Tissue-Specific Conditional CCM2 Knockout Mice Establish The

RESEARCH ARTICLE Disease Models & Mechanisms 2, 168-177 (2009) doi:10.1242/dmm.001263

Tissue-specific conditional CCM2 knockout mice establish the essential role of endothelial CCM2 in angiogenesis: implications for human cerebral cavernous malformations

Gwénola Boulday1,2, Anne Blécon1,2, Nathalie Petit1,2, Fabrice Chareyre3, Luis A. Garcia1, Michiko Niwa-Kawakita3, Marco Giovannini3 and Elisabeth Tournier-Lasserve1,2,4,*

SUMMARY Cerebral cavernous malformations (CCM) are vascular malformations of the brain that lead to cerebral hemorrhages. In 20% of CCM patients, this results from an autosomal dominant condition caused by loss-of-function mutations in one of the three CCM genes. High expression levels of the CCM genes in the neuroepithelium indicate that CCM lesions might be caused by a loss of function of these genes in neural cells rather than in vascular cells. However, their in vivo function, particularly during cerebral angiogenesis, is totally unknown. We developed mice with constitutive and tissue-specific CCM2 deletions to investigate CCM2 function in vivo. Constitutive deletion of CCM2 leads to early embryonic death. Deletion of CCM2 from neuroglial precursor cells does not lead to cerebrovascular defects, whereas CCM2 is required in endothelial cells for proper vascular development. Deletion of CCM2 from endothelial cells severely affects angiogenesis, leading to morphogenic defects in the major arterial and

DMM venous blood vessels and in the heart, and results in embryonic lethality at mid-gestation. These findings establish the essential role of endothelial CCM2 for proper vascular development and strongly suggest that the endothelial cell is the primary target in the cascade of events leading from CCM2 mutations to CCM cerebrovascular lesions.

INTRODUCTION al., 1998; Labauge et al., 2007). Familial CCM (FCCM) cases are Cerebral cavernous malformations (CCM) are slow-flow vascular characterized by the presence of multiple lesions upon cerebral anomalies characterized by densely packed vascular sinusoids magnetic resonance imaging (MRI) and the major risk endured by embedded in a collagen matrix without intervening neural tissue FCCM patients is the recurrence of cerebral hemorrhages. (Russell and Rubinstein, 1989). These clusters of vascular sinusoids Our group and others have identified three CCM genes namely (also called caverns) are lined by a thin endothelium and by rare CCM1/KRIT1, CCM2/MGC4607 (also called malcavernin) and subendothelial cells (Clatterbuck et al., 2001). An absence of tight CCM3/PDCD10 (Craig et al., 1998; Laberge Le Couteulx et al., 1999; junctions between endothelial cells (ECs) has been reported in Liquori et al., 2003; Denier et al., 2004; Bergametti et al., 2005). CCM lesions upon ultrastuctural examination. Most of these The mutations detected in CCM patients are loss-of-function Disease Models & Mechanisms lesions are located within the central nervous system (CNS) but mutations. It has been suggested that a Knudson two-hit they may also affect the retina (for a review, see Labauge et al., mechanism is likely to be involved in CCM pathophysiology, as 2007). Clinical onset is generally around 20-30 years of age but reported previously in some other vascular conditions (Brouillard symptoms can start in early infancy and in old age. The most et al., 2002). This is based on the observed autosomal dominant common manifestations include headaches, seizures and focal pattern of CCM inheritance and the presence of multiple lesions neurological deficits caused by cerebral hemorrhages. in FCCM, contrasting with the detection of a single lesion in From large series studies, the prevalence of CCM in the general nonhereditary cavernous angiomas. In addition, recent data population has been estimated to be close to 0.1-0.5% and CCM showing biallelic mutations in CCM genes (germline and somatic) bleeding is involved in more than 10% of young patients who show have been reported (Gault et al., 2005; Akers et al., 2008; intracerebral hemorrhage (Otten et al., 1989; Moussa et al., 2006). Pagenstecher et al., 2008). Both sporadic and familial autosomal dominant forms of the The CCM1 gene encodes KRIT1, a 736-amino acid protein disorder have been identified (Rigamonti et al., 1988; Labauge et containing three ankyrin domains and a FERM (protein 4.1, ezrin, radixin, moesin) domain. CCM2/MGC4607 encodes a protein containing a phosphotyrosine-binding domain (PTB) and 1INSERM, UMR-S 740, Paris, France CCM3/PDCD10 encodes a protein, without a known conserved 2Université Paris 7-Denis Diderot, Faculté de Médecine, Site Lariboisière, Paris, functional domain, which was shown recently to interact with STK F-75010, France serine threonine kinases (Ma et al., 2007; Voss et al., 2007). Ccm 3 INSERM UMR-S 674, Paris, France genes have highly similar patterns of expression in both the embryo 4AP-HP, Groupe hospitalier Lariboisiere-Fernand-Widal, Laboratoire de Génétique, Paris, F-75010, France and adult mouse. Within the CNS, Ccm transcripts are detected *Author for correspondence (e-mail: [email protected]) mostly in neuronal cell layers (Petit et al., 2006; Plummer et al.,

168 dmm.biologists.org CCM2 and angiogenesis RESEARCH ARTICLE

2006). By embryonic day (E)14.5, moderate labeling of all three transcripts can be observed in the large arterial and venous blood vessels and in the heart. Ccm1 mRNA is not detected in small cerebral vessels at any stage of development. Ccm2 and Ccm3 mRNAs are weakly, and only transiently, detected within meningeal and parenchymal cortical vessels at P8. Regarding CCM protein expression in tissue sections, controversial results have been published that are most likely explained by a lack of antibody specificity. Inter-relations between neural and vascular cells are crucial for proper cerebrovascular development and, therefore, the mostly neuronal expression pattern of CCM genes raises the question of which cell type, neuronal or vascular, underlies the vascular lesions observed in CCM patients (Proctor et al., 2005). Recent in vitro data suggest strongly that CCM proteins are scaffold proteins that exist as a complex in cells (Zhang et al., 2001; Zawistowski et al., 2002; Zawistowski et al., 2005; Hilder et al., 2007). CCM1 has been shown to interact with (1) the PTB domain of CCM2 protein, (2) RAP1A, a small Ras-like GTPase Fig. 1. Targeted disruption of the mouse Ccm2 gene. (A) Schematic drawing (Serebriiski et al., 1997; Glading et al., 2007), and (3) ICAP1, a of the Ccm2 gene targeting strategy. The Ccm2 locus was targeted by protein that binds to the cytoplasmic tail of integrin β1 (Zhang homologous recombination using a construct containing three loxP sites et al., 2001; Zawistowski et al., 2002). The yeast ortholog of CCM2, (open triangles) flanking a hygromycin resistance cassette and Ccm2 exons 3 OSM (osmosensing scaffold for MEKK3), has been identified as and 4 (black boxes). The relevant restriction sites (X and H), primers for genotyping (F, forward; R, reverse) and probes for Southern blotting (P1 and

