DOCSLIB.ORG

Genomic Structure of the Human Caldesmon Gene

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genomic Structure of the Human Caldesmon Gene Proc. Natd. Acad. Sci. USA Vol. 89, pp. 12122-12126, December 1992 Biochemistry Genomic structure of the human caldesmon gene (dfetatn/smooh m e/acmyos/tr yosl/c d ) KEN'ICHIRO HAYASHI*, HAJIME YANO*, TAKASHI HASHIDAt, RIE TAKEUCHIt, OSAMU TAKEDAt, Kiyozo ASADAt, EI-ICHI TAKAHASHI*, IKUNOSHIN KATOt, AND KENJI SOBUE*§ *Department of Neurochemistry and Neuropharmacology, Biomedical Research Center, Osaka University Medical School, 2-2 Yamadaoka, Suita, Osaka 565, Japan; tBiotechnology Research Laboratories, Takara Shuzo Company, Ltd., 341 Seta, Otsu-shi, Shiga 520-21, Japan; and *Division of Genetics, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263, Japan Communicated by Christian Anfinsen, September 17, 1992 ABSTRACT The high molecular weight cldemon (h- predominantly expressed in differentiated smooth muscle CaD) is predominantly expressed in smooth muscles, whereas cells and is replaced by I-CaD during dedifferentiation (12- the low molecular weight caldesmon (I-CaD) is widely distrib- 14). uted in nonmusce tissues and cells. The changes in CaD To investigate the regulation of CaD isoform expression, isoform expression are closely correlated with the phenotypic we have searched for isoform diversity of human CaDs and modulation ofsmooth muce cells. During a search for isdorm have determined the genomic structure¶ and the chromoso- diversity of human CaDs, I-CaD cDNAs were cloned from mal location ofthe CaD gene. Our studies have revealed two HeLa S3 cells. HeLa i-CaD I is composed of 558 amino acids, splice sites within exon 3 of the CaD gene. We discuss this whereas 26 amino acids (residues 202-227 for HeLa i-CaD I) feature in relation to the regulation of CaD isoform expres- are deleted in HeLa i-CaD H. The short amino i sion. sequence of HeLa i-CaDs is different from that of fibroblast (WI-38) I-Cal) H and human aorta h-CaD. We have also identiied WI-38 I-CaD I, which contains a 26-amino acid MATERIALS AND METHODS insertion relative to WI-38 I-CaD H. To reveal the mo r Cloning and Sequencing of cDNA. An oligo(dT)-primed events of the expressional regulation of the CaD iorms, the cDNA library from HeLa S3 mRNA was screened with genomic sructure ofthe human CaD gene was detemiu. The 32P-labeled restriction fragments originating from embryonic human CaD gene is composed of 14 exons and was m ed to chicken brain I-CaD cDNA. Four positive clones carrying a single locus, 7q33-q34. The 26-amino acid in is I-CaD cDNAs were obtained and their sequences were de- encoded in exon 4 and Is cay spliced in the mRNAs for termined. both h-CaD and i-CaDs I. Exon 3 is the exon that encodes the Southern Blot Analysis. Genomic DNA (5 pg) from HeLa central repeating domain specific to h-CaD (residues 208-436) S3 cells or human peripheral lymphocytes was digested with together with the common domain in all CaDs (residues 73-207 restriction enzymes and the digests were electrophoresed in for h-CaD and WI-38 i-CaDs, and residues 68-201 for HeLa 0.7% agarose gels. The separated DNA fragments were i-CaDs). The regulation of h- and i-CaD exp is thought blotted to nylon membranes by the method of Southern (15). to depend on selection of the two 5' splice sites within exon 3. The hybridization conditions with 32P-labeled HeLa i-CaD I Thus, the change In essio between I-CaD and h-CaD or II cDNA fragments have been described (9). might be caused by this splicing pathway. Reverse Trauscriptio-PR. The first-strand cDNA from each cell type was synthesized by using (dT)1218 and/or the Caldesmon (CaD), a calmodulin- and actin-binding protein, antisense primer specific to the 3' noncoding sequence of plays a vital role in the regulation of smooth muscle and human