DOCSLIB.ORG

Sequence Studies of Several Alphavirusgenomic Rnas

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Sequence Studies of Several Alphavirusgenomic Rnas Proc. Nati Acad. Sci. USA Vol. 79, pp. 5235-5239, September 1982 Biochemistry Sequence studies of several alphavirus genomic RNAs in the region containing the start of the subgenomic RNA (Sindbis virus/RNA sequence determination/sequence homology/nonstructural proteins/transcription initiation) JING-HSIUNG OU, CHARLES M. RICE, LYNN DALGARNO*, ELLEN G. STRAUSS, AND JAMES H. STRAUSSt Division of Biology, California Institute ofTechnology, Pasadena, California 91125 Communicated by Ray D. Owen, June 7, 1982 ABSTRACT The alphaviruses produce two mRNAs after in- RNA contains sequences identical to the 3'-terminal one-third fection: the genomic (49S) RNA which is translated into the non- of the genomic 49S RNA. The nucleotide sequences of the ge- structural (replicase) proteins and the subgenomic (26S) RNA nomic RNA preceding and including the beginning of the 26S which serves as the mRNA for the virion structural proteins. The RNA (called the "junction region") wouldbe expected to contain sequence of the region of the genomic RNA that contains the 5' signals important in the termination of translation of the non- end of the subgenomic RNA and the 5' flanking sequences in the structural polyprotein precursor as well as sequences important genomic RNA were determined for several alphaviruses. A highly for 26S RNA transcription. conserved sequence of 21 nucleotides was found which includes By comparing several different alphavirus sequences in a the first two nucleotides of the subgenomic RNA and the 19 nu- we have found that it is to cleotides preceding it. We propose that the complement of this given region of-interest, possible sequence in the minus strand is the recognition site used by the define potentially important features involved in alphavirus viral transcriptase for initiation of transcription of 26S RNA and replication by virtue of their conservation (or lack thereof) dur- that, in general, such short recognition sequences are commonly ing evolution (4-7). Here we report the sequences of four dif- used among the RNA viruses. The COOH-terminal sequence of ferent alphavirus junction regions. Comparison of these se- the nonstructural polyprotein precursor has been deduced for quences has revealed several common features and provides each virus. These protein sequences are highly homologous and insight intothe translation and transcription ofthe 26S and 49S are followed by multiple in-phase termination codons clustered in RNAs and the evolution of these viruses. the nontranslated region ofthe 26S RNA in each case. In contrast to the proposed transcriptase recognition site, the particular trip- MATERIALS AND METHODS lets used for a given conserved amino acid have diverged markedly during evolution of these viruses. The protein homology is suffi- Preparation of Vaccinia Guanylyltransferase. Guanylyl- cient, however, for deduction of the correct coding phase of the transferase was prepared from vaccinia virus (WR strain, isolate RNA and allows the alignment of the corresponding nucleic acid 11; a gift from W. K. Joklik) by a simplified version of the sequence data from different alphaviruses without knowledge of method of Paoletti et al. (8); 2 mg ofvaccinia virus in 640 ,ul of the sequence of the entire genomes. 1 mM Tris'HCl (pH 9.0) was used for each preparation of the enzyme. After disruption ofthe virus cores, the preparation was The Alphavirus genus of the Togaviridae family includes more briefly sonicated to shear viral DNA and then centrifuged at than 20 distinct viruses, many of which are important human 136,000 x gfor 60 min. The guanylyltransferase activity present or veterinary pathogens. These viruses are transmitted in na- in the supernatant was stable for 2 weeks at 4°C. ture via arthropod vectors and have the ability to replicate in 5'-End Labeling of Alphavirus 26S RNA. The 26S RNA of awide range ofvertebrates including both avian and mammalian Sindbis virus (HR strain), Semliki Forest virus, and Middelburg hosts. Because these viruses differ in geographical distribution, virus were prepared as described (4) and decapped by ,3-elim- host range, and the pathological result of infection but are ex- ination by the method of Rose and Lodish (9). Decapped RNA tremely similar in molecular architecture and in the pattern of was then end-labeled by using conditions modified from Ahl- events comprising viral replication, they provide an ideal sys- quistet al. (10). The 100-,ul reaction mixture contained 0.16mM tem for studyingthe evolutionary relationships amongmembers ATP, 1 mM MgCl2, 1 mM dithiothreitol, 2.5 p.M [a-32P]GTP of a structurally and functionally related virus group. Viruses (410 Ci/mmol; 1 Ci = 3.7 x 1010 becquerels; Amersham), 50 are known to mutate rapidly in general (1, 2), but the wide host mM Tris HCl (pH 7.8), and 