DOCSLIB.ORG

Complete Sequence of the Mitochondrial Genome of Odontamblyopus Rubicundus (Perciformes: Gobiidae): Genome Characterization and Phylogenetic Analysis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Complete Sequence of the Mitochondrial Genome of Odontamblyopus Rubicundus (Perciformes: Gobiidae): Genome Characterization and Phylogenetic Analysis c Indian Academy of Sciences RESEARCH ARTICLE Complete sequence of the mitochondrial genome of Odontamblyopus rubicundus (Perciformes: Gobiidae): genome characterization and phylogenetic analysis TIANXING LIU, XIAOXIAO JIN, RIXIN WANG∗ and TIANJUN XU∗ Laboratory for Marine Living Resources and Molecular Engineering, College of Marine Science, Zhejiang Ocean University, Zhoushan 316000, People’s Republic of China Abstract Odontamblyopus rubicundus is a species of gobiid fishes, inhabits muddy-bottomed coastal waters. In this paper, the first complete mitochondrial genome sequence of O. rubicundus is reported. The complete mitochondrial genome sequence is 17119 bp in length and contains 13 protein-coding genes, two rRNA genes, 22 tRNA genes, a control region and an L-strand origin as in other teleosts. Most mitochondrial genes are encoded on H-strand except for ND6 and seven tRNA genes. Some overlaps occur in protein-coding genes and tRNAs ranging from 1 to 7 bp. The possibly nonfunctional L-strand origin folded into a typical stem-loop secondary structure and a conserved motif (5-GCCGG-3) was found at the base of the stem within the tRNACys gene. The TAS, CSB-2 and CSB-3 could be detected in the control region. However, in contrast to most of other fishes, the central conserved sequence block domain and the CSB-1 could not be recognized in O. rubicundus,whichis consistent with Acanthogobius hasta (Gobiidae). In addition, phylogenetic analyses based on different sequences of species of Gobiidae and different methods showed that the classification of O. rubicundus into Odontamblyopus due to morphology is debatable. [Liu T., Jin X., Wang R. and Xu T. 2013 Complete sequence of the mitochondrial genome of Odontamblyopus rubicundus (Perciformes: Gobiidae): genome characterization and phylogenetic analysis. J. Genet. 92, 423–432] Introduction studying molecular evolution and phylogenetic relationships (Xu et al. 2011). In general, the typical genome organization of animal mito- When compared with other teleost groups, Gobiidae is one chondrial DNA (mtDNA) is a closed double-stranded cir- of the largest families of fishes with more than 2000 species, ∼ cular molecule ranging in size from 16 to 18 kb, and in 210 genera, living in marine, freshwater and blackish habi- encoding 37 genes: 13 protein-coding genes (CO1, CO2, tats (Nelson 2006; Zander 2011). Most of adult gobiid fishes CO3, Cytb, ND1, ND2, ND3, ND4, ND5, ND6, ND4L, are relatively small, typically less than 10 cm. In addition, ATPase6 and ATPase8), two ribosomal RNA genes (small their economic value is low and hence they are not much and large ribosomal genes), 22 transfer RNA genes, and a studied. To date, most of the studies about Gobiidae mainly large noncoding region commonly related to the initiation of concentrated in the reproductive biology, early life-history transcription and replication, namely, the control region (CR) and species survey, etc. The researches of molecular aspects (Wolstenholme 1992; Boore 1999). Mitochondrial genomes are very few, especially in molecular evolution and phyloge- have played an important role in studies of population genet- netic relationships. Moreover, the phylogenetic relationships ics and reconstruction of phylogeny, on account of their of gobiid fishes are still controversial. Giinthe (1861) divided quick evolutionary rate, maternal inheritance, high informa- Gobiidae into Gobiinae, Amblyopinae, Trypaucheninae and tion content and lack of recombination (Avise 2000; Boore Callionymina according to the number of fins and tandem et al. 2005). So far, mitochondrial