DMM a scaffold protein that interacts with kinases involved in the p38 mitogen-activated kinase pathway in response to osmolarity P2) are indicated. (B,C) Validation of Ccm2 targeting by Southern blot analysis. 10 μg of genomic DNA from cells, mouse tissues or embryos (as indicated) was stress (Uhlik et al., 2003). It also interacts with CCM1 and CCM3, digested with XbaI and hybridized with the 5Ј external probe, P1. as well as with MEKK3, RAC1, RIN2 (a protein shown to regulate (B) Identification of the ES clone and mice (M1 and M2) containing the E-cadherin internalization), actin and tubulins. In addition, CCM2 targeted Ccm2 allele (indicated as the trilox allele). The 5.3 kb and the 8.3 kb and CCM3 bind to phosphatidyl insositol phospholipids (Hilder DNA fragments represent the wild-type Ccm2 and targeted alleles, et al., 2007). Altogether, these data suggest that the three CCM respectively. (C) Southern blot analysis for Ccm2 in either wild-type animals +/– proteins are members of a larger signaling complex that is (WT), or wild-type embryos (+/+), heterozygous Ccm2 embryos (+/–) or involved in cell-cell junction homeostasis and cytoskeleton homozygous deleted embryos (null). The 5.3 kb and the 8.2 kb DNA fragments represent the wild-type Ccm2 and the deleted alleles, respectively. (D) Western remodeling. blot analysis of CCM2 protein expression using 15 μg of total protein lysates These biochemical data have provided useful insights into CCM from E9.5 embryos (Ccm2+/+ and Ccm2-null embryos). Protein lysate from HEK protein function. However, their in vivo function, particularly cells transfected with the Ccm2 cDNA was used as a positive control (200 ng). during cerebral angiogenesis, remains obscure. In the zebrafish Immunoblotting for α-tubulin on the same blot was performed as a control for embryo, Ccm1 and Ccm2 are expressed mostly in the brain, the the amount of protein loaded. F, forward primer; H, HindIII; Hyg, hygromycine; notochord and the posterior cardinal vein. Their inactivation leads P, probe; R, reverse primer; X, XbaI. to an early death with massive dilation of both the heart and large Disease Models & Mechanisms venous vessels (Mably et al., 2006; Hogan et al., 2008). Constitutive deletion of CCM1 in the mouse leads to abnormal arterial premature stop codon, leading to partial mRNA decay (Denier et morphogenesis including both enlargement and narrowing of large al., 2004) (supplementary material Fig. S1). Ccm2 gene targeting trunk arteries and ultimately to mid-gestation death (Whitehead was confirmed by Southern blot on ES cells and mice, and by et al., 2004). northern blot and western blot analysis (Fig. 1B-D; supplementary Here, we used constitutive and tissue-specific inactivation of material Fig. S2). CCM2 to investigate its role in mouse vascular development. We Heterozygous Ccm2+/– and Ccm2+/flox mice and homozygous showed that (1) neuroepithelial expression of CCM2 is dispensable floxed (Ccm2flox/flox) mice were viable, fertile and indistinguishable for proper vascular development and (2) endothelium-specific from control littermates. A similar level of CCM2 protein was inactivation of CCM2 results in embryonic lethality at mid- detected in wild-type (WT) and floxed mice (data not shown). gestation, abnormal angiogenesis and massive heart and blood vessel defects. Ubiquitous CCM2 ablation is lethal in embryonic mice When Ccm2+/– mice were interbred, we did not obtain any Ccm2- RESULTS null pups (from a total of 96 offspring) (Table 1), strongly suggesting Targeting Ccm2 in mice in utero lethality. During embryogenesis, all of the different We targeted the Ccm2 locus in embryonic stem (ES) cells by using genotypes were recovered at a Mendelian ratio (Table 1). The a linearized construct containing exons 3 and 4 of the Ccm2 gene, absence of the CCM2 protein in null embryos was confirmed by which encode most of the PTB (Fig. 1A and Methods). Mutations western blots (Fig. 1D). No phenotypic difference between embryos leading to transcripts with these two exons deleted have been was detected upon dissection at E8.5 (supplementary material Fig. detected in several CCM patients and result in a frameshift and a S3). At E9.5, mutant mice were recognized because their very pale

Disease Models & Mechanisms 169 RESEARCH ARTICLE CCM2 and angiogenesis

Table 1. Genotype of the progeny from Ccm2+/– intercrosses Cerebrovascular development does not require expression of Ccm2 genotype* CCM2 in neuroepithelial precursor cells Age Total +/+ +/– Null To assess whether CCM2 expression in neuroepithelial cells is E8.5 71 13 (19) 40 (56) 18 (25) required for proper vascular development in the mouse brain, we E9.5 60 18 (30) 28 (47) 14 (23) specifically ablated CCM2 in these cells by using a nestin-Cre line that expresses Cre under the control of the neural enhancer E10.5 33 8 (24) 16 (49) 9† (27) element of the nestin promoter (Tronche et al., 1999). This P21 96 36 (37) 60 (63) 0 transgene drives Cre-mediated recombination in neural precursor *Numbers are given with percentage in brackets; †all 9 null embryos were already in resorption. cells giving rise to both neurons and glia, but does not drive recombination in ECs (Graus-Porta et al., 2001). Briefly, we sequentially crossed the transgenic nestin-Cre line with Ccm2+/– yolk sacs (YSs) showed a wrinkled appearance (supplementary and Ccm2 floxed mice to generate NPKO mice (nestin-Cre; material Fig. S3). Homozygous null embryos showed a Ccm2–/flox). We obtained NPKO mice with the expected Mendelian developmental delay with failure to complete turning and signs of ratio at weaning (27% from a total of 176 offspring). NPKO mice resorption. Most Ccm2-null embryos had a massive pericardial were fertile and indistinguishable from their control littermates at edema at E9.5 and their hearts, which were sometimes still beating, up to 1 year of age. They did not have any significant weight were showing a retarded S-shape. No Ccm2-null embryos were difference or detectable neurological defect. found alive at E10.5; all of them were already in resorption The neural-specific recombination of the floxed allele and the (supplementary material Fig. S3). Altogether, our results show that absence of the CCM2 protein within the brain of NPKO mice were constitutive deletion of Ccm2 leads to cardiovascular failure and confirmed at P8 (Fig. 2A,B). In addition, X-Gal staining performed mid-gestation embryonic death. on E12.5 embryos, obtained from crosses between nestin-Cre; DMM Disease Models & Mechanisms