h- and I-CaD cDNAs. Primers used in this experiment nonmuscle contraction (1, 2). Two CaD isoforms have been were as follows: sense primer Pn, d(ATGCTGGGTGGATC- identified; h-CaD (high Mr, 120,000-150,000) and i-CaD (low CGGATC), specific to the short amino-terminal sequence of Mr, 70,000-80,000) asjudged by NaDodSO4/polyacrylamide HeLa I-CaDs; antisense primer Pm, d(GTTTAAGTT- gel electrophoresis (3-6). Sequencing studies on chicken TGTGGGTCATGAATTCTCC), complementary to the com- CaD cDNAs have demonstrated that the deduced molecular mon sequence in all CaD isoforms, nucleotide positions weights ofh- and i-CaD are in the range of87,000-89,000 and 832-859 in WI-38 i-CaD II cDNA; sense primer Pn2, d(CAC- 59,000-60,000, respectively, and that the major parts ofboth CATGGATGATTTTGAGCG), nucleotide positions 108- CaDs have identical amino acid sequences except for the 128 in WI-38 i-CaD II cDNA (16); and antisense primer Pi, insertion of the central repeating domain of the h-CaD d(GAAGGTAGGCTTGTCTTCTTGGAGCTTTTC), com- molecule (7-10). Structural and functional analyses have plementary to the insertion sequence of the HeLa i-CaD I revealed that the calmodulin-, actin-, and tropomyosin- sense strand (Fig. 1). DNA fragments amplified by PCR (17) binding sites contained in a region involved in the regulation were separated in 1.5% agarose gels. of actin-myosin interaction reside within the common car- Cha t a of Human CaD Gene. A human placental boxyl-terminal domain of both CaD isoforms (9, 11). The genomic library in EMBL3 was screened by hybridization tissue and cell distributions of the two isoforms are distinc- with 32P-labeled probes from the HeLa I-CaD I cDNA. tively different, however. h-CaD is primarily found in smooth Restriction mapping revealed four overlapping clones muscles, whereas i-CaD is widely distributed in nonmuscle (EMBL 11, SA, 111, and C4) and a nonoverlapping clone tissues and cells. Notably, the changes in expression of the (EMBL 2) (see Fig. 3A). Restriction fragments from each two CaD isoforms are closely correlated with phenotypic modulation of smooth muscle cells, in which h-CaD is Abbreviations: CaD, caldesmon; h-CaD, high molecular weight CaD; I-CaD, low molecular weight CaD. ITo whom reprint requests should be addressed. The publication costs ofthis article were defrayed in part by page charge IThe nucleotide sequences reported in this paper have been depos- payment. This article must therefore be hereby marked "advertisement" ited in the GenBank/EMBL/DDJB data base (accession nos. in accordance with 18 U.S.C. §1734 solely to indicate this fact. D90452 and D90453). 12122 Downloaded by guest on September 30, 2021 Biochemistry: Hayashi et al. Proc. Natd. Acad. Sci. USA 89 (1992) 12123 0Y clone were subcloned and sequenced. Clones carrying the C5~ exon that encodes, the amino-terminal domain of WI-38 i-CaDs or aorta h-CaD were obtained by using the cassette primer method. This method is based on the modification and sense Pri Pn2 Pil Pn2 improvement of the specific-primer PCR method (18, 19). antisense Prn Pm Pi Pi The specific DNA fragment containing the target exon thus obtained was used for isolation ofthe genomic clone (EMBL F5). ) 731 752__ _~af 691 Chromosomal Mapping of Human CaD Gene. The human -670 CaD gene was localized by using the genomic clones EMBL 2, 11, 111, and C4 as probes in a mapping system combining fluorescence in situ hybridization with R-banding (20, 21). FIG. 2. Characterization ofI-CaD isoforms expressed in HeLa S3 RESULTS and WI-38 cells. The reverse transcription-PCR method was done with the indicated primers sets, using first-strand cDNA from HeLa Isoform Diversity ofHuman CaDs. Sequence analysis in the S3 and WI-38 as templates. Sizes ofthe amplifiedfragments are given present study revealed the two different molecules of i-CaD in base