Molecular Cloning, Characterization and Evolutionary Analysis of Leptin

Open Life Sci. 2017; 12: 406–417

Research Article

Hai-feng Tian, Qiao-mu Hu, Yan Meng, Han-bing Xiao* Molecular cloning, characterization and evolutionary analysis of leptin gene in Chinese giant salamander, Andrias davidianus https://doi.org/10.1515/biol-2017-0048 Received March 30, 2017; accepted May 15, 2017 1 Introduction

Abstract: Leptin is an important hormone possessing Leptin, the protein product of the obese (ob or Lep) gene, diverse physiological roles in mammals and teleosts. was first cloned in ob/ob mice [1], and then was identified However, it has been characterized only in a few amphibian in human and other mammals (reviewed in [2]). Leptins species, and its evolutions are still under debate. Here, also were identified in non-mammalians, including birds the full length of the leptin (Adlep) cDNA of Chinese giant [3-5], reptiles [2], amphibians [6-8], and teleosts, the salamander (Andrias davidianus), an early diverging later generally possess duplicated leptins [8-15]. Leptin amphibian species, is characterized and according to the has been found to be responsible for the regulation of results of the primary sequence analysis, tertiary structure body weight and energy homeostasis [16,17], and it also reconstruction and phylogenetic analysis is confirmed is involved in regulating appetite, reproduction [18], the to be an ortholog of mammalian leptin. An intron was immune system [19], bone formation [20], angiogenesis identified between the coding exons of A. davidianus [21], and stress response [22,23]. leptin, which indicated that the leptin is present in the The primary amino acid sequences of leptins show low salamander genome and contains a conserved gene conservation among vertebrates. The identity of the leptin structure in vertebrates. Adlep is widely distributed but protein in Xenopus to that of pufferfish, human, and tiger expression levels vary among different tissues, with salamander (Ambystoma tigrinum) is 13%, 35%, and 60%, highest expression levels in the muscle. Additionally, the respectively [6,7,9]. Although, positive selections of leptins leptin receptor and other genes were mapped to three are revealed in several mammal lineages, for example, known leptin signaling pathways, suggesting that the pikas (Ochotona curzoniae), Cetacea and Pinnipedia, and leptin signaling pathways are present in A. davidianus. heterothermic bats [24-26], the conserved gene structure Phylogenetic topology of leptins are consistent with (three exons separated by two introns) and secondary the generally accepted evolutionary relationships of and tertiary structures of leptins were found from teleosts vertebrates, and multiple leptin members found in teleosts to mammals [2,3,6,11,27,28]. Phylogeny reconstruction seem to be obtained through a Cluopeocephala-specific of vertebrate leptins showed that most vertebrates form gene duplication event. Our results will lay a foundation distinct clades with topology consistent with the generally for further investigations into the physiological roles of accepted vertebrate topology except that the relationships leptin in A. davidianus. among teleosts remain inconsistent [2,11,29]. Leptin is mainly expressed in adipose tissue, Keywords: Leptin (Lep); tissue expression; evolution; stomach and liver in mammals [2], however, expression leptin signaling pathways; Andrias davidianus of leptins in non-mammalians is variable. For example, leptin mRNA is widely distributed in brain, pituitary and heart tissue in frogs [6], different individuals show different tissue distributions in tiger salamander [7], and *Corresponding author: Han-bing Xiao, No. 8, 1st Wudayuan Road, different tissue expressions among taxa in teleosts, such Donghu Hi-Tech Development Zone, Wuhan 430223, China, E-mail: as mainly expressed in liver in most ﬁsh species [29], [email protected] weakly and transiently expressed in adipose of rainbow Hai-feng Tian, Qiao-mu Hu, Yan Meng, Yangtze River Fisheries trout (Oncorhynchus mykiss) [30], and widely expressed in Research Institute, Chinese Academy of Fishery Sciences, Wuhan 430223, P. R. China tilapia [31]. Interestingly, leptins seem to exert pleiotropic