Fig. 2. Conditional deletion of CCM2 from neuroglial precursors does not lead to major cerebrovascular defects. (A-C) Analysis of the specific inactivation of CCM2 in the neuroglial compartment. (A) Southern blot analysis using 12 μg of genomic DNA extracted from tissues at P8. DNA was digested by HindIII and hybridized with the external radiolabeled 3Ј probe P2. The floxed allele (8.2 kb) in NPKO was recombined specifically within the brain of NPKO mice. A Ccm2–/flox brain from a littermate was used as a control for the absence of recombination (second lane from the left). The 6.3 kb and the 8.2 kb DNA fragments represent the Ccm2-deleted and floxed alleles, respectively. Note that the DNA fragment in the first lane is slightly lower than the floxed fragment and corresponds to the 8.13 kb wild-type allele. (B) Western blot analysis of CCM2 protein expression within the brain (100 μg protein lysates) and the lung (70 μg protein lysates) from NPKO mice and a control littermate at P8. CCM2 protein was not detected in NPKO brain lysates. Protein lysate from Ccm2-transfected HEK cells was used as a positive control (200 ng). Note that the second lane of the blot is free of sample. Immunoblotting for α-tubulin on the same blot was performed as a loading control. (C) β-galactosidase expression analysis on a E12.5 embryo obtained after crossing a nestin-Cre; Ccm2 floxed animal with a Rosa26R reporter line (genotype of the embryo: nestin-Cre; Rosa26R; Ccm2+/flox). Note that the blood vessels (red arrow) are not blue, demonstrating an absence of recombination in the ECs. (D,E) Analysis of the brains from NPKO and control mice. (D) Analysis of 2 mm-thick brain coronal sections from 2-month-old NPKO and control animals under a dissecting microscope, showing slices of the cerebrum (left panels) and the cerebellum (right panels). (E) Hematoxylin and eosin (H&E) staining on 10 μm paraffin-embedded brain sections from NPKO or control mice at P19. B, brain; C, control; cc, corpus callosum; co, cortex; cpu, caudate putamen; Fb, forebrain; fd, fascia dentata; H, heart; Hb, hindbrain; hi, hippocampus; K, kidney; Li, liver; Lu, lung; Mb, midbrain; Nt, neural tube; ob, olfactory bulb; S, spleen; T, toe; v, ventricle.

170 dmm.biologists.org CCM2 and angiogenesis RESEARCH ARTICLE

Ccm2 floxed mice with a Rosa26R reporter line (Soriano, 1999) (Fig. 2C), showed specific expression of Cre recombinase in neural cells, in agreement with previously published data (Graus-Porta et al., 2001; Proctor et al., 2005). Analysis of NPKO mice at P8 (n=8), P19 (n=7), 2 months of age (n=11) and 6 months of age (n=8) did not reveal any macroscopic anomaly in major organs. Analysis of 2 mm coronal slices of brain under a dissecting microscope did not show any cerebral hemorrhage in NPKO mutants (Fig. 2D). Moreover, histological and immunostaining analyses of the vasculature did not show any gross brain structure anomaly or any obvious vascular defect within the NPKO brain (Fig. 2E and data not shown). Altogether, these data strongly suggest that, in spite of Ccm2 being expressed essentially in neuronal layers within the CNS, ablation of CCM2 from neuroglial precursor cells does not lead to major cerebrovascular defects or obvious cerebral anomalies.

Endothelial-specific ablation of CCM2 leads to mid-gestation embryonic death In order to determine whether the disruption of CCM2 in ECs leads to vascular defects, we generated mice with an endothelium-

DMM restricted deletion of CCM2, by using a previously well- characterized Tie2-Cre transgenic mouse (Kisanuki et al., 2001). Fig. 3. Conditional deletion of CCM2 from endothelial cells leads to a Intercrosses between Tie2-Cre; Ccm2+/– and Ccm2 floxed mice did variable phenotype at E10.5 and finally to death. (A) ECKO progeny +/– not produce any Tie2-Cre; Ccm2–/flox pups (ECKO) at weaning resulting from intercrosses between Tie2-Cre; Ccm2 and homozygous Ccm2 floxed mice. Viability was assessed by the presence of heartbeats. At E11.5 and (from a total of 77 offspring) (Fig. 3A). During embryogenesis, all E12.5, no ECKO embryos were found alive (genotyping was performed on the genotypes were obtained at the expected Mendelian ratios at embryos under resorption). (B-E) ECKO embryo classes reflecting the severity the different stages tested. of the phenotype at E10.5. (B) Control embryo. (C) Class I ECKO embryo (CI) EC-specific Cre expression was confirmed in the YS and embryo without developmental delay. Note the hemorrhage in the trunk (white vasculature at E9.5, and Cre-mediated recombination of the Ccm2 arrows). (D) Class II ECKO embryo (CII, right) with a control littermate (left). floxed allele was observed in the endothelium (supplementary (E) Class III ECKO embryo (CIII) showing failure to complete turning and an material Fig. S4 and S5). enormous heart with a massively enlarged atrium (white arrow). Note that this μ At E8.5, ECKO embryos could not be distinguished from embryo shows signs of resorption. Bars, 1 mm (B,C); 500 m (E). controls (data not shown). At E9.5, most of the ECKO embryos were comparable in size to the control embryos and did not show any obvious anomaly. However, 10% of them were retarded and Abnormal remodeling of the extra-embryonic vasculature in ECKO failed to complete turning, showing a phenotype similar to the embryos Disease Models & Mechanisms one described in the constitutive null embryos at this stage The blood islands of the YS are the first sites of vasculogenesis (supplementary material Fig. S3 and data not shown). At E10.5, and their fusion gives rise to the primitive vascular plexus. In wild- ECKO embryos exhibited phenotypes of variable severity, which type embryos at around E9, the initial honeycomb-like pattern of we assigned to three classes (Fig. 3B-E). Class I included 19% of the YS vasculature is remodeled into a more mature and branched ECKO embryos dissected at this stage and corresponded to ECKO pattern of vitelline vessels (Risau, 1997). YSs of ECKO embryos embryos showing no significant size difference compared with were wrinkled, similar to those of Ccm2-null embryos, allowing controls (Fig. 3C). A slight developmental delay restricted to the the identification of mutant embryos during dissection. YS vessels craniofacial part of the embryos was noticed in several ECKO remained in the honeycomb pattern and failed to develop into embryos of this group. Most ECKO embryos were assigned to large vitelline vessels (Fig. 4B; supplementary material Fig. S4B). class II (58%); they were characterized by a marked general Endodermal and mesodermal layers were less frequently developmental delay (Fig. 3D). Class III included the remaining connected compared with in control embryos and almost no 23% of ECKO embryos, which showed general growth arrest, a blood cells were detected in the immature vessels (Fig. 4C,D). failure to complete turning and/or signs of resorption; the heart These data suggest that vasculogenesis occurred normally in was still beating in most of these embryos (Fig. 3E). At E10.5, ECKO YSs but that angiogenesis was impaired, with severe most ECKO embryos had a pericardial edema that was more remodeling defects. severe in class II and III embryos. Half of the mutants had signs Vascular defects were also observed in the placental labyrinth. of hemorrhage in the pericardial cavity and in the trunk. At E10.5, the different layers of the placenta were difficult to define Interestingly, we never observed any hemorrhage within the upper and appeared poorly organized in ECKO embryos (Fig. 4F). Further, part of the embryo and the head. No ECKO embryos were found embryonic blood vessels did not invade the labyrinthine layer to alive at E11.5 and E12.5. the same extent as seen in control placentas.