15 ,ul ofguanylyltransferase extract. range ofthis group ofviruses and the alternation in nature be- After incubation at 37°C for 15 min, the reaction was terminated tween vertebrate and invertebrate hosts means that the al- by phenol/chloroform extraction followed by ethanol precipi- phaviruses are subject to different selective pressures compared tation as described (4). RNA pellets were resuspended in 50 ,ud to viruses with more limited host ranges. of 10 mM Tris'HCl, pH 8.2/10mM NaCl/1 mM EDTA/0.1% The alphavirus genome consists ofa single plus-strand RNA NaDodSO4 and purified from the unincorporated label by gel molecule about 13,000 nucleotides long with a sedimentation filtration on a Bio-Gel A-5m column. The excluded volume frac- coefficient of 49 S (reviewed in ref. 3). This genomic RNA tions containing theRNA were pooled and the RNA was ethanol serves as the mRNA for the nonstructural proteins which func- precipitated twice with carrier RNA and resuspended in water tion as the replicase/transcriptase activities required for rep- to a final concentration of about 2,000 cpm//.l. More than 1 lication ofthe viral RNA and for transcription ofa 26S subgeno- X 105 cpm was incorporated per 30 ,ug ofRNA, which was suf- mic mRNA encoding the virion structural proteins. The 26S ficient for several experiments. The publication costs ofthis article were defrayed in part by page charge * Present address: Biochemistry Dept., The Australian National Uni- payment. This article must therefore be hereby marked "advertise- versity, P.O. Box 4, Canberra, Australia 2600. ment" in accordance with 18 U. S. C. §1734 solely to indicate this fact. t To whom reprint requests should be addressed. 5235 5236 Biochemistry: Ou et at Proc. Natl. Acad. Sci. USA 79 (1982) Direct Enwymatic Sequence Determination of the RNA from the 5' End. Partial RNase digestion ofthe 5'-end labeled -, !I RNA was performed by the method recommended by P-L Bio- '. chemicals (method E998) and the products were separated on sequencing gels. A brief description of the reaction conditions is in the legend of Fig. 1. *W ...::" Single-Stranded cDNA Synthesis and Chemical Sequence b.-r;.e O ............. Determination. The 49S RNAs of Sindbis, Middelburg, and .A..' I Semliki Forest viruses were prepared as described (4). Ross mi .00. OW River virus (T48-strain.from R. Shope) 26S and 49S RNAs were Ae,. prepared from infected BHK cells. Single-stranded cDNA to these RNAs were synthesized with reverse transcriptase and calfthymus DNA or oligo(dT) primers as described (11). Prep- aration, isolation, and chemical sequence determination of 5'- end-labeled restriction fragments from these cDNAs have been described (11). RESULTS -p In recent studies, nearly the entire 26S RNA nucleotide se- quences for Sindbis virus (5) and Semliki Forest virus (12, 13) have been determined. However, the 5' termini of these RNAs, a necessary landmark for defining the junction region, could not be localized unambiguously from these data. Thus, 4, we began by directly determining the 5'-terminal 26S RNA se- -3- quences for several' alphaviruses. The 26S RNAs of'Sindbis, 0 Middelburg, and Semliki Forest viruses were decapped by /- S- elimination, end-labeled with guanylyltransferase, and then partially digested by using endonucleases with four different base specificities. The resulting products were separated' on acrylamide gels and the sequences were determined from the ladder produced. Fig. 1 presents part of the data to illustrate 0 the Each RNA was at least and the i. technique. analyzed twice, I 1, ".... --- ., .` --dommommi. sequences obtained are shown in lowercase letters in Fig. 2. In .:.. .i general this enzymatic method gives a clean signal for the pu- rines, but the pyrimidines are often ambiguous (Fig. 1). In order to determine the sequences preceding the start of FIG. 1. Direct 5'-end sequence analysis of the 26S RNAs of Sem- 26S RNA and to clarify the direct RNA sequence analysis data, liki Forest virus (Left) and Middelburg virus (Right). About 2,000 cpm chemical of cDNA made to of end-labeled RNA was enzymatically digested at 5600 for 3-10 min sequence analysis single-strand 49S (depending on the degree of digestion preferred). Alkaline hydrolysis RNA of Sindbis, Middelburg, Semliki Forest, and Ross River was at 9000 for 6 min. G reaction: 1 1.d of RNA was added to 3 1.d of viruses was used (Fig. 2, uppercase letters). The method in- buffer I containing 1 unit of RNase T1. A>G reaction: 1 ,ulofRNA was volved analysis of Hae III fragments of the cDNA (11) by the added to 3 1d ofbuffer II containing 1 unit of RNase U2. A+U reaction: methods of Maxam and Gilbert (14). For Sindbis and Middel- 1 p1of RNAwas added to 3 p1 ofbufferIcontaining 1 unit ofPhysarum burg viruses, restriction fragments produced by Hae III diges- M RNase. U+C reaction: 1 ul of RNA was added to 3 jil of buffer m tion ofcDNA to 49S' RNA were selected for containing 1 unit of Bacillus cereus RNase.
