DOCSLIB.ORG

Molecular Epidemiology and Characterisation of Wesselsbron Virus and Co-Circulating Alphaviruses in Sentinel Animals in South Africa

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Epidemiology and Characterisation of Wesselsbron Virus and Co-Circulating Alphaviruses in Sentinel Animals in South Africa Molecular Epidemiology and Characterisation of Wesselsbron Virus and Co-circulating Alphaviruses in Sentinel Animals in South Africa 3 4 Human S.1, Gerdes T , Stroebel J. C. , and Venter M1, 2* 1 Department of Medical Virology, Faculty of Health Sciences, University of Pretoria, South Africa; 2 National Health Laboratory Services, Tshwane Academic Division; 3 Onderstepoort Veterinary Institute, South Africa; 4 Western Cape Provincial Veterinary Laboratory * Contact person: Dr M Venter. Senior lecturer, Department of Medical Virology, Faculty of Health Sciences, University of Pretoria/NHLS Tshwane Academic Division, P.O Box 2034, Pretoria, 0001, South Africa. Tel: +27 12 319 2660, Fax: +27 12 319 5550, e-mail: [email protected], [email protected] ABSTRACT Flavi and alphaviruses are a significant cause of morbidity and mortality in both humans and animals worldwide. In order to determine the contribution of flavi and alphaviruses to unexplained neurological hepatic or fever cases in horses and other animals in South Africa, cases resembling these symptoms were screened for Flaviviruses (other than West Nile virus) and Alphaviruses. The results show that both Wesselsbron and alphaviruses (Sindbis-like and Middelburg virus) can contribute to neurological disease and fevers in horses. KEYWORDS Wesselsbron virus disease, Sindbis-like virus, Middelburg virus INTRODUCTION In South Africa (SA) the most important mosquito borne viruses are West Nile Virus (WNV) and Wesselsbron virus (Flaviviridae) and the Sindbis and Middelburg viruses (Togaviridae). These viruses are transmitted by Culex spp. (WNV and Sindbis virus) and Aedes spp. (Wesselsbron and Middelburg virus) mosquitoes. Wesselsbron (WSLB) virus was first discovered in 1955 in the Wesselsbron district of the Free State province in SA where it was isolated from an eight-day-old lamb (Weiss et al., 1956). WSLB virus disease causes an acute, biphasic, febrile illness in livestock and has a broad host range occasionally causing illness in ostriches (Verwoed, 2000; Allwright et al, 1995) and man. In adult animals it is sub-clinical, except in the case of pregnant ewes where it may cause hepatitis, haemorrhages and abortions associated with hydrops amnii (Smithburn et al, 1957). In newborn lambs WSLB virus primarily causes a fatal disease. Liver pathology in lambs is constant and typical with features including fatty infiltration, bile pigmentation, death of hepatocytes as well as the infiltration of neutrophils and lymphocytes (Coetzer et al, 1978). Outbreaks of abortions amongst sheep and goats as well as substantial mortality among newborn lambs and kids attract considerable attention, especially as these losses lead to a heavy economic burden amongst farmers. Alphaviruses are important pathogens of livestock and humans worldwide (Attoui et al, 2007). Until the 1974 outbreaks in the Karoo and Northern Cape Province in SA (Jupp et al, 1986), Sindbis virus (SINV) was considered to be of little medical importance (Sammels et al, 1999) as it causes a self-limiting febrile disease. Another epidemic occurred in 1983/84 in the Witwatersrand/Pretoria regions of SA, where hundreds of human cases were reported (Jupp et al, 1986). Middelburg virus was thought to be non-pathogenic until it was isolated from a spleen of a horse in Zimbabwe that died of symptoms clinically similar to African Horse Sickness (Attoui et al, 2007). We aimed to screen horses with unexplained neurological and/or hepatic disease for flaviviruses other than WNV. As alphaviruses are transmitted by the same vectors as flaviviruses, these viruses were screened for as well. MATERIALS AND METHODS Clinical Specimen Collection Serum, plasma, cerebrospinal fluid (CSF), formalin fixed and fresh organ specimens were collected from horses and other animals displaying unexplained hepatic and/or neurological disease or fever in 2008/2009. Samples were received from the Onderstepoort Veterinary Institute (OVI), University of Pretoria Faculty of Veterinary Science and by private equine veterinarians from the Gauteng, Kwa-Zulu Natal and the Northern and Western Cape provinces. Extraction of Viral RNA, Flavivirus and Alphavirus Screening and Cloning Viral RNA was extracted from