pairs. (i-CaDs I and II) that originated from HeLa S3 cells. The primary structures of HeLa I-CaDs I and II in comparison using a HeLa-type sense primer (Pn) and the common with those ofW138 i-CaD II (16) and human aorta h-CaD (22) antisense primer (Pm). The similarly amplified DNA frag- are shown schematically in Fig. 1. HeLa i-CaD I and II are ments (752 and 830 bp) were obtained from WI-38 mRNA by composed of558 amino acids (Mr 64,252) and 532 amino acids using a WI-38-type sense primer (Pn2). The result suggests (Mr of 61,210), respectively; 26 amino acids (residues 202- that the two i-CaD isoforms are expressed in HeLa S3 and 227) of HeLa i-CaD I have been deleted in HeLa i-CaD II. WI-38 cells. In both cases, large and small DNA fragments The short amino-terminal sequences (residues 1-18) ofHeLa would be derived from the mRNAs for the respective i-CaD i-CaDs are different from those of WI-38 i-CaD II and aorta with the insertion of 26 amino acids (i-CaD I) and without it h-CaD (residues 1-24). The 26-amino acid insertion in HeLa (i-CaD II). Large DNA fragments were not well amplified, i-CaD I is found in aorta h-CaD, but not in WI38 i-CaD II. The however. Immunoblotting of HeLa S3 and WI-38 cells re- central repeating domain specific to h-CaD (residues 208- vealed that the expression of I-CaD I was very low compared 436) is deleted in all i-CaDs. To search for isoform diversity with that of I-CaD II (data not shown). Therefore, such of human CaD, the reverse transcription-PCR method was amplifications would be reflected in the amount of each introduced (Fig. 2). The primers used in this experiment are mRNA for I-CaD I or II.
Load more

Recommended publications
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]
  • Biological Functions of CDK5 and Potential CDK5 Targeted Clinical Treatments
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 10), pp: 17373-17382 Review Biological functions of CDK5 and potential CDK5 targeted clinical treatments Alison Shupp1, Mathew C. Casimiro2 and Richard G. Pestell2 1 Departments of Cancer Biology, Medical Oncology, Sidney Kimmel Cancer Center, Thomas Jefferson University, Philadelphia, PA, USA 2 Pennsylvania Cancer and Regenerative Medicine Research Center, Baruch S Blumberg Institute, Doylestown, PA, USA Correspondence to: Richard G. Pestell, email: [email protected] Keywords: CDK5, cancer Received: October 22, 2016 Accepted: December 17, 2016 Published: January 06, 2017 ABSTRACT Cyclin dependent kinases are proline-directed serine/threonine protein kinases that are traditionally activated upon association with a regulatory subunit. For most CDKs, activation by a cyclin occurs through association and phosphorylation of the CDK’s T-loop. CDK5 is unusual because it is not typically activated upon binding with a cyclin and does not require T-loop phosphorylation for activation, even though it has high amino acid sequence homology with other CDKs. While it was previously thought that CDK5 only interacted with p35 or p39 and their cleaved counterparts, Recent evidence suggests that CDK5 can interact with certain cylins, amongst other proteins, which modulate CDK5 activity levels. This review discusses recent findings of molecular interactions that regulate CDK5 activity and CDK5 associated pathways that are implicated in various diseases. Also covered herein is the growing body of evidence for CDK5 in contributing to the onset and progression of tumorigenesis. INTRODUCTION the missing 32 amino acids are encoded by exon 6 [9]. Although these two groups reported conflicting data, it has Cyclin dependent kinases are proline-directed been suggested that the identified isoforms are in fact the serine/threonine protein kinases that are traditionally same protein and the variances in their data are due to activated upon association with a regulatory subunit.