genome sequence and scales. Bleeker (1872) redefined four subfamily of Gobiidae, structure analysis have become a powerful approach for based on the analysis of the teeth, bones and the position of the eyes. Gosline (1995) considered that it was difficult to separate Eleotridae and Gobiidae based on morphology. In ∗ For correspondence. E-mail: Rixin Wang, [email protected]; addition, morphological characteristics of gobiid fishes are Tianjun Xu, [email protected]. Keywords. mitochondrial genome; phylogenetic analysis; Gobiidae; Bayesian analysis; Odontamblyopus rubicundus. Journal of Genetics, Vol. 92, No. 3, December 2013 423 Tianxing Liu et al. unconspicuous as a result of small body. Therefore, there conducted in 25 μL reaction mixtures containing 2.5 μL10× are a lot of controversies in Gobiidae classification and it is Taq Plus polymerase buffer (Tiangen), 2 μLdNTP(2.5mM) desirable to adopt molecular methods to resolve these issues. and 1 μL of the forward and reverse primers (10 μM), In this study, we present the first complete nucleotide respectively, 0.2 μL Taq DNA polymerase (5 U/μL) sequence for the mitochondrial genome of the O. rubicun- (Tiangen), 1 μL of the DNA template and 17.3 μLof dus and determined its mitochondrial genomic structure. This sterile distilled H2O. The PCR reaction consisted of pre- is the first species in Odontamblyopus for which the com- denaturation at 94◦C for 5 min; 35 cycles of denaturation plete mitochondrial genome has been determined. Finally, at 94◦C for 30 s annealing at 56–60◦C for 30 s and final we conducted phylogenetic analysis based on the mito- extension at 72◦C for 1–2 min. All of the PCR products chondrial sequence data with the main aim of investigating were sequenced on an ABI3730xl DNA Analyzer (Applied the phylogenetic position of O. rubicundus within family Biosystems, Foster City, USA) by primer walking. Gobiidae. Materials and methods Table 2. List I of species from Gobiidae used in phylogenetic analyses, with GenBank accession numbers. Sample collection and DNA extraction Accession The specimens of O. rubicundus were collected from the Genera Species number Zhoushan (Zhejiang Province, China). A portion of the dor- a sal fin was sampled and preserved in 95% ethanol. Total Acanthogobius Acanthogobius hasta NC006131 Acentrogobius Acentrogobius pflaumii NC018064a DNA was extracted using the standard phenol–chloroform Bathygobius Bathygobius coalitus AB429403 procedure as described previously. Bathygobius cocosensis AB374647 Bathygobius cyclopterus AB429402 Bathygobius fuscus AB429401 Bathygobius hongkongensis AB429400 PCR amplifications and sequencing Boleophthalmus Boleophthalmus pectinirostris NC016195 Callogobius Callogobius tanegasimae AB269898 To obtain the complete mitochondrial genome of O. rubi- a cundus, we conducted two-step PCR amplification. First, Gillichthys Gillichthys mirabilis NC012906 Gillichthys seta NC012908a the long-PCR amplification was used to acquire two long Glossogobius Glossogobius circumspectus NC018824a fragments, which covered the whole mtDNA of O. rubi- Glossogobius olivaceus NC016664a cundus. Twenty-five μL of the long PCR mixture con- Gymnogobius Gymnogobius petschiliensis NC008743a μ × Luciogobius Luciogobius platycephalus NC019811a tained 5 L5 LA buffer (New England Biolabs, a Beverly, USA), 3 μLdNTP(2.5mM)and1μL(10μM) Odontamblyopus Odontamblyopus rubicundus NC019647 Odontamblyopus lacepedii FJ968551 of the forward and reverse primers (Miya and Nishida 2000; Odontamblyopus Rebecca FJ968569 Kawaguchi et al. 2001), respectively, 1 μLofLATaq Odontamblyopus sp. FJ968564 DNA polymerase (New England Biolabs, Beverly, USA), Oxuderces Oxuderces dentatus NC016194a 1 μL of the DNA template and 13 μL of sterile dis- Periophthalmus Periophthalmus argentilineatus AB257626 tilled H O. The PCR was performed in a PTC-200 with Periophthalmus modestus AB257624 2 Rhinogobius Rhinogobius brunneus AB674658 pre-denaturation at 94◦Cfor1min;35cyclesofdenat- ◦ ◦ Rhinogobius duospilus AB190337 uration at 94 C for 30 s, annealing at 65 C for 10 min Rhinogobius flumineus AB190326 and a final extension at 65◦C for 10 min. The long PCR Rhinogobius giurinus AB190338 Rhinogobius_sp. AB190335 products were purified using the DNA Gel Extraction Kit a (Tiangen, Shanghai, China). The purified products obtained Scartelaos Scartelaos histophorus NC017888 Sicyopterus Sicyopterus japonicas AB613024 in the first step, with two pairs of homologous primers Stiphodon Stiphodon alcedo NC018054a (table 1) and others (Miya and Nishida 1999)wereused Stiphodon atropurpureus AB613042 in the second PCR amplification. The PCR reactions were Stiphodon elegans AB613025 Stiphodon imperiorientis AB613026 Stiphodon percnopterygionus AB613059 Table 1. Primers used for PCR amplification of the mtDNA of Synechogobius Synechogobius ommaturus JX186192a O. rubicundus. Taenioides Taenioides anguillaris FJ968577 Taenioides cirratus FJ968576 Primer Sequence 5–3 Tridentiger Tridentiger barbatus JX536694 Tridentiger bifasciatus NC015992a a 1-F AAACCAAGGATAAGAAAGGAGC Trypauchen Trypauchen vagina NC016693 1-R TACATAAGGGACAGCAGAGAGG Valenciennea Valenciennea strigata AB429399 2-F TCTTTGCTCCTAACTACCT a 2-R TAAATCTTACCACCAATCG This accession number represents the number of complete mtDNA sequence. 424 Journal of Genetics, Vol. 92, No. 3, December 2013 Mitogenome of Odontamblyopus rubicundus Table 3. List II of species from Gobiidae used in phylogenetic analyses, with GenBank accession numbers. Genera Species Accession number Acanthogobius Acanthogobius hasta NC006131a Acentrogobius Acentrogobius pflaumii NC018064a Amblyeleotris Amblyeleotris fasciata HQ536758 HQ536784 HQ536686 Amblyeleotris guttata HQ536711 FJ796083 HQ536670 Amblyeleotris gymnocephala HQ536746 FJ796084 HQ536676 Amblyeleotris periophthalma HQ536723 FJ796085 HQ536651 Amblyeleotris steinitzi HQ536713 FJ796095 HQ536644 Amblyeleotris yanoi HQ536726 FJ796097 HQ536654 Arenigobius Arenigobius bifrenatus HQ909513
Load more

Recommended publications
  • Pacific Plate Biogeography, with Special Reference to Shorefishes
    Pacific Plate Biogeography, with Special Reference to Shorefishes VICTOR G. SPRINGER m SMITHSONIAN CONTRIBUTIONS TO ZOOLOGY • NUMBER 367 SERIES PUBLICATIONS OF THE SMITHSONIAN INSTITUTION Emphasis upon publication as a means of "diffusing knowledge" was expressed by the first Secretary of the Smithsonian. In his formal plan for the Institution, Joseph Henry outlined a program that included the following statement: "It is proposed to publish a series of reports, giving an account of the new discoveries in science, and of the changes made from year to year in all branches of knowledge." This theme of basic research has been adhered to through the years by thousands of titles issued in series publications under the Smithsonian imprint, commencing with Smithsonian Contributions to Knowledge in 1848 and continuing with the following active series: Smithsonian Contributions to Anthropology Smithsonian Contributions to Astrophysics Smithsonian Contributions to Botany Smithsonian Contributions to the Earth Sciences Smithsonian Contributions to the Marine Sciences Smithsonian Contributions to Paleobiology Smithsonian Contributions to Zoo/ogy Smithsonian Studies in Air and Space Smithsonian Studies in History and Technology In these series, the Institution publishes small papers and full-scale monographs that report the research and collections of its various museums and bureaux or of professional colleagues in the world cf science and scholarship. The publications are distributed by mailing lists to libraries, universities, and similar institutions throughout the world. Papers or monographs submitted for series publication are received by the Smithsonian Institution Press, subject to its own review for format and style, only through departments of the various Smithsonian museums or bureaux, where the manuscripts are given substantive review.