serum/plasma/CSF/culture using the QIA-amp viral RNA mini kit (Qiagen, Valencia, CA) according to the manufacturer’s instruction. A 30mg piece of tissue was used for extraction from fresh and formalin fixed tissues using the RNeasy Plus mini kit (Qiagen, Valencia, CA) according to the manufacturer’s instructions. A nested Flavivirus family RT-PCR was used to screen specimens for Flaviviruses. Similarly, an alphavirus family-specific nested RT-PCR was used to screen clinical specimens (Sanchez-Seco et al, 2001). PCR products were visualised following agarose gel electrophoresis and UV transillumination. Positive alphavirus PCR products were purified and cloned. Sequencing and Phylogenetic Analysis Positive PCR products and recombinant clones were gel purified and sequenced. Sequences were compiled using Sequencher v4.6 and aligned with MAFFT v6 (http://align.bmr.kyushu-u.ac.jp/mafft/software/). Aligned sequences were edited with BioEdit v7.0.9.0. Neighbor-joining trees were generated with the Kimura 2- parameter model for 1000 bootstrap replicates using Mega v4. RESULTS RT-PCR and Nucleotide Sequencing Out of a total of 80 specimens screened in 2008, of which 48 had fever and 32 were neurological, 2 horses (SAE118/08 and SAE12/08) with neurological symptoms were shown to be Wesselsbron virus by DNA sequence analysis. Phylogenetic analysis clustered them within the Unassigned and Yellow Fever virus group within the Flaviviridae. Both cases had severe neurological disease with symptoms similar to WNV, one which was fatal. Symptoms included ataxia, weak hind and/or forelimb and paresis; complete paralysis, jaundice and/or hepatitis. SAE118/08 was grouped with H117 a Wesselsbron strain that caused a febrile illness in a human (Smithburn et al, 1957) and SAE122/08 clustered most closely to AR2209, a Wesselsbron strain isolated from mosquitoes. Alphavirus Screening Of the 43 cases screened this year, 5 cases were PCR positive (SAE30/09, SAE31/09, SAE40/09, SAE55/09 and SAE68/09). Sequencing confirmed four specimens to be Sindbis-like virus and one as Middelburg virus. SAE40/09 and SAE55/09 had a co-infection with WNV and had to be euthanized due to severe neurological symptoms including weak hindquarters, multiple skin abrasions on the head and limbs, increased respiratory and heart rate, severe ataxia, weak facial reflexes and recumbency. SAE30/09 had symptoms such as fever and jaundice and survived, whilst SAE31/09 was mildly choleric, mildly ataxic, had pale mucous membranes, petechia and mild neurological symptoms but recovered. The horse diagnosed with Middelburg virus (SAE68/09) recovered after displaying severe neurological symptoms and ataxia. Phylogenetically, the Sindbis-like specimens grouped with the SA strains of Sindbis-like virus as. The average number of nucleotide differences within the Sindbis-like specimens was 0.7% and differed with the known Sindbis-like and prototype Sindbis viruses by 1.7% and 8% respectively. Meanwhile, the positive Middelburg specimen differed by 3.4% to the known strain of Middelburg virus; and to the known Sindbis-like viruses by 29% and the prototype Sindbis virus by 32%. DISCUSSION Mosquito borne viruses such as WSLB, Middelburg and Sindbis viruses have the potential to infect a large number of farm animals as well as horses during conditions that favour the breeding of the mosquito vectors, and have the ability to infect farm workers and owners during zoonotic transmission (McIntosh B.M., 1986) or through mosquito bites. This may create a burden on not only the farmer or animal owner, but also the country’s economy if large outbreaks occur. Using sentinel animals such as horses to screen for WSLB virus is an easy method of outbreak prevention by prediction of an increase in cases and initiating vector control. Since sheep and cattle farming contribute most to the agricultural sector in SA and makes up approximately four percent of SA’s gross domestic product (GDP), it is important to control outbreaks in herds of these animals (www.southafrica.info/business/economy/sectors/542547.html). The positive WSLB specimens were horses that presented clinically with severe neurological symptoms fever, jaundice, profuse urination and recumbency. This is the first study to describe Wesselsbron in horses in South Africa. Alphavirus screening revealed 5 (SAE30/09, SAE31/09, SAE40/09, SAE55/09 and SAE68/09) positive cases. Two horses (SAE40/09 and SAE55/09) had a co-infection with WNV and had to be euthanised due to severe neurological infection. These positive PCR results came