    [Show full text]
  • Proteins Regulating Cyclin Dependent Kinases Cdk4 and Cdk5
    Proteins regulating cyclin dependent kinases Cdk4an dCdk 5 Promoter: Dr.C .Veege r Emeritushoogleraa r ind eBiochemi e Landbouwuniversiteit Wageningen Co-promotoren: Dr.B . Chaudhuri Program Team Head, Oncology Research Novartis Pharmat eBase l Dr. ir.J . Visser Universitair hoofddocent sectieMoleculair e Geneticava n IndustriSle Micro-organismen Landbouwuniversiteit Wageningen /JfSO^";''V MarkJohanne sMagdalen a Willibrordus Moorthamer Proteins regulating cyclin dependent kinases Cdk4 and Cdk5 Proefschrift terverkrijgin g van degraa dva n doctor opgeza gva n derecto r magnificus van deLandbouwuniversitei t Wageningen, Dr. C. M.Karssen , inhe t openbaar te verdedigen opmaanda g2 7 September 1999 desnamiddag st evie ruu ri nd eAula . ••• * C W / * • i\) NOVARTIS Theresearc h described inthi sthesi swa scarrie d out at and financed byth e Oncology Research Department, Novartis PharmaAG ,Basel , Switzerland. ISBN 90-5808-084-6 BIBUOTHEEK LANDBOUWUNIVESST MT WAGFMTNOFN Stellingen 1. Dehypothes e dat neuroblasten vertraagd ofgestop t worden ind door verlengde expressie van cyclin D2 isnie t correct. M.E Ross &M. Risken (1995) J.Neurosci. 14, 6384-6391. 2. Degefosforyleerd e band bij ~31kD ai nfiguur 3b ,waarva n wordt beweerd dat het bacterieel eiwitis ,i shoogs t waarschijnlijk gefosforyleerd Cdk5. J. Lew,Q.-Q. Huang,Z. Qi, R.J. Winkfein, R. Aebersold, T. Hunt&J.H. Wang(1994) Nature371 423-426. 3. Telomeraseactivitei t iskarakteristie k voor kanker. Het kan echter kanker niet verklaren en hetword t ook niet exclusief bij kankercellen alleen aangetroffen. X.R Jiang,G. Jimenez, E. Chang, M. Frolkis, B.Kusler, M. Sage, M.Beeche, A.G. Bodnar, G.M. Wahl, T.D.Tlsty &C.P.
    [Show full text]
  • View of the Foregoing There Are a Nephropathy [18]
    PRACE ORYGINALNE/ORIGINAL PAPERS Endokrynologia Polska DOI: 10.5603/EP.2017.0003 Tom/Volume 68; Numer/Number 1/2017 ISSN 0423–104X Association of rs 3807337 polymorphism of CALD1 gene with diabetic nephropathy occurrence in type 1 diabetes — preliminary results of a family-based study Związek polimorfizmu rs 3807337 genuCALD1 z nefropatią cukrzycową w przebiegu cukrzycy typu 1 — wstępne wyniki badania rodzin Mirosław Śnit, Katarzyna Nabrdalik, Michał Długaszek, Janusz Gumprecht, Wanda Trautsolt, Sylwia Górczyńska-Kosiorz, Władysław Grzeszczak Department and Clinic of Internal Medicine, Diabetology, and Nephrology in Zabrze, Medical University of Silesia in Katowice, Poland Abstract Introduction: The worldwide growing burden of diabetes and end-stage renal disease due to diabetic nephropathy has become the reason for research looking for a single marker of chronic kidney disease development and progression that can be found in the early stages of the disease, when preventive action delaying the destructive process could be performed. The aim of the study was to investigate the influence of rs3807337 polymorphism of the caldesmon 1 (CALD1) gene located on the long arm of chromosome 7 encoding for protein that is connected with physiological kidney function on development of diabetic nephropathy. Material and methods: There was an association study of rs3807337 polymorphism of the CALD1 gene in parent-offspring trios by PCR- RFLP method. Ninety-nine subjects: 33 patients with diabetic nephropathy due to type 1 diabetes and 66 of their biological parents, were examined. The mode of alleles transmission from heterozygous parents to affected offspring was determined using the transmission disequilibrium test. Results: The allele G of rs3807337 polymorphism of the CALD1 gene was transmitted to affected offspring significantly more often than expected for no association.