Load more

Recommended publications
  • Evolutionary Relationships and Systematics of the Alphaviruses ANN M
    JOURNAL OF VIROLOGY, Nov. 2001, p. 10118–10131 Vol. 75, No. 21 0022-538X/01/$04.00ϩ0 DOI: 10.1128/JVI.75.21.10118–10131.2001 Copyright © 2001, American Society for Microbiology. All Rights Reserved. Evolutionary Relationships and Systematics of the Alphaviruses ANN M. POWERS,1,2† AARON C. BRAULT,1† YUKIO SHIRAKO,3‡ ELLEN G. STRAUSS,3 1 3 1 WENLI KANG, JAMES H. STRAUSS, AND SCOTT C. WEAVER * Department of Pathology and Center for Tropical Diseases, University of Texas Medical Branch, Galveston, Texas 77555-06091; Division of Vector-Borne Infectious Diseases, Centers for Disease Control and Prevention, Fort Collins, Colorado2; and Division of Biology, California Institute of Technology, Pasadena, California 911253 Received 1 May 2001/Accepted 8 August 2001 Partial E1 envelope glycoprotein gene sequences and complete structural polyprotein sequences were used to compare divergence and construct phylogenetic trees for the genus Alphavirus. Tree topologies indicated that the mosquito-borne alphaviruses could have arisen in either the Old or the New World, with at least two transoceanic introductions to account for their current distribution. The time frame for alphavirus diversifi- cation could not be estimated because maximum-likelihood analyses indicated that the nucleotide substitution rate varies considerably across sites within the genome. While most trees showed evolutionary relationships consistent with current antigenic complexes and species, several changes to the current classification are proposed. The recently identified fish alphaviruses salmon pancreas disease virus and sleeping disease virus appear to be variants or subtypes of a new alphavirus species. Southern elephant seal virus is also a new alphavirus distantly related to all of the others analyzed.
    [Show full text]
  • Temperature-Sensitive Mutants of Sindbis Virus: Complementation Group F Mutants Have Lesions in Nsp4 YOUNG S
    JOURNAL OF VIROLOGY, Mar. 1989, p. 1194-1202 Vol. 63, No. 3 0022-538X/89/031194-09$02.00/0 Copyright © 1989, American Society for Microbiology Mapping of RNA- Temperature-Sensitive Mutants of Sindbis Virus: Complementation Group F Mutants Have Lesions in nsP4 YOUNG S. HAHN,' ARASH GRAKOUI,2 CHARLES M. RICE,2 ELLEN G. STRAUSS,' AND JAMES H. STRAUSS'* Division ofBiology, California Institute of Technology, Pasadena, California 91125,1 and Department of Microbiology and Immunology, Washington University, St. Louis, Missouri 631102 Received 24 October 1988/Accepted 28 November 1988 Temperature-sensitive (ts) mutants of Sindbis virus belonging to complementation group F, ts6, tsllO, and ts118, are defective in RNA synthesis at the nonpermissive temperature. cDNA clones of these group F mutants, as well as of ts+ revertants, have been constructed. To assign the ts phenotype to a specific region in the viral genome, restriction fragments from the mutant cDNA clones were used to replace the corresponding regions of the full-length clone Totol101 of Sindbis virus. These hybrid plasmids were transcribed in vitro by SP6 RNA polymerase to produce infectious transcripts, and the virus recovered was tested for temperature sensitivity. After the ts lesion of each mutant was mapped to a specific region of 400 to 800 nucleotides by this approach, this region of the cDNA clones of both the ts mutant and ts+ revertants was sequenced in order to determine the precise nucleotide change and amino acid substitution responsible for each mutation. Rescued mutants, which have a uniform background except for one or two defined changes, were examined for viral RNA synthesis and complementation to show that the phenotypes observed were the result of the mutations mapped.