    [Show full text]
  • Ecology, Biology and Taxonomy. Mudskippers
    Chapter of the edited collection: Mangroves: Ecology, Biology and Taxonomy. Mudskippers: human use, ecotoxicology and biomonitoring of mangrove and other soft bottom intertidal ecosystems. Gianluca Polgar 1 and Richard Lim 2 1Institute of Biological Sciences, Institute of Ocean and Earth Sciences, Faculty of Science, University of Malaya, 50603 Kuala Lumpur, Malaysia. Tel. +603-7967-4609 / 4182; e-mail: [email protected] / [email protected]. Web site: www.themudskipper.org 2Centre for Environmental Sustainability, School of the Environment, Faculty of Science, University of Technology Sydney, Broadway, New South Wales 2007, Australia. e-mail: [email protected] Abstract (269) Mudskippers (Gobiidae: Oxudercinae) are air-breathing gobies, which are widely distributed throughout the West African coast and the Indo-Pacific region. They are closely linked to mangrove and adjacent soft bottom peri-tidal ecosystems. Some species are amongst the best adapted fishes to an amphibious lifestyle. All mudskippers are benthic burrowers in anoxic sediments, and since tidal mudflats are efficient sediment traps, and sinks for nutrients and other chemical compounds, they are constantly in contact with several types of pollutants produced by industrial, agricultural and domestic activities. Due to their natural abundance, considerable resistance to highly polluted conditions, and their benthic habits, mudskippers are frequently used in aquatic ecotoxicological studies. For the same reasons, mudskippers also frequently occur in urbanised or semi-natural coastal areas. Since several species are widely consumed throughout their whole geographical range, these same characteristics also facilitate their aquaculture in several countries, such as Bangladesh, Thailand, Philippines, China, Taiwan and Japan. Even when not directly used, mudskippers are often abundant and are important prey items for many intertidal transient species (marine visitors), and several species of shorebirds.
    [Show full text]
  • Rhinogobius Mizunoi, a New Species of Freshwater Goby (Teleostei: Gobiidae) from Japan
    Bull. Kanagawa prefect. Mus. (Nat. Sci.), no. 46, pp. 79-95, Feb. 2017 79 Original Article Rhinogobius mizunoi, A New Species of Freshwater Goby (Teleostei: Gobiidae) from Japan Toshiyuki Suzuki 1), Koichi Shibukawa 2) & Masahiro Aizawa 3) Abstract. A new freshwater goby, Rhinogobius mizunoi, is described based on six specimens from a freshwater stream in Shizuoka Prefecture, Japan. The species is distinguished from all congeneric species by the following combination of characters: I, 8 second dorsal-fin rays; 18–20 pectoral-fin rays; 13–18 predorsal scales; 33–35 longitudinal scales; 8 or 9 transverse scales; 10+16=26 vertebrae 26; first dorsal fin elongate in male, its distal tip reaching to base of fourth branched ray of second dorsal fin in males when adpressed; when alive or freshly-collected, cheek with several pale sky spots; caudal fin without distinct rows of dark dots; a pair of vertically- arranged dark brown blotches at caudal-fin base in young and females. Key words: amphidoromous, fish taxonomy, Rhinogobius sp. CO, valid species Introduction 6–11 segmented rays; anal fin with a single spine and 5–11 The freshwater gobies of the genus Rhinogobius Gill, segmented rays; pectoral fin with 14–23 segmented rays; 1859 are widely distributed in the East and Southeast pelvic fin with a single spine and five segmented rays; Asian regions, including the Russia Far East, Japan, 25–44 longitudinal scales; 7–16 transverse scales; P-V 3/ Korea, China, Taiwan, the Philippines, Vietnam, Laos, II II I I 0/9; 10–11+15–18= 25–29 vertebrae; body mostly Cambodia, and Thailand (Chen & Miller, 2014).
    [Show full text]
  • Information on Distribution of Round Goby
    Baltic Marine Environment Protection Commission Continuation of the project on Baltic-wide assessment of FISH-PRO II 4-2017 coastal fish communities in support of an ecosystem-based management Tallinn, Estonia, 13-15 February 2017 Document title Information on distribution of round goby Code 2-2 Category INF Agenda Item 2 – Information of relevance to FISH-PRO II Submission date 6.2.2017 Submitted by Estonia Reference Paragraph 3.13 of the Outcome of FISH-PRO II 3-2016 Background FISH-PRO II 3-2016 agreed that it would be valuable to compile information on the distribution and national monitoring of round goby. The attached document is a paper by Kotta et al.: “Shipping and natural environmental conditions determine the distribution of the invasive non-indigenous round goby Neogobius melanostomus in a regional sea.” Action requested The Meeting is invited to take note and make use of the information as appropriate. Page 1 of 1 Estuarine, Coastal and Shelf Science 169 (2016) 15e24 Contents lists available at ScienceDirect Estuarine, Coastal and Shelf Science journal homepage: www.elsevier.com/locate/ecss Shipping and natural environmental conditions determine the distribution of the invasive non-indigenous round goby Neogobius melanostomus in a regional sea * Jonne Kotta a, , Kristiina Nurkse a, Riikka Puntila b, c, Henn Ojaveer a a Estonian Marine Institute, University of Tartu, Maealuse€ 14, 12618 Tallinn, Estonia b Finnish Environment Institute, Marine Research Center, Erik Palmenin aukio 1, FI-00560 Helsinki, Finland c University of Helsinki, Department of Aquatic Sciences, P.O. Box 65, Biocenter 3, Viikinkaari 1, FI-00014, Finland article info abstract Article history: Introductions of non-indigenous species (NIS) are considered a major threat to aquatic ecosystems Received 5 March 2015 worldwide.