    [Show full text]
  • Loss of LMOD1 Impairs Smooth Muscle Cytocontractility and Causes
    Loss of LMOD1 impairs smooth muscle cytocontractility PNAS PLUS and causes megacystis microcolon intestinal hypoperistalsis syndrome in humans and mice Danny Halima,1, Michael P. Wilsonb,1, Daniel Oliverc, Erwin Brosensa, Joke B. G. M. Verheijd, Yu Hanb, Vivek Nandab, Qing Lyub, Michael Doukase, Hans Stoope, Rutger W. W. Brouwerf, Wilfred F. J. van IJckenf, Orazio J. Slivanob, Alan J. Burnsa,g, Christine K. Christieb, Karen L. de Mesy Bentleyh, Alice S. Brooksa, Dick Tibboeli, Suowen Xub, Zheng Gen Jinb, Tono Djuwantonoj, Wei Yanc, Maria M. Alvesa, Robert M. W. Hofstraa,g,2, and Joseph M. Mianob,2 aDepartment of Clinical Genetics, Erasmus University Medical Center, 3015 CN Rotterdam, The Netherlands; bAab Cardiovascular Research Institute, University of Rochester School of Medicine and Dentistry, Rochester, NY 14642; cDepartment of Physiology and Cell Biology, University of Nevada School of Medicine, Reno, NV 89557; dDepartment of Genetics, University Medical Center, University of Groningen, 9700 RB Groningen, The Netherlands; eDepartment of Pathology, Erasmus University Medical Center, 3015 CN Rotterdam, The Netherlands; fCenter for Biomics, Erasmus University Medical Center, 3015 CN Rotterdam, The Netherlands; gStem Cells and Regenerative Medicine, Birth Defects Research Centre, University College London Institute of Child Health, London WC1N 1EH, United Kingdom; hDepartment of Pathology and Laboratory Medicine, University of Rochester School of Medicine and Dentistry, Rochester, NY 14642; iDepartment of Pediatric Surgery, Erasmus University Medical Center, 3015 CN Rotterdam, The Netherlands; and jDepartment of Obstetrics and Gynecology, Faculty of Medicine, Universitas Padjadjaran, Bandung, Indonesia Edited by Eric N. Olson, University of Texas Southwestern Medical Center, Dallas, TX, and approved February 21, 2017 (received for review December 13, 2016) Megacystis microcolon intestinal hypoperistalsis syndrome (MMIHS) is lacking (6, 7).
    [Show full text]
  • Erectile Dysfunction and Cancer: Current Perspective Renu Madan, Chinna Babu Dracham, Divya Khosla, Shikha Goyal, Arun Kumar Yadav
    pISSN 2234-1900 ROJ ROJ R O eISSN 2234-3156 J Radiation JournalRadiation Oncology Journal Oncology JournalRadiation Radiation Oncology Journal Radiation Oncology R a d i a t i o n O Oncology n c o l ogy J o urna l Journal Volume 38 Volume V Volume 37 • Number 4 • December 2019 2019 37 • Number 4 December Volume olume 33 • Number 3 · Number 3 · September 2020 September S ep t ember 2015 Pages 151-000 Pages Pages 232 - 308 Pages P a ges 16 1 -26 4 w www.e-roj.org www.e-roj.org w w . e - r o j Vol. 38, No. 4, December 2020 www.e-roj.org . Vol. 37, No. 4, December 2019 o r g The Korean Society for Radiation Oncology www.e-roj.org pISSN 2234-1900 eISSN 2234-3156 Vol. 38, No. 4, December 2020 Aims and Scope The Radiation Oncology Journal (ROJ) is an official journal of the Korean Society for Radiation Oncology. It was launched in 1983 as the official journal of the Korean Society of Therapeutic Radiology. It was changed in 2000 as the official journal of the Korean Society for Therapeutic Radiology and Oncology and finally in 2011 as ROJ. The aims of Radiation Oncology Journal are to contribute to the advancements in the fields of radiation oncology through the scientific reviews and interchange of all of radiation oncology. It encompasses all areas of radiation oncology that impacts on the treatment of cancer using radiation as well basic experimental work relating radiation oncology and health policy. It publishes papers describing clinical radiotherapy, combined modality therapy, radiation biology, cancer biology, radiation physics, radiation informatics and new technology including particle therapy.