from brain specimens, while the rest were diagnosed from blood samples. SAE30/09 survived and had symptoms such as fever and jaundice, whilst SAE31/09 was mildly choleric and displayed mild neurological symptoms but recovered. This suggests that a neurotropic virus such as WNV may allow the alphaviruses to cross the blood-brain-barrier (BBB) and that infection with only Sindbis did not develop severe neurological disease. The horse diagnosed with Middelburg virus (SAE68/09) had more severe neurological symptoms and ataxia but recovered. This suggests that Middelburg virus may be more pathogenic and neurotropic than Sindbis-like viruses in horses and is able to cross the BBB, resulting in severe neurological disease. Further investigations in mice
Load more

Recommended publications
  • Evolutionary Relationships and Systematics of the Alphaviruses ANN M
    JOURNAL OF VIROLOGY, Nov. 2001, p. 10118–10131 Vol. 75, No. 21 0022-538X/01/$04.00ϩ0 DOI: 10.1128/JVI.75.21.10118–10131.2001 Copyright © 2001, American Society for Microbiology. All Rights Reserved. Evolutionary Relationships and Systematics of the Alphaviruses ANN M. POWERS,1,2† AARON C. BRAULT,1† YUKIO SHIRAKO,3‡ ELLEN G. STRAUSS,3 1 3 1 WENLI KANG, JAMES H. STRAUSS, AND SCOTT C. WEAVER * Department of Pathology and Center for Tropical Diseases, University of Texas Medical Branch, Galveston, Texas 77555-06091; Division of Vector-Borne Infectious Diseases, Centers for Disease Control and Prevention, Fort Collins, Colorado2; and Division of Biology, California Institute of Technology, Pasadena, California 911253 Received 1 May 2001/Accepted 8 August 2001 Partial E1 envelope glycoprotein gene sequences and complete structural polyprotein sequences were used to compare divergence and construct phylogenetic trees for the genus Alphavirus. Tree topologies indicated that the mosquito-borne alphaviruses could have arisen in either the Old or the New World, with at least two transoceanic introductions to account for their current distribution. The time frame for alphavirus diversifi- cation could not be estimated because maximum-likelihood analyses indicated that the nucleotide substitution rate varies considerably across sites within the genome. While most trees showed evolutionary relationships consistent with current antigenic complexes and species, several changes to the current classification are proposed. The recently identified fish alphaviruses salmon pancreas disease virus and sleeping disease virus appear to be variants or subtypes of a new alphavirus species. Southern elephant seal virus is also a new alphavirus distantly related to all of the others analyzed.
    [Show full text]
  • Temperature-Sensitive Mutants of Sindbis Virus: Complementation Group F Mutants Have Lesions in Nsp4 YOUNG S
    JOURNAL OF VIROLOGY, Mar. 1989, p. 1194-1202 Vol. 63, No. 3 0022-538X/89/031194-09$02.00/0 Copyright © 1989, American Society for Microbiology Mapping of RNA- Temperature-Sensitive Mutants of Sindbis Virus: Complementation Group F Mutants Have Lesions in nsP4 YOUNG S. HAHN,' ARASH GRAKOUI,2 CHARLES M. RICE,2 ELLEN G. STRAUSS,' AND JAMES H. STRAUSS'* Division ofBiology, California Institute of Technology, Pasadena, California 91125,1 and Department of Microbiology and Immunology, Washington University, St. Louis, Missouri 631102 Received 24 October 1988/Accepted 28 November 1988 Temperature-sensitive (ts) mutants of Sindbis virus belonging to complementation group F, ts6, tsllO, and ts118, are defective in RNA synthesis at the nonpermissive temperature. cDNA clones of these group F mutants, as well as of ts+ revertants, have been constructed. To assign the ts phenotype to a specific region in the viral genome, restriction fragments from the mutant cDNA clones were used to replace the corresponding regions of the full-length clone Totol101 of Sindbis virus. These hybrid plasmids were transcribed in vitro by SP6 RNA polymerase to produce infectious transcripts, and the virus recovered was tested for temperature sensitivity. After the ts lesion of each mutant was mapped to a specific region of 400 to 800 nucleotides by this approach, this region of the cDNA clones of both the ts mutant and ts+ revertants was sequenced in order to determine the precise nucleotide change and amino acid substitution responsible for each mutation. Rescued mutants, which have a uniform background except for one or two defined changes, were examined for viral RNA synthesis and complementation to show that the phenotypes observed were the result of the mutations mapped.