    [Show full text]
  • Fishes of Terengganu East Coast of Malay Peninsula, Malaysia Ii Iii
    i Fishes of Terengganu East coast of Malay Peninsula, Malaysia ii iii Edited by Mizuki Matsunuma, Hiroyuki Motomura, Keiichi Matsuura, Noor Azhar M. Shazili and Mohd Azmi Ambak Photographed by Masatoshi Meguro and Mizuki Matsunuma iv Copy Right © 2011 by the National Museum of Nature and Science, Universiti Malaysia Terengganu and Kagoshima University Museum All rights reserved. No part of this publication may be reproduced or transmitted in any form or by any means without prior written permission from the publisher. Copyrights of the specimen photographs are held by the Kagoshima Uni- versity Museum. For bibliographic purposes this book should be cited as follows: Matsunuma, M., H. Motomura, K. Matsuura, N. A. M. Shazili and M. A. Ambak (eds.). 2011 (Nov.). Fishes of Terengganu – east coast of Malay Peninsula, Malaysia. National Museum of Nature and Science, Universiti Malaysia Terengganu and Kagoshima University Museum, ix + 251 pages. ISBN 978-4-87803-036-9 Corresponding editor: Hiroyuki Motomura (e-mail: [email protected]) v Preface Tropical seas in Southeast Asian countries are well known for their rich fish diversity found in various environments such as beautiful coral reefs, mud flats, sandy beaches, mangroves, and estuaries around river mouths. The South China Sea is a major water body containing a large and diverse fish fauna. However, many areas of the South China Sea, particularly in Malaysia and Vietnam, have been poorly studied in terms of fish taxonomy and diversity. Local fish scientists and students have frequently faced difficulty when try- ing to identify fishes in their home countries. During the International Training Program of the Japan Society for Promotion of Science (ITP of JSPS), two graduate students of Kagoshima University, Mr.
    [Show full text]
  • A Dissertation Entitled Evolution, Systematics
    A Dissertation Entitled Evolution, systematics, and phylogeography of Ponto-Caspian gobies (Benthophilinae: Gobiidae: Teleostei) By Matthew E. Neilson Submitted as partial fulfillment of the requirements for The Doctor of Philosophy Degree in Biology (Ecology) ____________________________________ Adviser: Dr. Carol A. Stepien ____________________________________ Committee Member: Dr. Christine M. Mayer ____________________________________ Committee Member: Dr. Elliot J. Tramer ____________________________________ Committee Member: Dr. David J. Jude ____________________________________ Committee Member: Dr. Juan L. Bouzat ____________________________________ College of Graduate Studies The University of Toledo December 2009 Copyright © 2009 This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. _______________________________________________________________________ An Abstract of Evolution, systematics, and phylogeography of Ponto-Caspian gobies (Benthophilinae: Gobiidae: Teleostei) Matthew E. Neilson Submitted as partial fulfillment of the requirements for The Doctor of Philosophy Degree in Biology (Ecology) The University of Toledo December 2009 The study of biodiversity, at multiple hierarchical levels, provides insight into the evolutionary history of taxa and provides a framework for understanding patterns in ecology. This is especially poignant in invasion biology, where the prevalence of invasiveness in certain taxonomic groups could
    [Show full text]
  • Taxonomic Research of the Gobioid Fishes (Perciformes: Gobioidei) in China
