Proc. Natd. Acad. Sci. USA Vol. 89, pp. 12122-12126, December 1992 Biochemistry Genomic structure of the human caldesmon gene (dfetatn/smooh m e/acmyos/tr yosl/c d ) KEN'ICHIRO HAYASHI*, HAJIME YANO*, TAKASHI HASHIDAt, RIE TAKEUCHIt, OSAMU TAKEDAt, Kiyozo ASADAt, EI-ICHI TAKAHASHI*, IKUNOSHIN KATOt, AND KENJI SOBUE*§ *Department of Neurochemistry and Neuropharmacology, Biomedical Research Center, Osaka University Medical School, 2-2 Yamadaoka, Suita, Osaka 565, Japan; tBiotechnology Research Laboratories, Takara Shuzo Company, Ltd., 341 Seta, Otsu-shi, Shiga 520-21, Japan; and *Division of Genetics, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263, Japan Communicated by Christian Anfinsen, September 17, 1992 ABSTRACT The high molecular weight cldemon (h- predominantly expressed in differentiated smooth muscle CaD) is predominantly expressed in smooth muscles, whereas cells and is replaced by I-CaD during dedifferentiation (12- the low molecular weight caldesmon (I-CaD) is widely distrib- 14). uted in nonmusce tissues and cells. The changes in CaD To investigate the regulation of CaD isoform expression, isoform expression are closely correlated with the phenotypic we have searched for isoform diversity of human CaDs and modulation ofsmooth muce cells. During a search for isdorm have determined the genomic structure¶ and the chromoso- diversity of human CaDs, I-CaD cDNAs were cloned from mal location ofthe CaD gene. Our studies have revealed two HeLa S3 cells. HeLa i-CaD I is composed of 558 amino acids, splice sites within exon 3 of the CaD gene. We discuss this whereas 26 amino acids (residues 202-227 for HeLa i-CaD I) feature in relation to the regulation of CaD isoform expres- are deleted in HeLa i-CaD H. The short amino i sion. sequence of HeLa i-CaDs is different from that of fibroblast (WI-38) I-Cal) H and human aorta h-CaD. We have also identiied WI-38 I-CaD I, which contains a 26-amino acid MATERIALS AND METHODS insertion relative to WI-38 I-CaD H. To reveal the mo r Cloning and Sequencing of cDNA. An oligo(dT)-primed events of the expressional regulation of the CaD iorms, the cDNA library from HeLa S3 mRNA was screened with genomic sructure ofthe human CaD gene was detemiu. The 32P-labeled restriction fragments originating from embryonic human CaD gene is composed of 14 exons and was m ed to chicken brain I-CaD cDNA. Four positive clones carrying a single locus, 7q33-q34. The 26-amino acid in is I-CaD cDNAs were obtained and their sequences were de- encoded in exon 4 and Is cay spliced in the mRNAs for termined. both h-CaD and i-CaDs I. Exon 3 is the exon that encodes the Southern Blot Analysis. Genomic DNA (5 pg) from HeLa central repeating domain specific to h-CaD (residues 208-436) S3 cells or human peripheral lymphocytes was digested with together with the common domain in all CaDs (residues 73-207 restriction enzymes and the digests were electrophoresed in for h-CaD and WI-38 i-CaDs, and residues 68-201 for HeLa 0.7% agarose gels. The separated DNA fragments were i-CaDs). The regulation of h- and i-CaD exp is thought blotted to nylon membranes by the method of Southern (15). to depend on selection of the two 5' splice sites within exon 3. The hybridization conditions with 32P-labeled HeLa i-CaD I Thus, the change In essio between I-CaD and h-CaD or II cDNA fragments have been described (9). might be caused by this splicing pathway. Reverse Trauscriptio-PR. The first-strand cDNA from each cell type was synthesized by using (dT)1218 and/or the Caldesmon (CaD), a calmodulin- and actin-binding protein, antisense primer specific to the 3' noncoding sequence of plays a vital role in the regulation of smooth muscle and human h- and I-CaD cDNAs. Primers used in this experiment nonmuscle contraction (1, 2). Two CaD isoforms have been were as follows: sense primer Pn, d(ATGCTGGGTGGATC- identified; h-CaD (high Mr, 120,000-150,000) and i-CaD (low CGGATC), specific to the short amino-terminal sequence of Mr, 70,000-80,000) asjudged by NaDodSO4/polyacrylamide HeLa I-CaDs; antisense primer Pm, d(GTTTAAGTT- gel electrophoresis (3-6). Sequencing studies on chicken TGTGGGTCATGAATTCTCC), complementary to the com- CaD cDNAs have demonstrated that the deduced molecular mon sequence in all CaD isoforms, nucleotide positions weights ofh- and i-CaD are in the range of87,000-89,000 and 832-859 in WI-38 i-CaD II cDNA; sense primer Pn2, d(CAC- 59,000-60,000, respectively, and that the major parts ofboth CATGGATGATTTTGAGCG), nucleotide positions 108- CaDs have identical amino acid sequences except for the 128 in WI-38 i-CaD II cDNA (16); and antisense primer Pi, insertion of the central repeating domain of the h-CaD d(GAAGGTAGGCTTGTCTTCTTGGAGCTTTTC), com- molecule (7-10). Structural and functional analyses have plementary to the insertion sequence of the HeLa i-CaD I revealed that the calmodulin-, actin-, and tropomyosin- sense strand (Fig. 1). DNA fragments amplified by PCR (17) binding sites contained in a region involved in the regulation were separated in 1.5% agarose gels. of actin-myosin interaction reside within the common car- Cha t a of Human CaD Gene. A human placental boxyl-terminal domain of both CaD isoforms (9, 11). The genomic library in EMBL3 was screened by hybridization tissue and cell distributions of the two isoforms are distinc- with 32P-labeled probes from the HeLa I-CaD I cDNA. tively different, however. h-CaD is primarily found in smooth Restriction mapping revealed four overlapping clones muscles, whereas i-CaD is widely distributed in nonmuscle (EMBL 11, SA, 111, and C4) and a nonoverlapping clone tissues and cells. Notably, the changes in expression of the (EMBL 2) (see Fig. 3A). Restriction fragments from each two CaD isoforms are closely correlated with phenotypic modulation of smooth muscle cells, in which h-CaD is Abbreviations: CaD, caldesmon; h-CaD, high molecular weight CaD; I-CaD, low molecular weight CaD. ITo whom reprint requests should be addressed. The publication costs ofthis article were defrayed in part by page charge IThe nucleotide sequences reported in this paper have been depos- payment. This article must therefore be hereby marked "advertisement" ited in the GenBank/EMBL/DDJB data base (accession nos. in accordance with 18 U.S.C. §1734 solely to indicate this fact. D90452 and D90453). 12122 Downloaded by guest on September 30, 2021 Biochemistry: Hayashi et al. Proc. Natd. Acad. Sci. USA 89 (1992) 12123 0Y clone were subcloned and sequenced. Clones carrying the C5~ exon that encodes, the amino-terminal domain of WI-38 i-CaDs or aorta h-CaD were obtained by using the cassette primer method. This method is based on the modification and sense Pri Pn2 Pil Pn2 improvement of the specific-primer PCR method (18, 19). antisense Prn Pm Pi Pi The specific DNA fragment containing the target exon thus obtained was used for isolation ofthe genomic clone (EMBL F5). ) 731 752__ _~af 691 Chromosomal Mapping of Human CaD Gene. The human -670 CaD gene was localized by using the genomic clones EMBL 2, 11, 111, and C4 as probes in a mapping system combining fluorescence in situ hybridization with R-banding (20, 21). FIG. 2. Characterization ofI-CaD isoforms expressed in HeLa S3 RESULTS and WI-38 cells. The reverse transcription-PCR method was done with the indicated primers sets, using first-strand cDNA from HeLa Isoform Diversity ofHuman CaDs. Sequence analysis in the S3 and WI-38 as templates. Sizes ofthe amplifiedfragments are given present study revealed the two different molecules of i-CaD in base pairs. (i-CaDs I and II) that originated from HeLa S3 cells. The primary structures of HeLa I-CaDs I and II in comparison using a HeLa-type sense primer (Pn) and the common with those ofW138 i-CaD II (16) and human aorta h-CaD (22) antisense primer (Pm). The similarly amplified DNA frag- are shown schematically in Fig. 1. HeLa i-CaD I and II are ments (752 and 830 bp) were obtained from WI-38 mRNA by composed of558 amino acids (Mr 64,252) and 532 amino acids using a WI-38-type sense primer (Pn2). The result suggests (Mr of 61,210), respectively; 26 amino acids (residues 202- that the two i-CaD isoforms are expressed in HeLa S3 and 227) of HeLa i-CaD I have been deleted in HeLa i-CaD II. WI-38 cells. In both cases, large and small DNA fragments The short amino-terminal sequences (residues 1-18) ofHeLa would be derived from the mRNAs for the respective i-CaD i-CaDs are different from those of WI-38 i-CaD II and aorta with the insertion of 26 amino acids (i-CaD I) and without it h-CaD (residues 1-24). The 26-amino acid insertion in HeLa (i-CaD II). Large DNA fragments were not well amplified, i-CaD I is found in aorta h-CaD, but not in WI38 i-CaD II. The however. Immunoblotting of HeLa S3 and WI-38 cells re- central repeating domain specific to h-CaD (residues 208- vealed that the expression of I-CaD I was very low compared 436) is deleted in all i-CaDs. To search for isoform diversity with that of I-CaD II (data not shown). Therefore, such of human CaD, the reverse transcription-PCR method was amplifications would be reflected in the amount of each introduced (Fig. 2). The primers used in this experiment are mRNA for I-CaD I or II.