Open Access. © 2017 Hai-feng Tian et al., published by De Gruyter Open. This work is licensed under the Creative Commons Attribution- NonCommercial-NoDerivs 4.0 License. Molecular cloning, characterization and evolutionary analysis of leptin gene in Chinese giant salamander 407 effects in both mammals and non-mammalians 2.2 Cloning the full-length cDNA and [2,3,6,29,32-34]. For example, leptins possess roles in food intronic DNA of Adlep intake and energy metabolism in mammals [35,36], growth and reproduction in birds [3], growth and development Total RNA of 12 tissues were isolated using TRIZOL of the hind limb in X. laevis [6], and food intake and (Takara, Dalian, China) based on the manufacturer’s reproduction in teleosts [37,38]. Generally, more diverse protocol, and then tissues were treated with DNase I physiological roles have been characterized in teleosts (THERMO SCIENTIFIC) to remove genomic DNA and in contrast to those found in mammals [39]. Hence, the used as templates for the following experiments. The evolution of multiple functional leptins becomes an first stand of cDNA was obtained by using SuperScript III interesting question. However, due to the inconsistency transcriptase (Invitrogene, Carlsbad, CA, USA) following of the phylogenetic analysis of leptins, especially for the manufacturer’s instructions. One annotated leptin those teleostean homologs [2,29,40,41], identifying more gene sequence (m.112490) was found in the transcriptome leptins and characterizing their physiological roles in of A. davidianus in our previous work [50]. Here, the non-mammals, especially in amphibians, would help to internal region of leptin in A. davidianus was obtained by address this question. To our knowledge, leptin had only using one pair of primers designed according to the partial been characterized in two amphibian species, in which sequence of leptin in A. davidianus mentioned above they are involved in regulating food intake, growth rate, (Table 1). Then, based on the obtained sequence, primers and bone and lung development [6,7,42,43]. were designed (Table 1) and the 5’- and 3’- terminus were The Chinese giant salamander (A. davidianus) obtained by using 5’- and 3’- RACE System (Clontech, belongs to the family Cryptobranchidae, which is thought Palo Alto, CA, USA) according to the manufacturer’s to be a primitive group within the Caudata based on recommendations. PCR amplification products were molecular and fossil evidence [44-46]. Moreover, a examined by electrophoresis using 1% agarose gel with rapidly growing industry to farm this species has been the DL2000 marker (Takara, Dalian, China). The purified developed throughout China during past two decades sequence fragments were cloned into a pMD-18 T vector and [47], which is mainly based on controlled artificial sequenced. All obtained sequence data were assembled propagation [48] and ecological breeding methods [49]. using the LasergeneSeqMan program (DNAStar, Madison, Noticeably, significant weight differences (5- to 15- fold) WI, USA). Prediction of Open Reading Frames (ORF) was have been found in one- and two-year-old artificial carried out using the EditSeq program (DNASTAR). The propagated populations (unpublished data), which led sequence of the signal peptide was predicted using the us to identify and characterize leptin in A. davidianus. program SignalP 4.1 (http://www.cbs.dtu.dk/services/ Therefore, the objectives of the present study were: (1) to SignalP/) [51]. The domains were predicted on the Pfam clone and analyze the characteristics of leptin genes in A. server (http://pfam.xfam.org/). davidianus; (2) to examine the tissue distribution of the For the quantitative real-time PCR (qPCR) analysis, genes in A. davidianus; and (3) to investigate the evolution total RNA from 12 different tissues were extracted, and of the leptin gene in vertebrates. their first-strand cDNAs were synthesized as mentioned above. The qPCR was performed on a BIO-RAD Connect™ CFX using Power SYBR® Green PCR Master Mix. The 2 Materials and Methods specific primers for qPCR are listed in Table 1. The reaction contained: 10 µL of 2× PCR Master Mix, 1 µL of forward 2.1 Sample collection primer, 1 µL of reverse primer, 1 µL of cDNA template, and

7 µL of H2O. The PCR protocols were as follows: initial The individuals of A. davidianus used in this study were denaturation at 95°C for 2 min, 40 cycles of 95°C for 10 cultured in Yangtze River Fisheries Research Institute, s, 55°C for 20 s, 72°C for 20 s. The melting curves were Chinese Academy of Fisheries Science. Three one-year- analyzed at 65–95°C after 40 cycles. Each PCR analysis old male salamanders were anesthetized according to was performed in triplicate. Relative expression analysis the standards of the Chinese Council on Animal Care. is normalized against the β-actin. The values were Organ tissues, including kidney, spleen, lung, stomach, expressed as mean ± standard error of the mean (SEM). skin, muscle, intestine, gonad, heart, liver, brain, and The expression difference was analyzed by one-way pituitary gland, were collected and preserved in RNA Lock ANOVA with Tukey adjustment using GraphPad Prism Stabilizer Reagent (E.Z.N.A.® RNA-Lock Reagent; Omega Software (GraphPad Software Inc., San Diego, CA, USA). Bio-Tek Inc.) for RNA extraction. Significance was set at P < 0.05. 408 H. Tian, et al.

In order to obtain the genomic sequence of the protein modeling program MODELLER9v14 [52-54]. leptin in A. davidianus, genomic DNA of muscle was After alignment, a bundle of 20 models from random isolated using the Blood & Cell Culture DNA Kit (QIAGEN, generation of the starting structure was calculated, and Hilden, Germany) according to the manufacturer’s the best one was selected according to the lowest molpdf recommendations. Primers for PCR ampliﬁcation of the and DOPE score implemented within Modeller [52-54]. leptin gene intron are listed in Table 1. The obtained The selected best model was further subjected to loop PCR products were sequenced and then assembled by refinement in Modeller. To gain better relaxation and a using DNASTAR. The intron was characterized by using more correct arrangement of the atoms, the best model sequence alignment of the obtained genomic region with after loop refinement was further subjected to energy the full length cDNA. minimization by GROMOS96 force field provided by Swiss-Pdb Viewer V4.1.0 [55] using the steepest descent method of 200 steps. The predicted model also was 2.3 Tertiary structural analysis subjected to energy minimization using the steepest descent technique to check for non-compatible contacts The predicted amino acid sequence of Adlep gene was within the protein. Computations were carried out used as query to Blast search against the Protein Data Bank in vacuo with the GROSMOS96 43B1 parameters set, (PDB)to obtain the template protein based on sequence implemented through Swiss-pdb Viewer [56] with default homology. The X-ray structure of the Crystal structure of settings. The obtained model was then validated using the human obesity protein, leptin (Chain A) was the best Ramachandran plot with the PROCHECK program [57] mold found (PDBID: 1AX8) [1]. Thus, the human obesity (a Windows version prepared by Bernhard Rupp, http:// protein leptin (Chain A) was used as template to analyze www.ruppweb.org/ftp_warning.html) and the overall the structural model of the enzyme Adlep in A. davidianus. quality factor with Errat on the Structural Analysis The template and target sequences were aligned and Veriﬁcation Server (http://nihserver.mbi.ucla.edu/ using the align2d script available in comparative SAVES/).