    KOREAN JOURNAL OF ICHTHYOLOGY, Vol. 21 Supplement, 63-72, July 2009 Received : April 17, 2009 ISSN: 1225-8598 Revised : June 15, 2009 Accepted : July 13, 2009 Taxonomic Research of the Gobioid Fishes (Perciformes: Gobioidei) in China By Han-Lin Wu, Jun-Sheng Zhong1,* and I-Shiung Chen2 Ichthyological Laboratory, Shanghai Ocean University, 999 Hucheng Ring Rd., 201306 Shanghai, China 1Ichthyological Laboratory, Shanghai Ocean University, 999 Hucheng Ring Rd., 201306 Shanghai, China 2Institute of Marine Biology, National Taiwan Ocean University, Keelung 202, Taiwan ABSTRACT The taxonomic research based on extensive investigations and specimen collections throughout all varieties of freshwater and marine habitats of Chinese waters, including mainland China, Hong Kong and Taiwan, which involved accounting the vast number of collected specimens, data and literature (both within and outside China) were carried out over the last 40 years. There are totally 361 recorded species of gobioid fishes belonging to 113 genera, 5 subfamilies, and 9 families. This gobioid fauna of China comprises 16.2% of 2211 known living gobioid species of the world. This report repre- sents a summary of previous researches on the suborder Gobioidei. A recently diagnosed subfamily, Polyspondylogobiinae, were assigned from the type genus and type species: Polyspondylogobius sinen- sis Kimura & Wu, 1994 which collected around the Pearl River Delta with high extremity of vertebral count up to 52-54. The undated comprehensive checklist of gobioid fishes in China will be provided in this paper. Key words : Gobioid fish, fish taxonomy, species checklist, China, Hong Kong, Taiwan INTRODUCTION benthic perciforms: gobioid fishes to evolve and active- ly radiate. The fishes of suborder Gobioidei belong to the largest The gobioid fishes in China have long received little group of those in present living Perciformes.
    [Show full text]
  • DNA Barcoding of Gobiid Fishes (Perciformes, Gobioidei)
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by CMFRI Digital Repository http://informahealthcare.com/mdn ISSN: 1940-1736 (print), 1940-1744 (electronic) Mitochondrial DNA, Early Online: 1–5 ! 2013 Informa UK Ltd. DOI: 10.3109/19401736.2013.834438 SHORT COMMUNICATION DNA barcoding of gobiid fishes (Perciformes, Gobioidei) Divya Viswambharan1, A. Pavan-Kumar1, Dhirendra P. Singh1, A. K. Jaiswar1, S. K. Chakraborty1, J. Rajashekharan Nair2, and W. S. Lakra1 1Division of Fish Genetics and Biotechnology, Central Institute of Fisheries Education, Mumbai, Maharashtra, India and 2Department of Fishery Biology, Kerala University of Fisheries and Ocean Studies, Kochi, Kerala, India Abstract Keywords Gobiids constitute a major proportion of fish population in both tropical and temperate Cytochrome c oxidase subunit I, DNA freshwater as well as marine ecosystem. Due to their small size, cryptic ecology and ambiguous barcoding, gobiid fishes, nucleotide morphological characters, gobiids diversity was not documented completely. In this study, DNA diagnostic characters barcodes were generated for 11 species of gobiids, collected from the Ashtamudi Lake, India. The mitochondrial COI gene was amplified using universal primers and the resulted 650 bp History amplicon was sequenced. The COI barcodes clearly distinguished all the species with high inter- specific genetic distance values than intra-specific values based on K2P (Kimura 2 Parameter) Received 2 May 2013 model. The average genetic distance (K2P model) within species, genus and family was 1.2%, Revised 5 August 2013 22.2% and 25.3%, respectively. In addition to barcode-based species identification system, Accepted 10 August 2013 Nucleotide Diagnostic (ND) characters specific for species were identified.