    [Show full text]
  • Molecular Epidemiology and Characterisation of Wesselsbron Virus and Co-Circulating Alphaviruses in Sentinel Animals in South Africa
    Molecular Epidemiology and Characterisation of Wesselsbron Virus and Co-circulating Alphaviruses in Sentinel Animals in South Africa 3 4 Human S.1, Gerdes T , Stroebel J. C. , and Venter M1, 2* 1 Department of Medical Virology, Faculty of Health Sciences, University of Pretoria, South Africa; 2 National Health Laboratory Services, Tshwane Academic Division; 3 Onderstepoort Veterinary Institute, South Africa; 4 Western Cape Provincial Veterinary Laboratory * Contact person: Dr M Venter. Senior lecturer, Department of Medical Virology, Faculty of Health Sciences, University of Pretoria/NHLS Tshwane Academic Division, P.O Box 2034, Pretoria, 0001, South Africa. Tel: +27 12 319 2660, Fax: +27 12 319 5550, e-mail: [email protected], [email protected] ABSTRACT Flavi and alphaviruses are a significant cause of morbidity and mortality in both humans and animals worldwide. In order to determine the contribution of flavi and alphaviruses to unexplained neurological hepatic or fever cases in horses and other animals in South Africa, cases resembling these symptoms were screened for Flaviviruses (other than West Nile virus) and Alphaviruses. The results show that both Wesselsbron and alphaviruses (Sindbis-like and Middelburg virus) can contribute to neurological disease and fevers in horses. KEYWORDS Wesselsbron virus disease, Sindbis-like virus, Middelburg virus INTRODUCTION In South Africa (SA) the most important mosquito borne viruses are West Nile Virus (WNV) and Wesselsbron virus (Flaviviridae) and the Sindbis and Middelburg viruses (Togaviridae). These viruses are transmitted by Culex spp. (WNV and Sindbis virus) and Aedes spp. (Wesselsbron and Middelburg virus) mosquitoes. Wesselsbron (WSLB) virus was first discovered in 1955 in the Wesselsbron district of the Free State province in SA where it was isolated from an eight-day-old lamb (Weiss et al., 1956).
    [Show full text]
  • Study of Chikungunya Virus Entry and Host Response to Infection Marie Cresson
    Study of chikungunya virus entry and host response to infection Marie Cresson To cite this version: Marie Cresson. Study of chikungunya virus entry and host response to infection. Virology. Uni- versité de Lyon; Institut Pasteur of Shanghai. Chinese Academy of Sciences, 2019. English. NNT : 2019LYSE1050. tel-03270900 HAL Id: tel-03270900 https://tel.archives-ouvertes.fr/tel-03270900 Submitted on 25 Jun 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. N°d’ordre NNT : 2019LYSE1050 THESE de DOCTORAT DE L’UNIVERSITE DE LYON opérée au sein de l’Université Claude Bernard Lyon 1 Ecole Doctorale N° 341 – E2M2 Evolution, Ecosystèmes, Microbiologie, Modélisation Spécialité de doctorat : Biologie Discipline : Virologie Soutenue publiquement le 15/04/2019, par : Marie Cresson Study of chikungunya virus entry and host response to infection Devant le jury composé de : Choumet Valérie - Chargée de recherche - Institut Pasteur Paris Rapporteure Meng Guangxun - Professeur - Institut Pasteur Shanghai Rapporteur Lozach Pierre-Yves - Chargé de recherche - CHU d'Heidelberg Rapporteur Kretz Carole - Professeure - Université Claude Bernard Lyon 1 Examinatrice Roques Pierre - Directeur de recherche - CEA Fontenay-aux-Roses Examinateur Maisse-Paradisi Carine - Chargée de recherche - INRA Directrice de thèse Lavillette Dimitri - Professeur - Institut Pasteur Shanghai Co-directeur de thèse 2 UNIVERSITE CLAUDE BERNARD - LYON 1 Président de l’Université M.