Table 1. Primers used in this study

Experiments Primer Names 5’-3’ sequence

Internal region 1 Adlep_f: : GGAAAGCCAGGGAACCCAA Adlep_r: TGCTCCAGATGTTTGACGATGTTAT 5’RACE Adlep5’-1: ATCTCCAGGGTCTCAT Adlep5’-2: TGCTCTCCTGGGATGAAGTC Adlep5’-3: AAGGAACTGGCAGGGGTG 3’RACE Adlep 3’ -1: AGGAGTACGCCAAGTCCCCATACA Adlep 3’ -2: CCATAACATCGTCAAACATCCG qPCR Adlep-F2 AGAACCTCCGAAGCCTTCTC Adlep-R2 CCCAAAAGCCAACCGAGAAA Control β-actin-F1 CCCAAAAGCCAACCGAGAAA β-actin-R1 GACACCATCACCAGAGTCCA Intron-cloning F1: AAAATGCGCTACCCTGGT R1: CAGGGGTGGTCCTGTAGTC F2: GCCAGACTACAGGACCAC R2: ATCTCCAGGGTCTCAT F3: TGGACTCTGTGGATGAGAC R3: AGCTCAGGGTCTTCCGTGTC F4: CTGCTCGGCTGTACGACAC R4: TCCTCAGCAGCTCGTAGC Molecular cloning, characterization and evolutionary analysis of leptin gene in Chinese giant salamander 409

2.4 Phylogeny analysis to analysis against the Kyoto Encyclopedia of Genes and Genomes (KEGG) to assign their functions to the known The full-length Adlep gene sequence was used as a query biological pathways. to search against the NCBI Refseq protein database to obtain leptin homologs in other species, and then they Ethical approval: The research related to animals use has were extracted along with corresponding nucleotide been complied with all the relevant national regulations sequences. Amino-acid sequences were aligned using and institutional policies for the care and use of animals. MUSCLE (version 3.8.31) [58] and ambiguous regions were removed manually. Phylogenetic analyses were conducted using Bayesian inference and Maximum- 3 Results Likelihood (ML) methods. Bayesian inference was carried out in MrBAYES v3.2.2 [59] using the Metropolis-coupled 3.1 Cloning and sequence analysis of the Markov chain Monte Carlo (MCMCMC) algorithm, with leptin in A. davidianus four incrementally heated Markov chains, sampled every 1,000 generations with the temperature set to 0.5. Amino One full length coding sequences (CDS) of leptin named acid site substitution rate heterogeneity was corrected as Adlep was obtained in A. davidianus and deposited with an invariable and eight Γ- distributed substitution into GenBank under the accession number KX241573. The rate categories and the Whelan and Goldman (WAG) one leptin sequence segment found in the transcriptomic model for amino acid substitutions, abbreviated herein sequences of A. davidianus in our previous work was as WAG+I+8G. Two separate runs were performed to confirmed to be the internal region of the Adlep. The confirm the convergence of the chains. The average obtained Adlep is composed of a 169 bp 5’UTR sequence, standard deviation of split frequencies and the potential a 1,232 bp 3’ UTR sequence, and a 510 bp CDS sequence scale reduction factor convergence diagnostic were used encoding a protein of 169 amino acids with a calculated to assess the convergence of the two runs. Trees below molecular mass of 19.33 kDa and an estimated isoelectric the observed stationarity level were discarded, resulting point of 5.88. Typical polyadenylation signal (AATAAA) in a ‘burnin’ that comprising of 25% of the posterior and poly (A) stretch signal are found (Fig. 1). The predicted distribution of trees. The 50% majority-rule consensus tree Adlep protein sequence contains a signal peptide was determined to calculate the posterior probabilities for composed of 21 amino acid N-terminal residues (Fig. 1). each node. The ML tree was inferred with FastTree 2.1.3 One leptin domain (PF02024) was characterized using the [60], with default Jones-Taylor-Thornton (JTT) amino acid Pfam server. substitution matrix and the “CAT” approximation model Using four intron primer pairs, the genomic sequence to account for rate across sites; parameters recommended of Adlep gene was obtained and sequenced to be 1,415 by the authors were used to improve the effectiveness of bp (Fig. 2). Sequence alignment revealed that two exons the tree search at a slight cost of increased running time were present in the genomic sequence of the Adlep gene, (flags: -spr 4 -mlacc 2 -slownni) as described by Beiko et which corresponds to exon 2 and 3 in other vertebrates. al. [61]. Additionally, one intron with 906 bp was found in the genomic sequence of Adlep gene (Fig. 2). The intron of the Adlep gene started as GT and ended as AG (Fig. 1), and its 2.5 Mining the leptin signaling pathway in length was shorter than that of the second intron in other A. davidianus tetrapods while longer than that of teleosts (Fig. 2). Two conserved cysteine residues in positions from 119 Leptin (http://www.kegg.jp/dbget-bin/www_bget?K05424) aa to 169 aa forming a disulfide bond, which is revealed mediates its effects by binding to its receptor (leptin to be present in all the leptin sequences of tetrapods, receptor or LEPR), which activates the following signaling including Adlep (Fig. 1 & Fig. 3). Furthermore, the most pathways within the cell, such as the Janus kinase/signal highly conserved regions among tetrapod leptins also transducers and activators of transcription (JAK/STAT) were present (Fig. 3). pathway (ko04630), AMP-activated protein kinase (AMPK) The identity between the 1AX8 protein sequence signaling pathway (ko04152), adipocytokine signaling in human and Adlep protein sequence in A. davidianus pathway (ko04920). In order to investigate whether the is 35.62%, which is sufﬁcient to use the 1AX8 protein leptin signaling pathways are present in A. davidianus, model as a template to yield a reliable model. One our previously assembled transcriptome was subjected model (Adleptin.B99990017.pdb) of the twenty models 410 H. Tian, et al.