    [Show full text]
  • Study of Chikungunya Virus Entry and Host Response to Infection Marie Cresson
    Study of chikungunya virus entry and host response to infection Marie Cresson To cite this version: Marie Cresson. Study of chikungunya virus entry and host response to infection. Virology. Uni- versité de Lyon; Institut Pasteur of Shanghai. Chinese Academy of Sciences, 2019. English. NNT : 2019LYSE1050. tel-03270900 HAL Id: tel-03270900 https://tel.archives-ouvertes.fr/tel-03270900 Submitted on 25 Jun 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. N°d’ordre NNT : 2019LYSE1050 THESE de DOCTORAT DE L’UNIVERSITE DE LYON opérée au sein de l’Université Claude Bernard Lyon 1 Ecole Doctorale N° 341 – E2M2 Evolution, Ecosystèmes, Microbiologie, Modélisation Spécialité de doctorat : Biologie Discipline : Virologie Soutenue publiquement le 15/04/2019, par : Marie Cresson Study of chikungunya virus entry and host response to infection Devant le jury composé de : Choumet Valérie - Chargée de recherche - Institut Pasteur Paris Rapporteure Meng Guangxun - Professeur - Institut Pasteur Shanghai Rapporteur Lozach Pierre-Yves - Chargé de recherche - CHU d'Heidelberg Rapporteur Kretz Carole - Professeure - Université Claude Bernard Lyon 1 Examinatrice Roques Pierre - Directeur de recherche - CEA Fontenay-aux-Roses Examinateur Maisse-Paradisi Carine - Chargée de recherche - INRA Directrice de thèse Lavillette Dimitri - Professeur - Institut Pasteur Shanghai Co-directeur de thèse 2 UNIVERSITE CLAUDE BERNARD - LYON 1 Président de l’Université M.
    [Show full text]
  • Joseph Icenogle
    Progress Toward Rubella Elimination and CRS Prevention in Europe 8-10 February 2010 Rome MH Chen1, E Abernathy1, Q Zheng,1 E Kirkness2, BackgroundS Sumsita 2, W Bellini, Information J Icenogle1 1:National Center for Immunization and Respiratory Diseases, Centers for Disease Control and Prevention, Atlanta, GA 30333,Rubella USA; Virus 2: J. Craig Venter Institute, 9704 Medical Center Drive, Rockville, MD 20850, USA Joseph P. Icenogle Rubella Laboratory Team Lead MMRH Laboratory Branch National Center for Immunization & Respiratory Diseases MMRHLB Outline 1. A brief history of rubella virus, before the development of vaccines 2. Structure of the virus, partly by analogy to related viruses 3. Description of the genome of rubella virus 4. Variability in the genome of circulating rubella viruses 5. Some properties of specific viral proteins 6. The life cycle of rubella virus in tissue culture; details matter 7. Emphasis on a couple of important virus-host cell interactions Brief, Selected History of Rubella and Congenital Rubella Syndrome, Before Vaccines were Developed. 18th Century----Description of disease by German authors 1881--------------Recognition of rubella as a disease independent from measles and scarlet fever by an International Congress of Medicine in London 1881 to 1941---Little or no recognition of rubella as anything other than a mild childhood rash illness. Significant influence of prevalent opinion that birth defects were all of genetic origin. 1941-------------- N. McAlister Gregg. Congenital Cataract Following German Measles in the Mother. Trans Ophthalmol Soc Aust 1941;3:35-46 1941-1950s----Lack of Clarity on the importance of Congenital Rubella Syndrome 1957-1960------Multiple studies are published establishing Congenital Rubella Syndrome as a prevalent and serious disease.