    [Show full text]
  • Gene Amplifications at Chromosome 7 of the Human Gastric Cancer Genome
    225-231 4/7/07 20:50 Page 225 INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 20: 225-231, 2007 225 Gene amplifications at chromosome 7 of the human gastric cancer genome SANGHWA YANG Cancer Metastasis Research Center, Yonsei University College of Medicine, 134 Shinchon-Dong, Seoul 120-752, Korea Received April 20, 2007; Accepted May 7, 2007 Abstract. Genetic aberrations at chromosome 7 are known to Introduction be related with diverse human diseases, including cancer and autism. In a number of cancer research areas involving gastric The completion of human genome sequencing and the cancer, several comparative genomic hybridization studies subsequent gene annotations, together with a rapid develop- employing metaphase chromosome or BAC clone micro- ment of high throughput screening technologies, such as DNA arrays have repeatedly identified human chromosome 7 microarrays, have made it possible to perform genome-scale as containing ‘regions of changes’ related with cancer expression profiling and comparative genomic hybridizations progression. cDNA microarray-based comparative genomic (CGHs) in various cancer models. The elucidation of gene hybridization can be used to directly identify individual target copy number variations in several cancer genomes is generating genes undergoing copy number variations. Copy number very informative results. Metaphase chromosome CGH and change analysis for 17,000 genes on a microarray format was the recent introduction of BAC and especially cDNA micro- performed with tumor and normal gastric tissues from 30 array-based CGHs (aCGH) (1) have greatly contributed to patients. A group of 90 genes undergoing copy number the identification of chromosome aberrations and of amplified increases (gene amplification) at the p11~p22 or q21~q36 and deleted genes in gastric cancer tissues and cell lines (2-9).
    [Show full text]
  • Update on Endometrial Stromal Tumours of the Uterus
    diagnostics Review Update on Endometrial Stromal Tumours of the Uterus Iolia Akaev 1,* , Chit Cheng Yeoh 2 and Siavash Rahimi 1,3 1 School of Pharmacy and Biomedical Sciences, University of Portsmouth, St. Michaels Building, White Swan Road, Portsmouth PO1 2DT, UK; [email protected] 2 Department of Oncology, Portsmouth Hospitals University NHS Trust, Southwick Hill Road, Portsmouth PO6 3LY, UK; [email protected] 3 Department of Histopathology, Brighton and Sussex University Hospitals NHS Trust, Royal Sussex County Hospital, Brighton BN2 5BE, UK * Correspondence: [email protected] Abstract: Endometrial stromal tumours (ESTs) are rare, intriguing uterine mesenchymal neoplasms with variegated histopathological, immunohistochemical and molecular characteristics. Morphologically, ESTs resemble endometrial stromal cells in the proliferative phase of the men- strual cycle. In 1966 Norris and Taylor classified ESTs into benign and malignant categories according to the mitotic count. In the most recent classification by the WHO (2020), ESTs have been divided into four categories: Endometrial Stromal Nodules (ESNs), Low-Grade Endometrial Stromal Sarcomas (LG-ESSs), High-Grade Endometrial Stromal Sarcomas (HG-ESSs) and Undifferentiated Uterine Sarcomas (UUSs). ESNs are clinically benign. LG-ESSs are tumours of low malignant potential, often with indolent clinical behaviour, with some cases presented with a late recurrence after hys- terectomy. HG-ESSs are tumours of high malignant potential with more aggressive clinical outcome. UUSs show high-grade morphological features with very aggressive clinical behavior. With the advent of molecular techniques, the morphological classification of ESTs can be integrated with molecular findings in enhanced classification of these tumours. In the future, the morphological and immunohistochemical features correlated with molecular categorisation of ESTs, will become a Citation: Akaev, I.; Yeoh, C.C.; robust means to plan therapeutic decisions, especially in recurrences and metastatic disease.