Fig. 1. Nucleotide and deduced amino acid sequences of the Adlep in A. davidianus. The intron sequence is shown in lowercase and exon sequence in uppercase. Start codon (ATG) and putative stop codon (TGA) are shown in red. The predicted signal peptides are shown in bold. The termination codon is marked with an asterisks. Two cysteine residues are marked in circle. The GenBank accession number is KX241573. PolyA signals are indicated by underline. Molecular cloning, characterization and evolutionary analysis of leptin gene in Chinese giant salamander 411

Fig. 2. Leptin gene structure of A. davidianus. Exons are shown in dark shading, introns are shown as lines with length marked above, and undetermined genomic regions are shown with a dashed line.

Fig. 3. Multiple amino acid sequence alignment of leptins from the mouse (Accession No. P41160), rat (P50596), cow (P50595), pig (Q29406), dog (O02720), human (P41159), fat-tailed dunnart (Sminthopsis crassicaudata, a marsupial) (Q9XSW9), Xenopus laevis (AY884210), tiger salamander (Ambysto matigrinum) (AAY68394.1), Japanese fire belly newt (Cynops pyrrhogaster) (comp395199_c0_seq1), and Chinese giant salamander (A. davidianus) (KX241573). Alignment was performed by Clustal X 1.83 with default parameters. Note that all amphibian leptins comprise of 169 amino acids and all mammalian sequences comprises of 167 amino acids. Two conserved cysteine residues (positions 119 and 169 of the salamander sequence) forming a lasso knot are indicated by arrowheads. The mature peptide begins at position 22 of all these tetrapod sequences as indicated by a vertical line. Boxed regions are the most highly conserved sequences among tetrapod leptins. 412 H. Tian, et al. generated by Modeller9v14 was selected based on the the initial model. The predicted structure of Adlep in lowest DOPE score (-15826.54688 KJ/mol), and then it A. davidianus showed a tertiary structure of a bundle of was further subjected to loop refinement with loop.py. four main helices (Fig. 4). The best model was selected and subjected to energy minimization. The Procheck analysis showed 90.2% amino acids in core, 9.1% amino acids in allow, 0.0% in 3.2 Expression of Adlep in A. davidianus gener, and 0.8% in disallowed in the Ramachandran plot, tissues and the Errat analysis showed that the overall quality factor of the model rose to 86.466 from the original 77.206. The distribution of salamander leptin expression was These results supported the reliability of the modelled studied by qPCR on mRNA isolated from a variety of Adlep protein in A. davidianus. Superposition of the tissues in three one-year-old male individuals. As shown α-carbon skeleton of the template human leptin models in Figure 5, expression levels differed significantly among (1AX8) and the theoretical model of Adlep showed that different tissues, with high expression in muscle, moderate the root mean square deviation (rms deviation) is 0.51 expression in skin, and weak expression in other tissues Å, indicating a remarkable similarity of the structural (i.e. heart, pituitary, liver, intestine, lung, spleen, kidney, conformation between the Adlep theoretical model stomach, and gonad). The tissue expression profiles shows with the previous experimental model, and that Adlep light difference from our preliminary expression analysis does not have major conformational differences with using one female individual (Supplementary Fig. 1).

(a) (b) Fig. 4. (a)The predicted three-dimensional model of the Adlep protein; and (b) superimposition of Adlep protein with the leptin of human (1AX8).

Fig. 5. Expressions of Adlep in tissues of A. davidianus by using qPCR. I= intestine; P= pituitary; Lu= lung; Li= liver; M = muscle; B = brain; Sk = skin; Sp = spleen; K = kidney; St = stomach; H = heart; and G = gonad. Expression levels were normalized to the expression of the β-actin gene (β-actin). Data were analyzed by one-way ANOVA with Tukey adjustment using GraphPad Prism Software (GraphPad Software Inc., San Diego, CA, USA). Values expressed as mean ± SEM. Different letters indicate significant differences (P<0.05). Molecular cloning, characterization and evolutionary analysis of leptin gene in Chinese giant salamander 413

3.3 Phylogenetic analysis of leptin of mammals, birds, reptiles, amphibians and fishes, and that Adlep is recovered from the amphibian clade Both the Bayesian inference and Maximum Likelihood consisting of homologs of other amphibians (Fig. 6). (ML) trees showed similar topologies, therefore, we chose Except for the basal position of leptins in Latimeria to display the Bayesian tree as a representative with the chalumnae, Lepisosteus oculatus, and Anguilla anguilla, support values of ML tree also on the tree. Phylogenetic all other leptins of Teleostei were recovered into two high- reconstruction revealed that the topologies of vertebrate supporting clades, corresponding to leptin A and leptin B leptins are consistent with the general understanding respectively (Fig. 6 and Supplementary Fig. 2). of the evolution of vertebrates, corresponding to clades

Fig. 6. Phylogenetic tree of 78 vertebrate leptins, which was reconstructed using MrBayes 3.2.2 with 202 aligned amino acid sites. The GenInfo Identifier (GI) number of each sequence is given after species name (A. davidianus: KX241573; A. tigrinum: AAY68394.1; C. pyrrhogaster: comp395199_c0_seq1). Numbers at the nodes correspond to the bootstrap value of the ML tree (on the right of slashes) and the Bayesian posterior probabilities more than 0.50 (on the left of slashes). Scale bar, substitutions per position. 414 H. Tian, et al.