    [Show full text]
  • Joseph Icenogle
    Progress Toward Rubella Elimination and CRS Prevention in Europe 8-10 February 2010 Rome MH Chen1, E Abernathy1, Q Zheng,1 E Kirkness2, BackgroundS Sumsita 2, W Bellini, Information J Icenogle1 1:National Center for Immunization and Respiratory Diseases, Centers for Disease Control and Prevention, Atlanta, GA 30333,Rubella USA; Virus 2: J. Craig Venter Institute, 9704 Medical Center Drive, Rockville, MD 20850, USA Joseph P. Icenogle Rubella Laboratory Team Lead MMRH Laboratory Branch National Center for Immunization & Respiratory Diseases MMRHLB Outline 1. A brief history of rubella virus, before the development of vaccines 2. Structure of the virus, partly by analogy to related viruses 3. Description of the genome of rubella virus 4. Variability in the genome of circulating rubella viruses 5. Some properties of specific viral proteins 6. The life cycle of rubella virus in tissue culture; details matter 7. Emphasis on a couple of important virus-host cell interactions Brief, Selected History of Rubella and Congenital Rubella Syndrome, Before Vaccines were Developed. 18th Century----Description of disease by German authors 1881--------------Recognition of rubella as a disease independent from measles and scarlet fever by an International Congress of Medicine in London 1881 to 1941---Little or no recognition of rubella as anything other than a mild childhood rash illness. Significant influence of prevalent opinion that birth defects were all of genetic origin. 1941-------------- N. McAlister Gregg. Congenital Cataract Following German Measles in the Mother. Trans Ophthalmol Soc Aust 1941;3:35-46 1941-1950s----Lack of Clarity on the importance of Congenital Rubella Syndrome 1957-1960------Multiple studies are published establishing Congenital Rubella Syndrome as a prevalent and serious disease.
    [Show full text]
  • Medical Aspects of Biological Warfare
    Alphavirus Encephalitides Chapter 20 ALPHAVIRUS ENCEPHALITIDES SHELLEY P. HONNOLD, DVM, PhD*; ERIC C. MOSSEL, PhD†; LESLEY C. DUPUY, PhD‡; ELAINE M. MORAZZANI, PhD§; SHANNON S. MARTIN, PhD¥; MARY KATE HART, PhD¶; GEORGE V. LUDWIG, PhD**; MICHAEL D. PARKER, PhD††; JONATHAN F. SMITH, PhD‡‡; DOUGLAS S. REED, PhD§§; and PAMELA J. GLASS, PhD¥¥ INTRODUCTION HISTORY AND SIGNIFICANCE ANTIGENICITY AND EPIDEMIOLOGY Antigenic and Genetic Relationships Epidemiology and Ecology STRUCTURE AND REPLICATION OF ALPHAVIRUSES Virion Structure PATHOGENESIS CLINICAL DISEASE AND DIAGNOSIS Venezuelan Equine Encephalitis Eastern Equine Encephalitis Western Equine Encephalitis Differential Diagnosis of Alphavirus Encephalitis Medical Management and Prevention IMMUNOPROPHYLAXIS Relevant Immune Effector Mechanisms Passive Immunization Active Immunization THERAPEUTICS SUMMARY 479 244-949 DLA DS.indb 479 6/4/18 11:58 AM Medical Aspects of Biological Warfare *Lieutenant Colonel, Veterinary Corps, US Army; Director, Research Support and Chief, Pathology Division, US Army Medical Research Institute of Infectious Diseases, 1425 Porter Street, Fort Detrick, Maryland 21702; formerly, Biodefense Research Pathologist, Pathology Division, US Army Medical Research Institute of Infectious Diseases, 1425 Porter Street, Fort Detrick, Maryland †Major, Medical Service Corps, US Army Reserve; Microbiologist, Division of Virology, US Army Medical Research Institute of Infectious Diseases, 1425 Porter Street, Fort Detrick, Maryland 21702; formerly, Science and Technology Advisor, Detachment
    [Show full text]
  • Sindbis and Middelburg Old World Alphaviruses Associated with Neurologic Disease in Horses, South Africa