    [Show full text]
  • Medical Aspects of Biological Warfare
    Alphavirus Encephalitides Chapter 20 ALPHAVIRUS ENCEPHALITIDES SHELLEY P. HONNOLD, DVM, PhD*; ERIC C. MOSSEL, PhD†; LESLEY C. DUPUY, PhD‡; ELAINE M. MORAZZANI, PhD§; SHANNON S. MARTIN, PhD¥; MARY KATE HART, PhD¶; GEORGE V. LUDWIG, PhD**; MICHAEL D. PARKER, PhD††; JONATHAN F. SMITH, PhD‡‡; DOUGLAS S. REED, PhD§§; and PAMELA J. GLASS, PhD¥¥ INTRODUCTION HISTORY AND SIGNIFICANCE ANTIGENICITY AND EPIDEMIOLOGY Antigenic and Genetic Relationships Epidemiology and Ecology STRUCTURE AND REPLICATION OF ALPHAVIRUSES Virion Structure PATHOGENESIS CLINICAL DISEASE AND DIAGNOSIS Venezuelan Equine Encephalitis Eastern Equine Encephalitis Western Equine Encephalitis Differential Diagnosis of Alphavirus Encephalitis Medical Management and Prevention IMMUNOPROPHYLAXIS Relevant Immune Effector Mechanisms Passive Immunization Active Immunization THERAPEUTICS SUMMARY 479 244-949 DLA DS.indb 479 6/4/18 11:58 AM Medical Aspects of Biological Warfare *Lieutenant Colonel, Veterinary Corps, US Army; Director, Research Support and Chief, Pathology Division, US Army Medical Research Institute of Infectious Diseases, 1425 Porter Street, Fort Detrick, Maryland 21702; formerly, Biodefense Research Pathologist, Pathology Division, US Army Medical Research Institute of Infectious Diseases, 1425 Porter Street, Fort Detrick, Maryland †Major, Medical Service Corps, US Army Reserve; Microbiologist, Division of Virology, US Army Medical Research Institute of Infectious Diseases, 1425 Porter Street, Fort Detrick, Maryland 21702; formerly, Science and Technology Advisor, Detachment
    [Show full text]
  • Sindbis and Middelburg Old World Alphaviruses Associated with Neurologic Disease in Horses, South Africa
    Sindbis and Middelburg Old World Alphaviruses Associated with Neurologic Disease in Horses, South Africa Stephanie van Niekerk, Stacey Human, and acute neurologic infections reported to our surveil- June Williams, Erna van Wilpe, lance program by veterinarians across South Africa dur- Marthi Pretorius, Robert Swanepoel, ing January 2008–December 2013. Of reported cases, 346 Marietjie Venter horses had neurologic signs; 277 had mainly febrile illness and other miscellaneous signs, including colic and sudden Old World alphaviruses were identified in 52 of 623 horses death (online Technical Appendix Figure 1, panel A, http:// with febrile or neurologic disease in South Africa. Five of wwwnc.cdc.gov/EID/article/21/12/15-0132-Techapp.pdf). 8 Sindbis virus infections were mild; 2 of 3 fatal cases in- Formalin-fixed tissue samples from horses that died were volved co-infections. Of 44 Middelburg virus infections, 28 caused neurologic disease; 12 were fatal. Middelburg virus submitted for histopathology. Horses ranged from <1 to 20 likely has zoonotic potential. years of age and included thoroughbred, Arabian, warm- blood, and part-bred horses; most were bred locally. A generic nested alphavirus nonstructural polyprotein lphaviruses (Togaviridae) include zoonotic, vector- (nsP) region 4 gene reverse transcription PCR (10) was Aborne viruses with epidemic potential (1). Phyloge- used to screen total nucleic acids. TaqMan probes (Roche, netic analysis defined 2 monophyletic groups: 1) the New Indianapolis, IN, USA) were developed for rapid differen- World group, consisting of Sindbis virus (SINV), Venezu- tiation of MIDV and SINV by real-time PCR (online Tech- elan equine encephalitis virus, and Eastern equine encepha- nical Appendix).