    [Show full text]
  • Patterns of Evolution in Gobies (Teleostei: Gobiidae): a Multi-Scale Phylogenetic Investigation
    PATTERNS OF EVOLUTION IN GOBIES (TELEOSTEI: GOBIIDAE): A MULTI-SCALE PHYLOGENETIC INVESTIGATION A Dissertation by LUKE MICHAEL TORNABENE BS, Hofstra University, 2007 MS, Texas A&M University-Corpus Christi, 2010 Submitted in Partial Fulfillment of the Requirements for the Degree of DOCTOR OF PHILOSOPHY in MARINE BIOLOGY Texas A&M University-Corpus Christi Corpus Christi, Texas December 2014 © Luke Michael Tornabene All Rights Reserved December 2014 PATTERNS OF EVOLUTION IN GOBIES (TELEOSTEI: GOBIIDAE): A MULTI-SCALE PHYLOGENETIC INVESTIGATION A Dissertation by LUKE MICHAEL TORNABENE This dissertation meets the standards for scope and quality of Texas A&M University-Corpus Christi and is hereby approved. Frank L. Pezold, PhD Chris Bird, PhD Chair Committee Member Kevin W. Conway, PhD James D. Hogan, PhD Committee Member Committee Member Lea-Der Chen, PhD Graduate Faculty Representative December 2014 ABSTRACT The family of fishes commonly known as gobies (Teleostei: Gobiidae) is one of the most diverse lineages of vertebrates in the world. With more than 1700 species of gobies spread among more than 200 genera, gobies are the most species-rich family of marine fishes. Gobies can be found in nearly every aquatic habitat on earth, and are often the most diverse and numerically abundant fishes in tropical and subtropical habitats, especially coral reefs. Their remarkable taxonomic, morphological and ecological diversity make them an ideal model group for studying the processes driving taxonomic and phenotypic diversification in aquatic vertebrates. Unfortunately the phylogenetic relationships of many groups of gobies are poorly resolved, obscuring our understanding of the evolution of their ecological diversity. This dissertation is a multi-scale phylogenetic study that aims to clarify phylogenetic relationships across the Gobiidae and demonstrate the utility of this family for studies of macroevolution and speciation at multiple evolutionary timescales.
    [Show full text]
  • Reef Fishes of the Phoenix Islands, Central Pacific Ocean
    REEF FISHES OF THE PHOENIX ISLANDS, CENTRAL PACIFIC OCEAN BY GERALD ALLEN1 AND STEVEN BAILEY2 ABSTRACT Visual inventories and fish collections were conducted at the Phoenix Islands during June-July 2002. A list of fishes was compiled for 57 sites. The survey involved 163 hours of scuba diving to a maximum depth of 57 m. A total of 451 species were recorded, including 212 new records. The total known fish fauna of the Phoenix Islands now stands at 516 species. A formula for predicting the total reef fish fauna based on the number of species in six key indicator families indicates that at least 576 species can be expected to occur at this location. Wrasses (Labridae), groupers (Serranidae), gobies (Gobiidae), damselfishes (Pomacentridae), and surgeonfishes (Acanthuridae) were the most speciose families with 53, 40, 36, 36, and 32 species respectively. Species numbers at visually sampled sites during the survey ranged from 17 to 166, with an average of 110. Leeward outer reefs contained the highest diversity with an average of 135.5 species per site. Other major habitats included windward outer reefs (123.7 per site), passages (113.5), and lagoon reefs (38.5). The Napoleon Wrasse (Cheilinus undulatus) was extraordinarily abundant, providing excellent baseline information on the natural abundance of this species in the absence of fishing pressure. Conservation recommendations include protection of certain large predatory fishes including the Napoleon Wrasse, Bumphead Parrotfish, and reef sharks. INTRODUCTION The primary goal of the fish survey was to provide a comprehensive inventory of reef fishes inhabiting the Phoenix Islands. This segment of the fauna includes fishes living on or near coral reefs down to the limit of safe sport diving or approximately 55 m depth.