Disease Models & Mechanisms 171 RESEARCH ARTICLE CCM2 and angiogenesis

ECKO embryos exhibited a rather coarse vascular network with poorly organized vessels, making it difficult to distinguish the internal carotid artery or primary head veins, which seemed to narrow in some ECKO embryos (Fig. 5D and data not shown). However, vessel sprouting into the neural tube did occur in ECKO embryos (data not shown). Intersomitic vessels were also less organized and their limits were poorly defined compared with control embryos. To further explore the angiogenic defects of ECKO embryos, we used smooth muscle actin immunostaining to search for the presence of vascular smooth muscle cells/pericytes. In control embryos, mural cell recruitment could be detected at E9.5 and DA sections were clearly SMA positive at E10.5 in both the trunk and the caudal region (Fig. 5O and data not shown). In contrast, mural cells were hardly detectable in the DA of ECKO embryos although SMA staining was detected in the somites and in the heart (Fig. 5P; Fig. 6L and data not shown). Only the class I ECKO embryos showed some rare mural cell recruitment in the DA (data not shown). In order to explore whether the Ccm2 deletion affects arterial identity, we examined the arterial expression of an early arterial- specific molecular EC marker, the transmembrane ligand ephrin

DMM B2 (Efnb2), prior to establishment of aortal blood flow at E8.5, using an Efnb2-tau-lacZ reporter transgenic mouse (Wang et al., 1998) and did not detect any difference between control and Ccm2-null embryos (supplementary material Fig. S6). Fig. 4. Vascular defects in extra-embyonic tissues in ECKO embryos at Altogether, our results suggest that EC-specific ablation of E10.5. (A,B) Newly dissected E10.5 ECKO YSs are easily distinguishable from CCM2 does not affect vasculogenesis but severely hampers control ones owing to their wrinkled surface and their immature vasculature, angiogenesis and the remodeling of capillary, arterial and venous which remains in a honeycomb pattern. (C,D) H&E staining of E10.5 YS cross vessels, and that it is associated with a defect in mural cell sections. Compared with the control YSs (C), the endodermal (e) and recruitment. mesodermal (m) layers are rarely connected in the ECKO YSs [red arrows in panel (D)]. (E,F) Placenta histology in control (E) or ECKO (F) embryos at E10.5. Note the rare embryonic nucleated red blood cells (arrowheads) in the Heart defects in ECKO embryos labyrinthine layer in the ECKO placenta, and the presence of maternal red Although most ECKO embryo hearts were still beating at E10.5 blood cells (arrows). Cp, chorionic plate; Gc, giant cells; Lb, labyrinthine (the hearts of a few class III embryos were not), they were enlarged trophoblaste; Md, maternal decidua; Sp, spongiotrophoblast. and showed edematous pericardial swelling and bleeding, a hallmark of cardiac failure (Fig. 3C-E). In class I and some class II ECKO embryos, the size of the heart, assessed on an Disease Models & Mechanisms Embryonic vasculature in ECKO embryos is abnormal and shows atrioventricular axis, relative to the size of the embryo from the impaired recruitment of vascular smooth muscle cells hindbrain/midbrain boundary to the rostral part of the limbud, was Visualization of the embryonic vasculature at E9.5, using whole- about 17% larger than in control embryos. Chamber specification mount platelet endothelial cell adhesion molecule (PECAM) appeared normal and, at this stage, ECKO embryos showed both staining, revealed the presence of all major blood vessels, paired a common atrial and a common ventricular chamber (Fig. 6F). dorsal aortae (DA), branchial arch arteries, cardinal veins and Several embryos had an enlarged outflow tract and almost all of intersomitic vessels in ECKO embryos, suggesting that them had an enlarged atrium (Fig. 6A-D). In most severe cases, vasculogenesis occurred normally. the massively enlarged atrium and sinus venosus led to distortion However, in E9.5 ECKO embryos, the DA already had an of the embryo. However, the atrial wall of ECKO embryos was irregular appearance and were thinner than in controls (Fig. 5B). comparable to control embryos, with a single layer of endocardial At E10.5, the vascular phenotype was even more severe; the DA cells surrounded by a few layers of cardiomyocytes, including a were now highly irregular in appearance and had narrow lumens monolayer of SMA-positive cells (Fig. 6F,L). Interestingly, the (Fig. 5F,J). In the caudal region, DA failed to fuse in most ECKO dilations that were seen in the atrial chamber of the heart, as well embryos (except in a few class I embryos) and remained present as in the venous system, could not be correlated to an increase in as two stenotic DA (Fig. 5H,L). Interestingly, we never observed the proliferative rate of ECs, as determined by double labeling with DA dilations or arterio-venous malformations. With regard to antibodies for PECAM and phosphorylated histone 3 (data not venous vessels, we observed an important dilation of the large shown). vessels connecting to the heart, including the common cardinal Ventricular trabeculations were strongly reduced with, in some veins and the sinus venosus (Fig. 5F,J). In the head, the cephalic extreme cases, detachment of the endocardial cells from the plexus failed to remodel into a hierarchical branched network and myocardium (Fig. 6J and data not shown). This much thinner

172 dmm.biologists.org CCM2 and angiogenesis RESEARCH ARTICLE

ventricular wall could be responsible for blood cells leaking into ECs leads to a very severe vascular phenotype. Vasculogenesis the pericardial cavity, which was observed in some ECKO embryos. appears normal in ECKO embryos, contrasting with marked In addition, there was a paucity of cells in the cushions in the angiogenesis remodeling abnormalities in the extra-embryonic and atrioventricular canal (Fig. 6H), suggesting a reduction in the ability embryonic vasculature that lead to major heart defects and both of endocardial cells to invade the cardiac jelly and undergo arterial and venous defects. These data establish the role of endocardial-mesenchymal transformation (Conway et al., 2003). endothelial CCM2 in angiogenesis. In constitutive null embryos, lethality occurred one embryonic DISCUSSION day earlier than in ECKO embryos. Further, whilst all null embryos Loss-of-function mutations in the CCM2 gene in humans lead to are already in resorption at E10.5, only 15% of ECKO embryos are cerebrovascular malformations, causing recurrent brain dead at this stage. This delayed lethality might be explained by the hemorrhages. Here, we demonstrate that, in spite of CCM2 being incomplete and progressive endothelial-specific recombination predominantly expressed in the neuronal layers within the CNS, induced by the Tie2-Cre cell line. Kisanuki et al. showed that EC- deletion of CCM2 from neuroglial precursor cells in mice does not specific recombination induced by this Tie2-Cre line starts at E7.5 have a major phenotypic effect. In contrast, deletion of CCM2 from in some blood islands but is still not complete at E9.5. However, DMM Disease Models & Mechanisms