    [Show full text]
  • Sindbis and Middelburg Old World Alphaviruses Associated with Neurologic Disease in Horses, South Africa
    Article DOI: http://dx.doi.org/10.3201/eid2112.150132 Sindbis and Middelburg Old World Alphaviruses Associated with Neurologic Disease in Horses, South Africa Technical Appendix Detailed Methods and Results 1. Generic Real-Time Reverse Transcription PCR for Diagnosis of Middelburg and Sindbis Virus Infections Viral RNA was extracted from plasma or serum samples derived from EDTA-clotted blood and from cerebrospinal fluid samples with the High Pure Viral Total Nucleic Acid Extraction Kit (Roche, Indianapolis, IN, USA). Nervous tissue or visceral organ samples were homogenized by using a mortar and pestle, and RNA was extracted by using the RNeasy Plus Mini Kit (QIAGEN, Valencia, CA, USA). The first round and nested PCR primers that were based on a highly conserved region of the nsP4 gene were prepared as described previously (1). First-round PCR was performed by using the Titan one tube reverse transcription (RT)-PCR system (Roche). Each reaction contained 10 μL of RNA, 10 μL 10× reaction buffer, 1 μL of dNTP mix (10 mmol/L), 2 μL of 10 pmol of each primer (Alpha1+; Alpha1–), 2.5 μL Dithiothreitol solution (100 mmol/L), 0.25 μL RNase inhibitor (40 U/μL), and 1 μL of the Titan enzyme mix. The final volume was made up to 50 μL with distilled water. Cycling conditions were 50°C for 30 min, 94°C for 2 min, (94°C for 10 s, 52°C for 30 s, 68°C for 1 min) × 35 cycles, and 68°C for 7 min. By using Primer 3 (2), two probes were designed for rapid differentiation of Sindbis virus (SINV, a New World virus) and Middelburg virus (MIDV, an Old World virus) as follows: SINV: 5 ATGACGAGTATTGGGAGGAGTTTG 3-FAM; MIDV: 5 GCTTTAAGAAGTACGCATGCAACA 3 –VIC.
    [Show full text]
  • Short Review: Assessing the Zoonotic Potential of Arboviruses of African Origin
    Short Review: Assessing the zoonotic potential of arboviruses of African origin Marietjie Venter (PhD)* *Corresponding author: [email protected] Zoonotic Arbo- and Respiratory virus program, Department Medical Virology, Faculty of Health, University of Pretoria, South Africa. +27832930884 Word count: Text 2096 Abstract: 121 Abstract: Several African arboviruses have emerged over the past decade in new regions where they caused major outbreaks in humans and/or animals including West Nile virus, Chikungunya virus and Zika virus. This raise questions regarding the importance of less known zoonotic arboviruses in local epidemics in Africa and their potential to emerge internationally. Syndromic surveillance in animals may serve as an early warning system to detect zoonotic arbovirus outbreaks. Rift Valley fever and Wesselsbronvirus are for example associated with abortion storms in livestock while West Nile-, Shuni- and Middelburg virus causes neurological disease outbreaks in horses and other animals. Death in birds may signal Bagaza- and Usutu virus outbreaks. This short review summarize data on less known arboviruses with zoonotic potential in Africa. Introduction: African arboviruses in the families Flaviviridae (West Nile Virus (WNV); Zika virus; Yellow Fever (YFV); Usutu virus); Togaviridae (Chikungunya virus) and bunyaviridae (Rift Valley fever (RVF) and Crimean Congo Haemorrhagic Fever (CCHF) were some of the major emerging and re-emerging zoonotic pathogens of the last decade [1,2].These viruses were largely unnoticed as diseases in Africa before they emerged internationally. Arboviruses often circulate between mosquito vectors and vertebrate hosts and spill over to sensitive species during climatic events where they may cause severe disease. One Health surveillance for syndromes associated with arboviruses in animals; screening of mosquito vectors and surveillance for human disease may help to identify less known zoonotic arboviruses and determine their potential to emerge internationally (Figure 1).