    Sindbis and Middelburg Old World Alphaviruses Associated with Neurologic Disease in Horses, South Africa Stephanie van Niekerk, Stacey Human, and acute neurologic infections reported to our surveil- June Williams, Erna van Wilpe, lance program by veterinarians across South Africa dur- Marthi Pretorius, Robert Swanepoel, ing January 2008–December 2013. Of reported cases, 346 Marietjie Venter horses had neurologic signs; 277 had mainly febrile illness and other miscellaneous signs, including colic and sudden Old World alphaviruses were identified in 52 of 623 horses death (online Technical Appendix Figure 1, panel A, http:// with febrile or neurologic disease in South Africa. Five of wwwnc.cdc.gov/EID/article/21/12/15-0132-Techapp.pdf). 8 Sindbis virus infections were mild; 2 of 3 fatal cases in- Formalin-fixed tissue samples from horses that died were volved co-infections. Of 44 Middelburg virus infections, 28 caused neurologic disease; 12 were fatal. Middelburg virus submitted for histopathology. Horses ranged from <1 to 20 likely has zoonotic potential. years of age and included thoroughbred, Arabian, warm- blood, and part-bred horses; most were bred locally. A generic nested alphavirus nonstructural polyprotein lphaviruses (Togaviridae) include zoonotic, vector- (nsP) region 4 gene reverse transcription PCR (10) was Aborne viruses with epidemic potential (1). Phyloge- used to screen total nucleic acids. TaqMan probes (Roche, netic analysis defined 2 monophyletic groups: 1) the New Indianapolis, IN, USA) were developed for rapid differen- World group, consisting of Sindbis virus (SINV), Venezu- tiation of MIDV and SINV by real-time PCR (online Tech- elan equine encephalitis virus, and Eastern equine encepha- nical Appendix).
    [Show full text]
  • Sindbis and Middelburg Old World Alphaviruses Associated with Neurologic Disease in Horses, South Africa
    Article DOI: http://dx.doi.org/10.3201/eid2112.150132 Sindbis and Middelburg Old World Alphaviruses Associated with Neurologic Disease in Horses, South Africa Technical Appendix Detailed Methods and Results 1. Generic Real-Time Reverse Transcription PCR for Diagnosis of Middelburg and Sindbis Virus Infections Viral RNA was extracted from plasma or serum samples derived from EDTA-clotted blood and from cerebrospinal fluid samples with the High Pure Viral Total Nucleic Acid Extraction Kit (Roche, Indianapolis, IN, USA). Nervous tissue or visceral organ samples were homogenized by using a mortar and pestle, and RNA was extracted by using the RNeasy Plus Mini Kit (QIAGEN, Valencia, CA, USA). The first round and nested PCR primers that were based on a highly conserved region of the nsP4 gene were prepared as described previously (1). First-round PCR was performed by using the Titan one tube reverse transcription (RT)-PCR system (Roche). Each reaction contained 10 μL of RNA, 10 μL 10× reaction buffer, 1 μL of dNTP mix (10 mmol/L), 2 μL of 10 pmol of each primer (Alpha1+; Alpha1–), 2.5 μL Dithiothreitol solution (100 mmol/L), 0.25 μL RNase inhibitor (40 U/μL), and 1 μL of the Titan enzyme mix. The final volume was made up to 50 μL with distilled water. Cycling conditions were 50°C for 30 min, 94°C for 2 min, (94°C for 10 s, 52°C for 30 s, 68°C for 1 min) × 35 cycles, and 68°C for 7 min. By using Primer 3 (2), two probes were designed for rapid differentiation of Sindbis virus (SINV, a New World virus) and Middelburg virus (MIDV, an Old World virus) as follows: SINV: 5 ATGACGAGTATTGGGAGGAGTTTG 3-FAM; MIDV: 5 GCTTTAAGAAGTACGCATGCAACA 3 –VIC.