Fig. 5. Conditional deletion of CCM2 from endothelial cells results in major vascular defects in ECKO embryos. (A-H) Whole-mount PECAM staining of control (left panels) and ECKO embryos (right panels) at E9.5 (A,B) and E10.5 (C-H). (I-L) E10.5 PECAM-stained embryo sections after counterstaining with eosin. The presence of PECAM-positive DA, somitic vessels and branchial arch arteries (numbered in red) at E9.5 demonstrates the occurrence of vasculogenesis (A,B). However, at E10.5 (C-H), the arterial and venous blood vessels are abnormal in ECKO embryos and the internal carotid artery is difficult to distinguish [red arrow (D)]. Further, DA are highly irregular in appearance and common cardinal veins are enlarged (F,J). In some animals, the caudal part of the DA fails to fuse (red arrows (H,L)]. (M-P) Double staining for PECAM [red (M,N)] and SMA [green (O,P)] on E10.5 DA sections from the trunk. Note the impaired recruitment of vascular smooth muscle cells/pericytes in the DA of ECKO embryos (P). CCV, common cardinal vein; DA, dorsal aorta; ICA, internal carotid artery; LB, limb bud; NT, neural tube; S, somite; Bars, 500 μm (A,B); 50 μm (M-P).

Disease Models & Mechanisms 173 RESEARCH ARTICLE CCM2 and angiogenesis

we cannot exclude a role for CCM2 in other cell types, such as in Some of the vascular defects described here in ECKO embryos vascular smooth muscle cells, which might also explain the more are reminiscent of those reported in embryos with constitutive severe phenotype of constitutive null embryos. CCM1 inactivation (Whitehead et al., 2004). In Ccm1–/– embryos, The neural expression of Ccm2 and other Ccm genes suggested vasculogenesis seems intact but angiogenesis is severely that CCM vascular lesions could be secondary to neural defects. compromised. Ccm1–/– embryos die at E10.5 and show multiple However, NPKO mice did not show neurological symptoms and arterial morphogenesis defects including a variable narrowing of we did not observe any vascular lesion within the brain of NPKO both branchial arch arteries and the proximal dorsal aorta, as well mice, up to 6 months of age. Interestingly, constitutive ablation of as heart defects including atrial enlargement and signs of CCM1 did not lead to neural lesions in Ccm1–/– embryos cardiovascular failure. In addition, Ccm1–/– embryos show a defect (Whitehead et al., 2004). Further analysis of NPKO mice would be in mural cell recruitment, similar to that observed in our ECKO required to search for subtle neuropathological lesions that might embryos. However, the main phenotype reported in Ccm1–/– affect the cerebral cortex and to investigate the functional embryos is an extensive vascular dilation of the dorsal and caudal consequences of a complete loss of CCM2 in neurons. aortae, and of the cranial and intersomitic vessels, which was never observed in our ECKO embryos. These defects have been associated with an increase in the proliferative rate of ECs of the dilated dorsal aortae and a downregulation of arterial-specific markers including Efnb2, neither of which was observed in ECKO embryos. Interestingly, no dilation of the venous compartment was reported in Ccm1–/– embryos, contrasting with the dilation of the common cardinal vein and sinus venosus in CCM2 ECKO embryos and dilation of the major large venous vessels in ccm1–/– zebrafish embryos (Hogan et al., 2008).

DMM Recessive loss-of-function mutations in santa and valentine, the respective orthologs of CCM1 and CCM2 in zebrafish, lead to similar and major cardiac and vascular defects (Mably et al., 2006; Hogan et al., 2008). The cardiac phenotype observed in these mutants is also highly similar to that observed in heart of glass mutants (Mably et al., 2003) and is characterized by a massive dilation of the heart chambers, which show only one layer of cardiomyocytes instead of the two or three layers present in wild- type embryos. Enlargement of the atrium is one of the main phenotypic features in ECKO embryos; however, we did not observe any anomaly in the number of cell layers composing the atrial wall of these embryos. The vascular phenotype of Ccm1–/– embryos, and to a lesser degree ccm2–/– zebrafish embryos, is characterized by a progressive and massive dilation of venous vessels including the caudal vein and posterior cardinal vein, contrasting with the normal development of dorsal aorta and Disease Models & Mechanisms intersomitic vessels (Hogan et al., 2008). This venous defect is associated with a progressive thinning and spreading of ECs, which is EC cell-autonomous, strongly suggesting that CCM1 is involved in the control of EC shape. Interestingly, the authors did not observe an increase in EC proliferation rate or any modification in the expression of the arterial specification markers. Blood vessel growth and differentiation involves a broad spectrum of genetic and physical signals, such as blood flow; one of the main challenges in the analysis of these various animal models is to differentiate the primary effects of mutations on the Fig. 6. Cardiac defects in ECKO embryos. (A-D) Hearts from control (A) and vasculature from the secondary effects of altered blood flow ECKO embryos (B-D) after whole-mount PECAM staining at E10.5. (E-J) Heart (Carmeliet, 2000; Lucitti et al., 2007). Indeed, most of the genes sections from PECAM-stained control (E) and ECKO (F) embryos, expressed in ECs are expressed in endocardial cells and when counterstained with eosin, showing the common atrial chamber (a) and the mutated, many of them, such as Ccm2, lead to cardiac defects. common ventricular chamber (v). The black and red boxes in (E,F) are shown Altered blood flow may in turn influence extra-embryonic and enlarged in (G,H) and (I,J), respectively. (G,H) A reduction of cells was observed embryonic vessel morphogenesis and remodeling (le Noble et al., in the atrioventricular canal in the ECKO heart. (I,J) Ventricular trabeculations are strongly reduced in the ECKO heart (J). (K,L) Double staining for PECAM 2004; Jones et al., 2008). Altered expression of arterial-specific (red) and SMA (green) showing the atrial wall from a control (K) and an ECKO markers such as Efbn2 can also be a secondary effect of abnormal (L) embryo. Sections were counterstained with DAPI. Bars, 100 μm (E,F); 25 μm blood flow (le Noble et al., 2004). Even very subtle differences in (G-J); 20 μm (K,L). flow patterns may result in remodeling abnormalities (Lucitti et