    [Show full text]
  • Discovery of Mwinilunga Alphavirus : a Novel Alphavirus in Culex Mosquitoes in Zambia
    Title Discovery of Mwinilunga alphavirus : A novel alphavirus in Culex mosquitoes in Zambia Torii, Shiho; Orba, Yasuko; Hang'ombe, Bernard M.; Mweene, Aaron S.; Wada, Yuji; Anindita, Paulina D.; Author(s) Phongphaew, Wallaya; Qiu, Yongjin; Kajihara, Masahiro; Mori-Kajihara, Akina; Eto, Yoshiki; Harima, Hayato; Sasaki, Michihito; Carr, Michael; Hall, William W.; Eshita, Yuki; Abe, Takashi; Sawa, Hirofumi Virus Research, 250, 31-36 Citation https://doi.org/10.1016/j.virusres.2018.04.005 Issue Date 2018-05-02 Doc URL http://hdl.handle.net/2115/73890 © 2018. This manuscript version is made available under the CC-BY-NC-ND 4.0 license Rights http://creativecommons.org/licenses/by-nc-nd/4.0/ Rights(URL) http://creativecommons.org/licenses/by-nc-nd/4.0/ Type article (author version) File Information Torii_et_al_HUSCUP.pdf Instructions for use Hokkaido University Collection of Scholarly and Academic Papers : HUSCAP Discovery of Mwinilunga alphavirus: a novel alphavirus in Culex mosquitoes in Zambia Shiho Torii1, Yasuko Orba1*, Bernard M. Hang’ombe2,10, Aaron S. Mweene3,9,10, Yuji Wada1, Paulina D. Anindita1, Wallaya Phongphaew1, Yongjin Qiu4, Masahiro Kajihara5, Akina Mori-Kajihara5, Yoshiki Eto5, Hayato Harima4, Michihito Sasaki1, Michael Carr6,7, William W. Hall7,8,9,10, Yuki Eshita4, Takashi Abe11, Hirofumi Sawa1,7,9,10* 1Division of Molecular Pathobiology, Research Center for Zoonosis Control, Hokkaido University, Sapporo, Japan 2Department of Para-clinical Studies, School of Veterinary Medicine, University of Zambia, Lusaka, Zambia 3Department
    [Show full text]
  • Sindbis Virus and Pogosta Disease in Finland
    Department of Virology Haartman Institute, Faculty of Medicine University of Helsinki SINDBIS VIRUS AND POGOSTA DISEASE IN FINLAND SATU KURKELA ACADEMIC DISSERTATION Pro Doctoratu To be presented with due permission of the Faculty of Medicine at the University of Helsinki for public examination and debate on Friday, November 23rd, 2007, at 12 noon in the Lecture Hall 3 at Biomedicum Helsinki, Haartmaninkatu 8, Helsinki HELSINKI 2007 SUPERVISORS____________________________________________________ OLLI VAPALAHTI, MD, PHD Departments of Virology and Basic Veterinary Sciences Professor of Zoonotic Virology Faculties of Medicine and Veterinary Medicine University of Helsinki Helsinki, Finland ANTTI VAHERI, MD, PHD Department of Virology Professor of Virology Faculty of Medicine University of Helsinki Helsinki, Finland REVIEWERS______________________________________________________ TYTTI VUORINEN, MD, PHD Department of Virology Docent in Virology Faculty of Medicine University of Turku Turku, Finland JARMO OKSI, MD, PHD Department of Medicine Docent in Internal Medicine Turku University Central Hospital Turku, Finland OFFICIAL OPPONENT____________________________________________ ANTOINE GESSAIN, MD, PhD Oncogenic Virus Epidemiology Head of Laboratory, Unit Chief and Pathophysiology Unit Department of Virology Institut Pasteur Paris, France Back cover art courtesy of Sini Virtanen, specially drawn for this publication ISBN 978-952-92-2880-5 (paperback) ISBN 978-952-10-4262-1 (PDF, available at http://ethesis.helsinki.fi) Yliopistopaino – Helsinki University Printing House Helsinki 2007 Your theory is crazy, but it's not crazy enough to be true - Niels Bohr (1885-1962) – CONTENTS – CONTENTS LIST OF ORIGINAL PUBLICATIONS 6 ABBREVIATIONS 7 ABSTRACT 8 TIIVISTELMÄ (SUMMARY IN FINNISH) 10 REVIEW OF THE LITERATURE 12 1. Arboviruses as human pathogens 12 2. Introduction to alphaviruses 13 Classification, genomic structure, and replication 13 Phylogenetic relationships and geographic distribution 16 Reservoirs and vectors 20 Alphaviruses as human pathogens 21 3.