    [Show full text]
  • Short Review: Assessing the Zoonotic Potential of Arboviruses of African Origin
    Short Review: Assessing the zoonotic potential of arboviruses of African origin Marietjie Venter (PhD)* *Corresponding author: [email protected] Zoonotic Arbo- and Respiratory virus program, Department Medical Virology, Faculty of Health, University of Pretoria, South Africa. +27832930884 Word count: Text 2096 Abstract: 121 Abstract: Several African arboviruses have emerged over the past decade in new regions where they caused major outbreaks in humans and/or animals including West Nile virus, Chikungunya virus and Zika virus. This raise questions regarding the importance of less known zoonotic arboviruses in local epidemics in Africa and their potential to emerge internationally. Syndromic surveillance in animals may serve as an early warning system to detect zoonotic arbovirus outbreaks. Rift Valley fever and Wesselsbronvirus are for example associated with abortion storms in livestock while West Nile-, Shuni- and Middelburg virus causes neurological disease outbreaks in horses and other animals. Death in birds may signal Bagaza- and Usutu virus outbreaks. This short review summarize data on less known arboviruses with zoonotic potential in Africa. Introduction: African arboviruses in the families Flaviviridae (West Nile Virus (WNV); Zika virus; Yellow Fever (YFV); Usutu virus); Togaviridae (Chikungunya virus) and bunyaviridae (Rift Valley fever (RVF) and Crimean Congo Haemorrhagic Fever (CCHF) were some of the major emerging and re-emerging zoonotic pathogens of the last decade [1,2].These viruses were largely unnoticed as diseases in Africa before they emerged internationally. Arboviruses often circulate between mosquito vectors and vertebrate hosts and spill over to sensitive species during climatic events where they may cause severe disease. One Health surveillance for syndromes associated with arboviruses in animals; screening of mosquito vectors and surveillance for human disease may help to identify less known zoonotic arboviruses and determine their potential to emerge internationally (Figure 1).
    [Show full text]
  • Discovery of Mwinilunga Alphavirus : a Novel Alphavirus in Culex Mosquitoes in Zambia
    Title Discovery of Mwinilunga alphavirus : A novel alphavirus in Culex mosquitoes in Zambia Torii, Shiho; Orba, Yasuko; Hang'ombe, Bernard M.; Mweene, Aaron S.; Wada, Yuji; Anindita, Paulina D.; Author(s) Phongphaew, Wallaya; Qiu, Yongjin; Kajihara, Masahiro; Mori-Kajihara, Akina; Eto, Yoshiki; Harima, Hayato; Sasaki, Michihito; Carr, Michael; Hall, William W.; Eshita, Yuki; Abe, Takashi; Sawa, Hirofumi Virus Research, 250, 31-36 Citation https://doi.org/10.1016/j.virusres.2018.04.005 Issue Date 2018-05-02 Doc URL http://hdl.handle.net/2115/73890 © 2018. This manuscript version is made available under the CC-BY-NC-ND 4.0 license Rights http://creativecommons.org/licenses/by-nc-nd/4.0/ Rights(URL) http://creativecommons.org/licenses/by-nc-nd/4.0/ Type article (author version) File Information Torii_et_al_HUSCUP.pdf Instructions for use Hokkaido University Collection of Scholarly and Academic Papers : HUSCAP Discovery of Mwinilunga alphavirus: a novel alphavirus in Culex mosquitoes in Zambia Shiho Torii1, Yasuko Orba1*, Bernard M. Hang’ombe2,10, Aaron S. Mweene3,9,10, Yuji Wada1, Paulina D. Anindita1, Wallaya Phongphaew1, Yongjin Qiu4, Masahiro Kajihara5, Akina Mori-Kajihara5, Yoshiki Eto5, Hayato Harima4, Michihito Sasaki1, Michael Carr6,7, William W. Hall7,8,9,10, Yuki Eshita4, Takashi Abe11, Hirofumi Sawa1,7,9,10* 1Division of Molecular Pathobiology, Research Center for Zoonosis Control, Hokkaido University, Sapporo, Japan 2Department of Para-clinical Studies, School of Veterinary Medicine, University of Zambia, Lusaka, Zambia 3Department
    [Show full text]
  • Sindbis Virus and Pogosta Disease in Finland