174 dmm.biologists.org CCM2 and angiogenesis RESEARCH ARTICLE

al., 2007). The current generation of mouse models, with their temporally controlled CCM2 deletion from blood vessels that TRANSLATIONAL IMPACT begins at later stages, should help to elucidate this issue and perhaps Clinical issue help to obtain models that more closely recapitulate the human Bleeding owing to cerebral cavernous malformations (CCM) is involved in 10 CCM phenotype and thus allow dissection of the relevant cellular percent of young patients who show cerebral hemorrhage. These cerebral and biochemical pathways involved in this condition. vascular malformations can result from either sporadic or familial autosomal dominant (FCCM) conditions. Recurrent bleeding is the major complication in METHODS patients affected by FCCM, which is characterized by the presence of multiple Targeting the Ccm2 gene and generation of CCM2 mouse mutants CCM lesions. FCCM is caused by loss-of-function mutations in any of the three ES cells (129 background) were electroporated with a linearized CCM genes identified so far. High expression levels of the CCM genes in the neuroepithelium indicate that CCM lesions may be caused by a loss of 10.1 kb construct, containing three loxP sites flanking a GFP- function of CCM genes in neural cells rather than in vascular cells. In vitro data hygromycin resistance cassette (2.7 kb) and exons 3 and 4 of the suggest that CCM proteins are members of a large signaling complex involved Ccm2 gene (Fig. 1A). Hygromycin was used to select a positive ES in cell-cell junction homeostasis and cytoskeleton remodeling; however, their clone, which was then used to inject C57BL/6 blastocysts. The in vivo function, particularly during cerebral angiogenesis, is totally unknown chimeric tri-lox mice were bred with MeuCre40 mice (Leneuve et and the mechanisms leading to the formation of CCM lesions are obscure. al., 2003) to remove the cassette and to obtain mosaic animals; these +/– Results were then backcrossed with wild-type C57BL/6 mice. Ccm2 and Here, we used constitutive and tissue-specific inactivation of CCM2 to +/flox Ccm2 mutants, selected to be free of the Cre transgene, were investigate its role in vascular development in the mouse. Constitutive backcrossed with C57BL/6 mice at least seven times to establish a deletion of CCM2 leads to an early embryonic death. Deletion of CCM2 from C57BL/6 genetic background. neuroglial precursor cells by using nestin-Cre transgenic mice results in mice Southern blot analysis was developed to confirm transmission with a normal phenotype, whereas deletion of CCM2 from endothelial cells by of the targeted Ccm2 locus. Two different DNA fragments that were using Tie2-Cre transgenic mice severely hampers angiogenesis, leading to Ј morphogenic defects in the major arterial and venous blood vessels and in the DMM external to the targeting construct, one at the 5 end (245 bp) and heart, and results in embryonic lethality at mid-gestation. one at the 3Ј end (282 bp), were radiolabeled before being probed with XbaI- or HindIII-digested genomic DNA. Implications and future directions The absence of the CCM2 protein in mutants was confirmed by This study provides the first definitive demonstration that, despite the strong western blot. Total protein lysates were prepared from embryos neuroepithelial expression of CCM2, it is the endothelial expression of CCM2 that is crucial for proper angiogenesis. It also strongly suggests that the or mouse tissues and lyzed in RIPA buffer that had been endothelial cell is the primary target in the cascade of events leading from supplemented with protease inhibitors. The CCM2 protein CCM2 mutations to CCM cerebrovascular lesions. These findings have (48.8 kDa) was detected using a purified polyclonal antibody, which important implications for the understanding of the mechanisms surrounding was raised against a 15-amino acid peptide located at the C- CCM lesion development. They indicate that development of these vascular terminal end of the CCM2 protein (peptide sequence: NH2- lesions, which are found almost exclusively within the brain, may require DDRSAPSEGDEWDRM-COOH; Ab made by Eurogentec). Lysates additional events to take place within the cerebral environment, which have from full-lengh-CCM2-transfected HEK 293T cells were used as yet to be identified. a positive control (200 ng). Western blots for α-tubulin (clone DM doi:10.1242/dmm.002584 1A, Sigma), performed on the same blots, were used as a control for the amount of protein loaded. microscope. H&E staining was performed on paraffin-embedded Offspring genotyping was analyzed by PCR on genomic DNA sections. Disease Models & Mechanisms using the following primers (5Ј to 3Ј): wild-type (177 bp) and Placentas and YSs were fixed in 4% PFA and embedded in floxed allele (263 bp), ATGGCACTTTGCTTTTCCAC and TG- paraffin. Histological analysis was performed on 7 μm sections GCATCGAGAATCTTTCAA; deleted allele (285 bp), ATG- using H&E staining. GCACTTTGCTTTTCCAC and ACCCTGCTGTCTGAAC- AAGG; Cre (370 bp), TCCAATTTACTGAGCGTACACC and Immunochemistry and immunofluorescence CGTTTTCTTTTCGGATCC. The following antibodies were used for immunohistochemistry and/or immunofluorescence: anti-PECAM (1:100; MEC13.3, BD Mouse lines Pharmingen); FITC-conjugated anti-αSMA (1:100; Clone 1A4, The nestin-Cre mice (Tronche et al., 1999), Tie2-Cre mice (Kisanuki Sigma); anti-phosphohistone H3 (1:200; Abcam); peroxidase- et al., 2001), Rosa26R reporter line (Soriano, 1999) and Efnb2-tau- conjugated anti-rat IgG (H+L) (1:500; Jackson ImmunoResearch lacZ reporter transgenic mouse (Wang et al., 1998) have been Laboratories); Alexa Fluor 594-conjugated anti-rat IgG (H+L) described previously. Mice were all bred with a C57BL/6 background. (1:200; Molecular Probe); FITC-conjugated anti-rabbit IgG (H+L) The procedure followed in the care and euthanasia of study animals (1:100; Jackson ImmunoResearch Laboratories). was in accordance with European Community standards on the care Immunochemistry on whole embryos was performed as and use of laboratory animals (Ministère de l’Agriculture, France). described previously (Nagy et al., 2003) after neutralization of free aldehyde residues in PFA-fixed embryos by incubation with 100 Histology mM glycin for 20 minutes. Whole brains were fixed by immersion overnight in 4% PFA, before X-gal staining on whole embryos was performed as described being sectioned in 2 mm coronal slices using an acrylic brain matrix previously (Moessler et al., 1996). Sections (7 μm) of the paraffin- (electron microscopy services) for examination under a dissecting embedded embryos were counterstained with 1% eosin.