3.4 Leptin signaling pathways in response [64], and to be associated with growth rate A. davidianus [65-69] in different vertebrates. The JAK/STAT pathway is found to be conserved between frogs and mammals [70], Through the KEGG annotation of our transcriptome, a suggesting conservation of the leptin signaling mechanism total of 577 unigenes are assigned to 184 KEGG orthology across vertebrate groups. More diverse physiological roles (KO) identifiers, and the leptin receptor and other genes have been characterized in teleosts than those found in belong to subsequent signaling pathways were found. mammals [39]. However, further studies are needed to The three leptin signaling pathways were reconstructed as clarify the conservation and evolution of the physiological shown in Figure 7 (and Supplementary Fig. 2). roles of leptin in diverse vertebrate groups. Here, one full length cDNA of Adlep was obtained in A. davidianus (Fig. 1). The gene organization of Adlep in A. davidianus is 4 Discussion similar to that of human, X. laevis and Takifugu [6,9,28], which suggested that the leptin present in the salamander Leptins have been characterized and demonstrated to genome though the length of the second intron is possess pleiotropic roles in many vertebrates over the past between those of other tetrapods and those of teleosts two decades [62]. Interestingly, leptins have been shown to (Fig. 2). Further homolog searching, domain and tertiary be involved in early development [63] and innate immune structure analysis, and phylogenetic analysis showed

Fig. 7. The reconstructed Adipocytokine signaling pathway (ko04920) in A. davidianus (the presence of corresponding genes is shown in red). Molecular cloning, characterization and evolutionary analysis of leptin gene in Chinese giant salamander 415 that the identified Adlep is the ortholog of mammalian previously [41], indicating that the multiple leptins leptins. Furthermore, the characterization of two cysteine in teleost are obtained through gene duplication that residues and conserved regions and determination of the occurred in the ancestor of Cluopeocephala. Given the 3D structure suggests that Adlep could bind to the leptin conserved tertiary structures from teleosts to mammals receptor and trigger the subsequent signaling pathways. [2,34], the diverse physiological roles of leptins in Interestingly, we found broad tissue expression of Adlep different vertebrates characterized to date [74], and the in muscle, skin, heart, testis, pituitary, liver, kidney, common intracellular signaling pathways presented in all spleen, and stomach, and the muscle and skin showed Tetrapoda as suggested by this research, the phylogenetic the highest expression levels (Fig. 5), which is similar in topology of vertebrate leptins obtained in this research X. laveis, A. tigrinum and teleosts [2,6,7,15] and different suggest that it would be very interesting to detect whether from the restricted expression in mammals [16,71,72]. there are different regulation mechanisms for pleiotropic Noticeably, the expression patterns of Adlep in these roles or expressions of leptins throughout evolution. three male individuals also differed from that of our preliminary work with one female individual (one-year- Acknowledgement: This work was supported by the old), with high expression in skin, kidney, stomach, Central Public-interest Scientific Institution Basal liver, and ovary (Supplementary Fig. 1).The expression Research Fund, CAFS (NO. 2016JBF0305). The authors level variation among individuals might be explained by also would like to thank anonymous reviewers who gave different nutritional state among individuals or caused by valuable suggestion that has helped to improve the quality seasonal variation as the samples in these two different of the manuscript. expression analyses were collected at different times. This phenomenon also has been reported in A. tigrinum Conflict of interest: Authors state no conflict of interest. [7]. Altogether, the wide tissue distribution of Adlep seems different from the relatively restricted expression distribution of mammalian leptins. The different Reference expression pattern of leptins among different vertebrate [1] Zhang Y., Proenca R., Maffei M., Barone M., Leopold L., groups remains to be clarified in future. The presence Friedman J.M., Positional cloning of the mouse obese gene and of leptin receptor and the subsequent leptin signaling its human homologue, Nature, 1994, 372, 425-432 pathways (i.e. JAK/STAT, AMPK, and adipocytokine) [2] Denver R.J., Bonett R.M., Boorse G.C., Evolution of leptin in A. davidianus suggests that the conservation of the structure and function, Neuroendocrinology, 2011, 94, 21-38 [3] Friedman-Eina M., Cogburn L.A., Yosefi S., Hen G., Shinder leptin signaling pathway could be traced back to the D., Shirak A., et al., Discovery and characterization of the first ancestor of Tetrapoda, and that Adlep might be correlated genuine avian leptin gene in the rock dove (Columba livia), with homeostasis, energy status, and lipid regulating. Endocrinology, 2014, 155, 3376-3384 Hence it would be interesting to investigate the potential [4] Seroussi E., Cinnamon Y., Yosefi S., Genin O., Smith J.G., Rafati physiological roles of Adlep in future studies, such as N., et al., Identification of the long-sought leptin in chicken identification and association analyses of polymorphisms and duck: Expression pattern of the highly GC-rich avian leptin fits an autocrine/paracrine rather than endocrine function, in Adlep with growth traits among different individuals in Endocrinology, 2016, 157, 737-751 farmed populations of A. davidianus because significant [5] Prokop J.W., Duff R.J., Ball H.C., Copeland D.L., Londraville R.L., growth rate differences among different individuals of Leptin and leptin receptor: analysis of a structure to function different ages have been found. relationship in interaction and evolution from humans to fish, The evolution of leptin is still under debate considering Peptides, 2012, 38, 326-336 [6] Crespi E.J., Denver R.J., Leptin (ob gene) of the South African the presence of multiple copies in teleost fish [2,62,73]. clawed frog Xenopus laevis, Proc. Natl. Acad. Sci. U. S. A., Here, the overall topology of the leptins in vertebrates 2006, 103, 10092-10097 is consistent with the general accepted evolutionary [7] Boswell T., Dunn I.C., Wilson P.W., Joseph N., Burt D.W., Sharp relationships of vertebrates (Fig. 5). Noticeably, two leptins P.J., Identification of a non-mammalian leptin-like gene: in Anolis carolinensis are clustered together as reported characterization and expression in the tiger salamander previously [2], indicating that they are obtained through (Ambystoma tigrinum), Gen. Comp. Endocrinol., 2006, 146, 157-166 species specific gene duplication. Moreover, leptins in [8] Froiland E., Murashita K., Jorgensen E.H., Kurokawa T., Leptin Lepisosteus oculatus and Anguilla anguilla are branched and ghrelin in anadromous Arctic charr: cloning and change first, and then leptins of other teleosts are generally in expressions during a seasonal feeding cycle, Gen. Comp. recovered into two subclades, leptin A and leptin B, which Endocrinol., 2010, 165, 136-143 are generally consistent with another research reported 416 H. Tian, et al.