    [Show full text]
  • DINÂMICA EVOLUTIVA DO Dnar EM CROMOSSOMOS DE PEIXES DA FAMÍLIA ELEOTRIDAE E REVISÃO CITOGENÉTICA DA ORDEM GOBIIFORMES(OSTEICHTHYES, TELEOSTEI)
    DINÂMICA EVOLUTIVA DO DNAr EM CROMOSSOMOS DE PEIXES DA FAMÍLIA ELEOTRIDAE E REVISÃO CITOGENÉTICA DA ORDEM GOBIIFORMES(OSTEICHTHYES, TELEOSTEI) SIMIÃO ALEFE SOARES DA SILVA ________________________________________________ Dissertação de Mestrado Natal/RN, Fevereiro de 2019 UNIVERSIDADE FEDERAL DO RIO GRANDE DO NORTE CENTRO DE BIOCIÊNCIAS PROGRAMA DE PÓS-GRADUAÇÃO EM SISTEMÁTICA E EVOLUÇÃO DINÂMICA EVOLUTIVA DO DNAr EM CROMOSSOMOS DE PEIXES DA FAMÍLIA ELEOTRIDAE E REVISÃO CITOGENÉTICA DA ORDEM GOBIIFORMES (OSTEICHTHYES, TELEOSTEI) Simião Alefe Soares da Silva Dissertação apresentada ao Programa de Pós-Graduação em Sistemática e Evolução da Universidade Federal do Rio Grande do Norte, como parte dos requisitos para obtenção do título de Mestre em Sistemática e Evolução. Orientador: Dr. Wagner Franco Molina Co-Orientador: Dr. Paulo Augusto de Lima Filho Natal/RN 2019 Universidade Federal do Rio Grande do Norte - UFRN Sistema de Bibliotecas - SISBI Catalogação de Publicação na Fonte. UFRN - Biblioteca Central Zila Mamede Silva, Simião Alefe Soares da. Dinâmica evolutiva do DNAr em cromossomos de peixes da família Eleotridae e revisão citogenética da ordem gobiiformes (Osteichthyes, Teleostei) / Simião Alefe Soares da Silva. - 2019. 69 f.: il. Dissertação (mestrado) - Universidade Federal do Rio Grande do Norte, Centro de Biociências, Programa de Pós-Graduação em 1. Evolução cromossômica - Dissertação. 2. Diversificação cariotípica - Dissertação. 3. Rearranjos cromossômicos - Dissertação. 4. DNAr - Dissertação. 5. Microssatélites - Dissertação. I. Lima Filho, Paulo Augusto de. II. Molina, Wagner Franco. III. Título. RN/UF/BCZM CDU 575:597.2/.5 SIMIÃO ALEFE SOARES DA SILVA DINÂMICA EVOLUTIVA DO DNAr EM CROMOSSOMOS DE PEIXES DA FAMÍLIA ELEOTRIDAE E REVISÃO CITOGENÉTICA DA ORDEM GOBIIFORMES (OSTEICHTHYES, TELEOSTEI) Dissertação apresentada ao Programa de Pós-Graduação em Sistemática e Evolução da Universidade Federal do Rio Grande do Norte, como requisitos para obtenção do título de Mestre em Sistemática e Evolução com ênfase em Padrões e Processos Evolutivos.
    [Show full text]
  • Training Manual Series No.15/2018
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by CMFRI Digital Repository DBTR-H D Indian Council of Agricultural Research Ministry of Science and Technology Central Marine Fisheries Research Institute Department of Biotechnology CMFRI Training Manual Series No.15/2018 Training Manual In the frame work of the project: DBT sponsored Three Months National Training in Molecular Biology and Biotechnology for Fisheries Professionals 2015-18 Training Manual In the frame work of the project: DBT sponsored Three Months National Training in Molecular Biology and Biotechnology for Fisheries Professionals 2015-18 Training Manual This is a limited edition of the CMFRI Training Manual provided to participants of the “DBT sponsored Three Months National Training in Molecular Biology and Biotechnology for Fisheries Professionals” organized by the Marine Biotechnology Division of Central Marine Fisheries Research Institute (CMFRI), from 2nd February 2015 - 31st March 2018. Principal Investigator Dr. P. Vijayagopal Compiled & Edited by Dr. P. Vijayagopal Dr. Reynold Peter Assisted by Aditya Prabhakar Swetha Dhamodharan P V ISBN 978-93-82263-24-1 CMFRI Training Manual Series No.15/2018 Published by Dr A Gopalakrishnan Director, Central Marine Fisheries Research Institute (ICAR-CMFRI) Central Marine Fisheries Research Institute PB.No:1603, Ernakulam North P.O, Kochi-682018, India. 2 Foreword Central Marine Fisheries Research Institute (CMFRI), Kochi along with CIFE, Mumbai and CIFA, Bhubaneswar within the Indian Council of Agricultural Research (ICAR) and Department of Biotechnology of Government of India organized a series of training programs entitled “DBT sponsored Three Months National Training in Molecular Biology and Biotechnology for Fisheries Professionals”.
    [Show full text]