Disease Models & Mechanisms 175 RESEARCH ARTICLE CCM2 and angiogenesis

Immunochemistry on frozen sections was performed after Jones, E. A., Yuan, L., Breant, C., Watts, R. J. and Eichmann, A. (2008). Separating fixation in aceton and permeabilization of the tissue. Sections were genetic and hemodynamic defects in neuropilin 1 knockout embryos. Development 135, 2479-2488. counterstained with DAPI and mounted in a fluorescent mounting Kisanuki, Y. Y., Hammer, R. E., Miyazaki, J., Williams, S. C., Richardson, J. A. and medium (DakoCytomation). Yanagisawa, M. (2001). Tie2-Cre transgenic mice: a new model for endothelial cell- lineage analysis in vivo. Dev. Biol. 230, 230-242. ACKNOWLEDGEMENTS Labauge, P., Denier, C., Bergametti, F. and Tournier-Lasserve, E. (2007). Genetics of This work was supported by the Agence Nationale pour la recherche grant ANR-07- cavernous angiomas. Lancet Neurol. 6, 237-244. MRAR-002-01 (to E.T.-L.), the Leducq grant 07 CVD 02 hemorrhagic stroke (to E.T.-L.), Labauge, P., Laberge, S., Brunereau, L., Levy, C. and Tournier-Lasserve, E. (1998). INSERM. G.B. has been partly supported by the PHRC grant AOR0301. N.P. was sequentially supported by Lefoulon Delalande and Fédération pour les Maladies Hereditary cerebral cavernous angiomas: clinical and genetic features in 57 French Orphelines FMO and ‘Association Cavernomes France’ fellowships. We thank deeply families. Societe Francaise de Neurochirurgie. Lancet 352, 1892-1897. A. Joutel from UMR-S 740, A. Eichmann from INSERM U833 and S.M. Meilhac from Laberge-le, Couteulx, S., Jung, H. H., Labauge, P., Houtteville, J. P., Lescoat, C., CNRS URA 2578 for very helpful discussions, and M. Arnoult for excellent technical Cecillon, M., Marechal, E., Joutel, A., Bach, J. F. and Tournier-Lasserve, E. (1999). help. Truncating mutations in CCM1, encoding KRIT1, cause hereditary cavernous angiomas. Nat. Genet. 23, 189-193. COMPETING INTERESTS le Noble, F., Moyon, D., Pardanaud, L., Yuan, L., Djonov, V., Matthijsen, R., Breant, The authors declare no competing financial interests. C., Fleury, V. and Eichmann, A. (2004). Flow regulates arterial-venous AUTHOR CONTRIBUTIONS differentiation in the chick embryo yolk sac. Development 131, 361-375. G.B. was the principal person for the experiments involving mice, and wrote the Leneuve, P., Colnot, S., Hamard, G., Francis, F., Niwa-Kawakita, M., Giovannini, M. first draft of the paper; A.B. contributed to breeding, genotyping and phenotyping and Holzenberger, M. (2003). Cre-mediated germline mosaicism: a new transgenic of NPKO and ECKO mice; L.A.G. made the targeting vector; N.P., F.C. and M.N.-K. mouse for the selective removal of residual markers from tri-lox conditional alleles. contributed to the ES cell work and generation of floxed mice under the Nucleic Acids Res. 31, e21. supervision of M.G.; and E.T.-L. was the principal investigator on the project and Liquori, C. L., Berg, M. J., Siegel, A. M., Huang, E., Zawistowski, J. S., Stoffer, T., contributed the final version of the paper. Verlaan, D., Balogun, F., Hughes, L., Leedom, T. P. et al. (2003). Mutations in a gene encoding a novel protein containing a phosphotyrosine-binding domain cause SUPPLEMENTARY MATERIAL type 2 cerebral cavernous malformations. Am. J. Hum. Genet. 73, 1459-1464. Supplementary material for this article is available at Lucitti, J. L., Jones, E. A., Huang, C., Chen, J., Fraser, S. E. and Dickinson, M. E. http://dmm.biologists.org/content/2/3-4/168/suppl/DC1 (2007). Vascular remodeling of the mouse yolk sac requires hemodynamic force.