[9] Kurokawa T., Uji S., Suzuki T., Identification of cDNA coding for [26] Yuan L., Zhao X., Lin B., Rossiter S.J., He L., Zuo X., et al., a homologue to mammalian leptin from pufferfish, Takifugu Adaptive evolution of Leptin in heterothermic bats, PloS One, rubripes, Peptides, 2005, 26, 745-750 2011, 6, e27189 [10] Angotzi A.R., Stefansson S.O., Nilsen T.O., Rathore R.M., [27] Zhang F., Basinski M.B., Beals J.M., Briggs S.L., Churgay L.M., Ronnestad I., Molecular cloning and genomic characterization Clawson D.K., et al., Crystal structure of the obese protein of novel leptin-like genes in salmonids provide new insight leptin-E100, Nature, 1997, 387, 206-209 into the evolution of the Leptin gene family, Gen. Comp. [28] Isse N., Ogawa Y., Tamura N., Masuzaki H., Mori K., Okazaki T., Endocrinol., 2013, 187, 48-59 et al., Structural organization and chromosomal assignment of [11] Gorissen M., Bernier N.J., Nabuurs S.B., Flik G., Huising M.O., the human obese gene, J. Biol. Chem., 1995, 270, 27728-27733 Two divergent leptin paralogues in zebrafish (Danio rerio) that [29] Copeland D.L., Duff R.J., Liu Q., Prokop J., Londraville R.L., originate early in teleostean evolution, J. Endocrinol., 2009, Leptin in teleost fishes: an argument for comparative study, 201, 329-339 Front. Physiol., 2011, 2, 26 [12] Kurokawa T., Murashita K., Genomic characterization of [30] Pfundt B., Sauerwein H., Mielenz M., Leptin mRNA and protein multiple leptin genes and a leptin receptor gene in the immunoreactivity in adipose tissue and liver of rainbow trout Japanese medaka, Oryzias latipes, Gen. Comp. Endocrinol., (Oncorhynchus mykiss) and immunohistochemical localization 2009, 161, 229-237 in liver, Anat. Histol. Embryol., 2009, 38, 406-410 [13] Murashita K., Uji S., Yamamoto T., Ronnestad I., Kurokawa T., [31] Shpilman M., Hollander-Cohen L., Ventura T., Gertler A., Production of recombinant leptin and its effects on food intake Levavi-Sivan B., Production, gene structure and characte- in rainbow trout (Oncorhynchus mykiss), Comp. Biochem. rization of two orthologs of leptin and a leptin receptor in Physiol. B. Biochem. Mol. Biol., 2008, 150, 377-384 tilapia, Gen. Comp. Endocrinol., 2014, 207, 74-85 [14] Li G.G., Liang X.F., Xie Q., Li G., Yu Y., Lai K., Gene structure, [32] Huising M.O., Geven E.J., Kruiswijk C.P., Nabuurs S.B., Stolte recombinant expression and functional characterization of E.H., Spanings F.A., et al., Increased leptin expression in grass carp leptin, Gen. Comp. Endocrinol., 2010, 166, 117-127 common Carp (Cyprinus carpio) after food intake but not after [15] Ronnestad I., Nilsen T.O., Murashita K., Angotzi A.R., fasting or feeding to satiation, Endocrinology, 2006, 147, Gamst Moen A.G., Stefansson S.O., et al., Leptin and leptin 5786-5797 receptor genes in Atlantic salmon: Cloning, phylogeny, tissue [33] Baltzegar D.A., Reading B.J., Douros J.D., Borski R.J., Role distribution and expression correlated to long-term feeding for leptin in promoting glucose mobilization during acute status, Gen. Comp. Endocrinol., 2010, 168, 55-70 hyperosmotic stress in teleost fishes, J.Endocrinol., 2014, 220, [16] Friedman J.M., Halaas J.L., Leptin and the regulation of body 61-72 weight in mammals, Nature, 1998, 395, 763-770 [34] Gorissen