    Department of Virology Haartman Institute, Faculty of Medicine University of Helsinki SINDBIS VIRUS AND POGOSTA DISEASE IN FINLAND SATU KURKELA ACADEMIC DISSERTATION Pro Doctoratu To be presented with due permission of the Faculty of Medicine at the University of Helsinki for public examination and debate on Friday, November 23rd, 2007, at 12 noon in the Lecture Hall 3 at Biomedicum Helsinki, Haartmaninkatu 8, Helsinki HELSINKI 2007 SUPERVISORS____________________________________________________ OLLI VAPALAHTI, MD, PHD Departments of Virology and Basic Veterinary Sciences Professor of Zoonotic Virology Faculties of Medicine and Veterinary Medicine University of Helsinki Helsinki, Finland ANTTI VAHERI, MD, PHD Department of Virology Professor of Virology Faculty of Medicine University of Helsinki Helsinki, Finland REVIEWERS______________________________________________________ TYTTI VUORINEN, MD, PHD Department of Virology Docent in Virology Faculty of Medicine University of Turku Turku, Finland JARMO OKSI, MD, PHD Department of Medicine Docent in Internal Medicine Turku University Central Hospital Turku, Finland OFFICIAL OPPONENT____________________________________________ ANTOINE GESSAIN, MD, PhD Oncogenic Virus Epidemiology Head of Laboratory, Unit Chief and Pathophysiology Unit Department of Virology Institut Pasteur Paris, France Back cover art courtesy of Sini Virtanen, specially drawn for this publication ISBN 978-952-92-2880-5 (paperback) ISBN 978-952-10-4262-1 (PDF, available at http://ethesis.helsinki.fi) Yliopistopaino – Helsinki University Printing House Helsinki 2007 Your theory is crazy, but it's not crazy enough to be true - Niels Bohr (1885-1962) – CONTENTS – CONTENTS LIST OF ORIGINAL PUBLICATIONS 6 ABBREVIATIONS 7 ABSTRACT 8 TIIVISTELMÄ (SUMMARY IN FINNISH) 10 REVIEW OF THE LITERATURE 12 1. Arboviruses as human pathogens 12 2. Introduction to alphaviruses 13 Classification, genomic structure, and replication 13 Phylogenetic relationships and geographic distribution 16 Reservoirs and vectors 20 Alphaviruses as human pathogens 21 3.
    [Show full text]
  • Non-Commercial Use Only Acidification Causes the E1 Protein to Under- Go a Conformational Change, Exposing the Fusion Loop
    Translational Medicine Reports 2019; volume 3:8156 Chikungunya virus: Update ronments. The origin of the term chikun- on molecular biology, gunya comes from the African word kun- Correspondence: Mariateresa Vitiello, gunyala, literarily meaning to be contorted, Department of Clinical Pathology, Virology epidemiology and current and it refers to the typical patients’ posture Unit, San Giovanni di Dio e Ruggi d’Aragona strategies resulting from severe muscular and joint Hospital, Salerno, Italy. E-mail: [email protected] pain.3,4 CHIKV was first isolated during an Debora Stelitano,1 Annalisa Chianese,1 epidemic in Tanzania, in 1952-1953. Key words: Chikungunya virus; Life cycle; Roberta Astorri,1 Enrica Serretiello,1 However, it has been suggested that Epidemiology; Vector; Clinical management. 1 1 CHIKV outbreaks had already happened in Carla Zannella, Veronica Folliero, Africa, Asia and America before this date Contributions: DS, data collecting and manu- Marilena Galdiero,1 Gianluigi Franci,1 and were generally mistaken for dengue script writing; AC, RA, ES, CZ, VF, MG, GF, Valeria Crudele,1 Mariateresa Vitiello2 epidemics.5,6 In fact, as these viruses can VC, data collecting, manuscript reviewing and 1 reference search; MTV, data collecting, fig- Department of Experimental Medicine, cause similar clinical syndromes, retrospec- ures preparation and manuscript writing. University of Campania Luigi Vanvitelli, tive studies suggested that they may have 2 Naples; Department of Clinical been confused in the past, especially in the Conflict of interest: the authors declare no Pathology, Virology Unit, San Giovanni regions in which they are both endemic. potential conflict of interest. di Dio e Ruggi d’Aragona Hospital, Since its discovery, the virus has spread, Salerno, Italy from Africa and Asia, where it caused spo- Funding: VALEREplus program.
    [Show full text]