DMM Received 6 August 2008; Accepted 10 December 2008. Development 134, 3317-3326. Ma, X., Zhao, H., Shan, J., Long, F., Chen, Y., Chen, Y., Zhang, Y., Han, X. and Ma, D. REFERENCES (2007). PDCD10 interacts with Ste20-related kinase MST4 to promote cell growth Akers, A. L., Johnson, E., Steinberg, G. K., Zabramski, J. M. and Marchuk, D. A. and transformation via modulation of the ERK pathway. Mol. Biol. Cell 18, 1965-1978. (2008). Biallelic somatic and germline mutations in cerebral cavernous Mably, J. D., Mohideen, M. A., Burns, C. G., Chen, J. N. and Fishman, M. C. (2003). malformations (CCM): evidence for a two-hit mechanism of CCM pathogenesis. Hum. heart of glass regulates the concentric growth of the heart in zebrafish. Curr. Biol. 13, Mol. Genet. Dec 16 [Epub ahead of print] [doi:10.1093/hmg/ddn430]. 2138-2147. Bergametti, F., Denier, C., Labauge, P., Arnoult, M., Boetto, S., Clanet, M., Coubes, Mably, J. D., Chuang, L. P., Serluca, F. C., Mohideen, M. A., Chen, J. N. and Fishman, P., Echenne, B., Ibrahim, R., Irthum, B. et al. (2005). Mutations within the M. C. (2006). santa and valentine pattern concentric growth of cardiac myocardium programmed cell death 10 gene cause cerebral cavernous malformations. Am. J. in the zebrafish. Development 133, 3139-3146. Hum. Genet. 76, 42-51. Moessler, H., Mericskay, M., Li, Z., Nagl, S., Paulin, D. and Small, J. V. (1996). The SM Brouillard, P., Boon, L. M., Mulliken, J. B., Enjolras, O., Ghassibe, M., Warman, M. L., 22 promoter directs tissue-specific expression in arterial but not in venous or visceral Tan, O. T., Olsen, B. R. and Vikkula, M. (2002). Mutations in a novel factor, glomulin, smooth muscle cells in transgenic mice. Development 122, 2415-2425. are responsible for glomuvenous malformations (“glomangiomas”). Am. J. Hum. Moussa, R., Harb, A., Menassa, L., Risk, T., Nohra, G., Samaha, E., Mohasseb, G., Genet. 70, 866-874. Okais, N. and Awad, I. (2006). Etiologic spectrum of intracerebral hemorrhage in Carmeliet, P. (2000). Mechanisms of angiogenesis and arteriogenesis. Nat. Med. 6, 389- young patients. Neurochirurgie 52, 105-109. 395. Nagy, A., Gertsenstein, M., Vintersten, K. and Behringer, R. (2003). Manipulating The Clatterbuck, R. E., Eberhart, C. G., Crain, B. J. and Rigamonti, D. (2001). Mouse Embryo: A Laboratory Manual, pp. 666-669. Cold Spring Harbor: Cold Spring Ultrastructural and immunocytochemical evidence that an incompetent blood-brain Harbor Laboratory Press. barrier is related to the pathophysiology of cavernous malformations. J. Neurol. Otten, P., Pizzolato, G. P., Rilliet, B. and Berney, J. (1989). 131 cases of cavernous Disease Models & Mechanisms Neurosurg. Psychiatr. 71, 188-192. angioma (cavernomas) of the CNS, discovered by retrospective analysis of 24,535 Conway, S. J., Kruzynska-Frejtag, A., Kneer, P. L., Machnicki, M. and Koushik, S. V. autopsies. Neurochirurgie 35, 82-83; 128-131. (2003). What cardiovascular defect does my prenatal mouse mutant have, and why? Pagenstecher, A., Stahl, S., Sure, U. and Felbor, U. (2008). A two-hit mechanism Genesis 35, 1-21. causes cerebral cavernous malformations: complete inactivation of CCM1, CCM2 or Craig, H. D., Gunel, M., Cepeda, O., Johnson, E. W., Ptacek, L., Steinberg, G. K., CCM3 in affected endothelial cells. Hum. Mol. Genet. Dec 16 [Epub ahead of print] Ogilvy, C. S., Berg, M. J., Crawford, S. C., Scott, R. M. et al. (1998). Multilocus linkage identifies two new loci for a mendelian form of stroke, cerebral cavernous [doi:10.1093/hmg/ddn420]. malformation, at 7p15-13 and 3q25.2-27. Hum. Mol. Genet. 7, 1851-1858. Petit, N., Blecon, A., Denier, C. and Tournier-Lasserve, E. (2006). Patterns of Denier, C., Goutagny, S., Labauge, P., Krivosic, V., Arnoult, M., Cousin, A., Benabid, A. expression of the three cerebral cavernous malformation (CCM) genes during L., Comoy, J., Frerebeau, P., Gilbert, B. et al. (2004). Mutations within the MGC4607 embryonic and postnatal brain development. Gene Expr. Patterns 6, 495-503. gene cause cerebral cavernous malformations. Am. J. Hum. Genet. 74, 326-337. Plummer, N. W., Squire, T. L., Srinivasan, S., Huang, E., Zawistowski, J. S., Gault, J., Shenkar, R., Recksiek, P. and Awad, I. A. (2005). Biallelic somatic and germ Matsunami, H., Hale, L. P. and Marchuk, D. A. (2006). Neuronal expression of the line CCM1 truncating mutations in a cerebral cavernous malformation lesion. Stroke Ccm2 gene in a new mouse model of cerebral cavernous malformations. Mamm. 36, 872-874. Genome 17, 119-128. Glading, A., Han, J., Stockton, R. A. and Ginsberg, M. H. (2007). KRIT-1/CCM1 is a Proctor, J. M., Zang, K., Wang, D., Wang, R. and Reichardt, L. F. (2005). Vascular Rap1 effector that regulates endothelial cell cell junctions. J. Cell Biol. 179, 247-254. development of the brain requires beta8 integrin expression in the neuroepithelium. Graus-Porta, D., Blaess, S., Senften, M., Littlewood-Evans, A., Damsky, C., Huang, J. Neurosci. 25, 9940-9948. Z., Orban, P., Klein, R., Schittny, J. C. and Muller, U. (2001). Beta1-class integrins Rigamonti, D., Hadley, M. N., Drayer, B. P., Johnson, P. C., Hoenig-Rigamonti, K., regulate the development of laminae and folia in the cerebral and cerebellar cortex. Knight, J. T. and Spetzler, R. F. (1988). Cerebral cavernous malformations. Incidence Neuron 31, 367-379. and familial occurrence. N. Engl. J. Med. 319, 343-347. Hilder, T. L., Malone, M. H., Bencharit, S., Colicelli, J., Haystead, T. A., Johnson, G. L. Risau, W. (1997). Mechanisms of angiogenesis. Nature 386, 671-674. and Wu, C. C. (2007). Proteomic identification of the cerebral cavernous Russell, D. S. and Rubinstein, L. J. (1989). Pathology of Tumors of the Nervous System, malformation signaling complex. J. Proteome Res. 6, 4343-4355. pp. 730-736. Baltimore, MD: Williams and Wilkins. Hogan, B. M., Bussmann, J., Wolburg, H. and Schulte-Merker, S. (2008). ccm1 cell Serebriiskii, I., Estojak, J., Sonoda, G., Testa, J. R. and Golemis, E. A. (1997). autonomously regulates endothelial cellular morphogenesis and vascular Association of Krev-1/rap1a with Krit1, a novel ankyrin repeat-containing protein tubulogenesis in zebrafish. Hum Mol Genet 17, 2424-2432. encoded by a gene mapping to 7q21-22. Oncogene 15, 1043-1049.

176 dmm.biologists.org CCM2 and angiogenesis RESEARCH ARTICLE

Soriano, P. (1999). Generalized lacZ expression with the ROSA26 Cre reporter strain. Whitehead, K. J., Plummer, N. W., Adams, J. A., Marchuk, D. A. and Li, D. Y. (2004). Nat. Genet. 21, 70-71. Ccm1 is required for arterial morphogenesis: implications for the etiology of human Tronche, F., Kellendonk, C., Kretz, O., Gass, P., Anlag, K., Orban, P. C., Bock, R., cavernous malformations. Development 131, 1437-1448. Klein, R. and Schutz, G. (1999). Disruption of the glucocorticoid receptor gene in Zhang, J., Clatterbuck, R. E., Rigamonti, D., Chang, D. D. and Dietz, H. C. (2001). the nervous system results in reduced anxiety. Nat. Genet. 23, 99-103. Interaction between krit1 and icap1alpha infers perturbation of integrin beta1- Uhlik, M. T., Abell, A. N., Johnson, N. L., Sun, W., Cuevas, B. D., Lobel-Rice, K. E., mediated angiogenesis in the pathogenesis of cerebral cavernous malformation. Horne, E. A., Dell’Acqua, M. L. and Johnson, G. L. (2003). Rac-MEKK3-MKK3 Hum. Mol. Genet. 10, 2953-2960. scaffolding for p38 MAPK activation during hyperosmotic shock. Nat. Cell Biol. 5, Zawistowski, J. S., Serebriiskii, I. G., Lee, M. F., Golemis, E. A. and Marchuk, D. A. 1104-1110. (2002). KRIT1 association with the integrin-binding protein ICAP-1: a new direction in Voss, K., Stahl, S., Schleider, E., Ullrich, S., Nickel, J., Mueller, T. D. and Felbor, U. the elucidation of cerebral cavernous malformations (CCM1) pathogenesis. Hum. (2007). CCM3 interacts with CCM2 indicating common pathogenesis for cerebral Mol. Genet. 11, 389-396. cavernous malformations. Neurogenetics 8, 249-256. Zawistowski, J. S., Stalheim, L., Uhlik, M. T., Abell, A. N., Ancrile, B. B., Johnson, G. Wang, H. U., Chen, Z. F. and Anderson, D. J. (1998). Molecular distinction and L. and Marchuk, D. A. (2005). CCM1 and CCM2 protein interactions in cell signaling: angiogenic interaction between embryonic arteries and veins revealed by ephrin-B2 implications for cerebral cavernous malformations pathogenesis. Hum. Mol. Genet. and its receptor Eph-B4. Cell 93, 741-753. 14, 2521-2531. DMM Disease Models & Mechanisms

Disease Models & Mechanisms 177