M., Flik G., Leptin in teleostean fish, towards the [17] Pelleymounter M.A., Cullen M.J., Baker M.B., Hecht R., Winters origins of leptin physiology, J. Chem. Neuroanat., 2014, 61-62, D., Boone T., et al., Effects of the obese gene product on body 200-206 weight regulation in ob/ob mice, Science, 1995, 269, 540-543 [35] Ahima R.S., Saper C.B., FlierJ.S., Elmquist J.K., Leptin [18] Zieba D.A., Szczesna M., Klocek-Gorka B., Williams G.L., Leptin regulation of neuroendocrine systems, Front. Neuroen- as a nutritional signal regulating appetite and reproductive docrinol., 2000, 21, 263-307 processes in seasonally-breeding ruminants, J. Physio. [36] Elmquist J.K., Coppari R., Balthasar N., Ichinose M., Lowell B.B., Pharmacol., 2008, 59, 7-18 Identifying hypothalamic pathways controlling food intake, [19] De Rosa V., Procaccini C., Cali G., Pirozzi G. Fontana S., body weight, and glucose homeostasis, J. Comp. Neurol., 2005, Zappacosta S., et al., A key role of leptin in the control of 493, 63-71 regulatory T cell proliferation, Immunity 2007, 26, 241-255 [37] Trombley S., Mustafa A., Schmitz M., Regulation of the [20] Fu L., Patel M.S., Karsenty G., The circadian modulation of seasonal leptin and leptin receptor expression profile during leptin-controlled bone formation, Prog. Brain. Res., 2006, 153, early sexual maturation and feed restriction in male Atlantic 177-188 salmon, Salmo salar L., parr, Gen. Comp. Endocrinol., 2014, [21] Anagnostoulis S., Karayiannakis A.J., Lambropoulou M., 204, 60-70 Efthimiadou A., Polychronidis A., Simopoulos C., Human leptin [38]Trombley S., Schmitz M., Leptin in fish: possible role in sexual induces angiogenesis in vivo, Cytokine, 2008, 42, 353-357 maturation in male Atlantic salmon, Fish. Physiol. Biochem., [22] Malendowicz L.K., Rucinski M., Belloni A.S., Ziolkowska 2013, 39, 103-106 A., Nussdorfer G.G., Leptin and the regulation of the [39] Deck C.A., Honeycutt J.L., Cheung E., Reynolds H.M., Borski R.J., hypothalamic-pituitary-adrenal axis, Int. Rev. Cytol. 2007, 263, Assessing the functional role of leptin in energy homeostasis 63-102 and the stress response in vertebrates, Front. Endocrinol. [23] Roubos E.W., Dahmen M., Kozicz T., Xu L., Leptin and the (Lausanne), 2017, 8, 63 hypothalamo-pituitary-adrenal stress axis, Gen. Comp. [40] Zhao H., Zeng C., Yi S., Wan S., Chen B., Gao Z., Leptin genes Endocrinol., 2012, 177, 28-36 in blunt snout bream: cloning, phylogeny and expression [24] Yang J., Wang Z.L., Zhao X.Q., Wang D.P., Qi D.L., Xu B.H., et correlated to gonads development, Int. J. Mol. Sci., 2015, 16, al., Natural selection and adaptive evolution of leptin in the 27609-27624 ochotona family driven by the cold environmental stress, PloS [41] Morini M., Pasquier J., Dirks R., van den Thillart G., Tomkiewicz One, 2008, 3, e1472 J., Rousseau K., et al., Duplicated leptin receptors in two [25] Yu L., Jin W., Zhang X., Wang D., Zheng J.S., Yang G., et al., species of eel bring new insights into the evolution of the Evidence for positive selection on the leptin gene in Cetacea leptin system in vertebrates, PloS One, 2015, 10, e0126008 and Pinnipedia, PLoS One, 2011, 6, e26579 Molecular cloning, characterization and evolutionary analysis of leptin gene in Chinese giant salamander 417