    [Show full text]
  • Differential Gene Regulation in Fibroblasts in Co-Culture with Keratinocytes and Head and Neck SCC Cells
    ANTICANCER RESEARCH 35: 3253-3266 (2015) Differential Gene Regulation in Fibroblasts in Co-culture with Keratinocytes and Head and Neck SCC Cells MALIN HAKELIUS1, DANIEL SAIEPOUR1, HANNA GÖRANSSON2, KRISTOFER RUBIN3, BENGT GERDIN1 and DANIEL NOWINSKI1 Departments of 1Surgical Sciences, Plastic Surgery and 3Medical Biochemistry and Microbiology, Uppsala University, Uppsala, Sweden; 2Array Facility, Department of Medical Sciences, Uppsala University, Uppsala, Sweden Abstract. Background: While carcinoma-associated growth. In cancers, this microenvironment, or tumor stroma, fibroblasts (CAFs) support tumorigenesis, normal tissue constitutes the backbone of the tumor and is essential for the fibroblasts suppress tumor progression. Mechanisms behind cohesiveness of the tumor tissue the tumor’s ability to thrive conversion of fibroblasts into a CAF phenotype are largely (1). This stroma has considerable similarities with that of unrevealed. Materials and Methods: Transwell co-cultures non-malignant repair processes that are characterized by with fibroblasts in collagen gels and squamous-cell activation of fibroblasts and neoformation of stromal tissue, carcinoma (SCC) cells or normal oral keratinocytes (NOKs) which has led to the concept of a tumor as a "wound that in inserts. Differences in fibroblast global gene expression never heals" (2). were analyzed using Affymetrix arrays and subsequent A fibroblast phenotype characterized by expression of functional annotation and cluster analysis, as well as gene alpha-smooth muscle actin (SMA), platelet-derived growth set enrichment analysis were performed. Results: There were factor receptor-beta (PDGFR-β) and the pericyte marker 52 up-regulated and 30 down-regulated transcript IDs neuron glial antigen 2 (NG2) is regarded as a key cell in the (>2-fold, p<0.05) in fibroblasts co-cultured with SCC tumor stroma (3).
    [Show full text]
  • Linking Electronic Health Records with the Biomedical Literature
    LINKING ELECTRONIC HEALTH RECORDS WITH THE BIOMEDICAL LITERATURE A THESIS SUBMITTED TO THE UNIVERSITY OF MANCHESTER FOR THE DEGREE OF DOCTOR OF PHILOSOPHY IN THE FACULTY OF SCIENCE AND ENGINEERING 2016 By Xiao Fu School of Computer Science Contents List of Tables ............................................................................................................... 5 List of Figures ............................................................................................................. 7 Abstract ..................................................................................................................... 10 Declaration ................................................................................................................ 11 Copyright ................................................................................................................... 12 Acknowledgements ................................................................................................... 14 Abbreviations ............................................................................................................ 15 1 Introduction ........................................................................................................... 19 1.1 Motivation ........................................................................................................ 19 1.2 Research hypotheses and objectives ................................................................ 20 1.3 Overview of contributions ...............................................................................
