7 Lieu. Asp Ser Asp Asp Tyr Lieu. Glu Pro Asp Ala Val Glu Lieu. Cys Lieu. 1. 5 1O 15 Lys Glu Phe US 7,569,386 B2 43 44 What I claim is: 8. The recombinant host cell of claim 5, wherein the recom 1. A purified nucleic acid segment having a coding region binant host cell is a eukaryotic cell cultured in vitro. encoding enzymatically active chondroitin synthase, wherein 9. A purified nucleic acid segment having a coding region the enzymatically active chondroitin Synthase is a single pro encoding enzymatically active chondroitin synthase, wherein tein that catalyzes the incorporation of both UDP-GlcA and the enzymatically active chondroitin Synthase is a single pro UDP-GalNAc to form a chondroitin molecule, and wherein tein that catalyzes the incorporation of both UDP-GlcA and the purified nucleic acid segment comprises at least one of UDP-GalNAc to form a chondroitin molecule, and wherein (a) the nucleotide sequence in accordance with SEQ ID the purified nucleic acid segment has at least 90% identity to NO:3; and SEQID NO:3. 10 10. A recombinant vector comprising the purified nucleic (b) a nucleotide sequence encoding the amino acid acid segment of claim 9. sequence of SEQID NO:4. 11. The recombinant vector of claim 10, wherein the 2. A recombinant vector comprising the purified nucleic recombinant vector is selected from the group consisting of a acid segment of claim 1. plasmid, cosmid, phage, integrated cassette and virus vector. 3. The recombinant vector of claim 2, wherein the recom 15 12. The recombinant vector of claim 10, further comprising binant vector is selected from the group consisting of a plas a promoter operatively linked to the coding region encoding mid, cosmid, phage, integrated cassette and virus vector. enzymatically active chondroitin synthase. 4. The recombinant vector of claim 2, further comprising a 13. A recombinant host cell comprising the recombinant promoter operatively linked to the coding region encoding vector of claim 10. enzymatically active chondroitin synthase. 14. The recombinant host cell of claim 13, wherein the host 5. A recombinant host cell comprising the recombinant cell produces chondroitin. vector of claim 2. 15. The recombinant host cell of claim 13, wherein the 6. The recombinant host cell of claim 5, wherein the host recombinant host cell is a prokaryotic cell. cell produces chondroitin. 16. The recombinant host cell of claim 13, wherein the 7. The recombinant host cell of claim 5, wherein the recom 25 recombinant host cell is a eukaryotic cell cultured in vitro. binant host cell is a prokaryotic cell. k k k k k UNITED STATES PATENT AND TRADEMARK OFFICE CERTIFICATE OF CORRECTION PATENT NO. : 7,569,386 B2 Page 1 of 1 APPLICATIONNO. : 11/042530 DATED : August 4, 2009 INVENTOR(S) : Paul L. DeAngelis It is certified that error appears in the above-identified patent and that said Letters Patent is hereby corrected as shown below: Column 24, line 51, Table 3: Delete “UDP-GlcNAc which is listed below “UDP - GalUA' and replace with -- UDP-GalNAc --. Signed and Sealed this Eighth Day of September, 2009 David J. Kappos Director of the United States Patent and Trademark Office