    [Show full text]
  • Non-Commercial Use Only Acidification Causes the E1 Protein to Under- Go a Conformational Change, Exposing the Fusion Loop
    Translational Medicine Reports 2019; volume 3:8156 Chikungunya virus: Update ronments. The origin of the term chikun- on molecular biology, gunya comes from the African word kun- Correspondence: Mariateresa Vitiello, gunyala, literarily meaning to be contorted, Department of Clinical Pathology, Virology epidemiology and current and it refers to the typical patients’ posture Unit, San Giovanni di Dio e Ruggi d’Aragona strategies resulting from severe muscular and joint Hospital, Salerno, Italy. E-mail: [email protected] pain.3,4 CHIKV was first isolated during an Debora Stelitano,1 Annalisa Chianese,1 epidemic in Tanzania, in 1952-1953. Key words: Chikungunya virus; Life cycle; Roberta Astorri,1 Enrica Serretiello,1 However, it has been suggested that Epidemiology; Vector; Clinical management. 1 1 CHIKV outbreaks had already happened in Carla Zannella, Veronica Folliero, Africa, Asia and America before this date Contributions: DS, data collecting and manu- Marilena Galdiero,1 Gianluigi Franci,1 and were generally mistaken for dengue script writing; AC, RA, ES, CZ, VF, MG, GF, Valeria Crudele,1 Mariateresa Vitiello2 epidemics.5,6 In fact, as these viruses can VC, data collecting, manuscript reviewing and 1 reference search; MTV, data collecting, fig- Department of Experimental Medicine, cause similar clinical syndromes, retrospec- ures preparation and manuscript writing. University of Campania Luigi Vanvitelli, tive studies suggested that they may have 2 Naples; Department of Clinical been confused in the past, especially in the Conflict of interest: the authors declare no Pathology, Virology Unit, San Giovanni regions in which they are both endemic. potential conflict of interest. di Dio e Ruggi d’Aragona Hospital, Since its discovery, the virus has spread, Salerno, Italy from Africa and Asia, where it caused spo- Funding: VALEREplus program.
    [Show full text]
  • Genus Suggests a Marine Origin Genome-Scale Phylogeny of The
    Genome-Scale Phylogeny of the Alphavirus Genus Suggests a Marine Origin N. L. Forrester, G. Palacios, R. B. Tesh, N. Savji, H. Guzman, M. Sherman, S. C. Weaver and W. I. Lipkin J. Virol. 2012, 86(5):2729. DOI: 10.1128/JVI.05591-11. Published Ahead of Print 21 December 2011. Downloaded from Updated information and services can be found at: http://jvi.asm.org/content/86/5/2729 http://jvi.asm.org/ These include: SUPPLEMENTAL MATERIAL http://jvi.asm.org/content/suppl/2012/02/01/86.5.2729.DC1.html REFERENCES This article cites 83 articles, 49 of which can be accessed free at: http://jvi.asm.org/content/86/5/2729#ref-list-1 on March 28, 2012 by COLUMBIA UNIVERSITY CONTENT ALERTS Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more» Information about commercial reprint orders: http://jvi.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/ Genome-Scale Phylogeny of the Alphavirus Genus Suggests a Marine Origin N. L. Forrester,a G. Palacios,b* R. B. Tesh,a N. Savji,b* H. Guzman,a M. Sherman,c S. C. Weaver,a and W. I. Lipkinb Institute for Human Infections and Immunity, Center for Biodefense and Emerging Infectious Diseases and Department of Pathology, University of Texas Medical Branch, Galveston, Texas, USAa; Center for Infection and Immunity, Mailman School of Public Health, Columbia University, New York, New York, USAb; and W. M. Keck Center for Virus Imaging, University of Texas Medical Branch, Galveston, Texas, USAc Downloaded from The genus Alphavirus comprises a diverse group of viruses, including some that cause severe disease.
    [Show full text]