    [Show full text]
  • Caldesmon Effects on the Actin Cytoskeleton and Cell Adhesion in Cultured HTM Cells
    Experimental Eye Research 82 (2006) 945–958 www.elsevier.com/locate/yexer Caldesmon effects on the actin cytoskeleton and cell adhesion in cultured HTM cells Inna Grosheva a,1, Jason L. Vittitow b, Polina Goichberg a, B’Ann True Gabelt c,*, Paul L. Kaufman c, Terete Borra´s b, Benjamin Geiger a, Alexander D. Bershadsky a a Department of Molecular Cell Biology, Weizmann Institute of Science, Rehovot 76100, Israel b Department of Ophthalmology, University of North Carolina, 6109 NeuroSci Res Building, Box 7041, Chapel Hill, NC, USA c Department of Ophthalmology & Visual Sciences, University of Wisconsin, 600 Highland Avenue, F4/340 CSC, Madison, WI 53792, USA Received 19 September 2005; accepted in revised form 17 January 2006 Abstract Caldesmon is a multifunctional ubiquitous regulator of the actin cytoskeleton, which can affect both actomyosin contractility and actin polymerization. Previous studies showed that caldesmon over-expression in cultured fibroblasts produces effects that resemble those of chemical inhibitors of cellular contractility. Since these inhibitors (H-7, Y-27632, etc.) have been shown to lower intraocular pressure and increase outflow facility from the anterior chamber of the eye, we proposed that caldesmon might be used for gene therapy of glaucoma. In the present study we examined the effects of expression of adenovirus-delivered rat non-muscle caldesmon fused with green fluorescent protein (AdCaldGFP) on the actin cytoskeleton and matrix adhesions in cultured human trabecular meshwork (HTM) cells. In addition, we assessed the effect of caldesmon on the stability of cell–cell junctions in kidney epithelial MDCK cells. Cultured HTM cells demonstrate a well-developed actin cytoskeleton, comprising mainly arrays of parallel actomyosin bundles (stress fibers).
    [Show full text]
  • Network-Based Analysis of Oligodendrogliomas Predicts Novel
    Gladitz et al. Acta Neuropathologica Communications (2018) 6:49 https://doi.org/10.1186/s40478-018-0544-y RESEARCH Open Access Network-based analysis of oligodendrogliomas predicts novel cancer gene candidates within the region of the 1p/19q co-deletion Josef Gladitz1, Barbara Klink2,3 and Michael Seifert1,3* Abstract Oligodendrogliomas are primary human brain tumors with a characteristic 1p/19q co-deletion of important prognostic relevance, but little is known about the pathology of this chromosomal mutation. We developed a network-based approach to identify novel cancer gene candidates in the region of the 1p/19q co-deletion. Gene regulatory networks were learned from gene expression and copy number data of 178 oligodendrogliomas and further used to quantify putative impacts of differentially expressed genes of the 1p/19q region on cancer-relevant pathways. We predicted 8 genes with strong impact on signaling pathways and 14 genes with strong impact on metabolic pathways widespread across the region of the 1p/19 co-deletion. Many of these candidates (e.g. ELTD1, SDHB, SEPW1, SLC17A7, SZRD1, THAP3, ZBTB17) are likely to push, whereas others (e.g. CAP1, HBXIP, KLK6, PARK7, PTAFR) might counteract oligodendroglioma development. For example, ELTD1, a functionally validated glioblastoma oncogene located on 1p, was overexpressed. Further, the known glioblastoma tumor suppressor SLC17A7 located on 19q was underexpressed. Moreover, known epigenetic alterations triggered by mutated SDHB in paragangliomas suggest that underexpressed SDHB in oligodendrogliomas may support and possibly enhance the epigenetic reprogramming induced by the IDH-mutation. We further analyzed rarely observed deletions and duplications of chromosomal arms within oligodendroglioma subcohorts identifying putative oncogenes and tumor suppressors that possibly influence the development of oligodendroglioma subgroups.
    [Show full text]