[42] Crespi E.J., Denver R.J., Roles of stress hormones in food intake [59] Ronquist F., Huelsenbeck J.P., MrBayes 3: Bayesian regulation in anuran amphibians throughout the life cycle, phylogenetic inference under mixed models, Bioinformatics, Comp. Biochem. Physiol. A. Mol. Integr. Physiol., 2005, 141, 2003,19, 1572-1574 381-390 [60] Price M.N., Dehal P.S., Arkin A.P., FastTree 2—approximately [43] Torday J.S., Ihida-Stansbury K., Rehan V.K., Leptin stimulates maximum-likelihood trees for large alignments, PloSOne, Xenopus lung development: evolution in a dish, Evol. Dev., 2010, 5, e9490 2009, 11, 219-224 [61] Beiko R.G., Telling the whole story in a 10,000-genome world, [44] Pyron R.A., Wiens J.J., A large-scale phylogeny of Amphibia Biol. Direct., 2011, 6, 34 including over 2800 species, and a revised classification of [62] Londraville R.L., Macotela Y., Duff R.J., Easterling M.R., Liu Q., extant frogs, salamanders, and caecilians, Mol. Phylogenet. and Crespi E.J., Comparative endocrinology of leptin: assessing Evol., 2011, 61, 543-583 function in a phylogenetic context, Gen. Comp. Endocrinol., [45] Zhang P., Chen Y.Q., Liu Y.F., Zhou H., Qu L.H., The complete 2014, 203, 146-157 mitochondrial genome of the Chinese giant salamander, [63] Liu Q., Dalman M., Chen Y., Akhter M., Brahmandam S., Patel Andrias davidianus (Amphibia: Caudata), Gene, 2003, 311, Y., et al., Knockdown of leptin A expression dramatically alters 93-98 zebrafish development, Gen. Comp. Endocrinol., 2012, 178, [46] Gao K.Q., Shubin N.H., Earliest known crown-group 562-572 salamanders, Nature, 2003, 422, 424-428 [64] Dalman M.R., Mustafa A., Liu Q., Londraville R.L., Leptin [47] Cunningham A.A., Turvey S.T., Zhou F., Meredith H.M.R., Guan knockdown reduces innate immune function in zebrafish, W., Liu X., et al., Development of the Chinese giant salamander FASEB J., 2013, 27, 937-920 Andrias davidianus farming industry in Shaanxi Province, [65] Huang H., Wei Y., Meng Z., Zhang Y., Liu X., Guo L., et al., China: conservation threats and opportunities, Oryx, 2015, 50, Polymorphisms of leptin-b gene associated with growth traits 265-273 in orange-spotted grouper (Epinephelus coioides), Int. J. Mol. [48] Xiao H.B., Liu J.Y., Yang Y.Q., Lin X.Z., Artificial propagation of Sci., 2014, 15, 11996-12006 tank-cultured Chinese giant salamander (Andrias davidianus), [66] Clempson A.M., Pollott G.E., Brickell J.S., Bourne N.E., Munce Acta. Hydrobiologica Sinica, 2006, 30, 530-534 (In Chinese) N., Wathes D.C., Evidence that leptin genotype is associated [49] Yu H.H., Liang G., Liu Q.Q., Xu W.G., Relation between with fertility, growth, and milk production in Holstein cows, J. environmental factors and nocturnal active rhythm during Dairy Sci., 2011, 94, 3618-3628 the pre-reproductive period of the Chinese giant salamander, [67] Sun J., Shan H.E., Liang X.F., Ling L.I., Wen Z., Zhu T., et al., Journal of Shaanxi Normal University (Natural Science Edition), Identification of SNPs in NPY and LEP and the association with 2006, 41, 70-75 (In Chinese) food habit domestication traits in mandarin fish, J. Genet., [50] Tian H.F., Meng Y., Hu Q.M., Xiao H.B., Molecular cloning, 2014, 93, 1-5 characterization and evolutionary analysis of vitellogenin in [68] Wei Y., Huang H., Meng Z., Zhang Y., Luo J., Chen G., et al., Chinese giant salamander Andrias davidianus, Biologia, 2015, Single nucleotide polymorphisms in the leptin-a gene and 70, 1254-1262 associations with growth traits in the orange-spotted grouper [51] Petersen T.N., Brunak S., von Heijne G., Nielsen H., SignalP 4.0: (Epinephelus coioides), Int. J. Mol. Sci., 2013, 14, 8625-8637 discriminating signal peptides from transmembrane regions, [69] Wu C., Wu G., Zhang G., Wang Q., Luo J., Chen G., Single Nat. Methods., 2011, 8, 785-786 nucleotide polymorphisms in the leptin-a gene and [52] Fiser A., Sali A., Modeller: generation and refinement of associations with growth traits in the golden pompano, homology-based protein structure models, Methods Enzymol., Trachinotus blochii, Journal of the World Aquaculture Society, 2003, 374, 461-491 2016, 47, 414-423 [53] Marti-Renom M.A., Stuart A.C., Fiser A., Sanchez R., Melo [70] Cui M.Y., Hu C.K., Pelletier C., Dziuba A., Slupski R.H., Li F., Sali A., Comparative protein structure modeling of genes C., et al., Ancient origins and evolutionary conservation of and genomes, Annu. Rev. Biophys. Biomol. Struct., 2000, 29, intracellular and neural signaling pathways engaged by the 291-325 leptin receptor, Endocrinology, 2014, 155, 4202-4214 [54] Sali A., Comparative protein modeling by satisfaction of spatial [71] Ikejima K., Takei Y., Honda H., Hirose M., Yoshikawa M., Zhang restraints, Mol. Med. Today, 1995, 1, 270-277 Y.J., et al., Leptin receptor-mediated signaling regulates hepatic [55] Guex N., Peitsch M.C., SWISS-MODEL and the Swiss- fibrogenesis and remodeling of extracellular matrix in the rat, PdbViewer: an environment for comparative protein modeling, Gastroenterology, 2002, 122, 1399-1410 Electrophoresis, 1997, 18, 2714-2723 [72] Potter J.J., Womack L., Mezey E., Anania F.A., Transdifferen- [56] Guex N., Peitsch M.C., Schwede T., Automated comparative tiation of rat hepatic stellate cells results in leptin expression, protein structure modeling with SWISS-MODEL and Swiss- Biochem. Biophys. Res. Commun., 1998, 244, 178-182 PdbViewer: a historical perspective, Electrophoresis, 2009, 30, [73] He S., Liang X.F., Li L., Huang W., Shen D., Tao Y.X., Gene S162-173 structure and expression of leptin in Chinese perch, Gen. [57] Laskowski R.A., Rullmannn J.A., MacArthur M.W., Kaptein Comp. Endocrinol., 2013, 194, 183-188 R., Thornton J.M., AQUA and PROCHECK-NMR: programs for [74] Londraville R.L., Prokop J.W., Duff R.J., Liu Q., Tuttle M., On the checking the quality of protein structures solved by NMR, J. molecular evolution of leptin, leptin receptor, and endospanin, Biomol. NMR., 1996, 8, 477-486 Front. Endocrinol. (Lausanne), 2017, 8, 58 [58] Edgar, R.C., MUSCLE: multiple sequence alignment with high accuracy and high throughput, NucleicAcidsRes., 2004, 32, Supplemental Material: The online version of this article 1792-1797 (DOI: 10.1515/biol-2017-0048) offers supplementary material.